j biol chem, 283(8)

The PHB1/2 Phosphocomplex Is Required for MitochondrialHomeostasis and Survival of Human T Cells*

Received for publication, October 3, 2007, and in revised form, November 14, 2007 Published, JBC Papers in Press, December 17, 2007, DOI 10.1074/jbc.M708232200

Jeremy A. Ross, Zsuzsanna S. Nagy, and Robert A. Kirken1

From the Department of Biological Sciences, University of Texas, El Paso, Texas 79902

Many immune pathologies are the result of aberrant regula-

tion of T lymphocytes. A functional proteomics approach utiliz-

ing two-dimensional gel electrophoresis coupled with mass

spectrometry was employed to identify differentially expressed

proteins in response to T cell activation. Two members of the

prohibitin family of proteins, Phb1 and Phb2, were determined

to be up-regulated 4–5-fold upon activation of primary human

T cells. Furthermore, their expressionwas dependent uponCD3

and CD28 signaling pathways that synergistically led to the up-

regulation (13–15-fold) of Phb1 and Phb2mRNA levels as early

as 48 h after activation. Additionally, orthophosphate labeling

coupled with phosphoamino acid analysis identified Phb1 to be

serine and Phb2 serine and tyrosine phosphorylated. Tyrosine

phosphorylationofPhb2wasmapped toTyr248 usingmass spec-

trometry and confirmed by mutagenesis and phosphospecific

antibodies. In contrast to previous reports of Phb1 and Phb2

being nuclear localized, subcellular fractionation, immunofluo-

rescent, and electron microscopy revealed both proteins to

localize to themitochondrial innermembrane of humanT cells.

Accordingly, small interfering RNA-mediated knockdown of

Phbs in Kit225 cells resulted in disruption of mitochondrial

membrane potential. Additionally, Phb1 and Phb2 protein lev-

els were up-regulated 2.5-fold during cytokine deprivation-me-

diated apoptosis of Kit225 cells, suggesting this complex plays a

protective role inhumanTcells. Taken together, Phb1 andPhb2

are novel phosphoproteins up-regulated duringT cell activation

that function to maintain mitochondrial integrity and thus rep-

resent previously unrecognized therapeutic targets for regulat-

ing T cell activation, differentiation, viability, and function.

Complete activation of T cells requires three threshold-lim-

ited sequential signals. Naı̈ve T cells receive induction signals

through engagement of the T cell receptor complex (TCR/

CD3) via specific antigens (signal 1). This signal is amplified by

co-stimulatory molecules such as B7-1/CD28 (signal 2), which

promotes the synthesis and secretion of cytokines, which acti-

vate cell surface receptors (signal 3) to drive clonal expansion

and functional differentiation. Each extracellular signal induces

an intracellular cascade of tyrosine, serine, threonine, and lipid

kinases. Early TCR signaling is mediated by the tyrosine kinase

p56lck, which phosphorylates immunoreceptor tyrosine-based

activation motifs within the cytoplasmic domains of the TCR

subunits (1–3). These phosphorylated immunoreceptor tyro-

sine-based activationmotifs recruit Zap70, which in turn prop-

agates the signal by phosphorylating multiple proteins includ-

ing linker of activated T cells (4). This protein acts as a scaffold

to recruit a number of downstream signalingmolecules, includ-

ing Grb2 to drive Ras signaling (5), and phospholipase C-�1 toproduce inositol 1,4,5-triphosphate and diacylglycerol from the

hydrolysis of phosphatidylinositol 4,5-bisphosphate (6, 7).

These effector pathways ultimately promote activation of key T

cell transcription factors (NFATvia inositol 1,4,5-triphosphate,

NF-�B via diacylglycerol, and AP-1 via Ras) to regulate the

expression of genes required for proliferation and differentia-

tion including interleukin 2 (IL-2),2 which serves as an auto-

crine growth factor (8, 9).

Signaling from IL-2 through its receptor is primarily deliv-

ered by two molecular families, namely Janus tyrosine kinases

(Jaks) and signal transducers and activators of transcription

(STATS) (10). Jak3, which is required for T cell proliferation in

response to IL-2, is differentially expressed upon activation

(11–13). Additionally, the IL-2 receptor � chain (CD25), which

is required for a high affinity IL2R complex, is also up-regulated

upon T cell activation (14). These findings have provided a

molecular rationale for therapeutic strategies targeting the IL-2

signaling pathway to treat lymphoid-derived diseases (15).

Additional insight into other proteins up-regulated or phos-

phorylated during T cell activation will likely harbor yet to be

realized therapeutic strategies.

To identify these potential regulatory proteins, two-dimen-

sional gel electrophoresis coupledwithmass spectrometry have

been critical. Using these technologies, we have identified the

highly conserved prohibitin (Phb) family of proteins, Phb1 and

Phb2, to be differentially expressed upon T cell activation. The

Phbs have been found inmultiple cellular compartments and pos-

sess diverse functions ranging from acting as scaffolding proteins

at the plasma membrane to transcriptional regulators in the

* This work was supported by National Institutes of Health Grant AI053566 (toR. A. K.) and 5G12RR008124 from the National Center for ResearchResources, a component of the National Institutes of Health. The costs ofpublication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby marked “advertisement” inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 To whom correspondence should be addressed: Dept. of Biological Sci-ences, 500 W. University Ave., El Paso, TX 79902. Tel.: 915-747-5844; Fax:915-747-5808; E-mail: [email protected].

2 The abbreviations used are: IL-2, interleukin 2; ConA, concanavalin A; Jak,Janus tyrosine kinase; LAT, linker of activated T cells; PBMC, peripheralblood mononuclear cells; PHA, phytohemagglutinin; Phb, prohibitin; PMA,phorbol 12-myristate 13-acetate; STAT, signal transducers and activatorsof transcription; TCR, T cell receptor; FITC, fluorescein isothiocyanate;GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PBS, phosphate-buffered saline; RT, reverse transcriptase; MALDI-TOF, matrix-assisted laserdesorption ionization time-of-flight; siRNA, small interfering RNA; PI, phos-phatidylinositol; PARP, poly(ADP-ribose) polymerase; WT, wild type.

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 283, NO. 8, pp. 4699 –4713, February 22, 2008© 2008 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.

FEBRUARY 22, 2008 • VOLUME 283 • NUMBER 8 JOURNAL OF BIOLOGICAL CHEMISTRY 4699

at STA

TE U

NIV

OF N

EW

YO

RK

ALB

AN

Y, on June 1, 2012

ww

w.jbc.org

Dow

nloaded from

nucleus. Phb2was originally identified as a B cell receptor-associ-

ated protein termed Bap37 (16). More recently, Phb1 was

shown to be required for activation of c-Raf by Ras in modulat-

ing epithelial cell adhesion and migration, thus providing evi-

dence for a signaling component to the Phb mechanism of

action (17). Conversely, Phb nuclear localization has been

described in a variety of cell lines predominantly from breast

and prostate cancers (18, 19). Prohibitins were shown to mod-

ulate the transcriptional activity of various transcription fac-

tors, including steroid hormone receptors, either directly or

through interactionswith chromatin remodeling proteins (20–

22). Interestingly, numerous studies in Saccharomyces cerevi-

siae andCaenorhabditis elegans suggest the evolutionarily con-

served Phb mechanism of action is as chaperone proteins in

mitochondria, which has been extensively reviewed (2, 23–25).

It is worth noting that Phb1 and Phb2 null yeast strains have a

reduced lifespan (25), however, higher eukaryotes are more

dependent upon their presence, suggesting enhanced biological

function(s). For example, the Phb homologue in Drosophila is

reported to be in a lethal complementation group (26) and

genetic deletion of Phb1 or Phb2 inmice is lethal before embry-

onic day 9.0, implying these proteins play a critical role in the

early stages of development (27, 28).

Little is known about the Phb family in lymphocytes. Phb1

has been proposed to inhibit cell proliferation and to promote

differentiation of lymphocytes. Indeed, its expression is

increased during pregnancy-associated thymic involution with

a pattern of limited tissue distribution localized to the medulla

of the thymus that primarily contains only mature, non-prolif-

erating thymocytes (29). The present study sought to identify

proteins differentially expressed upon T cell activation. Evi-

dence is provided that Phb1 and Phb2 form a phosphocomplex

in the mitochondrial inner membrane of primary human T

cells. Furthermore, functional analysis reveals that this complex

is required for mitochondrial homeostasis that may be critical

for differentiated T cell survival.

EXPERIMENTAL PROCEDURES

T Cell Purification, Activation, and Cell Culture

Peripheral blood mononuclear cells (PBMCs) were collected

from buffy coats obtained from the Gulf Coast Regional Blood

Bank orWBF2 filters (Pall Corporation) obtained from El Paso

United Blood Services and purified by isocentrifugation (Ficoll-

Hypaque). PBMCs were grown in RPMI 1640 supplemented

with 10% fetal calf serum (Atlanta Biologicals), 2 mM L-gluta-

mine, 50 IU/ml penicillin, and 50 mg/ml streptomycin (com-

plete RPMI). Explanted normal human T lymphocytes (3 �106/ml) were activated for 72 h using one of the following

agents: anti-CD3-coated 96-well plates (BD Biosciences) in the

presence or absence of soluble anti-CD28 (5 �g/ml), phytohe-

magglutinin (PHA) (10 �g/ml), concanavalin A (ConA) (10

�g/ml), or phorbol 12-myristate 13-acetate (PMA) (100 nM)

and ionomycin (500 ng/ml). CD3�T cells were purified by neg-

ative selection (R&D Systems) and their purity and activation

status determined by flow cytometry (Cytomics FC500, Beck-

man Coulter) using directly conjugated anti-CD3-PE and anti-

CD25-FITC, respectively. Jurkat (30), MT-2 (31), and T47D

(32) cells were maintained in complete RPMI. The IL-2-de-

pendent humanT cell line Kit225 (33) (kindly provided byDr. J.

Johnston, Queens University, UK) was maintained in complete

RPMI plus 100 IU/ml recombinant IL-2.

Cell Extracts, Immunoprecipitation, and Western Blot Analysis

Nuclear and cytoplasmic fractions were obtained by hypo-

tonic lysis as previously described (34). For subcellular fraction-

ation, activated primary human T cells (2 � 108) were sus-

pended in isotonic buffer (10 mM HEPES, pH 8.0, 10 mM

potassium chloride, 2 mM magnesium chloride, 250 mM

sucrose, 1.0mMEDTA, 2�g/ml leupeptin, 1�g/ml pepstatinA,

5 �g/ml aprotinin, and 1 mM phenylmethylsulfonyl fluoride)

and mechanically disrupted with passage through a 30-gauge

needle until�90%were trypan blue positive.Nuclei and unbro-

ken cells were pelleted by centrifugation at 1500� g for 10min.

The resulting supernatant was collected and centrifuged at

10,000 � g for 15 min to obtain the soluble cytoplasmic (super-

natant) and mitochondrial (pellet) fractions.

Forwhole cell lysis, frozen cell pellets were thawed on ice and

solubilized in 1% Triton X-100 containing lysis buffer as previ-

ously described (11). Immunoprecipitation and Western blot

analysis was performed as described previously (35). A novel

and specific affinity purified rabbit polyclonal antibody was

generated against the extreme C-terminal 15 amino acids of

human Phb2. Monoclonal anti-Phb1 (Molecular Probes), anti-

actin (Sigma), anti-GAPDH (Research Diagnostics), and the

affinity purified anti-Phb2 were used at a dilution of 1/1000 for

Western blot. For all samples, total protein was determined by

the bicinchoninic acid method (Pierce).

Two-dimensional Gel Electrophoresis and ProteinIdentification by Mass Spectrometry

First Dimension Separation—CD3� naı̈ve or PHA-activated

whole cell lysates (500 �g) were precipitated using trichloro-

acetic acid and washed twice with cold acetone before dissolv-

ing in sample rehydration buffer (7 M urea, 2 M thiourea, 50 mM

dithiothreitol, 2% Triton X-100, 0.2% carrier ampholytes (pH

3–10), and 0.001% bromphenol blue). Lysates were loaded onto

7-cm IPG ReadyStrips (Bio-Rad) through passive rehydration

overnight at room temperature. Following rehydration, these

proteins were isoelectrically focused on the Bio-Rad Protean

IEFCell with the following step protocol: 250V for 15min, 4000

V for 150 min, and maintained at 4000 V for a total of 10,000

V-h. ReadyStrip IPG strips were stored at �80 °C until second

dimension processing.

Second Dimension Separation—IPG ReadyStrips from the

first dimension separation were equilibrated in succession with

buffer I (375 mM Tris-HCl, pH 8.8, 6 M urea, 2% SDS, 130 mM

dithiothreitol, 20% glycerol) and buffer II (375 mM Tris-HCl,

pH 8.8, 6 M urea, 2% SDS, 135mM iodoacetamide, 20% glycerol)

for 10 min each. The IPG strips were then washed in Tris gly-

cine SDS running buffer (25 mM Tris, 192 mM glycine, 0.1%

(w/v) SDS, pH8.3), secured on top of 12% SDS-PAGE gels using

lowmelting point agarose, and electrophoresed at 200V for 1 h.

The resulting gels were stained using the mass spectrometry

compatible Silver Stain Plus kit from Bio-Rad according to the

manufacturer’s protocol and gel images collected in a 16-bit

T Cell Mitochondrial Integrity and Function Requires Phb1/2

4700 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 283 • NUMBER 8 • FEBRUARY 22, 2008

at STA

TE U

NIV

OF N

EW

YO

RK

ALB

AN

Y, on June 1, 2012

ww

w.jbc.org

Dow

nloaded from

grayscale format using an Epson 1680 Professional dual bed

scanner at 600 dpi resolution. Protein spots of interest were

excised and submitted to the Center for Functional Genomics

(University at Albany) or the Border Biomedical Research Cen-

ter Biomolecule Analysis Core Facility (University of Texas, El

Paso) for identification following their standard procedure.

Quantitative RT-PCR

PBMCswere plated at a concentration of 3� 105 cell perwell

in either uncoated or anti-CD3-coated 96-well plates (BD Bio-

sciences) in the presence or absence of anti-CD28 (5 �g/ml).

Total RNA was isolated from �5 � 106 cells using the RNeasy

kit (Qiagen), DNase treated, and reverse transcribed (100 ng,

50 °C for 30 min, Superscript II; Invitrogen) with specific

reverse primers. Quantification based on real-time monitoring

of amplification was determined using a Bio-Rad IQ5 with

SYBR Green dye. Absolute numbers of mRNAmolecules were

normalized to 18 S rRNA to correct for RNA concentration

differences. Samples were run in triplicates with one control

reaction containing no reverse transcriptase enzyme to test for

potential DNA contamination. Values of transcripts in

unknown samples were obtained by interpolating threshold

cycle (PCR cycle number at threshold) values on a standard

curve. Standard curves were prepared from known amounts of

purified, PCR-amplified amplicon. Primer sets for human Phb1

and Phb2 were as follows: Phb1 forward, GGAGGCGTGGT-

GAACTCTG; Phb1 reverse, CTGGCACATTACGTGGTC-

GAG; Phb2 forward, CTTGGTTCCAGTACCCCATTATC;

Phb2 reverse, CGAGACAACACTCGCAGGG. Primer sets for

human CD25 (ID number 4557667a1) were obtained from

PrimerBank.

Immunofluorescent Confocal Microscopy and TransmissionElectron Microscopy

For confocal microscopy, primary human T cells were cyto-

centrifuged and fixed on glass slides with cold methanol and

permeabilized with 0.2% Triton X-100 for 5 min. Immunofluo-

rescent staining was performed at room temperature. Slides

were blocked with 5% normal donkey serum for 1 h, and incu-

bated with either mouse monoclonal anti-Phb1 (Neomarkers),

and affinity purified rabbit polyclonal anti-Phb2 for 1 h. Cells

were washed three times with PBS-T (0.05% Tween 20 in PBS)

and incubated with secondary Cy2-conjugated donkey anti-

mouse antibody or Cy3-conjugated donkey anti-rabbit anti-

body (Jackson ImmunoResearch Laboratories) for 1 h at a 1:50

dilution. After three washes in PBS-T and onewashwith deion-

ized water, slides were mounted in FluorSave mounting

medium (Calbiochem), and imaged with a Zeiss LSM 510

META confocal microscope using a �63 oil immersion objec-

tive (Carl Zeiss) in the multitrack scanning mode with excita-

tion wavelengths set at 488 (Argon laser), 543, and 633 nm

(HeNe lasers); emission wavelengths were 505 to 530 nm and

�560 nm for Cy2 and Cy3 signal detection, respectively. Col-

lected images were processed using LSM Image Browser (Carl

Zeiss) and exported in a 12-bit TIFF RGB format.

For immunoelectron microscopy, naı̈ve or PHA-activated

primary human T cells (5 � 105) were pelleted with agar at

500� g for 5min at room temperature and fixed withmodified

Karnovsky solution (2% paraformaldehyde, 1% glutaraldehyde

in 120 mM Millonig phosphate buffer, pH 7.4) for 1 h at room

temperature. Cells were washed, post-fixed with 1% osmium

tetroxide and 50 mM potassium ferricyanide, washed, dehy-

drated with a series of ethanol gradients and acetone, and

embedded in Poly/Bed 812 resin mixture. The resin was poly-

merized for 72 h at 60 °C. Ultrathin sections (60–90 nm) were

obtained using a Leica Ultracut R microtome with a Microstar

diamond knife. Immunogold labeling was performed at room

temperature. The sectionswere treatedwith 10% sodiumperio-

date for 15 min and 50 mM glycine for 30 min to remove resin

and block residual aldehyde groups, respectively. After three

washeswith PBS, sectionswere blockedwith 5%normal donkey

serum for 1 h and incubated with 1:50 dilution ofmousemono-

clonal anti-Phb1 (Neomarkers) and 1:50 dilution of affinity

purified rabbit polyclonal anti-Phb2 for 1 h. The sections were

washed five times with 1% bovine serum albumin and 0.05%

Tween 20 in PBS and incubated with secondary 6-nm gold par-

ticle-conjugated donkey anti-mouse antibody or 12-nm golf

particle-conjugated donkey anti-rabbit antibody (Jackson

ImmunoResearch Laboratories) for 1 h at a 1:50 dilution. Post-

fixationwas performedwith 2.5% glutaraldehyde for 5min. The

sections were post-stained using the Kai Chien procedure with

2% uranyl acetate and Reynold’s (36) lead citrate for 6min each.

The sections were observed using a Zeiss EM-10 transmission

electron microscope operating at 60–80 kV in the Border Bio-

medical Research Center Analytical Cytology Core Facility

(University of Texas, El Paso). Photographs were obtained with

Kodak SO-163 film, and negatives were scanned with a Nikon

Super Coolscan 5000 ED scanner to obtain digital images.

Phosphoamino Acid Analysis and Phosphopeptide Mapping

Naı̈ve and PHA-activated primary human T cells and Kit225

cells weremetabolically labeledwith 1mCi/ml [32P]orthophos-

phate (PerkinElmer Life Sciences) overnight at 37 °C. The cells

were lysed and Phb2 was immunoprecipitated as described

above. The corresponding proteinswere visualized byCoomas-

sie Blue R-250 stain (Bio-Rad) and autoradiography, excised,

and subjected to limited hydrolysis in 6 N HCl at 100 °C for 30

min. The samples were then dried and resuspended in pH 1.9

buffer (formic acid:acetic acid:water at 50:156:1794 ratio) con-

taining 1 �g of phosphoamino acid standards. The samples

were spotted on a thin layer cellulose-acetate gel and electro-

phoresis was performed in the first dimension at 1500 V for 30

min in pH 1.9 buffer and in the second dimension at 1300 V for

15 min in pH 3.9 buffer (pyridine:acetic acid:water at 10:100:

1890 ratio) using the Hunter Thin Layer Electrophoresis appa-

ratus. Standards were visualized with ninhydrin and radiola-

beled samples detected by autoradiography. Phosphopeptide

mapping of immunoaffinity purified Phb2 by MALDI-TOF

mass spectrometrywas performed by the proteomics core facil-

ity at the Center for Functional Genomics (University at

Albany).

Phosphospecific Phb2 Tyr(P)248 Antibody and PeptideCompetition Assay

A rabbit polyclonal antibody was generated (SigmaGenosys)

against the Phb2 phosphopeptide, CKNPGpYIKLR. Anti-Phb2



at STA

TE U

NIV

OF N

EW

YO

RK

ALB

AN

Y, on June 1, 2012

ww

w.jbc.org

Dow

nloaded from

Tyr(P)248 antiserum was purified through negative selection

using the corresponding non-phosphopeptide. The affinity

purified anti-Phb2 Tyr(P)248 was diluted to 100 �g/ml and a

1:5000 dilutionwith overnight incubation at room temperature

was used for Western blot analysis. For peptide competition

assays, a 1:5000 dilution of anti-Phb2 Tyr(P)248 was incubated

with 100–500 �M of either Phb2 Tyr(P)248 phosphopeptide or

non-phosphopeptide for 2 h at room temperature. Samples

were then cleared by centrifugation at 15,000 � g for 10 min at

room temperature. The resulting supernatant was used to

Western blot Phb2 immunoprecipitate from human T cells.

Prohibitin Cloning, Site-directed Mutagenesis, andTransfection

Phb2 was PCR amplified frommRNA purified from the tumor

T cell line, Kit225. The pLenti6/V5-D-TOPO-Phb2-WTwas con-

structed by subcloning Phb2 cDNA from pcDNA3.1-Phb2 donor

plasmid using TOPO technology. The Phb2 Y248F mutant was

prepared using the QuikChange (Stratagene) site-directed

mutagenesis kit according to themanufacturer’s instructions. The

following primer (sense strand) was used for Phb2 Y248F muta-

tion: 5�-AGCAAGAACCCTGGCTTCATCAAACTTCGC-AAG-3�. Before use, subclones and mutations were verified by

DNA sequencing. The pLenti6-Phb2WT-V5 (2.5 �g) or

pLenti6-Phb2Y248F-V5 (2.5 �g) plasmid transfections were

performed in Kit225 (5 � 106) cells using Amaxa nucleofection

technology using protocol X-001 according to the manufactur-

er’s instructions. Cells were harvested 36 h post-nucleofection

and total cell lysates or anti-V5 (Invitrogen) immunoprecipi-

tated proteins were analyzed by SDS-PAGE and Western blot

as described above.

siRNA-mediated Silencing of Phb1 and Phb2

Phb1 (SMARTpool catalog numberM-010530-00) and Phb2

(SMARTpool catalog numberM-018703-00) specific siRNA as

well as control non-targeting (siControl pool catalog number

D-001206-13) siRNAwere purchased fromDharmacon.Trans-

fection of Kit225 cells was carried out by electroporation using

the Nucleofection system by Amaxa. Briefly, Kit225 cells (5 �106) were suspended in 100 �l of transfection solution V and

transfected with 1.5 �g of Phb1, Phb2, or control siRNA using

theX-001 program. Transfected cells were immediately diluted

with pre-warmed complete RPMI containing IL-2 (100 IU/ml)

and cultured for the time indicated.

Mitochondrial Transmembrane Potential, ��m, Analysis

Mitochondrial membrane potential was analyzed using the

lipophilic cation 5,5�,6,6�-tetrachloro-1,1�,3,3�-tetraethylben-zimidazolyl-carbocyanine iodide (DePsipher, R&D Systems).

Kit225 cells (1� 106) were electroporated alone or with control

non-targeting siRNA (500 nM) or Phb1/Phb2 siRNA (250 nM

each) and cultured for 36 h. The potassium ionophore valino-

mycin was used as a positive control for disruption of �m.

Kit225 cells (1 � 106) were treated with valinomycin (100 nM)

for 6 h at 37 °C and 5% CO2. The cells were harvested by cen-

trifugation at 500 � g for 5 min, resuspended in DePsipher

reagent (5 �g/ml), and incubated for 15 min at 37 °C and 5%

CO2. The cells were then washed twice with PBS, and fluores-

cence observed by flow cytometry (Cytomics FC500, Beckman

Coulter) and quantitated with CXP analysis software version

2.2 (Beckman Coulter).

Assessment of Apoptotic Cell Death

Kit225 cells (1� 106) were washed with PBS and centrifuged

at 200 � g for 5 min. Cell pellets were resuspended in 100 �l ofAnnexin-V-FLUOS staining solution (for 10 assays, 20 �l ofAnnexin V-Fluorescein, and 20 �l of PI in 1000 �l of HEPES

buffer) (Roche) and incubated for 15min at room temperature.

Stained cells were then analyzed by flow cytometry (Cytomics

FC500, Beckman Coulter) and quantitated with CXP analysis

software version 2.2 (Beckman Coulter) using 488-nm excita-

tion and 515-nm band pass filter for fluorescein detection and a

filter �600 nm for PI detection. Additionally, caspase activa-

tion was determined by detection of PARP degradation by

Western blot analysis with rabbit polyclonal anti-PARP (Cell

Signaling).

RESULTS

Proteomic Identification of Phb2 as a Differentially Expressed

Protein during T Cell Activation—In an effort to identify differ-

entially expressed proteins duringT cell activation, two-dimen-

sional gel electrophoresis coupled with mass spectrometry was

employed. Lysates fromprimary humannaı̈ve or PHAactivated

CD3� T cells were separated by two-dimensional gel electro-

phoresis and visualized with silver stain. Landmark spots were

selected to confirm equal loading and proper gel alignment.

Several proteins were differentially expressed upon T cell acti-

vation including a 37-kDa protein, with a pI of 9.0, was greater

in PHA activated compared with naı̈ve T cells (Fig. 1, A and B).

Two distinct spots were evident for p37, due to variance in

isoelectric points. The identification of p37 was achieved by

searching the National Center for Biotechnology Information

(NCBI) data base with spectra obtained from MALDI-TOF

mass spectrometry on the excised spots using theMascot algo-

rithm (Matrix Science) (Fig. 1C). The data base search sug-

gested three putative proteins, however, only Phb2 had a signif-

icant E-value and matched the theoretical molecular weight

and isoelectric point (37). The remaining differentially

expressed proteins remain unknown, but are being investigated

for their identity.

Phb1 and Phb2 Protein Levels AreUp-regulated during TCell

Activation—Phb1 and Phb2 are thought to be important for the

regulation of cell proliferation and differentiation in various

distinct cell types, however, no function has been ascribed to T

cells. To characterize these proteins within a T cell system,

specific polyclonal antibodies were generated to the extreme

C-terminal 15 amino acids of Phb2 and subsequently purified

by peptide affinity chromatography. Western blot analysis of

PBMC extracts during a PHA activation time course spanning

96 h revealed that both Phb1 and Phb2 protein levels were up-

regulated during T cell activation that was readily detected

between 48 and 96 h (Fig. 2A). Thismembranewas stripped and

reblotted for actin to ensure equal loading, whereas Jak3

expression confirmed efficient T cell activation. Densitometric

analysis indicated Phb1 and Phb2 were up-regulated 4–5-fold



at STA

TE U

NIV

OF N

EW

YO

RK

ALB

AN

Y, on June 1, 2012

ww

w.jbc.org

Dow

nloaded from

after 72 h and 6–8-fold after 96 h of PHA activation when

normalized to actin levels (Fig. 2B).

The process of PHA-mediated activation of primary human

T cells occurs through nonspecific cross-linking of cell surface

receptors, primarily the TCR and costimulatory molecules. To

determine whether other methods would generate the up-reg-

ulation of Phb1 and Phb2 protein levels, several approaches

were performed including anti-CD3 to specifically drive TCR

signaling pathways, lectin ConA to agglutinate cells, or PMA

and ionomycin. After 72 h of treatment with the various acti-

vating agents, Western blot analysis was performed to detect

Phb1, Phb2, and GAPDH protein levels (Fig. 3A). Phb1 and

Phb2 protein levels were again up-regulated 2–2.5-fold with all

activation agents, however, PMAand ionomycin resulted in the

greatest increase (3–4-fold) relative to the GAPDH levels (Fig.

3B). Purity and activation of PBMCs before and after treatment

was determined by flow cytometry utilizing anti-CD3-FITC or

anti-CD25-FITC-conjugated antibodies, respectively. PBMCs

were typically 70% CD3� T cells, whereas PHA, anti-CD3, or

PMA/ionomycin treatment resulted in a homogenous popula-

tion of CD25 expressing (�70%) activated human T cells. Con-

versely, ConA treatment yielded amixed population of CD25�expressing cells (62%) (Fig. 3C). The different mitogenic prop-

erties of PHA and ConA have been previously described in

detail, which may explain the observed variation in these acti-

vation profiles (38).

TCRandCostimulatory Signaling Pathways Result in theUp-

regulation of Phb1 and Phb2 mRNA Levels during T Cell

Activation—To determine Phb1 and Phb2mRNA levels during

T cell activation, Q-RT-PCR analysis of RNA extracted from

untreated or anti-CD3- and/or anti-CD28-stimulated primary

human T cells was performed. Phb1 mRNA levels were

FIGURE 1. Proteomic identification of Phb2 as a differentially expressedprotein during T cell activation. Two-dimensional gel electrophoresis sil-ver-stained images of naı̈ve (A) or PHA activated (B) primary human CD3� Tcell extracts separated over pI range 3–10 and then 12% SDS-PAGE. Landmarkprotein spots (circles) and protein spot of interest (square) are indicated.C, MALDI-TOF mass spectrum obtained from p37 analysis and resultingscored protein hits from the NCBI data base search. See “Experimental Proce-dures” for details.

FIGURE 2. Up-regulation of Phb1 and Phb2 protein levels during T cellactivation. A, PBMCs were activated with PHA (10 �g/ml) and harvested atthe time points indicated. Phb1, Phb2, Actin, and Jak3 protein levels weredetermined by Western blot (WB) analysis. B, Phb1 and Phb2 band intensitieswere normalized to Actin using densitometric analysis and -fold inductionplotted for each time point. Representative data from three independentexperiments are shown.



at STA

TE U

NIV

OF N

EW

YO

RK

ALB

AN

Y, on June 1, 2012

ww

w.jbc.org

Dow

nloaded from

detected at 48 h, and declined at 96 h of activation with anti-

CD3 and anti-CD3/anti-CD28 (Fig. 4A). There was no signifi-

cant increase in Phb1 mRNA levels with anti-CD28 treatment

alone, however, anti-CD3 and anti-CD28 synergistically led to

up-regulated Phb1 mRNA. Similarly, Phb2 mRNA levels

increased after 48 and declined after 96 h of activation with

anti-CD3 and anti-CD3/anti-CD28 (Fig. 4B). Only after 96 h of

anti-CD28 treatment did Phb2 mRNA levels show an increase.

Similar to Phb1, anti-CD3 and anti-CD28 synergistically up-

regulated Phb2 mRNA levels after 48 h. CD25 (IL2R�) up-reg-ulation was used as a positive control for anti-CD3 and anti-

CD28 signaling. CD25 mRNA levels increased as early as 12 h,

and declined at 96 h post-activation with anti-CD3 or anti-

CD3/anti-CD28 (Fig. 4C). As a positive control, CD25 was

found to be up-regulated following CD3 and CD28 activation

after 24 h of each treatment.

Phb1 and Phb2 Are Novel Phosphoproteins That Co-immu-

noprecipitate in Both Naı̈ve and Activated Primary Human T

Cells—Previous reports in non-hematopoietic cells suggested

that Phb1 and Phb2 are able to form a high molecular weight

complex composed of 14 Phb subunits in a 1:1 ratio (23,

39–41). To examine possible Phb1�Phb2 complex formation in

FIGURE 3. Phb1 and Phb2 protein levels are induced by different T cell activating protocols. A, PBMCs were left untreated (lane a) or treated with anti-CD3(lane b), PHA (lane c), ConA (lane d), or PMA/Ionomycin (lane e) for 72 h and protein levels detected by Western blot (WB) using the antibodies indicated. B, Phb1and Phb2 band intensities were normalized to GAPDH using densitometric analysis and the -fold induction plotted for each activation agent. C, PBMCs wereanalyzed by flow cytometry for the T cell marker CD3 (left panel) and activation marker CD25 (right panel). Percentages of positive cells are shown in theappropriate quadrants. Representative data from two independent experiments are shown.



at STA

TE U

NIV

OF N

EW

YO

RK

ALB

AN

Y, on June 1, 2012

ww

w.jbc.org

Dow

nloaded from

primary human T cells, lysates were immunoprecipitated with

either Phb1 or Phb2 antibodies. Phb1 or Phb2 immunoprecipi-

tated complexes from PHA-activated primary human T cells

were subjected to Western blot analysis for their association.

Indeed, the opposing Phb co-precipitated with either Phb anti-

body indicating that Phb1 and Phb2 form a complex in acti-

vated human T cells (Fig. 5A).

Our initial two-dimensional gel electrophoresis experiments

(Fig. 1) suggested Phb2 was post-translationally modified in

primary human T cells as evident by an acidic and basic form

during isoelectric focusing. To determine the global phospho-

rylation state of Phb proteins, phosphoamino acid analysis of32P-labeled immunopurified Phb1 and Phb2 from naı̈ve and

PHA-activated primary humanTcells and theT cell leukemia cell

line, Kit225, was performed. Phb2 was immunoprecipitated from

cells radiolabeled overnight with 1 mCi of [32P]orthophosphate

and subjected to separation by 10% SDS-PAGE and transferred

to polyvinylidene difluoride membrane. Phb1 and Phb2 were

visualized by Coomassie Blue stain (Fig. 5B) before the mem-

brane was subjected to autoradiography. To obtain a sufficient

amount of Phb proteins from naı̈ve human T cells, a 2-fold

greater number of cells were assayed comparedwithKit225 and

PHA-activated T cells. Autoradiography showed both Phb1

and Phb2 were phosphorylated in Kit225 cells and PHA-acti-

vated primary human T cells (Fig. 5C, lanes a and c), however,

radiolabeled protein was not present in naı̈ve human T cells

(Fig. 5C, lane b), which could be due to the quiescent nature of

these cells. Phb1 and Phb2 bands were excised and subjected to

phosphoamino acid analysis. Under these conditions, Phb1was

determined to be phosphorylated on serine residue(s), whereas

Phb2 was phosphorylated on serine and tyrosine residues in

primary human T cells (Fig. 5D). Similar results were obtained

in the Kit225 cells (data not shown). This finding provides the

first evidence that Phb function can be regulated by tyrosine

kinase signaling pathways.

Mass Spectrometry Analysis and Phosphospecific Antibodies

Identify Tyr248 as a Novel Phosphosite in Phb2—To identify the

specific phosphorylation sites in Phb2, phosphopeptide map-

ping with MALDI-TOF mass spectrometry was performed.

Briefly, Phb2was immunoprecipitated from activated humanT

cells, separated by SDS-PAGE, and subjected to Coomassie

Blue stain (Fig. 6A, lane a). A duplicate sample was transferred

to polyvinylidene difluoride membrane and Western blotted

with anti-Tyr(P) to confirm tyrosine phosphorylation (Fig. 6A,

lane b). The Phb2 corresponding band was excised, trypsin

digested, and subjected to analysis by MALDI-TOFmass spec-

trometry. Two novel Phb2 phosphosites were identified from

five phosphopeptides (Fig. 6B): 1) MLGEALSK, containing

Ser243 (underlined); and 2) NPGYIKLR, containing Tyr248

(underlined). Additionally, six other phosphorylated residues

were identified, however, the specific phosphoacceptor site

could not be confirmed by mass spectroscopy/mass spectros-

copy (Fig. 6B). A high level of protein coverage (81%) was

achieved during the mapping byMALDI-TOFmass spectrom-

etry (Fig. 6E). Interestingly, although Phb1 and Phb2 share 48%

identity and 67% similarity at the amino acid level, Tyr248 and

Ser243 are not conserved in Phb1 (Fig. 6E).

To confirm Tyr248 as a novel Phb2 phosphorylation site,

phosphospecific antibodies against the Phb2 phosphopeptide

CKNPGpYIKLR were generated. The resulting antiserum was

purified by negative selection using the non-phosphopeptide,

and peptide competition experimentswere performed to deter-

mine the specificity of this antiserum. Phb2 was immunopre-

FIGURE 4. TCR and CD28 signaling pathways synergistically lead to theup-regulation of both Phb1 and Phb2 mRNA levels during T cell activa-tion. PBMCs were treated with anti-CD3, anti-CD28, or anti-CD3 and anti-CD28 together and samples were collected at the time points indicated.A, Phb1 mRNA; B, Phb2 mRNA; and C, CD25 mRNA levels were determinedusing Q-RT-PCR. The experiment was performed in triplicate where values aremean S.D. of mRNA levels normalized to 18 S RNA. Time course was plottedon the x axis, whereas mRNA expression was plotted on the y axis. Represent-ative data from two independent experiments are shown.



at STA

TE U

NIV

OF N

EW

YO

RK

ALB

AN

Y, on June 1, 2012

ww

w.jbc.org

Dow

nloaded from

cipitated from PHA-activated human T cell lysates, separated

by SDS-PAGE, transferred to polyvinylidene difluoride mem-

brane, and probedwith the affinity purified anti-Phb2Tyr(P)248

(1:5000) in the presence of either 500 �M phosphopeptide or

non-phosphopeptide, followed by re-probing the membrane

with anti-Phb2. The anti-Phb2 Tyr(P)248 phosphoantibody was

specifically blocked by the phosphopeptide and not the non-

phosphopeptide, thus confirming antibody specificity (Fig. 6C).

Additionally, phosphopeptide inhibition of anti-Phb2

Tyr(P)248 was dose dependent relative to the non-phosphopep-

tide (Fig. 6D).

Phb2 Tyr248 Phosphorylation Is Not Required for Phb Com-

plex Formation But Is Present in Several Human Tumor Cell

Lines—Tyrosine phosphorylation can affect protein activity,

localization, and protein-protein interactions. To determine

whether phosphorylation of Phb2 Tyr248 is required for com-

plex formationwith Phb1, plasmids were constructed encoding

V5 tagged WT Phb2 or Y248F Phb2. The plasmids were trans-

fected into Kit225 cells and recombinant proteins immunopre-

cipitated using a monoclonal anti-V5 antibody followed by

SDS-PAGE separation and Western blot analysis. Phenylala-

nine substitution of Phb2 Tyr248 did

not affect its ability to form a com-

plex with endogenous Phb1, as indi-

cated by the presence of Phb1 in

both Y248F (lane b) and WT V5

(lane c) immunocapture assays (Fig.

7A). Total cell lysate Western blot-

ted with anti-V5 and anti-Phb1

confirmed equal protein input

amounts. Western blot analysis

with anti-Tyr(P) indicated Tyr248 is

the major tyrosine phosphorylation

site of Phb2 in Kit225 cells. The

phosphospecific Phb2 Tyr(P)248

Western blot shows the antiserum

primarily recognizes the WT Phb2,

however, it does cross-react with

the Y248F mutant Phb2. To deter-

mine the extent of cross-reaction,

we performed densitometry analy-

sis on the Phb2 Tyr(P)248 band

intensities from the Y248F and WT

recombinant Phb2 proteinWestern

blots normalized to the V5 band

intensities (Fig. 7B). The Phb2

Tyr(P)248 antiserum has a 2.67-fold

increase in affinity for theWT Phb2

relative to the Y248F Phb2.

To determine whether Phb2 is

tyrosine phosphorylated in other

human tumor cell lines, Phb2 was

assessed in an acute lymphoblastic

leukemia cell line (Jurkat), human T

cell leukemia virus 1 transformed

cell line (MT2), NK-like acute lym-

phoblastic lymphoma cell line (YT),

and a breast cancer cell line derived

from a ductal carcinoma (T47D). Western blot analysis (Fig.

7C) with anti-Tyr(P) and anti-Phb2 Tyr(P)248 revealed that

Phb2 is indeed tyrosine phosphorylated in these tumor cell

lines, specifically at residue 248. Additionally, Phb1was present

in each of the Phb2 immunoprecipitation reactions, also indi-

cating a heterocomplex formation in these tumor cell lines.

In Primary Human T Cells, Phb1 and Phb2 Co-localize to the

Mitochondrial Inner Membrane—Prohibitins have been found

to localize to many regions of the cell, including the plasma

membrane, mitochondria, and nucleus (17, 20, 40). Identifica-

tion of the cellular localization of the Phb complex is a critical

step in understanding its function in human T cells. To assess

their subcellular localization, immunofluorescent confocal

microscopy, subcellular fractionation, and immunoelectron

microscopywas performed. Phb1 andPhb2were determined to

primarily co-localize to polarized perinuclear regions in PHA-

activated human T cells (Fig. 8A). There were no detectable

levels of Phb1 or Phb2 at the plasma membrane and only lim-

ited amounts nuclear localized.

To confirm and further define Phb localization, subcellular

fractionation of PHA-activated primary humanT cells was per-

FIGURE 5. Phb1 and Phb2 form a phosphocomplex in primary human T cells and the T cell leukemia cellline, Kit225. A, lysates from PHA (10 �g/ml) activated human T cells were immunoprecipitated for either Phb1or Phb2, separated by 10% SDS-PAGE and subsequently analyzed by Western blot (WB) by the antibodiesindicated. B, Kit225 cells (lane a), naı̈ve (lane b) or PHA (10 �g/ml) activated primary human T cells (lane c) were32P-radiolabeled overnight under normal culturing conditions. Phb2 was immunoprecipitated, separated bySDS-PAGE, and subjected to Coomassie Blue staining. C, autoradiography of the membrane after 8 days expo-sure is presented. D, phosphoamino acid analysis was performed on both Phb1 and Phb2 from PHA-activatedhuman T cells (lanes c in panels A and B). Phospho standards were detected by ninhydrin (left panel), andmigration of Phb phosphoamino acids by autoradiography (right panel) is shown. Arrows denote locations ofPhb1 and Phb2. Brackets denote the locations of the immunoglobulin G heavy chains (IG HC) and light chains(IgG LC). IP denotes immunoprecipitation.



at STA

TE U

NIV

OF N

EW

YO

RK

ALB

AN

Y, on June 1, 2012

ww

w.jbc.org

Dow

nloaded from

formed using differential centrifugation. Western blot analysis

of nuclear and cytoplasmic fractions detected Phb1 (lane b) and

Phb2 (lane d) to be present only in the cytoplasmic fraction (Fig.

8B). The cytoplasmic tyrosine kinase Jak3 and nuclear DNA

repair protein PARP were used for fractionation controls. The

mitochondrial fraction was separated from the cytoplasmic

fraction using high speed centrifugation. Western blot analysis

of these fractions detected Phb1 (lane b) and Phb2 (lane d) only

in the mitochondria (Fig. 8C). The mitochondrial localized

OxPhos CII protein and cytoplasmic and mitochondrial local-

ized GAPDH were used as fractionation controls for these

studies.

Transmission electron microscopy was utilized to provide

the ultrastructural resolution required to determine the loca-

tion of Phb1 and Phb2 within the mitochondria. Immunogold

labeling of Phb1 and Phb2 was performed using monoclonal

anti-Phb1 and affinity purified polyclonal anti-Phb2 in combi-

nation with gold particle-conjugated secondary antibodies.

CD3� human T cells were either left untreated or PHA acti-

vated for 72 h. Representative whole cell electron micrographs

were taken at �5,000 magnification (Fig. 9, upper panel). To

resolve the gold particles, �31,500 magnification electron

micrograph images where taken of cell sections enriched in

mitochondria. Phb1 (6-nm gold) and Phb2 (12-nm gold) local-

ize to the innermitochondrialmembrane in PHA-activated pri-

mary human T cells (Fig. 9, lower panel). Furthermore, the gold

particles are in groups of two or three supporting the concept of

a multimeric Phb ring complex (42, 43). Interestingly, although

Phb1 andPhb2have been shown to forma complex in a number

of cell types, including this work, immunogold labeling did not

show Phb1 to be in complex with Phb2. The reason for this in

not clear, however, it may be due to steric hindrance between

the Phb1 and Phb2 antibodies, which is exacerbated by the pro-

posed Phb ring structure.

siRNA-mediated Knockdown of Individual Phbs Results in

Degradation of the Homologous Phb Protein in Kit225 Cells—

To gain insight into the Phb mechanism of action in human T

cells, siRNA mediated knockdown of Phb1 and Phb2 in Kit225

cells was performed. Phb1, Phb2, or non-targeting control

siRNA were delivered into Kit225 cells via electroporation and

protein knockdownwas determined byWestern blot analysis of

total cell lysates after 48 h (Fig. 10A). Interestingly, whenKit225

cells were electroporated with Phb1 (lane b) or Phb2 (lane c)

siRNA, a decrease in both protein levels compared with the

non-targeting control siRNA (lane a) was detected. To deter-

mine specificity of the siRNA, Q-RT-PCR analysis was per-

formed on RNA isolated from Kit225 cells treated with

control, Phb1, or Phb2 siRNA (Fig. 10B). Phb1- and Phb2-specific

siRNAandcontrol siRNAweredelivered intoKit225cells via elec-

troporation and RNA was isolated after 24 h incubation. Phb1

siRNA significantly (p � 0.05) reduced Phb1 mRNA levels 52%,

whereas Phb2 mRNA levels remained unchanged. Additionally,

Phb2 siRNA significantly (p � 0.01) reduced Phb2 mRNA levels

81%, whereas Phb1mRNA levels slightly increased, indicating the

Phb siRNA are specific. These findings demonstrate the interde-

pendent relationship between Phb1 and Phb2 in T cells.

Loss of the Prohibitin Complex in Kit225 Cells Results in Dis-

ruption of Mitochondrial Membrane Potential—Subcellular

fractionation in combination with immunofluorescent and

electron microscopy have established the localization of Phb1

and Phb2 to the mitochondria in human T cells (Figs. 8 and 9).

siRNA-mediated knockdown of Phb1 and Phb2 in Kit225 cells

results in cell death.3 Additionally, previous reports indicated

that the mitochondrial Phb complex functions as a molecular

chaperone to stabilize newly imported proteins, including sub-

units of mitochondrial respiratory enzymes (23, 25, 44). To

determine the effect of Phb1 and Phb2 knockdown on mito-

chondrial membrane potential in human T cells, Kit225 cells

were treated with Phb1 and Phb2 siRNA or non-targeting con-

trol siRNA for 36 h and the fluorescence of the mitochondrial

potential detector dye DePsipher (R&D Systems) was detected.

The potassium selective ionophore valinomycin, which uncou-

ples oxidative phosphorylation, was used as a positive control

for depolarization. Knockdown of Phb1 and Phb2 resulted in an

�50% decrease in DePsipher aggregation as detected by flow

cytometry (Fig. 10C, panel D). Treatment of Kit225 cells with

valinomycin for 6 h resulted in complete mitochondrial depo-

larization (Fig. 10C, panel E), whereas electroporation alone or

with non-targeting siRNA did not affect the mitochondrial

membrane potential (Fig. 10C, panels B andC). Non-DePsipher

treated Kit225 cells were used as a negative control for fluores-

cence detection (Fig. 10C, panel A).

Phb1 and Phb2 Are Up-regulated during IL-2 Deprivation-

mediated Apoptosis in Kit225 Cells—Cells respond to a variety

of insults, including growth factorwithdrawal, by up-regulating

stress response proteins that provide protection based primar-

ily upon their chaperoning ability (45, 46). Kit225 cells are

dependent on the T cell growth factor IL-2. To determine

whether Phb1 and Phb2 expression is induced upon growth

factor deprivation-mediated apoptosis, Western blot analysis

of lysates from IL-2-deprived Kit225 cells was assessed over 5

days with collection time points every 24 h (Fig. 11A). Rep-

robing the membrane for GAPDH levels confirmed equal

loading, whereas caspase activation was detected byWestern

blot via detection of PARP degradation. Densitometric anal-

ysis indicated Phb1 protein levels increased 2.0-fold after 72

and 96 h post-IL-2 withdrawal. Similarly, Phb2 protein levels

increased 2.0-fold at 48 h and 2.5-fold at 96 h after IL-2

withdrawal (Fig. 11B). Apoptosis of Kit225 cells was moni-

tored by Annexin V/PI staining at 24, 48, 72, 96, and 120 h

(Fig. 11C). Kit225 cells showed minimal Annexin V staining

(12.2%) after 24 h IL-2 withdrawal, however, significant

staining was observed after 48 (33.9%), 72 (37.4%), 96

(34.5%), and 120 h (42.9%).

DISCUSSION

In an effort to gain insight into the complexmolecularmech-

anisms of T cell activation, a functional proteomics approach

was used that identified the Phb family of proteins to be differ-

entially expressed. Further characterization revealed that

engagement specifically through the TCR complex and CD28

costimulatory molecule led to an increase of Phb1 and Phb2

3 J. A. Ross, Z. S. Nagy, and R. A. Kirken, unpublished observations.



at STA

TE U

NIV

OF N

EW

YO

RK

ALB

AN

Y, on June 1, 2012

ww

w.jbc.org

Dow

nloaded from



at STA

TE U

NIV

OF N

EW

YO

RK

ALB

AN

Y, on June 1, 2012

ww

w.jbc.org

Dow

nloaded from

mRNA and protein levels within 48 h (Figs. 2–4). Additionally,

Phb1 and Phb2 were identified as phosphoproteins that form a

hetero-complex in the mitochondrial inner membrane of pri-

mary human T cells. Specifically, Tyr248 was identified as a new

phospho-site in Phb2 by mass spectrometry, mutational analy-

sis, and phosphospecific antibodies. siRNA-mediated knock-

down of Phb1 and Phb2 in Kit225 cells resulted in disruption of

mitochondrial membrane potential (Fig. 10), suggesting this

complex plays a protective role in human T cells. This model is

supported by evidence demonstrating Phb1 and Phb2 are up-

regulated during growth factor withdrawal mediated apoptosis

of Kit225 cells (Fig. 11). Taken together, these findings provide

insight into the cell signaling effectors involved in mediating T

cell responses, including survival. Also, these findings suggest

thatmanipulation of Phb1 and Phb2might perturb T cell activ-

ity and thus serve as therapeutic targets to treat a variety of

disease states.

T cell activation is the product of

a highly coordinated network of sig-

nal transduction pathways induced

by the TCR complex and costimula-

tory molecules, which result in the

regulation of proteins required for

costimulation, migration, differen-

tiation, proliferation, and apoptosis.

To date, the majority of proteins

found differentially expressed upon

T cell activation are cell surface

molecules. The effector molecules

involved in this response are not

well established, therefore it is criti-

cal to expand studies to identify

these proteins. Indeed, we detected

the differential expression of Phb2

after 72 h PHA activation of CD3�

primary human T cells using two-

dimensional gel electrophoresis

(Fig. 1). Phb2, together with Phb1,

belong to a superfamily of proteins

that share a structurally related

domain referred to as the SPFH

(stomatin, prohibitin, flotillin,

hflKC) domain, also known as the

Phb domain (23). The up-regulation

of both Phb1 and Phb2 protein lev-

els during T cell activation was con-

firmed by Western blot analysis of

PBMCs activated with immobilized

anti-CD3, PHA, ConA, or PMA and

ionomycin for 72 h (Fig. 3). The

increase in Phb1 and Phb2 protein

levels was detected as early as 48 h and continued through 96 h

(Fig. 2), which closely paralleled the induction of Jak3 (48 to

60 h). The differential expression of Jak3 during T cell activa-

tion is primarily due to the TCR-mediated activation of the

transcription factors ETS-1 and AP1 (47). Indeed, activation

throughTCR andCD28 signal transduction pathways results in

an increase of Phb1 and Phb2 mRNA levels after 48 h, indicat-

ing that the control of Phb protein levels in this cell is at least

partially at the level of transcription (Fig. 4). Transcriptional

control of Phb expression by ETS-1 and AP-1 remains to be

investigated, however, the regulation of Phb levels in response

to various stimuli has been reported in a number of cell types.

For example, IL-6 signaling through STAT3 was shown to

modulate Phb1 expression in intestinal epithelial cells where it

was shown to protect against oxidative stress (48, 49). Addition-

ally, Phb1 expression was induced upon phorbol ester treat-

FIGURE 6. Phb2 is phosphorylated on tyrosine 248. A, Phb2 was immunoaffinity purified from PHA (10 �g/ml) activated primary human T cells, analyzed byCoomassie Blue staining (lane a) and anti-Tyr(P) Western blot (lane b), and subjected to phosphopeptide mapping. Arrows denote location of IgG heavy chain(HC), Phb1, and Phb2. B, MALDI-TOF mass spectrometry identified five putative Phb2 phosphorylation sites. The primary amino acid sequences returned areshown. C, a rabbit polyclonal phosphospecific antibody to Phb2 Tyr(P)248 was generated, double affinity purified, and its specificity confirmed by peptidecompetition experiments in human T cells. Arrows denote location of IgG HC and Phb2. D, a peptide competition dose curve (x axis) was also performed,analyzed by densitometry, and the Phb2 Tyr(P)248 band intensity normalized to the total Phb2 band intensity (y axis) was plotted. E, sequence alignment ofPhb1 and Phb2 sequence alignment showing conserved (*) and similar (: or .) residues, Phb2 peptide coverage during mass spectrometry analysis (gray),phosphopeptides identified (underlined), and the antibody confirmed phosphotyrosine 248 (�). WB, Western blot.

FIGURE 7. Tyr(P)248 is not required for Phb complex formation, but is constitutively phosphorylated inseveral human tumor cell lines. A, Kit225 cells were transfected alone (lane a), with Phb2 Y248F-V5 (lane b), orPhb2 WT-V5 (lane c) plasmids and the resulting proteins immunoprecipitated using the anti-V5 antibody andseparated by 10% SDS-PAGE. Western blot (WB) analysis was performed using the indicated antibodies. Forinput protein detection, total cell lysate (10 �g) was separated by 10% SDS-PAGE and Western blotted for theindicated proteins. B, densitometric analysis of the Phb2 Tyr(P)248 band intensity was normalized to the V5band from both the Phb2 Y248F mutant and Phb2 WT proteins. C, equal amounts of protein from Kit225 (lanea), Jurkat (lane b), MT2 (lane c), YT (lane d), and T47D (lane e) cells were immunoprecipitated for Phb2 andseparated by 10% SDS-PAGE. Western blot (WB) analysis was performed with the antibodies indicated. Arrowsdenote location of IgG heavy chain (HC), IgG LC, Phb1, and Phb2. IP denotes immunoprecipitation.



at STA

TE U

NIV

OF N

EW

YO

RK

ALB

AN

Y, on June 1, 2012

ww

w.jbc.org

Dow

nloaded from

ment of chronic lymphocytic leukemia-derived B lymphocytes,

suggesting Phb1 may facilitate proliferation or maturation of B

cells (50). In support of this notion, an increase in the oncopro-

tein Myc, which is commonly activated in proliferating cells,

induced the expression of Phb1 and Phb2 (40). However, the

androgen, dihydrotestosterone, was shown to down-regulate

Phb1 expression in the prostate cancer cell line LNCaP suggest-

ing an anti-proliferative function in this cell type (19). Phb1 has

also been shown to be preferentially expressed in non-prolifer-

ating thymocytes and is induced in thymi during pregnancy

(29). The different expression patterns of Phb1 and Phb2 may

be due to the apparent pleiotropic functions of this family of

proteins.

Phb1 was originally cloned from cDNAs derived from tran-

scripts that were more abundantly expressed in non-dividing

rat liver cells, thus suggesting a negative regulatory function on

cell cycle progression (51). When microinjected into normal

human fibroblasts, Phb1 mRNA attenuated DNA synthesis,

however, this effect was subsequently shown to be mediated by

the 3�-untranslated region rather than the coding region of the

cDNA (52, 53). The mechanism of cell cycle regulation was

determined by Wang et al. (54, 55) who showed Phb1 could

bind Rb as well as E2F1 to repress their transcriptional activity

(56). Phb2 was originally identified as a 37-kDa protein associ-

ated with the IgM receptor in B cells, and therefore initially

named B cell receptor-associated protein 37 (Bap37) (16). Phb2

was found to repress the transcriptional activity of the estrogen

receptor in breast cancer cell lines by competing for coactivator

binding sites on estrogen receptor in the nucleus (21) (57). Due

to this inhibitory action, the protein was named repressor of

estrogen receptor activity, however, it has recently been shown

to interact with histone deacetylases HDAC1 and HDAC5 to

mediate repression of COUP-TFs, suggesting a more general

nuclear receptor corepressor function (58). Interestingly,

nuclear Phb2 was recently shown to protect sister chromatid

cohesion during mitosis in the cervical carcinoma cell line,

HeLa (59).

Phosphorylation is a primary protein regulatory mechanism

for controlling activity, stability, localization, and cofactor

interactions. It is estimated that 30% of all cellular proteins

contain covalently bound phosphate at a ratio of 1800:200:1 for

FIGURE 8. Phb1 and Phb2 co-localize to perinuclear regions in acti-vated primary human T cells and fractionate to the mitochondria.A, immunofluorescent confocal microscopy was utilized to examine local-ization of Phb1 (green), Phb2 (red), overlay (yellow), and overlay with phasecontrast. B, activated primary human T cell nuclear (lanes a, c, e, and g) andcytoplasmic (lanes b, d, f, and h) fractions were analyzed by 10% SDS-PAGEand Western blot analysis with the antibodies indicated. C, activated pri-mary human T cell cytoplasmic fractions were further separated intocytoplasmic (lanes a, c, e, and g) and mitochondrial (lanes b, d, g, and h)fractions and analyzed by Western blot (WB) with the antibodiesindicated. Controls for cell fractionation were Jak3 (cytoplasm), PARP(nucleus), OxPhos CII (mitochondria), and GAPDH (cytoplasm andmitochondria).

FIGURE 9. Phb1 and Phb2 localize to the inner mitochondrial membranein primary human T cells. Transmission electron micrograph (�5,000 mag-nification) of CD3� primary human T cells activated with PHA (10 �g/ml) for72 h (upper panel). Electron micrograph of immunogold-labeled Phb1 (6-nmgold particle, white triangle), and Phb2 (12-nm gold particle, black triangle) inPHA activated primary human T cells at �31,500 magnification (lower panel).M denotes mitochondria. See “Experimental Procedures” for details.



at STA

TE U

NIV

OF N

EW

YO

RK

ALB

AN

Y, on June 1, 2012

ww

w.jbc.org

Dow

nloaded from

Ser(P), Thr(P), and Tyr(P), respectively (60). Evidence has

emerged that suggests prohibitins can be regulated by phos-

phorylation. Indeed, several studies have noted the presence of

multiple isoforms for Phb1, which was proposed to be phos-

phorylated derivatives (61). Recently, a global phosphopro-

teomic mass spectrometry study on epidermal growth factor

stimulation of HeLa cells identified Ser252 and Ser254 as accep-

tor sites in Phb1, however, phosphorylation of these sites in

vitro or in vivo has not been validated (62). We provide direct

evidence of Phb phosphorylation using the incorporation of

[32P]orthophosphate and subsequent phosphoamino acid anal-

ysis to determine Phb1 serine and Phb2 serine and tyrosine

residues are phosphorylated (Fig. 5).

Interestingly, multiple labeling

attempts (4 h) did not result in sig-

nificant incorporation, however,

prolonged incubation (18 h) with

radiolabel was successful, suggest-

ing slow phosphorylation kinetics.

Indeed, overnight labeling of naı̈ve

human T cells did not result in

phosphate incorporation into either

Phb1 or Phb2. Tyrosine phospho-

rylation of Phb2 was confirmed by

Western blot using an anti-phos-

photyrosine antibody. Further-

more, phosphopeptide mapping by

mass spectrometry suggested

Tyr248 was an acceptor site in Phb2.

Phosphospecific antibodiesmade to

this region, and site-directed

mutagenesis confirmed this notion

(Fig. 6). Interestingly, Tyr248 resides

within a known phosphotyrosine

binding domain called a NPXYmotif

and is presumably the reason this res-

idue is not required for complex for-

mation with Phb1, which does not

contain a known phosphotyrosine

binding domain. Phb2 Tyr248 is evo-

lutionarily conserved in human,

mouse, rat, Xenopus, zebrafish, and

Drosophila, however, C. elegans and

Schizosaccharomyces pombe contain

a phenylalanine at this position, sug-

gesting a gain of function at this point

of divergence. Sequence comparison

ofPhb1andPhb2reveal thatalthough

there is 45% identity and 74% similar-

ity at the amino acid level, the NPXY

motif is not conserved inPhb1.Tyr248

is present in a putative coiled coil

domain (amino acids 190–264),

which is C-terminal to the conserved

Phb domain (amino acids 39–201)

(42). Collectively, these findings sup-

port the hypothesis that phosphoryl-

ationcan regulatePhb functionpossi-

bly through the binding of novel cofactors, however, its exact role

in T cell function remains to be determined.

Prohibitin subcellular localization appears to be cell type

dependent. Phb1 and Phb2 have been reported at the plasma

membrane in human B cells (16), intestinal epithelial cells (16,

63), and vascular endothelial cells (64). Nuclear Phb1 and Phb2

have been described in human breast cancer (18) and prostate

cancer (19) cell lines. Mitochondrial prohibitins have been

described in detail in yeast (43, 44, 65), C. elegans (66), and

human fibroblasts (40). Utilizing immunofluorescent confocal

microscopy, Phb1 and Phb2 were shown to primarily co-local-

ize to perinuclear regions in PHA-activated primary human T

FIGURE 10. Loss of the Phb complex in human T cells results in disruption of mitochondrial membranepotential. A, Kit225 cells (1 � 106) were electroporated with non-targeting control siRNA (100 nM) (lane a),Phb1-specific siRNA (100 nM) (lane b), or Phb2-specific siRNA (100 nM) (lane c) and harvested at 48 h post-transfection. Cell lysates (10 �g) were subjected to 10% SDS-PAGE and Western blot (WB) analysis with anti-bodies directed toward Phb1, Phb2, and actin as indicated. B, siRNA specificity was determined by Q-RT-PCRanalysis of RNA isolated from Kit225 cells treated with non-targeting control, Phb1, or Phb2 siRNA for 24 h. Torepresent both Phb1 and Phb2 on the same graph Phb1 mRNA values are 1/20 of the original values. Eachexperiment was performed in triplicate where values represent the mean S.D. of Phb1 and Phb2 mRNA levelsnormalized to 18 S. Statistical significance was determined using Student’s t test. *, p � 0.05; **, p � 0.01.C, DePsipher fluorescence was detected by flow cytometry of Kit225 cells electroporated alone (panel B), withcontrol siRNA (500 nM) (panel C), Phb1 (250 nM), and Phb2 siRNA (250 nM) (panel D). Non-DePsipher treated cells(panel A) served as a negative fluorescent control and valinomycin (100 nM, 6 h) treated cells (panel E) were usedas a positive control for membrane depolarization.



at STA

TE U

NIV

OF N

EW

YO

RK

ALB

AN

Y, on June 1, 2012

ww

w.jbc.org

Dow

nloaded from

cells (Fig. 8A). Additionally, subcellular fractionation con-

firmed they are present in the cytoplasm and not the nucleus of

activated primary human T cells (Fig. 8B). Further separation

revealed that Phb1 and Phb2 are mitochondrial localized (Fig.

8C). To determine whether the Phb complex localizes to the

inner mitochondrial membrane in T cells, as previously

reported in yeast, we performed immunoelectron microscopy

(Fig. 9). Phb1 and Phb2were present in themitochondrial inner

membrane, however, we could not detect Phb1 and Phb2 in

complex. Because previous data and immunodetection studies

shown here support a Phb1/2 complex (Figs. 5–8 and 10), it is

probable that steric hindrance prevents Phb1 and Phb2 anti-

bodies to be present in the same complex. It is possible that

complex formation was observed by co-immunoprecipitation

due to incomplete solubilization of the mitochondrial inner

membrane, however, we did not detect the inner membrane

protein OxPhos CII during reblots of Phb2 co-precipitation

studies (data not shown). Taken together, these data suggest

Phb1 and Phb2 form a complex in the inner mitochondrial

membrane of activated primary human T cells.

Yeast molecular genetics has played a key role in examining

Phb function. The Phb1 and Phb2 homologues in S. cerevisiae

form a high molecular weight complex in the inner mitochon-

drialmembrane and are proposed to function as chaperones for

newly imported proteins including electron transport enzymes

(40, 44, 67). Indeed, siRNA-mediated knockdown of Phb1 and

Phb2 in Kit225 cells resulted in dis-

ruption of mitochondrial mem-

brane potential (Fig. 10). This is in

accordance with recent findings of

Kasashima et al. (68) who reported

loss of mitochondrial integrity upon

knockdown of Phb2 in HeLa cells.

Furthermore, Phb1 and Phb2 expres-

sion was induced upon IL-2 depriva-

tion-mediated cell death indicating

these proteins play an anti-apoptotic

or survival function in Kit225 cells

(Figs. 11). Our findings support the

hypothesis that Phb1 and Phb2 func-

tion as molecular chaperones in

human T cells to protect mitochon-

drial integrity during cellular stress

thatmay occur during events ofT cell

activation or cell death.

In conclusion, using a proteomics

based approach, we have identified

the Phb family of proteins, Phb1 and

Phb2, to be up-regulated during T

cell activation. Evidence is provided

that phosphorylation is a potential

regulator of the Phb mechanism of

action. Specifically, tyrosine phos-

phorylation of Phb2 Tyr248, which

lies within a conservedNPXYmotif,

occurs in primary and tumor cell

lines where it may be important in

protein-protein interactions, how-

ever, is not required for Phb1/Phb2 association. Mitochondria

play a critical role in providing ATP derived from the electron

transport chain and oxidative phosphorylation. Phb1 and Phb2

were determined to localize to the mitochondrial inner mem-

brane of humanT cells and function tomaintainmitochondrial

integrity, indicating this complex facilitates T cell survival

through stabilization of mitochondrial electron transport

enzymes during the increasedmetabolic demand required forT

cell proliferation. Their additional roles for cell signaling events

also cannot be ruled out. In addition to serving as intracellular

biomarkers for T cell activation, Phb1 and Phb2may hold ther-

apeutic value to regulate T cell-mediated diseases by manipu-

lating mitochondrial integrity and function.

Acknowledgments—Electron microscopy was performed by Dr. J. Ell-

zey, Ph.D., and M. Viveros at the Analytical Cytology Core Facility, a

component of the Border Biomedical Research Center (University of

Texas, El Paso). We thank Dr. J. Johnston, Queens University, UK, for

kindly providing the Kit225 cells and Dr. P. Coates, University of

Dundee, UK, for generously providing initial Phb1 and Phb2 antisera

to confirm Phb identification.

REFERENCES

1. Straus, D. B., and Weiss, A. (1992) Cell 70, 585–593

2. Iwashima, M., Irving, B. A., van Oers, N. S., Chan, A. C., and Weiss, A.

(1994) Science 263, 1136–1139

FIGURE 11. Phb1 and Phb2 protein levels increase during IL-2 withdrawal mediated apoptosis of humanT cells. A, Kit225 cells were harvested at 0 (lane a), 24 (lane b), 48 (lane c), 72 (lane d), and 96 h (lane e) after IL-2withdrawal. Cell lysate (10 �g) was separated by 10% SDS-PAGE, transferred to polyvinylidene difluoridemembrane, and Phb1, Phb2, GAPDH, and PARP protein levels were detected by Western blot analysis asindicated. B, Phb1 and Phb2 band intensities were normalized to GAPDH using densitometric analysis and the-fold increase plotted for each time point. Values are mean S.D. from three independent experiments. C, IL-2was withdrawn from Kit225 cells for the indicated time points and Annexin V-FITC/PI staining was detected byflow cytometry. Percentages of positive cells are shown in the appropriate quadrants.



at STA

TE U

NIV

OF N

EW

YO

RK

ALB

AN

Y, on June 1, 2012

ww

w.jbc.org

Dow

nloaded from

3. Zhang, J., Salojin, K., and Delovitch, T. L. (1998) J. Immunol. 160,

1148–1157

4. Wange, R. L., Malek, S. N., Desiderio, S., and Samelson, L. E. (1993) J. Biol.

Chem. 268, 19797–19801

5. Egan, S. E., Giddings, B.W., Brooks,M.W., Buday, L., Sizeland, A.M., and

Weinberg, R. A. (1993) Nature 363, 45–51

6. Finco, T. S., Kadlecek, T., Zhang,W., Samelson, L. E., andWeiss, A. (1998)

Immunity 9, 617–626

7. Zhang,W., Trible, R. P., Zhu, M., Liu, S. K., McGlade, C. J., and Samelson,

L. E. (2000) J. Biol. Chem. 275, 23355–23361

8. Lowenthal, J.W., Zubler, R. H., Nabholz,M., andMacDonald, H. R. (1985)

Nature 315, 669–672

9. Durand, D. B., Bush, M. R., Morgan, J. G., Weiss, A., and Crabtree, G. R.

(1987) J. Exp. Med. 165, 395–407

10. Ross, J. A., Nagy, Z. S., Cheng, H., Stepkowski, S. M., and Kirken, R. A.

(2007) Arch. Immunol. Ther. Exp. (Warsz.) 55, 231–245

11. Kirken, R. A., Rui, H., Malabarba, M. G., Howard, O. M., Kawamura, M.,

O’Shea, J. J., and Farrar, W. L. (1995) Cytokine 7, 689–700

12. Johnston, J. A., Kawamura, M., Kirken, R. A., Chen, Y. Q., Blake, T. B.,

Shibuya, K., Ortaldo, J. R., McVicar, D.W., and O’Shea, J. J. (1994)Nature

370, 151–153

13. Kawamura, M., McVicar, D. W., Johnston, J. A., Blake, T. B., Chen, Y. Q.,

Lal, B. K., Lloyd, A. R., Kelvin, D. J., Staples, J. E., Ortaldo, J. R., andO’Shea,

J. J. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 6374–6378

14. Dang,N.H., Torimoto, Y., Shimamura, K., Tanaka, T., Daley, J. F., Schloss-

man, S. F., and Morimoto, C. (1991) J. Immunol. 147, 2825–2832

15. Stepkowski, S. M., Kao, J., Wang, M. E., Tejpal, N., Podder, H., Furian, L.,

Dimmock, J., Jha, A., Das, U., Kahan, B. D., and Kirken, R. A. (2005) J. Im-

munol. 175, 4236–4246

16. Terashima, M., Kim, K. M., Adachi, T., Nielsen, P. J., Reth, M., Kohler, G.,

and Lamers, M. C. (1994) EMBO J. 13, 3782–3792

17. Rajalingam, K.,Wunder, C., Brinkmann, V., Churin, Y., Hekman,M., Siev-

ers, C., Rapp, U. R., and Rudel, T. (2005) Nat. Cell Biol. 7, 837–843

18. Fusaro, G., Dasgupta, P., Rastogi, S., Joshi, B., and Chellappan, S. (2003)

J. Biol. Chem. 278, 47853–47861

19. Gamble, S. C., Odontiadis, M., Waxman, J., Westbrook, J. A., Dunn, M. J.,

Wait, R., Lam, E. W., and Bevan, C. L. (2004) Oncogene 23, 2996–3004

20. Wang, S., Nath, N., Adlam, M., and Chellappan, S. (1999) Oncogene 18,

3501–3510

21. Delage-Mourroux, R.,Martini, P. G., Choi, I., Kraichely, D.M., Hoeksema,

J., and Katzenellenbogen, B. S. (2000) J. Biol. Chem. 275, 35848–35856

22. Wang, S., Zhang, B., and Faller, D. V. (2004) EMBO J. 23, 2293–2303

23. Nijtmans, L. G., Artal, S.M., Grivell, L. A., andCoates, P. J. (2002)CellMol.

Life Sci. 59, 143–155

24. Langer, T., Kaser, M., Klanner, C., and Leonhard, K. (2001) Biochem. Soc.

Trans. 29, 431–436

25. Coates, P. J., Jamieson,D. J., Smart, K., Prescott, A. R., andHall, P. A. (1997)

Curr. Biol. 7, 607–610

26. Eveleth, D. D., Jr., and Marsh, J. L. (1986) Nucleic Acids Res. 14,

6169–6183

27. Park, S. E., Xu, J., Frolova, A., Liao, L., O’Malley, B. W., and Katzenellen-

bogen, B. S. (2005)Mol. Cell. Biol. 25, 1989–1999

28. He, B., Feng,Q.,Mukherjee, A., Lonard, D.M., Demayo, F. J., Katzenellenbogen,

B. S., Lydon, J. P., and O’Malley, B. W. (2007) Mol. Endocrinol. doi:

10.1210/me.2007-0400

29. Dixit, V. D., Sridaran, R., Edmonsond, M. A., Taub, D., and Thompson,

W. E. (2003) Endocrinology 144, 1496–1505

30. Schneider, U., Schwenk, H. U., and Bornkamm,G. (1977) Int. J. Cancer 19,

621–626

31. Miyoshi, I., Kubonishi, I., Yoshimoto, S., and Shiraishi, Y. (1981)Gann 72,

978–981

32. Keydar, I., Chen, L., Karby, S., Weiss, F. R., Delarea, J., Radu, M., Chaitcik,

S., and Brenner, H. J. (1979) Eur. J. Cancer 15, 659–670

33. Hori, T., Uchiyama, T., Tsudo,M., Umadome, H., Ohno, H., Fukuhara, S.,

Kita, K., and Uchino, H. (1987) Blood 70, 1069–1072

34. Kirken, R. A., Malabarba, M. G., Xu, J., DaSilva, L., Erwin, R. A., Liu, X., Hen-

nighausen, L., Rui,H., and Farrar,W. L. (1997) J. Biol. Chem.272, 15459–15465

35. Kirken, R. A., Erwin, R. A., Taub, D., Murphy, W. J., Behbod, F., Wang, L.,

Pericle, F., and Farrar, W. L. (1999) J. Leukocyte Biol. 65, 891–899

36. Reynolds, E. S. (1963) J. Cell Biol. 17, 208–212

37. Bjellqvist, B., Hughes, G. J., Pasquali, C., Paquet, N., Ravier, F., Sanchez, J. C.,

Frutiger, S., and Hochstrasser, D. (1993) Electrophoresis 14, 1023–1031

38. Katial, R. K., Sachanandani, D., Pinney, C., and Lieberman, M. M. (1998)

Clin. Diagn. Lab. Immunol. 5, 78–81

39. Ikonen, E., Fiedler, K., Parton, R. G., and Simons, K. (1995) FEBS Lett. 358,

273–277

40. Coates, P. J., Nenutil, R.,McGregor, A., Picksley, S.M., Crouch,D.H., Hall,

P. A., and Wright, E. G. (2001) Exp. Cell Res. 265, 262–273

41. Back, J. W., Sanz, M. A., De Jong, L., De Koning, L. J., Nijtmans, L. G., De

Koster, C. G., Grivell, L. A., Van Der Spek, H., and Muijsers, A. O. (2002)

Protein Sci. 11, 2471–2478

42. Winter, A., Kamarainen, O., and Hofmann, A. (2007) Proteins 68,

353–362

43. Tatsuta, T., Model, K., and Langer, T. (2005)Mol. Biol. Cell 16, 248–259

44. Steglich, G., Neupert, W., and Langer, T. (1999) Mol. Cell Biol. 19,

3435–3442

45. Beere, H. M. (2004) J. Cell Sci. 117, 2641–2651

46. Schamberger, C. J., Gerner, C., andCerni, C. (2004) FEBS Lett. 573, 19–25

47. Aringer, M., Hofmann, S. R., Frucht, D. M., Chen, M., Centola, M., Mori-

nobu, A., Visconti, R., Kastner, D. L., Smolen, J. S., and O’Shea, J. J. (2003)

J. Immunol. 170, 6057–6064

48. Theiss, A. L., Idell, R. D., Srinivasan, S., Klapproth, J. M., Jones, D. P.,

Merlin, D., and Sitaraman, S. V. (2007) FASEB J. 21, 197–206

49. Theiss, A. L., Obertone, T. S., Merlin, D., and Sitaraman, S. V. (2007)

J. Biol. Chem. 282, 12804–12812

50. Woodlock, T. J., Bethlendy,G., and Segel, G. B. (2001)BloodCellsMol. Dis.

27, 27–34

51. McClung, J. K., Danner, D. B., Stewart, D. A., Smith, J. R., Schneider, E. L.,

Lumpkin, C. K., Dell’Orco, R. T., andNuell, M. J. (1989) Biochem. Biophys.

Res. Commun. 164, 1316–1322

52. Roskams, A. J., Friedman, V., Wood, C. M., Walker, L., Owens, G. A.,

Stewart, D. A., Altus, M. S., Danner, D. B., Liu, X. T., and McClung, J. K.

(1993) J. Cell Physiol. 157, 289–295

53. Manjeshwar, S., Branam,D. E., Lerner,M. R., Brackett, D. J., and Jupe, E. R.

(2003) Cancer Res. 63, 5251–5256

54. Wang, S., Nath, N., Fusaro, G., and Chellappan, S. (1999) Mol. Cell. Biol.

19, 7447–7460

55. Wang, S., Fusaro, G., Padmanabhan, J., and Chellappan, S. P. (2002) On-

cogene 21, 8388–8396

56. Joshi, B., Ko, D., Ordonez-Ercan, D., andChellappan, S. P. (2003)Biochem.

Biophys. Res. Commun. 312, 459–466

57. Montano,M.M.,Ekena,K.,Delage-Mourroux,R.,Chang,W.,Martini, P., and

Katzenellenbogen, B. S. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 6947–6952

58. Kurtev, V., Margueron, R., Kroboth, K., Ogris, E., Cavailles, V., and Seiser,

C. (2004) J. Biol. Chem. 279, 24834–24843

59. Takata, H., Matsunaga, S., Morimoto, A., Ma, N., Kurihara, D., Ono-

Maniwa, R., Nakagawa,M., Azuma, T., Uchiyama, S., and Fukui, K. (2007)

Curr. Biol. 17, 1356–1361

60. Hubbard, M. J., and Cohen, P. (1993) Trends Biochem. Sci. 18, 172–177

61. Thompson, W. E., Sanbuissho, A., Lee, G. Y., and Anderson, E. (1997) J.

Reprod. Fertil. 109, 337–348

62. Olsen, J. V., Blagoev, B., Gnad, F.,Macek, B., Kumar, C.,Mortensen, P., and

Mann, M. (2006) Cell 127, 635–648

63. Sharma, A., and Qadri, A. (2004) Proc. Natl. Acad. Sci. U. S. A. 101,

17492–17497

64. Kolonin, M. G., Saha, P. K., Chan, L., Pasqualini, R., and Arap, W. (2004)

Nat. Med. 10, 625–632

65. Nijtmans, L. G., de Jong, L., Artal Sanz,M., Coates, P. J., Berden, J. A., Back,

J. W., Muijsers, A. O., van der Spek, H., and Grivell, L. A. (2000) EMBO J.

19, 2444–2451

66. Artal-Sanz, M., Tsang, W. Y., Willems, E. M., Grivell, L. A., Lemire, B. D.,

van der Spek, H., and Nijtmans, L. G. (2003) J. Biol. Chem. 278,

32091–32099

67. Berger, K. H., and Yaffe, M. P. (1998)Mol. Cell. Biol. 18, 4043–4052

68. Kasashima, K., Ohta, E., Kagawa, Y., and Endo, H. (2006) J. Biol. Chem.

281, 36401–36410



at STA

TE U

NIV

OF N

EW

YO

RK

ALB

AN

Y, on June 1, 2012

ww

w.jbc.org

Dow

nloaded from

j biol chem, 283(8)

Documents