jacques van helden [email protected] statistics for bioinformatics jacques van helden...
TRANSCRIPT
![Page 1: Jacques van Helden Jacques.van.Helden@ulb.ac.be Statistics for Bioinformatics Jacques van Helden TGCATGACTGATTGGTC CGGCCGATAACAGGTGT GCTTGCACCCAGTGCCC](https://reader035.vdocuments.us/reader035/viewer/2022081421/551b1d61550346cf5a8b5674/html5/thumbnails/1.jpg)
Jacques van [email protected]
Qu
ickTim
e™
an
d a
de
com
pre
ssor
are
need
ed
to
see t
his
pic
ture
.
Statistics for Bioinformatics
Jacques van Helden
TGCATGACTGATTGGTCCGGCCGATAACAGGTGTGCTTGCACCCAGTGCCCAACGTCAACAAGCAGGAACAACGGGCTGATAAGGGAGAAGATAAGATAAGATAAGATAACAAATCATTGCGTCCGACCACAGGCCGACACATAGCAGAACGATGTGAAGCA
QuickTime™ and a decompressor
are needed to see this picture.
QuickTime™ and a decompressor
are needed to see this picture.
QuickTime™ and a decompressor
are needed to see this picture.
QuickTime™ and a decompressor
are needed to see this picture.
QuickTime™ and a decompressor
are needed to see this picture.QuickTime™ and a
decompressorare needed to see this picture.
![Page 2: Jacques van Helden Jacques.van.Helden@ulb.ac.be Statistics for Bioinformatics Jacques van Helden TGCATGACTGATTGGTC CGGCCGATAACAGGTGT GCTTGCACCCAGTGCCC](https://reader035.vdocuments.us/reader035/viewer/2022081421/551b1d61550346cf5a8b5674/html5/thumbnails/2.jpg)
Univariate statistics
1. Introduction 2. Study cases
2.1 Gene expression data 2.2 Sequence lengths 2.3 Word counts in DNA sequences
3. Descriptive statistics 4. Elements of probabilities 5. Theoretical distributions 6. Statistical inference
6.1 Sampling and estimation 6.2 Fitting 6.3 Hypothesis testing
• 6.3.1 Conformity
• 6.3.2 Significance
• 6.3.3 Homogeneity
• 6.3.4 Goodness of fit
![Page 3: Jacques van Helden Jacques.van.Helden@ulb.ac.be Statistics for Bioinformatics Jacques van Helden TGCATGACTGATTGGTC CGGCCGATAACAGGTGT GCTTGCACCCAGTGCCC](https://reader035.vdocuments.us/reader035/viewer/2022081421/551b1d61550346cf5a8b5674/html5/thumbnails/3.jpg)
Multivariate statistics
1. Introduction
2. Study cases
3. Correlation analysis
4. Regression analysis
5. Clustering
6. Principal component analysis
7. Multidimensional scaling
8. Discriminant analysis
9. Summary
![Page 4: Jacques van Helden Jacques.van.Helden@ulb.ac.be Statistics for Bioinformatics Jacques van Helden TGCATGACTGATTGGTC CGGCCGATAACAGGTGT GCTTGCACCCAGTGCCC](https://reader035.vdocuments.us/reader035/viewer/2022081421/551b1d61550346cf5a8b5674/html5/thumbnails/4.jpg)
Books
Statistics applied to bioinformatics van Helden, J. Statisitics pr bioinformatics. Oxford University Press. To appear in
2009. Ewens, W. J. & Grant, G. R. (2001). Statistical Methods in bioinformatics:
an introduction. Statistics for Biology and Health (Dietz, K., Krickeberg, K., Samet, J. & Tsiatis, A., Eds.), Springer, New York.
Univariate analysis Dagnelie, P. (1973). Theorie et methodes statistiques - applications
agronomiques. 2d edit, Les presses agronomiques de Gembloux, Gembloux - Belgium.
Zar, J. H. (1999). Biostatistical analysis. 4th edit (Ryu, T., Ed.), Prentice Hall, Upper Saddle River.
Multivariate analysis Kachigan, S. K. (1991). Multivariate statistical analysis: a conceptual
introduction. 2d edit, Radius Press, New York. Hastie, T., Tibshirani, R. & Friedman, J. (2001). The elements of statistical
learning - data mining, inference and prediction. Springer series in statistics. 1 vols, Springer-Verlag, New-York.
Flury, B. (1997). A first course in multivariate statistics, Springer-Verlag, New York.
Huberty, C. J. (1994). Applied Discriminant analysis. Wiley series in probability and mathematical statistics (al., B. e., Ed.), John Wiley & sons, New York.