isolation of aba insensitive mutants using a sensitized · addition to this, there may be several...
TRANSCRIPT
Isolation of ABA Insensitive Mutants using a Sensitized Screen
by
Eric Hyung-Uk Nam
A thesis submitted in conformity with the requirements for the degree of Master of Science
Graduate Department of Cell and Systems Biology University of Toronto
© Copyright by Eric Hyung-Uk Nam 2010
Isolation of ABA mutants using a Sensitized Screen
Eric Hyung-Uk Nam
Degree of Master of Science
Graduate Department of Cell and Systems Biology University of Toronto
2010
Abstract
ABA insensitive mutants (abi1 - abi5) have been isolated in germination screens that use
high concentrations of exogenous ABA, and this method is believed to be saturated. To
overcome this problem, a sensitized screen that used much lower concentration of exogenous
ABA was performed to isolate new ABA insensitive mutants. Some of the isolated mutants had
defects in light or retrograde signalling. One particular mutant (18-11) developed long
hypocotyls under normal light condition. Based on its response to blue, red and far-red light
conditions, this mutant is likely a novel hy mutant. Genetic analysis revealed that while ABA
insensitivity in this mutant is recessive, the long hypocotyl phenotype is dominant. Positional
cloning is currently being carried out to identify the gene. Findings from this study supports that
ABA signalling interacts with light signalling networks.
II
Table of Contents Section Page Abstract II
List of Tables V
List of Figures VI
List of Appendices VII
Abbreviations VIII
Introduction 1
Plant hormones 2
Physiological processes affected by ABA 4
ABA biosynthesis and catabolism 7
ABA receptors 11
ABA signalling by PYR/PYL/RCAR receptors 18
Other ABA responsive genes 20
Interaction of ABA and glucose signalling 22
Retrograde signalling 22
Influence of light on plant development 25
Research objectives 27
Materials and Methods 28
Growth conditions 29
Transfer experiment 30
Sensitized screen for ABA insensitive mutants 30
Positional cloning analysis 31
Chlorophyll measurement 36
RNA extraction and RT-PCR 41
Blue, red and far-red light sensitivity in 18-11 41
Germination rate of 18-11 under far-red or dark 42
Ecotype variation 42
III
Molecular techniques 42
Results 44
Effects of ABA and glucose on Arabidopsis 45
Designing a sensitized screen 48
Strength of this sensitized screen 48
Factors that influence ABA and glucose effects 53
Ecotype variation between Col and Ler 56
Isolation of ABA insensitive mutants 59
ABA & glucose target a specific process in young seedlings 62
Isolation of gun-like mutants 65
The mutation responsible for this gun phenotype is 69
located in chromosome 3
Isolation of a long hypocotyl mutant 73
18-11 has multiple light perception defects 80
18-11 mutation mapped to chromosome 3 86
Discussion 99
ABI mutants are resistant to both ABA and glucose 100
New screen to identify ABA insensitive mutants 101
Ecotype variation between Col and Ler 102
ABA plays a role in retrograde signalling 103
Isolation of a long hypocotyl mutant (18-11) 106
Future direction 109
Appendices 111
References 115
IV
List of Tables Table Page 22 SSLP markers used for bulk segregant analysis 32 SSLP and CAPS markers in chromosome 3 34 SSLP markers in chromosome 1 37 HY sequencing primers 39 Five HY sequences in 18-11 lines 81
V
List of Figures Figure Page Simplified model of ABA biosynthesis 8 ABA receptors present in plant cells 12 ABA signal transduction activated by PYR/PYL/RCAR 16 Three proposed plastid-to-nucleus retrograde signalling pathways 23 in plants Effect of ABA and glucose on young seedlings 46 Optimal conditions for the screen 49 pyl4 can develop green cotyledons on the screening condition 51 Factors that enhances the ABA and glucose effect 54 Natural variation between Col and Ler 57 Screening process for isolating ABA signalling mutants 60 Effect of different combinations of ABA and glucose concentrations 63 Isolation of retrograde signalling mutant 67 Positional cloning analysis of 4-3 70 4-3 mutation is semi-dominant 74 Isolation of a putative hy mutant 77 18-11 has light sensitivity defects 83 ABA insensitivity in 18-11 is recessive 87 Long hypocotyl phenotype in 18-11 is dominant 90 Hypocotyl variation in 6 day-old 18-11 seedlings (F2 - 18-11xLer) 92 Positional cloning analysis of 18-11 (long hypocotyl gene) 95
VI
List of Appendices Figure Page
Some ecotypes show a natural resistance to the ABA/glucose 112 growth inhibition
Several abi and etr1-7 mutants on 7% glucose media 114
VII
Abbreviations °C Degrees in Celsius aba ABA deficient mutant ABA Abscisic acid ABAR (putative) ABA RECEPTOR abi ABA insensitive mutant ABRE ABA response elements AFP ABI FIVE BINDING PROTEIN agh ABA-germination hypersensitive mutant AP2 APETALA 2 Ca2+ Calcium ion CAPS Cleaved Amplified Polymorphic Sequence CHLH Mg-protoporphyrin IX chelatase subunit H Col Columbia ecotype CRY Cryptochrome DNA Deoxyribonucleic acid DPA Dihydrophaseic acid EMS Ethyl methane sulfonate F1 First generation offspring F2 Second generation offspring FN Fast neuron GA Gibberellic acid gcr2 G-protein coupled receptor 2 mutant
VIII
G-protein Guanine nucleotide-binding protein GTG GPCR-type G protein gun Genome uncoupled mutant H2O2 Hydrogen peroxide hab Hypersensitive to ABA mutant hy Long hypocotyl mutant Ler Landsberg erecta ecotype Lhcb 1.2 Light harvesting chlorophyll a/b- binding protein 1.2 mRNA M3 Mutagenized seeds, third generation Mb Mega base pairs mg Milli gram ml Milli litre mM Milli molar MS Murashige and Skoog NADPH Nicotinamide adenine dinucleotide phosphate nced Nine-cis-epoxycarotenoid dioxygenase mutant nM Nano molar PA Phaseic acid PGE Plastid-gene expression PhANG Photosynthetic-associated nuclear genes PHY Phytochrome PP2C Protein phosphatase type 2C pyl PYR1-like mutant
IX
X
pyr1 Pyrobactin resistance 1 mutant rcar1 Regulatory components of ABA receptor 1 mutant PCR Polymerase chain reaction RNA Ribonucleic acid ROS Reactive oxygen species SnRK SNF-related kinases SSLP Simple sequence length polymorphism T-DNA Transferred DNA μE Micro Einsteins μg Micro gram μM Micro molar VP1 viviparous-1 WT Wild-type w/v Weight per volume
Introduction
1
1.0 Plant hormones
As plants are immovable, rapid response to environmental cues is critical for their
survival. Plant hormones are used to make rapid changes in various physiological processes.
Abscisic acid (ABA), for example, can cause stomatal closure within minutes (Weyers and
Paterson 2001). Although plant hormones mainly regulate plant growth and development, they
are also involved in biotic and abiotic stress responses (Raven et al 1999). Plant hormones are
different from animal hormones as not all plant hormones are transported from a specific
location of synthesis to a target tissue (Davies 2004). For example, while a plant hormone, such
as cytokinins, can be transported from root to leaf to control senescence, other hormones, such as
ethylene, can be synthesized locally to affect the same tissue. The only common theme between
the plant and animal hormones is that both can trigger a specific physiological change at
extremely low concentrations (Hedden and Thomas 2006).
Weyers and Paterson (2001) define plant hormones as chemicals that satisfy the
following conditions: a) specific physiological changes must occur only in presence of hormone
and b) such physiological changes can be triggered by extremely low dose of hormone. The first
condition suggests that no physiological change should be observed in absence of a hormone. To
test this, hormonal activity can be abolished by removing synthesis organs, using hormone
transporter inhibitors, or creating mutations in hormone biosynthesis or signalling pathways.
ABA, for example, satisfies both conditions. ABA biosynthesis or signalling mutants wilt
readily since they cannot move stomata properly. Also, extremely low amount of ABA is
sufficient to trigger stomatal closure.
The five classical plant hormones studied extensively are auxin, cytokinins, ethylene,
gibberellic acid (GA), and ABA. Of these, auxin and cytokinins deserve special mentions as
2
they play important roles in stem cell control and cell differentiation processes (Davies 2004).
While a combination of auxin and cytokinins stimulates rapid cell division in tissue culture, they
create opposite effects on plants. For example, while auxin stimulates root initiation, cytokinins
stimulate shoot initiation in tissue culture. When auxin inhibits the growth of lateral buds (apical
dominance), cytokinins stimulate growth in the lateral buds (Shimizu-Sato et al 2009). In
addition, auxin induces lateral organogenesis by enhancing the differentiation of transitional
stem cells in the proximal shoot apical meristem, and cytokinins maintain the stem cell niche by
enhancing division of meristems (Veit 2009). In roots, the roles are reversed. While root
meristem niche is maintained by auxin (Werner et al 2003), the rate of differentiation in the root
is regulated by cytokinins (Ioio et al 2007). As for the rest of the classical hormones, GA is
mainly involved in seed germination, stem growth, and bolting in long days, whereas ethylene is
involved in shoot and root growth, flower induction, adventitious root formation, and induction
of triple responses (Davies 2004).
In addition to those classical hormones, many other chemicals with biological functions
have been characterized. These compounds include brassinosteroids, jasmonic acid, salicylic
acid, strigalactone, and peptide hormones. Initially, they were not recognized as plant hormones
mainly because it was hard to assign specific physiological functions for each hormone. For
example, although brassinolide in plants was first identified in 1979, its hormonal status was not
recognized until its role in stem elongation was evaluated in GA-insensitive dwarf mutants
(Davies 2004, Hedden and Thomas 2006).
While ABA plays significant roles in many physiological processes throughout plant
lifecycle (see below), the ABA signalling mechanism has been rather poorly understood
3
compared to other hormone pathways until recently. In this thesis, ABA is discussed
extensively.
1.1 Physiological processes affected by ABA
Guard cell movement is a well characterized physiological response to ABA (Zeevaart
and Creelman 1988, Raven et al 1999). Under drought stress, the endogenous ABA level
increases dramatically. ABA induces H2O2 accumulation in guard cells (Pei et al 2000), and this
process is mediated by NADPH oxidase, which is encoded by AtrbohD and AtrbohF subunits
(Kwak et al 2003). Both gene expressions are up-regulated by ABA. Double mutations in
AtrbohD and AtrbohF cause reduction in H2O2 production and impairment in stomatal
movement (Kwak et al 2003). Stomatal impairment can be rescued by exogenously applied
H2O2 in this mutant. Also, inhibition of NADPH oxidase activity by a chemical inhibitor results
in impairment of stomatal closure (Pei et al 2000). Activation of Ica channel by H2O2 causes an
increase in Ca2+ influx rate, which results in the accumulation of cytosolic Ca2+ (Pei et al 2000).
Additionally, the release of Ca2+ from the endoplasmic reticulum and the vacuole is also
triggered by ABA (Allen et al 2000). The accumulation of Ca2+ and change in cytosolic pH by
H2O2 (Zhang et al, 2001) cause increased K+, Cl- and malate- efflux rates (Pandley et al 2007).
This results in the loss of turgor pressure in guard cells, and the closure of the stomata. In
addition to this, there may be several other mechanisms involved in stomatal closure as ABA can
induce the stomatal movement in a calcium-independent manner (Allan et al, 1994).
Although both stomatal opening and stomatal closure processes are regulated by ABA,
each process is controlled by different ABA signalling components (Mishra et al 2006). When
different ABA signalling mutants were tested for their responses to ABA in the opening and
4
closing of stomata, each mutant showed different guard cell movements. It is concluded that the
inhibition of stomatal opening by ABA is mediated by heteromeric G-protein, whereas stomatal
closure is mediated by ABA signalling involving protein phosphatase type 2C (PP2C)
components.
ABA is also involved in other abiotic stress responses, such as salt and cold tolerance.
Increased vulnerability to salt and cold stress in ABA auxotrophs suggests that ABA is required
to mediate the stress responses (Xiong et al, 2001). Interestingly, although salt stress response
can be induced by exogenously applying ABA to the auxotrophs, cold stress response is
unaffected by exogenous ABA. Another ABA-independent mechanism may be involved in cold
stress response.
ABA can repress pathogen defence mechanisms in plants by interfering with JA and
ethylene signalling (Anderson et al 2004). ABA hypersensitive mutants are highly susceptible to
several pathogen attacks, and ABA insensitive mutants are more resistant to such attacks (de
Torres-Zabala et al 2007). Oddly, ABA can enhance pathogen resistance in some other cases.
ABA-induced stomatal closure can block the entry of Pseudomonas syringae (Melotto et al
2006). Also, ABA can induce callose deposition in an infected area, which can act as a physical
barrier to pathogens (Flors et al 2008).
ABA plays a significant role in embryogenesis and seed maturation, as ABA auxotrophs
generate many unfertilized and aborted embryos at the early stage of embryogenesis (Cheng et al
2002). While ABA level is kept low in the early embryogenesis, the level increases as embryo
matures (Karssen et al, 1983). The ABA level diminishes once the fully matured seed is formed.
These changes in ABA concentrations correspond to the pattern changes in ABA biosynthesis
gene expressions (Cheng et al, 2002). Reciprocal crosses between wild-type (WT) and ABA
5
auxotroph mutants reveal that ABA is supplied by both the maternal tissue and the embryo
(Karssen et al 1983). Maternal ABA level peaks in the first half of embryogenesis, and
embryonic ABA peaks at the second half (Karssen et al 1983, Groot et al, 1991). While
maternal ABA may prevent precocious germination in seeds (Raz et al 2001), embryonic ABA is
required to preserve this dormancy (Karssen et al 1983). Maternal ABA also regulates the
duration of seed development and the thickness of the mucilage layer in seeds (Karssen et al
1983).
To ensure its survival, three types of dormancy are enforced on seeds before they can
germinate and grow (Dekkers 2006). Primary dormancy occurs during seed maturation as
mentioned above. Unlike primary dormancy, which is induced developmentally, secondary and
tertiary dormancies are induced environmentally. Environmental conditions, such as light and
temperature, can influence seed germination. Secondary dormancy can be triggered to withstand
hostile conditions temporarily (Koornneef and Karssen, 1994). This temporary developmental
arrest can be lifted once the condition becomes satisfactory for germination. Tertiary dormancy
differs from the previous ones, since it occurs after the germination of seedlings. The transition
from the embryonic phase to the vegetative phase can be blocked by several environmental
factors, such as exogenous ABA or glucose (Zhou et al, 1998, Lopez-Molina and Chua, 2000).
For example, ABA-induced dormancy can protect young seedlings from drought stress for at
least 30 days, and the seedlings can recover to grow as soon as ABA is removed. (Lopez-Molina
et al, 2001).
ABA can also regulate development of seedlings by promoting or inhibiting shoot and
root growth in a concentration dependent manner. A high concentration of exogenous ABA can
inhibit shoot and root growth of seedlings (Creelman et al 1990). Some ABA signalling mutants
6
that are insensitive to ABA can develop longer roots and heavier seedlings in the presence of
high ABA concentrations (Fujii et al 2007). However, a low concentration of ABA can induce
root and shoot growth. While Col seedlings can develop longer primary roots in presence of
1µM ABA or less, ABA signalling mutants are insensitive to this root elongation trigger
(Ephritikhine et al 1999, Fujii et al 2007). ABA auxotrophs also develop smaller cotyledons and
shorter roots with less branches compared to WT in absence of stress (Sharp et al 2000, Cheng et
al 2002). This growth retardation can be rescued by exogenously applied ABA (Sharp et al
2000).
1.2 ABA biosynthesis and catabolism
The isolation of several ABA deficient mutants (aba1, aba2, aba3) has helped to
construct the ABA biosynthesis pathway, and the mutants have been valuable tools for
understanding the physiological and developmental roles of ABA (Koornneef et al, 1982, Leon-
Koosterziel et al, 1996). ABA is derived from carotenoids (Marion-Poll and Leung 2006).
There are two parts in ABA synthesis: the synthesis of ABA precursors in plastids, and its
conversion to ABA in cytosol (Figure 1.1). The synthesis of trans-violaxanthin from zeaxanthin
by ABA1 in the plastids is considered the first step of ABA biosynthesis (Marin et al, 1996). A
mutation in ABA1 can result in precocious germination and a wilty phenotype. In the second
step, ABA4 converts trans-violaxanthin into trans-neoxanthin (North et al 2007). Over-
expression of ABA4 results in the accumulation of neoxanthin. Although the ABA level is
greatly reduced in aba4, it was not as severely reduced as in aba1-5. This is because neoxanthin
is not the only substrate for xanthoxin production. The last plastidial enzymatic reaction is
7
Figure 1.1 Simplified model of ABA biosynthesis. First half of ABA biosynthesis occurs in a plastid, where zeaxanthin is converted into xanthoxin in several steps. NCED performs the last plastidial enzymatic reaction, which produce xanthoxin. Xanthoxin is subsequently converted into ABA by ABA2 and AAO3. AAO3 requires molybdenum cofactor sulfurase (ABA3) to perform the last enzymatic step.
8
Zeaxanthin
trans-Violaxanthin
trans-Neoxanthin
9’-cis-Neoxanthin 9-cis-Violaxanthin
Xanthoxin
Abscisic aldehyde
Plastid
Cytosol
ABA1
ABA4
NCED
ABA2
AAO3 ABA3
ABA
9
mediated by nine-cis-epoxycarotenoid dioxygenases (NCEDs), which convert 9’-cis-neoxanthin
and 9-cis-violaxanthin into xanthoxin (Schwartz et al, 1997a, Tan et al, 1997). While there are 9
NCED genes in Arabidopsis (Schwartz et al 2003), only five NCEDs (NCED2,3,5,6,9) may be
biologically relevant for ABA biosynthesis (Iuchi et al 2001, Schwartz et al 2003, Tan et al
2003). Where NCED2,3,6 are localized in both thylakoid and stroma, NCED5 is only present in
the thylakoid, and NCED9 is only present in the stroma (Tan et al 2003). ABA2, AAO3 and
ABA3 are involved in the last two steps of ABA biosynthesis in the cytosol. ABA2 converts
xanthoxin into abscisic aldehyde (Schwarz et al 1997b, Cheng et al 2002). Conversion from
Abscisic aldehyde to ABA is catalyzed by absisic aldehyde oxidase3 (AAO3) in the presence of
molybdenum co-factor sulfurase (ABA3) (Schwartz et al 1997a, Seo et al, 2000).
ABA breakdown is mediated by the CYP707A gene family. While the hydroxylation of
any of the 7’, 8’ or 9’ carbons of ABA can deactivate it, 8’-OH ABA is the major form of
inactivation in plants (Nambara and Marion-Poll 2005). 8’-OH ABA is subsequently converted
into phaseic acid (PA) and dihydrophaseic acid (DPA) for further inactivation. Four CYP707A
(CYP707A1, A2, A3, A4) are involved in the 8’ hydroxylation of ABA. They are identified
using a reverse genetics approach, and their roles are verified by converting ABA into PA in
enzymatic assays (Kushiro et al 2004, Saito et al 2004). They may play different roles in ABA
responses as they display different temporal and spatial expression patterns. CYP707A1 and
CYP707A2 are strongly expressed during seed imbibitions, and they may play critical roles in
seed germination (Kushiro et al 2004). Both cyp707a1 and cyp707a2 mutants germinate slower
than WT as endogenous ABA levels stay high during imbibition (Kushiro et al 2004, Okamoto et
al 2006). In addition, cyp707a1/a2 double mutants exhibit more severe germination defects,
compared to cyp707a1/a3 or cyp707a2/a3 double mutants (Okamoto et al 2006). As CYP707A1
10
and CYP707A3 are strongly expressed during both dehydration and rehydration, they may be
involved in drought tolerance processes (Kushiro et al 2004, Umezawa et al 2006). cyp707a3
mutants have higher endogenous ABA levels during dehydration and rehydration processes, and
they consistently show strong drought tolerance (Umezawa et al 2006). The mutants have lower
transpiration rates than WT under non-stress conditions. Over-expression of CYP707A3 causes
higher transpiration rates and a decrease in ABA levels during dehydration and rehydration.
1.3 ABA receptors
Both cytosolic and membrane bound ABA receptors exist in plants. When ABA is
microinjected directly into guard cells, ABA response occurs without a delay (MacRobbie, 1995,
Levchenko et al, 2005). This suggests that a cytosolic form of ABA receptors must be present in
guard cell to trigger the stomatal closure. When a non-membrane permeable conjugate form of
ABA is applied to guard cells, ABA response is also triggered (Gilroy and Jones, 1994, Jeannette
et al, 1999). This ABA response can only be triggered if a plasma membrane bound ABA
receptor was also present. These results suggest that multiple ABA receptors are present in a
plant cell. Researchers believe that forward genetics screens have not yet yielded ABA receptors
because a functional mutation in one receptor can be compensated by others and would not
generate a mutant phenotype.
Several ABA receptors have been reported so far (Figure 1.2). Biochemical and genetic
approaches have been used to identify ABA receptors. All of the following ABA receptors in this
paragraph are identified using ABA binding assays and reverse genetics. The first reported ABA
receptor is FCA, which may be involved in flower timing processes (Razem et al, 2006).
Unfortunately, this paper was retracted recently, as the results were not reproducible (Razem et
11
Figure 1.2 ABA receptors present in plant cells. GCR2, GTG1 and GTG2 are plasma membrane bound ABA receptors. PYR/PYL/RCAR and ABAR/CHLH/GUN5 are cytosolic ABA receptors. FCA is not shown in this figure.
12
13
al 2008). The second ABA receptor identified is ABAR/CHLH/GUN5, a Mg-chelatase H
subunit involved in tetrapyrrole biosynthesis (Shen et al 2006). This gene is also involved in
retrograde signalling (Mochizuki et al, 2001). This mutant has defective ABA-mediated
responses in germination, root growth and guard cell movement. But how this receptor works
with other known ABA signalling components is currently unknown. A recent report suggests
that this gene may not be an ABA receptor (Muller and Hansson 2009). Mutation in XanF, a
barley homolog that is 82% identical to Arabidopsis Mg-cheltase H subunit, does not result in
ABA insensitivity on stomatal closure, root or shoot growth. Moreover, XanF does not bind
ABA in vitro. The third reported ABA receptor is a G-protein coupled receptor 2 (GCR2) (Liu
et al, 2007). This is the first identified plasma membrane bound ABA receptor. However, the
result of the paper is questioned by many researchers, and it is probably not an ABA receptor
(Gao et al, 2007, Johnson et al 2007, Illington et al 2008, Risk et al, 2008). Recently, two new
G-protein coupled receptor-type G proteins (GTG1, 2) were identified as new ABA receptors
(Pandey et al, 2009).
Unlike the above receptors, PYR/PYL/RCAR genes are identified as cytosolic ABA
receptors without using a reverse genetics approach. This ABA receptor family is identified
using two separate methods. PYROBACTIN RESISTANCE1 (PYR1) and PYR-LIKE (PYL)
are identified using a forward chemical genetics approach (Park, et al 2009, Santiago et al,
2009a). Unlike a traditional genetics approach, chemical genetics screens can identify genes
with high redundancy in function. A group of proteins that perform a similar function can be
identified in this type of screens because they may share the same or similar binding sites, which
can be targeted by the same chemical inhibitor (antagonist). In addition, a selective
agonist/activator can activate a particular protein to trigger a specific response. The Pyrobactin
14
used in this screen is a synthetic germination inhibitor that acts as an agonist of ABA. Due to
redundancy, a single loss of function mutation in PYLs does not result in any phenotypic
abnormality. However, triple (pyr1, pyl1, pyl4) or quadruplet mutants (pyr1, pyl1, pyl2, pyl4)
show ABA insensitivity. Regulatory components of ABA receptor (RCAR) are identified using
a yeast two-hybrid system, where interactors of ABI1 and ABI2 are examined (Ma et al, 2009).
Over-expression of RCAR1 results in hypersensitivity to ABA for stomatal movement, root
growth and seed dormancy. PYR/PYL/RCARs are shown to localize in both the cotysol and the
nucleus (Ma et al 2009, Santiago et al 2009a).
Five different research groups have recently reported the crystal structures of ABA-
bound PYR1, PYL1 and PYL2 (Santiago et al 2009b, Nishimura et al 2009, Melcher et al 2009,
Miyazono et al 2009, Yin et al 2009). PYR/PYL/RCARs have a common structure made of an
anti-parallel β-sheet that is made with 7 strands, and several helices in both c- and n- termini. In
absence of ABA, two receptor proteins form a stable dimer unit. ABA binding to an internal
cavity of a receptor causes conformation change, which results in an unstable asymmetric dimer
that eventually splits (Nishimura et al 2009). This split ABA-bound receptor can induce ABA
signal transduction by interacting with protein phosphatases type-2C (PP2C) proteins. Both (+)-
ABA and (-)-ABA can bind to PYR1, as stereoselectivity is not regulated by polar interaction
(Santiago et al 2009b, Nishimura et al 2009). However, PYL1 can bind to (+)-ABA only
(Miyazono et al 2009), and PYL2 shows strong preference to (+)-ABA binding (Melcher et al
2009).
15
Figure 1.3 ABA signal transduction activated by PYR/PYL/RCAR. In presence (left panel) and absence (right panel) of ABA, different ABA signalling components are activated. In presence of ABA, PYR/PYL/RCAR inhibits the action of PP2C. This allows SnRK2 to activate transcription factors (i.e. ABI5) to induce ABA response. In absence of ABA, PYR/PYL/RCAR is unable to inhibit the PP2C activity. As PP2C inhibits the activity of SnRK2, no ABA response can be triggered.
16
17
1.4 ABA signalling by PYR/PYL/RCAR receptors
ABA signal transduction triggered by this ABA receptor family is illustrated in Figure
1.3. In presence of ABA, the ABA receptors suppress the action of PP2C (Park, et al 2009,
Santiago et al, 2009a, Umezawa et al, 2009). Main targets of PP2C-mediated dephosphorylation
are SNF-related kinases (SnRK). As PP2C cannot suppress SnRK in presence of ABA, SnRK
activates ABA dependent downstream factors, such as bZIP transcription factors (i.e. ABI5).
The binding of ABI5 to the genes containing ABA Response Elements (ABRE) are thought to
triggers many ABA responses in the plant. In absence of ABA, PP2C will suppress the action of
SnRK, resulting in no ABA response. In summary, it appears that PP2Cs and SnRKs act as
negative and positive regulators of ABA signalling respectively.
The PP2C family involved in ABA signalling is a part of the serine/threonine
phosphatases family. Although there are at least 69 PP2C candidates present in Arabidopsis, only
six PP2C (ABI1, ABI2, HAB1, HAB2, AGH1, AGH3) have been identified as being involved in
ABA signalling (Kerk et al, 2002, Suzuki et al 2003, Saez et al 2004, Yoshida et al, 2006, Kuhn
et al 2006, Nishimura et al 2007). PYR1, PYL5 and RCAR1 have been shown to bind and
deactivate ABI1, ABI2 and HAB1 directly (Ma et al 2009, Park et al, 2009, Santiago et al
2009a). Furthermore, AGH3 can be inhibited by PYR1, but not by PYL5 (Santiago et al 2009a).
ABI1 and ABI2 were identified from ABA germination screens, where seed germination
was inhibited by exogenously applied ABA (Koornneef et al 1984). Generally, only ABA
insensitive mutants can germinate and grow in such conditions. The original abi1-1 and abi2-1
alleles identified were dominant mutations that resulted in pleiotrophic ABA insensitive
phenotypes in seed germination, root growth and stomatal movement. It is thought that the
PYR/PYL/RCAR receptors cannot suppress the PP2C activity in these mutants hence resulting in
18
constitutive PP2C activation (Ma et al, 2009, Park et al 2009). In guard cells, both ABI1 and
ABI2 are required for activating Ica channels (Murata et al 2001). ABA can enhance H2O2
production in abi2-1, but not in abi1-1. Also, application of exogenous H2O2 can restore
stomatal closure in abi1-1, but not in abi2-1. Based on these results, ABI1 and ABI2 are
involved in signal cascade steps before and after H2O2 production respectively. Loss-of-function
mutations were first identified in HAB1 using a reverse genetics approach, where homologs of
ABI1 and ABI2 were examined (Saez et al, 2004). HAB1 is localized in cytosol and nucleus
(Saez et al, 2008). Over-expression of HAB1 results in ABA-insensitivity, while loss of function
mutants show hypersensitivity to ABA. HAB2 is examined because of sequence similarity to
HAB1 (Saez et al, 2004). Both HAB1 and HAB2 gene expressions can be induced by ABA.
Loss-of-function mutations in AGH1 and AGH3 have been identified in a germination screen
where an ABA analog is utilized (Nishimura et al 2004). They are ABA hypersensitive mutants,
which do not germinate well in the presence of ABA or an ABA analog. In presence of ABA,
agh3-2, a severe allele of AGH3, shows strong reduction in chlorophyll synthesis and does not
form green cotyledons (Yoshida et al, 2006). The action of AGH1 and AGH3 is believed to be
specific to germination and to cotyledon growth, as the mutants do not show any defects in
hypocotyl and root growth, nor in sensitivity to sodium and sugar (Nishimura et al 2004). .
There are 38 SnRKs present in Arabidopsis (Hrabak et al 2003). Among SnRK2 genes,
only five of them (SnRK 2.2, 2.3, 2.6, 2.7 and 2.8) appear to be involved in ABA signalling
(Boudsocq et al 2004, Yoshida et al, 2006). SnRK2.6, also known as OPEN STOMATA1 (OST1),
is the first identified SnRK2 gene in Arabidopsis (Mustilli et al 2002, Yoshida et al 2002). It is
involved in stomatal movement and has no apparent role in seed germination. snrk2.6 mutants
cannot close stomata properly in response to ABA, and it shows poor drought tolerance.
19
SnRK2.6 is involved in the NADPH oxidase activation process, and snrk2.6 mutants do not
produce reactive oxygen species (ROS) in presence of ABA (Mustilli et al, 2002). This defect
can be rescued by exogenous H2O2. snrk2.6 also shows reduced expression of RD29B and
RD22, which are ABA-inducible stress elements (Yoshida et al 2002). SnRK2.6 interacts with
ABI1 and ABI2, and they are co-expressed in the cytosol and nuclei of guard cells (Umezawa et
al 2009). Although a single mutation in SnRK2.2 or SnRK2.3 does not cause any phenotypic
defect, double (snrk2.2 and snrk2.3) and triple (snrk2.2, 2.3, 2.6) mutants show strong ABA
insensitivity in germination (Fujii et al, 2007, Umezawa et al, 2009). While SnRK2.2 interacts
with all six PP2C, SnRK2.3 does not interact with HAB1. SnRK2.2, 2.3, and 2.6 activities are
severely reduced in abi1-1, while their activities are enhanced in agh1-1 and agh3-1 (Mustilli et
al 2002, Umezawa et al 2009).
1.5 Other ABA responsive genes
Three additional abi mutants have been identified in the germination screens. Loss of
function mutations in ABI3, ABI4, and ABI5 enable them to germinate in presence of exogenous
ABA. ABI3 was first identified in maize, where a mutation in the orthologue (VP1) can cause
precocious germination (Raven et al 1999). In Arabidopsis, ABI3 plays a critical role in seed
maturation, especially in seed storage protein accumulation, chlorophyll breakdown and
desiccation tolerance (Koornneef et al, 1984, Finkelstein and Somerville, 1990, Nambara et al,
1992). ABI3 is a multi-domain transcriptional factor that includes three basic domains (B1, B2,
B3) in the c-terminus region (Giraudat et al, 1992). B1 domain of ABI3 is shown to interact with
ABI5, a bZIP domain transcriptional factor, in a yeast two-hybrid test (Nakamura et al 2001).
This interaction may be necessary to trigger some ABA responses. ABI3 degradation can be
20
mediated by E3 ligase AIP2, which binds to B2 and B3 domains (Zhang et al, 2005). B3 domain
of both VP1 and ABI3 can bind to RY motif (CATGCA) in DNA to trigger ABA responses
(Suzuki et al, 1997, Ezcurra et al 2000, Monke et al 2004).
ABI4 is an APETALA 2-LIKE (AP2) domain transcription factor that was initially
believed to be involved in seed development and germination only (Finkelstein et al, 1998).
However, ABI4 was later shown to be involved in other processes including as glucose and
retrograde signalling (Arenas-Huertero et al, 2000, Koussevitzky et al, 2007). ABI4 ortholog in
Maize was shown to bind to Coupled Element (CE1) motif to trigger ABA responses (Niu and
Bate 2002).
Like other ABI genes, ABI5 is involved in seed maturation. But it may also play a
significant role in tertiary dormancy induction (Lopez-Molina et al 2001). Exogenously applied
ABA can induce ABI5 expression and improves the protein stability. ABI5 degradation is
mediated by ABI FIVE BINDING PROTEIN (AFP) (Lopez-Molina et al, 2003). Interestingly,
this proteasome nuclear body includes COP1, which is involved in light signalling. Recent
report suggests that HY5, a light signaling component, may bind to the promoter of ABI5 (Chen
et al 2008). Therefore, ABI5 may be involved in light signalling also. ABI5 can also be
negatively regulated by SUMO E3 ligase (SIZ1) (Miura et al 2009). A loss of function mutation
in SIZ1 results in hypersensitivity to ABA, and an abi5 mutant can suppress this
hypersensitivity. When ABI5 is interacting with ABI3 to induce ABA response, ABI5 is
considered working in downstream of ABI3 (Lopez-Molina et al 2002). ABI5 is a basic leucine
zipper (bZIP) domain transcriptional factor that binds to ABRE motif (Choi et al 2000, Umo et al
2000). This motif may be paired up with CE1 or CE3 motif to trigger ABA response with ABI4
(Shen et al 1996).
21
1.6 Interaction of ABA and glucose signalling.
Many glucose signalling components have been identified in high glucose screens, where
mutants show resistance to glucose-induced tertiary dormancy (Zhou et al 1998). Seedlings with
glucose-induced dormancy also show similar phenotypes as the seedlings with ABA-induced
dormancy: white and unexpanded cotyledons, and short hypocotyl and root. Isolation of ABI
alleles in glucose insensitive screens suggests that ABA and glucose signalling pathways interact
together to induce tertiary dormancy in young seedlings (Arenas-Huertero et al 2000, Cheng et al
2002). All ABA auxotrophs and abi3, abi4 and abi5 mutants show some resistance to the
glucose-induced dormancy. But interestingly, only abi4 alleles among abi mutants have been
isolated from a glucose screen. Based on epistasis experiments, ABA signalling is suggested to
act in downstream of glucose signalling to trigger the glucose-induced dormancy (Cheng et al,
2002).
1.7 Retrograde signalling
Communication between the nucleus and the plastids is critical for chloroplast
development as over 90% of chloroplast proteins are transcribed from the nucleus (Leister 2002).
Retrograde signalling is a communication signal from the plastids to the nucleus. Presently,
there are three defined retrograde signalling pathways: plastid-gene expression (PGE), Mg-
Protoporphyrin mediated genome uncoupled (GUN), and H2O2-mediated redox (Figure 1.4).
Of the three, the GUN signalling is the best defined pathway with respect to genetic analysi
Normally when plastid development is disturbed, nuclear genes that encode proteins with
functions in the chloroplast are down regulated at the transcriptional level. gun mutants exhibit
abnormal increased light signal nuclear gene expression in presence of chemicals such as
s.
22
Figure 1.4 Three proposed plastid-to-nucleus retrograde signalling pathways in plants. H2O2- (redox) mediated signals (top), genome-uncoupled (GUN) signals (mid), and plastid gene expression (PGE) signals (bottom) may regulate the ABI4-mediated photosynthesis-associated nuclear genes (PhANG) expressions in the nucleus. How these signals are transported from plastids to the nucleus is currently unknown. Although the concentration of Mg-Proto IX may not be important (see text), it may still play a role in a retrograde signalling.
23
Plastid Cytosol Nucleus
H2O2
?Proto
IX
GUN4
GUN5
Mg-Proto IX
GUN1 PhANG expression
? ABI4
24
norflurazon that disrupt plastid formation. GUN1 encodes a chloroplast-localized
pentatricopeptide-repeat protein (Koussevitzky et al, 2007). gun1 mutants show high Lhcb 1.2
expression in presence of both norflurazon and lincomycin. Norflurazon is a phytoene desaturase
inhibitor, which blocks carotenoid biosynthesis. Lincoymycin is a plastid translation inhibitor,
which blocks chloroplast biogenesis. Both chemicals repress the expression of photosynthesis-
associated nuclear genes (PhANG) (Larkin and Ruckle 2008). Due to its response to lincomycin,
GUN1 is considered to be involved in PGE pathway also. A recent report shows that GUN1 may
be involved in photomorphogenesis processes as well, and it can be repressed by blue light
(Ruckle and Larkin 2009).
The rest of the GUNs (GUN2 to GUN5) are involved in the tetrapyrrole biosynthesis
pathway. GUN2 and GUN3 are allelic to HY1 and HY2 (see below) (Vinti et al, 2000). GUN4
and GUN5 encode a Mg-ProtoIX-binding protein and a H subunit of Mg-Chelatase, respectively
(Larkin, et al 2003, Mochizuki et al, 2001). Because of these findings, Mg-Protoporphyrin IX is
considered a major signal molecule involved in GUN signalling (Strand et al 2003). However,
recent reports suggest that Mg-ProtoporphyrinIX may not play such role (Mochizuki et al, 2008,
Moulin et al 2008).
Additionally, ABI4 is involved in GUN signalling, where it binds the promoter of
retrograde-regulated genes to induce retrograde responses (Koussevitzky et al, 2007). How
GUN signalling components regulate ABI4 activity is unclear.
1.8 Influence of light on plant development
Light plays an important role in plant development. As mentioned before, seed
germination can be triggered by environmental factors, including light. Red light can induce
25
germination while far-red light can inhibit it (reviewed in Quall, 2002). A photoreceptor called
PHY B may play a significant role in this process. After seed germination, young seedlings are
subjected to photomorphogenesis, where developmental patterns are determined by light
conditions. In presence of light, the seedlings show short hypocotyls and expanded cotyledons
with mature green chloroplasts to perform photosynthesis. However, in absence of light, the
seedlings show long hypocotyls and unexpanded yellow cotyledons.
Five mutants, designated as hy1 to hy5, that show abnormal hypocotyl elongation in
presence of light were isolated in forward genetic screens (Koornneef et al 1980, Chory et al
1989). HY1 and HY2 encodes for heme oxygenase and phytochromobilin synthase, which are
involved in the last two steps of phytochromobilin biosynthesis (Davis et al, 1999, Muramoto et
al, 1999, Kohchi et al 2001). Phytochromobilin is a substrate required for photoreceptor
production. HY3 encodes PHY B photoreceptor, which is involved in red light perception
(Sharrock and Quail, 1989, Somers et al 1991). In presence of red light, PHY B localizes in the
nucleus (Yamaguchi et al, 1999). HY4 encodes the CRY1 photoreceptor, which detects blue
light with CRY2 (Ahmad and Cashmore, 1993). HY5 encodes a bZIP transcriptional factor,
which acts as a positive regulator of light signalling (Oyama et al 1997). HY5 processes the light
stimuli response from both phytochrome and cryptochrome photoreceptors to trigger appropriate
photomorphogenesis responses. Constitutive Photomorphogenic 1 (COP1), an E3 ubiquitin
ligase, may mediate HY5 degradation (Osterlund et al 2000). HY8 encodes the PHY A
photoreceptor, which is involved in far-red light perception (Parks and Quail 1993, Dehesh et al
1993). However, hy8 mutants do not show any hypocotyl elongation defects in white light.
26
1.9 Research objectives
Many ABA signalling components (e.g. ABIs) are isolated from germination assays that
utilize high concentrations of ABA. As many alleles of same ABI genes have been isolated, I
believe this screen approach has reached its limit in isolating new ABA genes. A new approach
that uses lower concentrations of ABA may be required to isolate unknown ABA signalling
components. This thesis proposes a new way to isolate ABA signalling mutants. Using a
sensitized screen that utilizes very low concentration of ABA (100nM), a new set of ABA
insensitive mutants has been isolated. In addition, interaction between ABA signalling network
and other networks, such as glucose and light signalling pathways, is examined.
27
Materials and Methods
28
2.0 Growth conditions
Arabidopsis thaliana wild type strains used in this study were Columbia (Col-0) and
Landsberg erecta (Ler). All hy, gun and pyr/pyl mutant seeds were obtained from Dr. Danielle
Vidaurre, Dr. Frederick Delmas and Dr. Shelley Lumba from McCourt lab respectively. hy1-
100, hy2-105, hy5-salk, pyr1, pyl4, pyr1/pyl4, gun1-1, gun4-1, gun5-1, and cch1-1 mutants are in
the Col background, while hy3-1 and hy4-2.23N mutants are in the Ler background. Most seeds
were surface sterilized in 70% ethanol for 10 minutes in room temperature, and they were
vacuum dried (Savant Speedvac). Seeds with heavy fungus contaminations were sterilized with
chlorine gas for 4 hours in a glass chamber, where 7ml HCl and 200mL sodium hypochlorite
were mixed. The plants were grown under continuous lights in soil (Promix 20-20-20) or on
petri plates containing 0.8% agar (w/v) supplemented with 2.2g/L Murashige and Skoog (MS)
basal culture salts (Sigma) buffered with 5mM morpholinoethanesulfonic acid (MES) (Sigma).
Plants grown on the petri plates were illuminated with either 25uE/m2/s or 50uE/m2/s light; the
latter condition was used in experiments with 18-11 mutant only. Unless stated otherwise, all
plants were imbibed at 4°C for 2 days and were grown for 6 days under light before their
phenotypes were observed.
Abscisic acid (ABA) and glucose were utilized together in most experiments. ABA stock
was made in methanol to a final concentration of 20mM. ABA stock was remade every 2 weeks.
Glucose stock was made in water to a final concentration of 40%, and it was filter sterilized
before use. Generally, MS-agar media was sterilized and allowed to cool to approximately 60°C
before ABA and glucose were added.
29
2.1 Transfer experiment
Col seedlings were initially grown on MS media before they were transferred to 100nM
ABA/4% glucose media at certain time points (points between the 24th and the 39th hour, with 90
minute spacings between each time point). 16 or 17 seedlings were transferred at each time
point. Seedlings were observed on day 4.
2.2 Sensitized screen for ABA insensitive mutants
2.2.1 Optimum screen condition
The optimum screen condition was tested by plating surface sterilized Col seeds on 24
well-plates containing both ABA and glucose. The concentrations of ABA used were 0nM,
50nM, 100nM and 250nM. The concentrations of glucose used were 0%, 3%, 4%, 5%.
2.2.2 Screen procedure
Approximately 32,000 EMS and 42,000 FN mutagenized lines (Lehle) in the Col
background were used in the first round screen. Additional 32,000 EMS lines were later
purchased for the second round screen. Approximately 1000 lines were plated on each big petri
plate (100x100x20mm Sarstedt) of 100nM ABA/4% glucose media. After 6 days on light,
individuals with green cotyledons were selected and transferred to soil in 51 well trays to
generate M3 seeds. 357 putative EMS and 204 putative FN mutants were subjected to retesting
at 100nM ABA/4% glucose. The seeds of the retested M3 lines were then plated on 2μM ABA
media and 7% glucose media to test for abi and gin mutant phenotypes respectively. Radical
emergence and green cotyledon traits were used to score for the positives in the abi and gin tests,
respectively.
30
2.2.3 Generating mapping populations
The retested EMS and FN mutants were germinated on 100nM ABA and 4% glucose
media. 4 individuals with the best mutant phenotypes from each mutant line were transferred to
a pot of soil with Ler seedling. Once a few seed siliques were formed, several flowers of the M3
mutants were fertilized with Ler pollen. To prevent self-fertilization, the stamens of the flowers
were removed. Successfully crossed flowers were covered in saran-wrap for a few days to
prevent dehydration. The harvested F1 seeds were grown on MS plates initially before being
transferred to soil for F2 progenies.
2.3 Positional cloning analysis
2.3.1 For ABA/glucose resistance mutation
The F2 population was grown on 100nM ABA and 4% glucose for 6 days. The seedlings
with green cotyledons were transferred to 51 well trays to generate the F3 population for
retesting. DNA was extracted from a leaf of each individual. To clone the mutations, a
positional cloning method described by Lukowitz et al (2000) was utilized. In the bulk
segregation analysis, 50 DNAs were mixed together to generate a pool of DNA. 22 simple
sequence length polymorphism (SSLP) markers were used in the touch-down PCR process
(Table 2.1). For the individual cloning procedure, each DNA line was used in PCR reactions
with SSLP mapping primers (Table 2.2 for 4-3).
31
Table 2.1 22 SSLP markers used for a bulk segregant analysis. These markers were designed by Lukowitz et al (2000). This data is shown here, as their supplementary data is no longer available to view on their website.
32
Chromosome Primer Name
Forward Primer Sequence Reverse Primer Sequence
F21M12 GGCTTTCTCGAAATCTGTCC
TTACTTTTTGCCTCTTGTCATTG
ciw12 AGGTTTTATTGCTTTTCACA
CTTTCAAAAGCACATCACA
ciw1 ACATTTTCTCAATCCTTACTC
GAGAGCTTCTTTATTTGTGAT
nga280 CTGATCTCACGGACAATAGTGC
GGCTCCATAAAAAGTGCACC
1
nga111 CTCCAGTTGGAAGCTAAAGGG
TGTTTTTTAGGACAAATGGCG
ciw2 CCCAAAAGTTAATTATACTGT
CCGGGTTAATAATAAATGT
ciw3 GAAACTCAATGAAATCCACTT
TGAACTTGTTGTGAGCTTTGA
nga1126 CGCTACGCTTTTCGGTAAAG
GCACAGTCCAAGTCACAACC
2
nga168 TCGTCTACTGCACTGCCG GAGGACATGTATAGGAGCCTCG
nga162 CATGCAATTTGCATCTGAGG
CTCTGTCACTCTTTTCCTCTGG
ciw11 CCCCGAGTTGAGGTATT GAAGAAATTCCTAAAGCATTC
ciw4 GTTCATTAAACTTGCGTGTGT
TACGGTCAGATTGAGTGATTC
3
nga6 TGGATTTCTTCCTCTCTTCAC
ATGGAGAAGCTTACACTGATC
ciw5 GGTTAAAAATTAGGGTTACGA
AGATTTACGTGGAAGCAAT
ciw6 CTCGTAGTGCACTTTCATCA
CACATGGTTAGGGAAACAATA
ciw7 AATTTGGAGATTAGCTGGAAT
CCATGTTGATGATAAGCACAA
4
nga1107 GCGAAAAAACAAAAAAATCCA
CGACGAATCGACAGAATTAGG
CTR1 CCACTTGTTTCTCTCTCTAG
TATCAACAGAAACGCACCGAG
ciw8 TAGTGAAACCTTTCTCAGAT
TTATGTTTTCTTCAATCAGTT
PHYC CTCAGAGAATTCCCAGAAAAATCT
AAACTCGAGAGTTTTGTCTAGATC
ciw9 CAGACGTATCAAATGACAAATG
GACTACTGCTCAAACTATTCGG
5
ciw10 CCACATTTTCCTTCTTTCATA
CAACATTTAGCAAATCAACTT
33
Table 2.2 SSLP and CAPS markers in chromosome 3. All SSLP markers generate longer Col PCR fragments than Ler. Ler PCR fragments generated with the CAPS marker (CAPS_ABI3) can be cleaved by HINF1 restrict enzyme. These markers were used for the fine mapping of 4-3.
34
Primer Name
Physical Location (Chromsome 3)
Forward Primer Sequence Reverse Primer Sequence
NGA126 3.5mb CAAGAGCAATATCAAGAGCAGC
GAAAAAACGCTACTTTCGTGG
3chr4.8m 4.8mb CGTCTCTTCAGCGAGCTTCT
GCAGTTCTGGTGGCGATTAT
3chr5.5m 5.5mb TCCTTCGCCTTATTTTCTTCC
CCATAATTCATTTCACCAACTCC
NT204 5.5mb TGGAAGCTCTAGAAACGATCG
ACCACCTAAACCGAGAATTGG
3chr6.0m 6.0mb ATTTTGGCCGCATAAAGGAT
CAACTGCCCATTTTTGAGGT
3chr6.6m 6.6mb ATTGACGTTGCCCAATTTGT
CGATGCAAAGTTTTGATTTCTG
3chr7.9m 7.9mb GAATGGGGCTCACTTAGCAA
AAGGAATTGTCACTTGCATGG
ATDMC1 8.1mb GCAACTGAATTTGTTTTCGTTTG
TTGATTAGTGGATCCGCAAACAA
3chr8.5m 8.5mb GAGATACGGTGGTTGCGATT
CTTTCCCGCACAAAATCAAT
CAPS_ABI3
9.0mb GGGCCTCCGGCTTTTGTCCGCTCGG
CCACGTCAGCAGGTGGTACCAGATC
3chr9.5m 9.5mb CCAAACAACGACGAAAAAGA
CGAATCTTGTTGGGAGGAAA
35
2.3.2 For the long hypocotyl mutation
The seedlings with similar hypocotyl lengths as 18-11 M3 were selected for the positional
cloning analysis. The degree of dominance was evaluated in several ways. First, the hypocotyl
lengths of the heterozygous individuals (F1 population of 18-11/Col and 18-11/Ler) were
measured and compared to the lengths of the homozygous mutants (18-11 M3). Second, the
percentage of individuals with the homozygous mutant phenotype in the 18-11 F2 population
(18-11/Ler) was calculated to test for a mendelian ratio. Individual positional cloning was
performed using SSLP markers (Table 2.3). HY genes in 18-11 were sequenced using HY
sequencing primers (Table 2.4)
2.4 Chlorophyll measurement
Prior to the chlorophyll extractions, the weight of 6 day-old Col, Ler, 4-3, 15-3, 18-11,
21-8, 29-1, 35-4, 35-5, gun1-1, gun4-1, gun5-1, and cch1-1 seedlings were measured. The whole
seedlings were ground in 1mL of 80% acetone with mini-pestles, and the debris was removed by
centrifuging at 13,000rpm for 5 minutes. To reduce the degradation of chlorophyll, the extracts
were covered in aluminum foils. OD663 and OD645 of the extracts were measured using a
spectrometer (BioRad SmartSpec Plus). The concentrations of chlorophyll a and b were
calculated using the following formula: Chl a = 12.7 * OD663 - 2.69 * OD645, Chl b =
22.9*OD645 – 4.68*OD663, Chl a + b = 20.2*OD 645 + 8.02*OD663. The values were
standardized by the weight of tissues used.
36
Table 2.3 SSLP markers in chromosome 1. They generate longer Col PCR fragments compared to Ler. These markers were used for the fine mapping of 18-11.
37
Primer Name
Physical Distance in (Chrosome 1)
Forward Primer Sequence Reverse Primer Sequence
20.8 20.8mb TGGGGGTTTTTCTACCCATT
CCGGACATTATTCTTTGTTGC
22 22.0mb GGATCCTTTTTCTTTCCCTTC
TGTTGGGTGTTTTAGGAGAAAA
23 23.0mb TGTATTGTCACAAAAATGCAACA
CTCGGACCCGTTACAAGAAA
24 24.0mb TCTTTCCACGGAGATTGACC
CCCGAATGAACAAACCAAAC
25 25.0mb GGCCCACTAATTGCAAACAT
AATGACATGTGGTCAACATCA
26 26.0mb TGCAAATAGTCATCTTTACGGATA
TGCAACTTTTGGTGTTTGAAG
T17F3 26.3mb AATATATTATCATTGGGAGATGTAACG
ACATGTTGGACCGACGGTTA
F24J13 26.6mb TCAGTGGCAATGGAAGCTAA
GCTCGGCTAAATGACTAAGTGG
F26A9 26.9mb ACGGTTGCATTGCATGATTA
CGCGTTTACTGTCTCATGTTTT
27 27.0mb TTGGTGAAAGAGTGTCCTTGG
CAGAATTTCAATTGCGCTTT
F25P22 27.7mb ACCCCAAGTAAGCCACTCCT
CAAGAACATAAATACATCTCTGATCTCTCT
F1M20 28.0mb GACCCATACAGAGACGGTGTG
CAGTCAAAGGCTCAAAGCTG
28.3 28.3mb CCTGAATCTCCTCTCCAAGG
ACGCTCTTAAGCTCGCTTTG
38
Table 2.4 HY sequencing primers. These primers were used to sequence HY genes in 18-11.
39
Primer Name Forward Primer Sequence Reverse Primer Sequence HY1-1 CACTCAACGCACTGTCGATATT
AC GCCCCGTGTTCTTGAACTCGG C
HY1-2 GACTCCAATTTCCCAACTTGTGAG
CATTGACTCTTCTTAGGCCCA CC
HY2-1 GAATTCCCCACGTCAACGTGA
C ATCAGTCATTTACACCTCAGC
HY2-2 CCAAGACAAGTATTATAACAAGA
GTTATGATATGTTTATGTCTGG
HY3-1 CGTGTGGCCACTAGAGA
GGCTGAATGTAACCA
HY3-2 CCGTTTTACGCCATTCTTCATAGG
GCTGGAGCGAGTGAATCGCAT CC
HY3-3 GGGGAGGCGCTAAGCATCAT
GGTCCTCGTTCAAGTCTGTGG
HY3-4 CACAGAGTGTTTCACGAAGGC
CTAGCAGTTGACAATGGTCGC
HY3-5 GCAGGTGGACAAGCCCTGAAGG
CGAAACAGCCTGGAGAGCATA C
HY4-1 CTCTCTATCAACCTCCA
AGATCTGAGAAGCACCA
HY4-2 GGGAGAGATGTCTTAGTATGCC
GAGACGACTCTTCGTCTTCTTC
HY4-3 CCATGGAGATGGGGGATGAAG
CAGTCCAACCAGATTTCACCGG
HY4-4 CGTCGATGCGCGTTGTGCTTGGC
AAAGAGAGAGAAGGAGAAGGA TC
HY5-1 ATCCATGGCGACTTGTCTGTAA
G CGGCGAGTGCCGGAGTTTGG
HY5-2 CTGAAGAGTAGAGAGTCGCTC
GGGGCCCACCCAATTAGCTC
40
2.5 RNA extraction and RT-PCR
Col, Ler, 4-3, 15-3, 18-11, 21-8, 29-1, 35-4, 35-5, gun1-1, gun4-1, gun5-1, and cch1-1
seedlings were grown on 5μM norflurazon for 5 days. The seedlings were frozen with liquid N2
and ground by mortar and pestle. RNAs were extracted using RNAqueous Kit (Ambion 1912)
with Plant RNA Isolation Aid (Ambion 9690). Only DEPC treated water was used in this
experiment. RNAs were treated with DNaseI (Fermentas) at 37°C for 1 hour to remove DNA
contamination. DNaseI was deactivated at 65°C for 10 minutes. RNAs were precipitated by
pretreating with LiCl at -20°C overnight then centrifuging at 13,000rpm for 15 minutes at 4°C.
The RNA pellet was washed with 70% ethanol and resuspended in DEPC water. RNA
concentration was measured by spectrometer (GeneQuant Pro). cDNA templates were
constructed from 300ng of RNA using a reverse-transcriptase (Invitrogen Superscriptase II)
according to the instructional manual. Oligo(dT)12-18 (500ug/ml) and RNase inhibitor
(Fermentas) were used. The cDNAs were used in regular PCR processes with Actin, rbcS, rbcL,
and Lhcb 1.2 primers. The relative levels were observed using DNA electrophoresis.
2.6 Blue, red and far-red light sensitivity in 18-11
Col, Ler, 18-11, hy1-100, hy2-105, hy3-1, hy4-2.23N and hy5-salk seeds plated on MS
plates were chilled at 4°C for 2 days. The plates were placed under white light (50uE/m2/s) for 1
hour (or 1 day for far-red light) before they were transfered to a light chamber with a blue, a red,
or a far-red LED light condition (12.5uE/m2/s) (Percival). The hypocotyl lengths of the
seedlings were observed on day 6.
41
2.7 Germination rate of 18-11 under far-red or dark
Col, Ler, 18-11, hy1-100, hy2-105, hy3-1, hy4-2.23N and hy5-salk seeds plated on MS
plates were chilled at 4°C for 2 days. For the far-red condition experiment, the plates were
placed under white light (50uE/m2/s) for 1 hour before transferring to a far-red light chamber.
For the dark condition experiment, the plates were wrapped in aluminum foil and were chilled at
4°C for 2 days. The plates were transferred to room temperature, and the seedlings were grown
in a dark condition for 6 days. The germination rates of both experiments were scored based on
the radical emergence.
2.8 Ecotype variation
65 ecotypes (Table S1) were grown on 100nM ABA/4% glucose media for 6 days. The
presence of green cotyledons was the criterion for ABA/glucose resistance. To explore the
difference between Col and Ler, Col with an erecta mutation and Landsberg without an erecta
mutation were utilized. These lines were generated as previously described (Masle et al 2005,
Godiard et al 2003).
2.9 Molecular techniques
2.9.1 DNA extraction
First, the leaf tissue was ground by 3mm borosilicate glassbeads in the mini-beadbeater
(Biospec). DNA extraction buffer (250mM Tris-HCl pH7.5, 250mM NaCl, 25mM EDTA, 0.5%
SDS) was added to the ground tissues. This was then centrifuged at 14,000rpm for 10 minutes.
The supernatant was mixed with isopropanol at 1:1 ratio, and they were subjected to 10 minutes
42
of centrifugation at 14,000rpm. The pellet was washed with 70°C ethanol and was resuspended
in 1X TE (pH 8).
2.9.2 DNA electrophoresis
Typically, 1% agarose gel (w/v) was used to visualize DNA bands. Agarose (Bioshop)
was melted in a 0.5x TAE buffer with ethidium bromide (0.5ug/ml). DNA was mixed with a
DNA loading dye (40% glycerol or 40% sucrose + bromophonol blue) prior to loading. DNA
bands were separated in an electrophoresis machine (Mupid-exU) at 100V for 25 minutes. DNA
bands were observed using a UV viwer (UVP MultiDoc-It Digital Imaging System).
For positional clonings, 4% agarose gels were used. The typical electrophoresis setting was
100V for 50 minutes.
2.9.3 Touch-down PCR
The touch-down PCR procedure was only used during the positional cloning analysis.
The PCR conditions were 1 cycle at 95°C for 1 minute, followed by 15 touch-down cycles of
95°C for 30 seconds, the touch-down annealing temperature for 30 seconds and 72°C for 30
seconds, and 40 regular PCR cycles of 95°C for 30 seconds, 50°C for 30 seconds and 72°C for
30 seconds, and then 72°C for 5 minutes. The touch-down annealing temperature was started at
65°C and gradually decreased by 1°C after each cycle. PCR was performed using either MJ
Research Gradient Cycler or Biometra Tgradient machines.
43
Results
44
Effects of ABA and glucose on Arabidopsis
As previously demonstrated by Cheng et al (2002), ABA and glucose may work
synergistically to inhibit the early developments of Arabidopsis seedlings (Figure 3.1a). They
have shown that 100nM ABA can cause severe development inhibition in young seedlings
grown on 4% glucose media. I decided to investigate this ABA signalling pathway that involves
low amount of ABA.
In order to verify Cheng et al (2002)’s result, I compared wild type Col and Ler with
several ABA mutant seeds (abi1-1, abi2-1, abi3-8, abi4-5, abi5-6, aba2-2) on MS, 4% glucose
alone, or 100nM ABA and 4% glucose media. After imbibed at 4°C for 2 days, the seeds were
subjected to constant light condition for 6 days. On 4% glucose media, Col seedlings did not
show any obvious developmental defect (Figure 3.1b). Col seedlings that were grown on 100nM
ABA and 4% glucose media, however, showed severe defects with respect to cotyledon,
hypocotyl, and root tissues. Seedlings did not produce green cotyledons but instead showed
white cotyledons with purple pigments (anthocyanin) on the outer edges or margins. The
cotyledons typically did not expand properly and were generally oval in shape. The seedlings
also showed shorter hypocotyls and root tissues than the ones on MS media. Finally, the
germination rate was also slower for seedlings imbibed on 100nM ABA and 4% glucose media.
In contrast, ABA insensitive mutants did not show these defects when grown on the same
media (Figure 3.1c). Also, some ABA insensitive mutants were able to form green cotyledons
when grown on 7% glucose media (Figure S1). Although aba2-2 germinated on 100nM ABA
and 4% glucose media did not look any different from Col, it showed more resistance to the
inhibition if ABA concentration was lowered to 75nM (data not shown).
45
Figure 3.1. Effect of ABA and glucose on young seedlings. ABA and glucose act synergistically to inhibit the post-germination growth. a) Current proposed model of how ABA and glucose inhibit the early seedling development. Both ABA-dependent and ABA-independent pathways are involved in this process. b) 6 day-old Col seedlings on MS, 4% glucose, and 100nM ABA & 4% glucose media. Col seedlings on 4% glucose media developed larger cotyledons and longer hypocotyls. Col seedlings on 100nM ABA/4% glucose did not form green cotyledons, and they had shorter hypocotyls and primary roots. c) ABA signalling mutants are resistant to the ABA/Glucose growth inhibition. All seedlings were grown on 100nM ABA & 4% glucose media. While Col and Ler seedlings did not develop any green cotyledon, abi mutants developed green cotyledons. Col and Ler also had very short hypocotyls and primary roots. All seedlings shown in this figure were 6 days old. All red bars are 1mm in scale.
46
a)
Glucose
b) MS 4% glucose 100nM ABA & 4% glucose
c) Col Ler abi1-1 abi2-1
abi3-8 abi4-5 abi5-6
HXK1 ABA
ABA Signaling
Post-germination Growth
47
Designing a sensitized screen
When designing a sensitized screen that uses two or more chemicals, the concentration
for each chemical used had to be calibrated to generate the best mutant phenotype. So the best
concentrations of ABA and glucose for this screen were measured. Col seeds were plated on the
media containing various concentrations of ABA and glucose (Figure 3.2). The following
combinations were able to trigger the developmental inhibition: 500nM+ ABA and 3% glucose,
100nM+ ABA and 4% glucose, or 50nM+ ABA and 5% glucose. For the sensitized screen,
100nM ABA and 4% glucose combination was chosen for the two reasons. Firstly, the young
seedlings had poor growth on 5% glucose media. Secondly, 500nM ABA was considered to be
rather high for this screen. Minimal concentrations of ABA and glucose were desireable since I
wanted to isolate new ABA signalling genes that were not previously identified using higher
concentration of ABA or glucose.
Strength of this sensitized screen
Recently, several ABA receptor mutants were identified. Using ABA receptor mutants,
pyr1-1 and its homolog pyl4-1, I have evaluated whether the screening method is suitable to
identify novel ABA signalling genes, including a novel ABA receptor. When pyr1-1 and pyl4-1
were grown on 100nM ABA and 4% glucose media, some seedlings were able to form green
cotyledons (Figure 3.3). When double mutants of pyr1-1 and pyl4-1 were grown on the media,
more individuals with green cotyledons were observed. This demonstrated the merits of this
screening method.
48
Figure 3.2 Optimal conditions for the screen. In order to find the best screening condition, Col seedlings were germinated on MS medium containing various concentrations of ABA and glucose. Seedlings failed to develop green cotyledons on several conditions. Among these, one condition (100nM ABA and 4% glucose) was chosen for the screen. Seedlings shown were 6 days old. Red bar is 1cm in scale.
49
0% 3% 4% 5% [glucose] 0nM 50nM
100nM
250nM 500nM [ABA]
50
Figure 3.3. pyl4 can develop green cotyledons on the screening condition. pyr1, pyl4, and pyr1/pyl4 double mutants were grown on 4% glucose/100nM ABA (right panel). pyl4 showed some resistance to sugar/aba. Although pyr1 did not form any green cotyledons, double mutants of pyr1/pyl4 showed greater resistance compared to pyl4. Numbers in brackets represent the number of individuals with green cotyledons over the total number of seedlings. All of them can develop green cotyledons on 4% glucose media (left panel). All seedlings shown were 6 days old. All red bars are 1.5mm in scale.
51
pyr1
pyl4
pyr1/pyl4
Col Col (0/27)
pyr1 (0/18)
pyl4 (7/22)
pyr1/pyl4 (14/24)
4% glucose 4% glucose/100nM ABA
52
Factors that influence ABA and glucose effects
Because the phenotypic variation that I was observing would make subsequent
characterization and potential mapping of genes problematic, I decided to determine more
stringent conditions to tighten up the phenotypes. For that reason, the factors that may influence
the ABA/glucose effect on young seedlings were investigated. It has been shown that an internal
ratio of carbon and nitrogen affects plant growth (Paul and Driscoll 1997, Coruzzi and Zhou
2001). Because all plant media used in the project contained MS salts, the effect of MS salts was
evaluated. Col and Ler seeds were plated on 40nM ABA and 4% glucose media with or without
MS salts. The seedlings on the media containing MS generally had a normal growth. However,
in the absence of MS salts, the seedlings developed a similar phenotype as if they were grown on
100nM ABA and 4% glucose media (Figure 3.4a). Few Ler seedlings on the media without MS
were able to form longer roots than Col. I also tested whether light condition affects the
ABA/glucose-induced developmental inhibition. Col seeds were grown on 3% or 4% glucose
media, containing various concentrations of ABA (0nM – 100nM), for 6 days in the presence or
absence of light. Because the seedlings in the dark environment formed etioplasts instead of
chloroplasts, I could not score the developmental inhibition with cotyledon colour. Instead,
hypocotyl length was used in this experiment. Figure 3.4b shows the result of Col on 3%
glucose media with different concentration of ABA. Without light, Col seedlings started to form
short hypocotyls at 30nM ABA. In the presence of light, normal hypocotyl length was observed
at 50nM ABA.
53
Figure 3.4. Factors that enhances the ABA and glucose effect. a) Higher nitrogen concentration reduces the ABA and glucose effect. Col and Ler seedlings were germinated on 4% glucose and 40nM ABA medium with and without ½x MS. The seedlings on the MS medium developed green cotyledons and long hypocotyls. b) Hypocotyl elongation inhibition by ABA/glucose is influenced by light conditions. Col seedlings were germinated on 3% glucose medium with various concentrations of ABA. These seedlings were then grown in presence or absence of light. In dark, 30μM ABA was sufficient to cause severe reduction in hypocotyl elongation. Seedlings with light, however, did not show hypocotyl reduction until 100μM ABA is added. All seedlings shown in this figure were 6 days old. All red bars are 2.5mm in scale.
54
a) With MS Without MS
Col Ler b) 10nM 20nM 30nM
DARK 40nM 50nM
50nM 100nM
LIGHT
55
Ecotype variation between Col and Ler
In general, a mutant in the Col background is usually crossed with Ler to generate a
mapping population. This is because the genomes of both Col and Ler seedlings have been
sequenced, and their sequence database is easily accessible to generate appropriate mapping
markers. As mutant lines to be used in the screen are in the Col background, I decided to
investigate if Ler seedlings behave differently to the ABA and glucose effect. Although both Col
and Ler seedlings did not develop green cotyledons on 100nM ABA and 4% glucose media, they
did show variable phenotypes on a population basis when ABA concentration was lowered
(Figure 3.5a). Because these differences were hard to observe on 4% glucose media, 3% glucose
was used for subsequent dose-curve experiments. Both Col and Ler seeds were plated on the
media containing different ABA concentrations, ranging from 30nM to 70nM. Under these
conditions, more Col individuals had green cotyledons than Ler (Figure 3.5b).
Because the Ler seedlings used in the experiments had the erecta mutation, the effect of
this mutation on ABA/glucose-induced inhibition was evaluated. Col with the erecta mutation
and Landsberg without the erecta mutation were grown on 40nM ABA and 4% glucose media.
In this experiment, only cotyledon colour trait was scored. Interestingly, the seedlings with the
erecta mutation were generally more resistant to the inhibition than the ones without (Figure
3.5c). Therefore, the effect of ABA/glucose on young seedlings indeed was influenced by the
erecta mutation. However, since both ecotypes without the mutation still had different responses
to ABA/glucose, this natural variation could not be explained with the erecta mutation.
I also investigated if other ecotypes behave differently on 100nM ABA and 4% glucose
media. Some ecotypes showed natural resistance to the ABA and glucose effect (Table S1).
56
Figure 3.5. Natural variation between Col and Ler. Col and Ler show different sensitivity to ABA and glucose. a) Duplicated plates with 40nM ABA and 4% glucose medium. More Col seedlings (left-side) developed green cotyledons than Ler seedlings (right-side). Red bar is 1cm in scale. b) Dose-curve of Col and Ler resistances to the ABA and glucose effect. c) erecta mutation enhances the resistance to the growth inhibition by ABA and glucose. All seedlings shown in this figure were 6 days old. Red bar is 2mm in scale.
57
a) Col Ler Col Ler
b)
c) Without erecta mutation With erecta mutation Col Ler
58
Isolation of ABA insensitive mutants.
Because it was hard to measure the hypocotyl length of each seedling, we used the
cotyledon colour trait to select the putative mutants in this screen (Figure 3.6a). As illustrated in
Figure 3.6b, approximately 56,000 EMS and 42,000 FN lines in the Col background were used
in this screen. About 1000 seeds were plated in a 15cm diameter petri plate containing 100nM
ABA and 4% glucose. After 6 days, seedlings with green cotyledons were transferred to a
growth chamber and grown for seeds. From this screen a total of 357 EMS and 204 FN putative
mutants were identified.
There were two groups of mutants that I expected to isolate from this screen. The first
ones were glucose insensitive –like (gin) mutants, as 100nM ABA would not cause any
developmental defects to those that cannot sense 4% glucose. The other ones were ABA
insensitive –like (i.e. abi1-abi5) mutants that were previously identified from various
germination assays that used high concentrations of ABA. All five abi mutants formed green
cotyledons on the screening condition (Figure 3.1c). I had no interest in working on either gin-
like or abi-like mutants that are isolated from this screen, as they are probably alleles of known
gin or abi mutants.
To eliminate these mutants I used a two-step process. First, mutant lines identified on my
primary screen were replated on 2μM ABA media and any ABA insensitive mutants were
removed. Second, mutant lines were re-tested on 7% glucose media for good growth, and any
lines with gin-like phenotypes were removed. After the above selections and retesting on the
screening condition for green cotyledons, 15 EMS and 24 FN putative mutants were selected.
These remaining mutant lines were crossed with Ler to generate the F2 populations, which
59
Figure 3.6. Screening process for isolating ABA signalling mutants. a) Sample pictures of putative ABA insensitive mutants on 4% glucose and 100nM ABA medium. The whole plate picture is shown on the top. Red arrows point to the putative mutants that had green cotyledons. Seedlings shown were 6 days old. b) Overview of the screening process. 32,000 EMS and 42,000 Fast Neuron (FN) lines were germinated on 4% glucose and 100nM ABA. During the retest process, the putative mutants were germinated on 7% glucose and/or 2μM ABA media to eliminate glucose insensitive (gin) and aba insensitive (abi) mutants, respectively. Total of 15 EMS and 24 FN mutants were isolated.
60
a) b)
61
would be used for mapping the mutations. Due to time constraints, I could not map all 39 mutant
lines and therefore decided to focus in a subset with interesting phenotypes. The action of the
ABA and glucose effect was investigated to assess what type of genes could possibly be isolated
from the screen (see below). 4-3 and 18-11 lines were chosen as they showed gun-like and hy-
like phenotypes respectively.
ABA & glucose target a specific process in young seedlings
Col seedlings grown on three different combinations of ABA and glucose concentrations
(750nM ABA and 2% glucose, 100nM ABA and 4% glucose, and 7% glucose alone), all showed
albino phenotypes by day 7 (Figure 3.7a). However, by day 24, different phenotypes were
observed and the degree of recovery from the ABA/glucose-induced developmental inhibition
was different for each condition (Figure 3.7a). The seedlings on 750nM ABA and 2% glucose
media recovered and grew normally by day 24. The seedlings on the screen condition (100nM
ABA and 4% glucose) showed partial root tissue recovery by day 24, but under this condition,
seedlings were still not able to form green cotyledons or true leaves. On 7% glucose media, the
seedlings did not show any recovery regardless of time. These results suggest that the different
combinations of ABA/glucose may target different developmental processes. The screening
condition may be targeting the greening process in cotyledons specifically.
To investigate the possibility in more detail, mRNA transcription of a variety of light
signalling genes was monitored using RT-PCR. RNA samples were extracted from the 7 day-old
Col grown on 750nM ABA/2% glucose, 100nM ABA/4% glucose, or 7% glucose media. After
cDNA template constructions, rbcS, rbcL, Lhcb1.2 mRNAs were amplified using PCR. Actin
62
Figure 3.7. Effect of different combinations of ABA and glucose concentrations. Different combinations may affect different biological processes during the early seedling development. a) While different combinations of varying ABA and glucose concentrations can inhibit the early growth development (day 7), they may affect different processes. After 24 days, the seedlings on 750nM ABA and 2% glucose medium were able to recover from the growth inhibition. The seedlings on 100nM ABA and 4% glucose medium had only the root recovered. No green cotyledons or true leaf was observed on those seedlings. b) ABA and glucose reduces photosynthetic-associated nuclear gene expression. The mRNA levels of both subunits of Rubiscos (rbcL and rbcS) were slightly by all three combinations of ABA/glucose. 750nM ABA and 2% glucose had a weaker inhibition on Lhcb1.2 transcription compared to 100nM ABA/4% glucose or 7% glucose alone. Actin mRNA was used as a control. c) The growth inhibition by ABA and glucose must be triggered during a specific timeframe of developments. Col seedlings were transferred from MS medium to 100nM ABA/4% glucose medium at different time points. Seedlings that were 34.5hrs old or younger did not develop green cotyledons when transferred. Seedlings that were 36hrs old (or older) were able to develop green cotyledons after the trasfer. Seedlings shown were 4 days old.
63
a) MS 750nM/2% 100nM/4% 7% Day 7 Day 24 b)
MS 750nM/2% 100nM/4% 7%
Lhcb1.2
rbcL
rbcS
Actin
c) Time of Transfer: 25.5hr 28.5hr 31.5hr
(albino # / total #): (16/16) (16/17) (12/16)
33hr 34.5hr 36hr
(14/17) (12/17) (0/16)
64
was used as a loading control. Lhcb1.2 transcription was highly inhibited by 100nM
ABA/4%glucose and 7% glucose, whereas only a weak inhibition was noticed in the 750nM
ABA/2% glucose sample (Figure 3.7b). rbcS and rbcL transcription levels were slightly reduced
by all three combinations of ABA and glucose.
Since the transcription of light signalling genes were affected, I decided to investigate if
retrograde signalling could also be affected by ABA and glucose. Chloroplasts send retrograde
signals to the nucleus to regulate the development of chloroplasts, since most chloroplast
proteins are encoded by nuclear genes. One of the retrograde signalling pathways, called PGE, is
only active for 3 days after germination (Oelmuller et al 1986). I tested if the ABA/glucose-
induced inhibition worked during this timeframe. Col seedlings were initially germinated on MS
media. They were then transferred to 100nM ABA/4% glucose media at various time points.
When the seedlings were transferred at or before 34.5 hours post-stratification, the development
of the seedlings was inhibited (Figure 3.7c). However, when transferred at 36hrs or later time
points, the seedlings could grow normally. Therefore, the developmental processes affected by
ABA and glucose may be only active before 36 hours post-stratification. As this timeframe is
similar to the PGE-active timeframe, it is possible that ABA and glucose are affecting PGE
retrograde signalling.
Isolation of gun-like mutants
gun mutants were extensively studied in retrograde signalling studies. The common
phenotypic characteristic of gun mutants is a higher level of Lhcb1.2 mRNA in the presence of
chemicals that inhibit carotenoid biosynthesis, such as norflurazon, compared to wild type
treated seedlings. Because the results of the above experiments suggest that retrograde signalling
65
could be affected by ABA and glucose, I decided to see if any gun-like mutants were identified
in my screening process. Several mutants (4-3, 15-3, 18-11, 21-8, 29-1, 35-4 and 35-5) were
grown on the media containing 5μM norflurazon for 5 days. Their mRNAs were extracted, and
RT-PCR was performed with Lhcb1.2 primers. Mutant lines 4-3, 15-3, 29-1, 35-4, and 35-5 all
expressed a similar level of Lhcb1.2 as known gun mutants while 18-11 and 21-8 had a similar
expression level as Col or Ler (Figure 3.8a).
As many gun mutants show abnormal chlorophyll levels, I tested the mutant collection
for alterations in chlorophyll accumulation. Chlorophylls (a/b) of each mutant were extracted by
grinding the 6 day-old samples in 80% acetone. OD663 and OD645 were measured using a
spectrometer, and the chlorophyll a/b concentrations were calculated. The chlorophyll a/b levels
in 4-3 and 18-11 were comparable to those in gun mutants (Figure 3.8b). Interestingly, 21-8 and
29-1 expressed a very high level of chlorophyll b.
Finally, if ABA and glucose had indeed been affecting the retrograde signalling, then it
was possible that gun mutants may behave differently on 100nM ABA and 4% glucose. To test
this, gun1-1, gun4-1, gun5-1, and cch1-1 (an allele of gun5) were grown on 100nM ABA and 4%
glucose media for 6 days. Although all seedlings had very short hypocotyls, some variations in
cotyledon colour were observed (Figure 3.8c). Unlike Col, gun1-1 and gun4-1 showed some
resistance to the growth inhibition by developing green cotyledons. gun5-1 and cch1-1,
however, did not show green cotyledons under these growth conditions. Based on this result, it
is likely that ABA and glucose are affecting the retrograde signalling.
66
Figure 3.8. Isolation of retrograde signalling mutant. Some gun-like mutants were isolated from the 100nM ABA/4% glucose screen. a) Lhcb1.2 mRNA expression level in various putative mutants were detected by RT-PCR. The seedlings were grown on MS or 5μM norflurazon mediums for 5 days before mRNA was extracted. Some EMS (4-3 and 15-3) and FN (29-1, 35-4, and 35-5) mutants had similar Lhcb1.2 expression level as other gun mutants (gun1-1, gun4-1, cch1-1) in presence of 5μM norflurazon. Col, Ler, and some EMS mutants (18-11 and 21-8) had much lower Lhcb1.2 expression than the gun mutants. b) Chlorophyll accumulation of the gun and putative ABA insensitive mutants. Blue bar indicates the chlorophyll A amount while red indicates the chlorophyll B. Seedlings were germinated on ½ MS plates. 3 sets of seedlings were used for the chlorophyll extraction. Chlorophyll amounts were standardized based on the fresh weight of seedlings (µg chlorophyll / mg fresh weight per 1ml of acetone). Error bar shows standard error in chlorophyll A level (Chl A). Error bars of Chlorophyll B are not shown, as they overlap with the other error bars. Red asterisk represents the statistically significant data compared to Col (P>0.05) c) gun1-1 and gun4-1 mutants can develop green cotyledons on 4% glucose / 100nM ABA. gun5-1 and cch1-1 (allele of GUN5) had white cotyledons like Col seedlings. The bracket shows the number of seedlings with green cotyledons out of the total seedlings number (n=20). Seedlings shown were 6 days old. Red bar is 1mm in scale.
67
a) MS 5uM norflurazon Col Col Ler 18-11 gun1-1 gun4-1 gun5-1 cch1-1 4-3 18-11 21-8 29-1 35-4 35-5
Lhcb1.2
Actin
b)
c) Col (0/20)
gun1-1 (9/20)
gun4-1 (10/20)
gun5-1 (0/20)
cch1-1 (0/20)
68
The mutation responsible for this gun phenotype is located in chromosome 3
The mutation in line 4-3 was chosen because it showed abnormal activities in retrograde
signalling as measured by the Lhcb1.2 gene expression, and also because this line had
abnormally low chlorophyll levels. To clone the mutation conferring the 4-3 phenotype, I first
did bulk segregation analysis to determine a chromosomal location (Lukowitz et al 2000). In
order to use this method, the degree of dominance of the mutation has to be calculated. There
are two ways to calculate this: a) look at the F1 population to see if the mutant phenotype is
masked by WT gene, or, b) look at the F2 population to calculate the percentage of the
individuals with the mutant phenotype. The latter option was chosen. Because less than 15% of
F2 seedlings (4-3 x Ler) had green cotyledons on 100nM ABA and 4% glucose media, the
phenotype was most likely recessive. The lack of a clear mendelian ratio (i.e. 25%) in this
population may be because the ABA concentration in the media was not accurately determined.
It was possible to reach the 25% ratio of mutant to wild type phenotype if ABA concentration
was lowered. However this lower concentration can lead to a higher false positive rate, and
therefore was not pursued.
To perform bulk segregation analysis approximately 50 DNA samples from the selected
F2 seedlings were pooled together. They were then subjected to a PCR process with 22 SSLP
markers (Table 2.1). However, I was unable to identify the chromosome with this method
(Figure 3.9a). So 13 individual DNA lines were selected and PCR was performed individually
with 10 SSLP markers. The SSLP markers were chosen in a way that both arms of all five
chromosomes were covered. After the individual PCR results, I concluded that the mutation was
located in chromosome 3 (Figure 3.9b). This chromosome contains GUN4, which is located at
21.9Mb. Because of the map location, the GUN4 gene was sequenced from 4-3 M3 seedlings
69
Figure 3.9. Positional cloning analysis of 4-3. a) Bulk segregation analysis on the 3rd chromosome of 4-3. Red dot presents the Col DNA band. b) Individual analysis result of 4-3. Region between 1.9Mb and 18.9Mb of chromosome 3 is shown. Electrophoresis data with first 13 samples is shown on the top. Heterozygous (first lane), Col (C) and Ler (L) DNA were used as controls. The data of 109 F2 lines are shown on the bottom. While 29 F2 lines (upper) suggest that the mutation is located towards 1.9mb, 22 lines (bottom) suggest that mutation is located towards 18.9Mb. Yellow lines at the very top and 29 red lines (middle) do not show in which direction the mutation is located in. Yellow, red and grey bars represent Col homozygous, heterozygous (Col / Ler) and Ler homozygous data, respectively.
70
a)
4-3 F2 bulk
Col x Ler F
1
71
b) + C L 1 2 3 4 5 6 7 8 9 10 11 12 13
C C C C C C C C
C C C C C C C
C C C
(8/13)
(7/13)
(3/13)
72
but no mutation was found in the coding region. Further mapping analysis with 130 DNA lines
suggested that the mutation was located between nga162 (located at 4.6mb) and ciw11 (located
at 9.7mb) markers (Figure 3.9b). Several SSLP markers on the upper arm of chromosome 3
were designed to pinpoint the specific location of the mutation (Table 2.2). However, I was
unable to clone the mutation, as the ratio of Col:Ler did not go higher than 60% on all SSLP
markers.
This failure to narrow down the mutant interval could be because the selection of mutant
F2 lines was not stringent enough and the population contained too many false positives.
Although retesting the F3 progenies could have helped to identify the false positives, this
approach would have taken several months to finish and was beyond the time limits of this study.
Therefore, I decided to identify the source of the high false positive rate. I had concluded that
the mutant 4-3 phenotype may not be truly recessive. To re-verify this, the F1 population (4-3 x
Ler) was grown on 100nM ABA and 4% glucose media. As several F1 seedlings had green
cotyledons, I concluded that 4-3 phenotype was semi-dominant (Figure 3.10). Because the
genetics of this line appeared to be complex, I stopped the mapped based cloning as it would be
very difficult to only select the homozygous individuals from the F2 population.
Isolation of a long hypocotyl mutant
One of the tissues affected by ABA and glucose is the hypocotyl. In the presence of
ABA and glucose, the hypocotyl length can be reduced to as little as half its length on minimal
media (Figure 3.1b). Recently, interaction between ABI5 and HY5 has been reported (Chen et al
2008). Most HY genes are involved in light perception processes, and mutations in HY cause a
loss in the photoinhibition of hypocotyl elongation. Therefore, I was intrigued when a long
73
Figure 3.10. 4-3 mutation is semi-dominant. 4-3 M4 (left), 4-3xCol F1 (mid) and Col (right) seedlings were germinated on 100nM ABA/4% glucose media. Many 4-3 M4 seedlings developed green cotyledons whereas Col seedlings did not. Some 4-3 F1 seedlings also developed green cotyledons. Seedlings shown were 6 days old. Red bar is 1cm in scale.
74
Col 4-3 x Col (F1) 4-3 M4
75
hypocotyl mutant was isolated from the screen. This mutant, labelled 18-11, had a long
hypocotyl when grown on MS media (Figure 3.11a). 18-11 had a similar hypocotyl length as
other hy mutants (Figure 3.11a). 18-11 was, however, unable to form any long hypocotyl on
ABA and glucose media.
According to Figure 3.8, this mutant had much lower chlorophyll contents, but it did not
express Lhcb1.2 mRNA under 5μM norflurazon. This suggests that 18-11 may be a general
light-signalling mutant, but not a gun mutant (hy1 or hy2). To further evaluate the long
hypocotyl mutant I tested the phenotypes of known hy mutants on ABA and glucose. Several
loss-of-function in hy1 (hy1-102), hy4 (hy4-2.23N) and hy5 (hy5-salk) were plated on 100nM
ABA and 4% glucose media. Some of the hy4 and hy5 seedlings showed a pale green cotyledon
phenotype that suggested they were weakly resistance to ABA and glucose (Figure 3.11b). This
result suggests that 18-11 is defective in light perception. Interestingly, as with 18-11, none of
the hy mutants was able to form a long hypocotyl on this media.
Because the cotyledons of hy4 and hy5 were pale rather than green, it is possible that
their photosynthesis efficiencies was decreased. I therefore tested to see if the shorter hypocotyls
in the 18-11 line and the hy mutants were caused by the lack of energy needed for hypocotyl
elongation by plating these lines on 5μM norflurazon media. Even in the absence of green
pigments, 18-11 was able to form a relatively long hypocotyl compared to the Col seedling
control (Figure 3.11c). Hence, I do not believe perturbed photosynthesis is the reason for the
short hypocotyl phenotype.
76
Figure 3.11. Isolation of a putative hy mutant. a) A mutant with long hypocotyls (18-11) was isolated from the ABA/glucose screen. 18-11 had similar hypocotyl length as other hy mutants under 25μE/m-2/s light condition. Each bar represents the mean hypocotyl length of 6 day old seedlings (n≥ 20) ± standard deviation (SD). A sample picture of each seedling is shown on the bottom. Red bar is 1cm in scale. b) hy mutants on 4% glucose / 100nM ABA. Although hy1-102 failed to develop green cotyledons, hy4-223M and hy5-salk developed pale-green cotyledons. All hy mutants and 18-11 had a short hypocotyl under this condition. Red bar is 1mm in scale. c) Lack of or reduction of green pigments (i.e. chlorophyll) is not responsible for the short hypocotyl phenotype seen on the 100nM ABA/4% glucose condition. 6 day-old Col and 18-11 that were grown on 5μM norflurazon had no green cotyledons. 18-11 developed long hypocotyls on this condition. All seedlings shown in this figure were 6 days old. Red bar is 1mm in scale.
77
a)
Col 18-11 hy1-100 hy2-105 hy4-2.23N hy5-salk
Col 18-11 hy2 hy5 Ler hy1 hy3 hy4
1cm
-100 -salk -100 -1 -2.23N
78
b) hy1-100 hy4-2.23N hy5-salk 18-11 Col c)
79
18-11 has multiple light perception defects
To determine the nature of the 18-11 hypocotyl phenotype, all five HY genes (HY1-HY5)
in 18-11 were sequenced (Table 3.1). No mutation was detected in any of these HY genes.
However, only intron and exon regions were sequenced. Mutations in the promoter region of HY
genes could have caused long hypocotyls in 18-11 seedlings. As sequencing data alone was not
sufficient to rule out the possibility, more experiments were carried out. (Note: I did not
sequence HY8 since hy8 mutants only have long hypocotyls in far-red light and is relatively
normal in terms of seedling development under white light)
As many hy mutants have defects in blue and/or red light perception, I tested if 18-11 had
a similar phenotype as other hy mutants. 18-11 and the other hy mutants were plated on MS
plates and after 2 days in 4°C for the seed imbibition, the seeds were treated with white light for
1 hour to induce germination. Then the seedlings were transferred to blue and red light
chambers. Under blue light, 18-11 had a long hypocotyl like hy5-salk, but it was not as long as
hy4-2.23N (Figure 3.12a). Because 18-11 had a much longer hypocotyl than Col, I concluded
that 18-11 was a weak blue-light insensitive mutant. Similarly, under red light, 18-11 again had
a longer hypocotyl than Col (Figure 3.12b). Its hypocotyl length was similar to that of hy4-
2.23N. As the hypocotyl was not as long as hy1-100 or hy3-1, I concluded that 18-11 was a weak
red-light insensitive mutant.
The only mutants that have long hypocotyls on both light conditions are hy4 and hy5
(Koornneef et al, 1980). Since 18-11 did not behave like hy4 under blue light, 18-11 could be an
allele of hy5 mutant. Since hy5 mutants also have long hypocotyls under the constant far-red
light condition, I tested if 18-11 behaves in a similar fashion under far-red light. Since far-red
light inhibits the germination, the seeds were placed under white light for 1 day to induce
80
Table 3.1 Five HY sequences in 18-11 lines. Five HY genes were sequenced to verify that 18-11 is a novel HY gene. A point mutation was found in 3’-UTR region of HAB1.
81
Gene Sequenced Mutation Found (Y/N) Location of Mutation (Exon/Intron/UTR)
HY1 N N/A HY2 N N/A HY3 N N/A HY4 N N/A HY5 N N/A
HAB1 Y 3’-UTR
82
Figure 3.12. 18-11 has light sensitivity defects. a) All seedlings were grown under constant blue light (12.5μM/m2/s). Although 18-11 seedlings had much longer hypocotyls than Col, they was not as long as hy3-1. 18-11 had a similar hypocotyl length as other hy mutants. For each line, longest (left) and shortest (right) seedlings were shown. b) All seedlings were grown under constant red light (12μE/m-2/s). Although 18-11 had a much longer hypocotyl than Col, it was not as long as hy3-1 or hy1-100. 18-11 had a similar hypocotyl length as hy4-223M mutant. For each line, longest (left) and shortest (right) seedlings were shown. c) 18-11 and Col seedlings were grown under constant far-red light. 18-11 generally had much longer hypocotyl than Col. d) 18-11 can germinate under the constant far-red light. Many hy mutants and Col could not germinate under the constant far-red light. 18-11 had a high germinate rate and hy3-1 and Ler had a moderate germinate rate under the far-red light. e) 18-11 can germinate in absence of light. 18-11 and Col seedlings were able to germinate in absence of light, where other seedlings had no or very poor germination rates. All seedlings shown in this figure were 6 days old. All red bars are 1cm in scale.
83
a)
Col Ler 18-11 hy1- hy2- hy3-1 hy4- hy5-salk 100 105 2.23N b)
Col Ler 18-11 hy3-1 hy4- hy1-100 2.23N
84
c)
18-11 Col d)
e)
18-11
hy5-salk
hy1-100 Ler
Col
1cm
hy2-105
hy4-2.23N hy3-1
18-11
hy5-salk
hy1-100 Ler
hy2-105
Col
hy3-1 hy4-2.23N
85
germination before transferring them to a far-red light chamber. As expected, 18-11 had longer
hypocotyls than Col (Figure 3.12c), but they were not as long as hy1-100, hy2-105, or hy5-salk.
I also tested if the germination of 18-11 could be inhibited by far-red light. In this case, the
imbibed 18-11 seeds were transferred to a far-red chamber directly. Unlike hy5-salk, 18-11 had
a 100% germination rate under constant far-red light (Figure 3.12d). Ler and hy3-1 showed a
moderate germination rate, while Col and other hy mutants were unable to germinate. This result
suggests that 18-11 is a novel hy mutant.
Because 18-11 was insensitive to far-red light, I tested if 18-11 could germinate in the
absence of light. 18-11 and other hy mutants seeds were imbibed and grown in dark. 18-11 had
a very high rate of germination (7/8) (Figure 3.12e). Col had a moderate germination rate (4/8),
while the rest of the hy mutants had poor or no germination.
18-11 mutation mapped to chromosome 3
The 18-11 seedlings are complicated because they have two distinct phenotypes: a long
hypocotyls, and a resistance to ABA/glucose. It is possible that these two phenotypes are due to
two separate mutations. Alternatively it is possible that a single mutation is responsible for both
phenotypes. Although the previous experimental results strongly suggest that the latter is
correct, I decided to map the 18-11 mutation using both phenotypes. If both phenotypes map to
the same region, then the latter explanation must be correct.
The gene responsible for the green cotyledon phenotype was chosen first. 100% of F1
population (18-11 crossed with Col) did not develop any green cotyledons when grown on
100nM ABA and 4% glucose media (Figure 3.13a). This suggested that the phenotype was
recessive. When F2 population (18-11 x Ler) was used to calculate the dominance, a similar
86
Figure 3.13. ABA insensitivity in 18-11 is recessive. 18-11 M4 (left), 18-11xLer (F1) (middle), Col (right) seedlings were grown on 100nM ABA/4% glucose media. 18-11 F1 and Col seedlings did not develop green cotyledons, whereas 18-11 M4 seedlings did. Seedlings shown were 6 days old. Red bar is 1cm in scale.
87
Col 18-11 x Col (F1) 18-11M4
88
result was observed. Of the F2 seedlings grown on the ABA/glucose media, less than 20% of the
individuals had green cotyledons (data not shown). Although this was not a Mendelian ratio
(25%), the phenotype is most likely recessive.
To obtain homozygous individuals from the F2 population, the seedlings with green
cotyledons on ABA/glucose media were selected. After a part of tissue was removed for DNA
extraction, the seedlings were transferred to soil to generate F3 populations. To perform the bulk
segregant analysis, a pool of 50 DNA samples was subjected to PCR processes with 22 SSLP
markers (Table 2.1). Unfortunately, I was unable to locate the mutation position. The individual
PCR mapping approach also failed to pinpoint the location of the mutation.
The gene responsible for the long hypocotyl phenotype was mapped next. Variation in
hypocotyl length was observed when the F1 population (18-11/Ler) was grown on MS media
(Figure 3.14a). The inconsistency in hypocotyl lengths may have been caused by Ler natural
variation, as Ler consistently had shorter hypocotyls than Col. To solve this problem, reciprocal
crosses between 18-11 and Col were created. When these F1 populations (18-11/Col and
Col/18-11) were used, all seedlings had long hypocotyls that were comparable to the
homozygous mutant (Figure 3.14a). This result suggested that the phenotype was dominant in
this ecotypic background. When the F2 population (18-11xLer) was grown on MS media to
evaluate the dominance of the hypocotyl phenotype, I did not observe a Mendelian ratio of 1:2:1.
Instead, I got a gradient of hypocotyl (that is closer to 1:1:1 ratio), from Col hypocotyl length to
the homozygous 18-11 hypocotyl length (Figure 3.15). This suggested that the phenotype may
be semi-dominant or incompletely penetrant. It is possible that Ler natural variation influenced
the percentage calculated.
89
Figure 3.14. Long hypocotyl phenotype in 18-11 is dominant. F1 population generated by the cross between 18-11 and Col had long hypocotyls. a) Hypocotyl length of 6 day old Col, Ler, 18-11M3, 18-11xCol, Colx18-11 and 18-11xLer seedlings. Each bar represents the average hypocotyl length ± SD (n ≥ 15). b) Col, 18-11M3, 18-11xCol and Colx18-11 seedlings grown on MS media. Seedlings shown were 6 days old. Red bar is 1cm in scale.
90
a)
White light (50umol m-2 s-1)
0
2
4
6
8
10
12
14
hyp
oco
tyl
len
gth
(m
m)
Col Ler 18-11 (2) 18-11(3) Colx18-11 18-11xCol 18-11xLer
b)
Col 18-11 M3 18-11xCol Colx18-11
91
Figure 3.15. Hypocotyl variation in 6 day-old 18-11 seedlings (F2 - 18-11xLer). a) 60 individuals from a MS plate were randomly picked, and they were placed according to the hypocotyl length (longest to shortest). Gradual decrease in hypocotyl length was observed. 18-11 M3 (b) and Col (c) had long and short hypocotyls respectively. Red bar is 1cm in scale.
92
a)
b)
c)
93
Assuming the 18-11 hypocotyl gene was at least semi-dominant, I selected the
individuals with short hypocotyls in the F2 mapping population (18-11 x Ler). In other words, I
was selecting for the homozygous Ler individuals, as homozygous Col and heterozygous
individuals would look the same. However, I was unable to clone the mutation using both bulk
segregation analysis and individual mapping methods, because too many false-positive
individuals were selected.
While trying to fix the problem, I realized that only a few F2 mapping individuals had a
similar hypocotyl length as the 18-11 M3 mutants (homozygous line). So I decided to clone the
mutation with the individuals with long hypocotyls. Here, two assumptions are made to clone
the gene: firstly that these individuals are comprised of only the homozygous mapping lines (18-
11/18-11), and secondly that the heterozygous mapping lines (18-11/Ler) are consistently shorter
than the homozygous mapping lines (18-11/18-11). The 2nd assumption was supported by the
fact that the 18-11/Ler individuals were generally shorter than the 18-11/Col individuals. With
these assumptions, the position of the 18-11 mutation was located. Based on the bulk segregant
analysis, the mutation was located at the bottom arm of chromosome 1 (Figure 3.16a). So far,
about 350 mapping individuals were collected, and 239 DNA lines were used to perform the
individual mapping. It is likely that the mutation is located in between 26.9Mb and 27.3Mb
(Figure 3.16b). Col/Ler percentages were 96% and 98% for 26.9Mb and 27.3Mb respectively.
94
Figure 3.16. Positional cloning analysis of 18-11 (long hypocotyl gene). a) Bulk segregation analysis result of 18-11. Chromosome 1 data is shown. DNA from 50 18-11 long hypocotyl seedlings were pooled together to perform PCR reactions. Red dots represent the Col chromosomes. ColxLer F1 DNA (left panel) was used as a control. b) Individual mapping data of the 238 F2 lines. Region between 26.6Mb and 28.0Mb of chromosome 1 is shown. Yellow bars represent the Col homozygous results. Red and grey bars represent the heterozygous (Col, Ler) and Ler homozygous results respectively. Ratio between Col to Ler was the highest at the nga111 (27.3mb) location. c) Sequencing data of HAB1 gene in 18-11. 1st sequence is HAB1 sequence from TAIR website. 2nd sequence shows the result of HAB1 gene sequencing from Col seedling (from lab). 3rd ,4th and 5th sequences are 18-11 F2 (41), 18-11 M4, and 18-11 F2 (79) lines respectively
95
a)
96
b) 26.6
26.9
27.3
27.7
28.0
97
c) HAB1
98
Discussion
99
ABI mutants are resistant to both ABA and glucose
Figure 3.1c shows that abi mutants can indeed tolerate glucose/ABA-induced tertiary
dormancy, as previously demonstrated by Cheng et al. (2002). Also, seedlings grown on 7%
glucose and seedlings grown on 100nM ABA/4% glucose media had similar phenotypes and
similar PhANG gene expressions (Figures 3.7a and 3.7b). This supports Cheng et al’s claim that
ABA and glucose signalling pathways are working synergistically to induce tertiary dormancy.
However, few differences were observed from their finding. Although aba2-2 did not form
green cotyledons on 100nM ABA/4% glucose media as shown by Cheng et al (2002), it was able
to withstand the tertiary dormancy induced by lower ABA concentrations which Col wild type
could not tolerate. In addition, I found that abi1-1, abi2-1 and abi3-8 mutants show resistance to
high glucose since they developed green cotyledons (Figure S1). This contradicts with the result
by Arenas-Huertero et al (2000), who found that only abi4 and abi5 are resistant to high glucose.
However, we cannot compare the results directly as Arenas-Huertero et al used 7.5% glucose,
instead of 7% glucose, on all abi mutants except abi5. Also, my seedlings were grown under
24hour-constant light, whereas gin6, an allele of abi5, was grown under 18:6 hr (light:dark),
which may have caused this discrepancy. The study by Dekkers et al (2008), where abi3
mutants are classified as gin mutants, supports my claim that all abi mutants are glucose
insensitive. I could not confirm if abi4 or abi5 mutants act as gin mutants as their germination
was severely delayed by high glucose, and no seedling was germinated by day 6.
There is a specific developmental timeframe in which ABA/glucose can trigger tertiary
dormancy, and ABI5 appears to be involved in this process. Figure 3.7c shows that the tertiary
dormancy can only be triggered if ABA and glucose are sensed by seedlings within 36 hours of
germination. Lopez-Molina et al (2001) had a similar result where ABA had to be applied to
100
seedlings within 1.5 days of seedling development to induce ABI5-mediated tertiary dormancy.
Therefore, it is possible that ABA and glucose cause ABI5-mediated tertiary dormancy. If this is
the case, then perhaps ABA and glucose are enhancing ABI5 protein stabilization. In order to
investigate this, western blot of ABI5 needs to be performed.
New screen to identify ABA insensitive mutants
While 4% glucose does not trigger any developmental inhibition in Col, the addition of
100nM ABA results in a tertiary dormancy. This provides an excellent experimental condition
to identify ABA signalling components that are activated by low ABA concentration.
Specifically, if an ABA receptor responsible for 100nM ABA detection is disabled, then the
mutant can grow as if grown on 4% glucose media. I have chosen the 100nM ABA and 4%
glucose condition instead of other combinations of ABA/glucose, as it minimizes the usage of
ABA and glucose which in turn reduces the chance of isolating previously known mutants.
Using this combination may allow me to isolate a new set of ABA signalling components that is
only triggered by low concentrations of ABA. Utilizing the fact that abi mutants can form green
cotyledons in this sensitized screen, both EMS and FN lines were used to isolate ABA
insensitive mutants. Demonstrating that recently identified ABA receptor mutants, such as
pyl4,can be isolated from the screen strengthens the validity of my approach (Figure 3.3).
Two obvious mutant groups that need to be discarded from our putative mutants are gin
and abi mutants (Figure 3.6b). Putative mutants were grown on 7% glucose to identify gin-like
mutants, and on 2μM ABA to identify abi-like mutants. 7% glucose is a very high concentration
for plants to grow normally. As several gin mutants were originally isolated at 6% glucose
(Zhou et al, 1998), it would have been ideal to use 6% glucose, instead of 7%. Unfortunately,
101
Col showed variable phenotypes when grown on 6% glucose. Therefore, 7% glucose media was
used to produce consistent results. As for identifying abi-like mutants, the putative mutants were
first tested on 2μM ABA since it produced consistent results. Mutants that showed unclear
germination results were re-tested on a lower ABA concentration at 1.5μM. However, it is still
possible for very weak alleles of abi to escape from this re-test. This problem can be addressed
by sequencing all ABI genes in each mutant line before they are subjected to positional cloning.
Although aba mutants are resistant to glucose-induced dormancy, it is unlikely for aba mutants
to be picked up in the screen because aba2 mutants are unable to form green cotyledons on
100nM ABA/4% glucose media (Cheng et al, 2002)
Ecotype variation between Col and Ler
The Ler ecotype is hypersensitive to ABA and glucose compared to the Col ecotype
(Figure 3.5b). Although the erecta mutation affects the sensitivity to ABA and glucose (Figure
3.5c), it is unlikely that this mutation is the cause for the natural variation between Col and Ler.
In addition to ABA sensitivity, Ler seedlings are generally shorter than Col seedlings (Figure
3.11a). These natural variations between Col and Ler were valuable tools for this study. For
instance, because Ler showed hypersensitivity to glucose and ABA, the positional cloning of
ABA insensitive mutants was possible. If Ler was insensitive compared to Col, then it would
have been difficult to distinguish between Ler homozygous seedlings from ABA insensitive
mutants as they would both develop green cotyledons.
Figure 3.14 suggests that the mutation responsible for the long hypocotyl in 18-11 is
dominant. Generally, to clone a dominant mutation, one would choose F2 seedlings with WT
phenotypes, as both homozygous and heterozygous mutant lines would show similar mutant
102
phenotypes. However, for 18-11, F2 seedlings with long hypocotyl phenotypes (18-11/18-11
genotype) were selected for the positional cloning. This was possible since both 18-11/Ler and
Ler/Ler seedlings had much shorter hypocotyls than 18-11/18-11 seedlings (Figure 3.14a).
ABA plays a role in retrograde signalling
Combinations of glucose and ABA can repress rbcS, rbcL and Lhcb1.2 expressions
(Figure 3.7b). This is in accordance with Penfield et al’s result (2006), who found that ABA can
specifically suppress PhANG expressions. Interestingly, seedlings grown on 750nM ABA/2%
glucose media had a different expression profile. While the rbcS expression was repressed to a
similar level as in 100nM ABA/4% glucose, the rbcL and Lhcb1.2 expressions were not
repressed as much. Also, unlike seedlings grown on 100nM ABA/4% glucose, seedlings on
750nM ABA/2% glucose were able to recover by day 25. These results suggest that different
ABA signalling pathways could be triggered by each condition. A similar result was shown by
Acevedo-Hernandez et al (2005), where 100μM ABA alone suppressed rbcS expression, but
100μM ABA and 200mM (~3.6%) glucose induced the expression.
Pesaresi et al (2007) suggested that ABA and sugar signalling pathways interact with
retrograde signalling. There are two possible mechanisms by which ABA and glucose can
influence retrograde signalling. The first is utilizing the plastid gene expression (PGE) pathway
to regulate PhANG expression. This type of retrograde signalling is only active within a 3 day
period after germination (Oelmuller et al 1986). Similarly, the effect of ABA and glucose are
active only within a similar timeframe (Figure 3.7c). In addition, the isolation of a gun-like
mutant (4-3) from the screen (Figure 3.8a) supports this claim. Furthermore, the gun1-1 mutant,
103
which is defective in the PGE pathway (Koussevitzky et al, 2007), can develop green cotyledons
on 100nM ABA/4% glucose media (Figure 3.8c).
The second mechanism involves retrograde redox signalling, which may be regulated by
ABA signalling. Here, we assume that the timeframe of the ABA and glucose effect is only
related to the timeframe of ABI5-mediated tertiary dormancy. As tertiary dormancy-induced
seedlings may not have developed fully functional photosynthetic systems, the seedlings may
experience high-light stress constantly even when grown under a normal light condition.
Normally, when adult plants are exposed to high-light stress, a rapid water loss occurs in leaf
tissues (Fryer et al 2003). ABA-mediated stomatal closures cause a reduction in the water
transpiration rate. To initiate stomatal closure, ABA induces the production of extracellular
reactive oxygen species (ROS) (Kwak et al 2003, Galvez-Valdivieso et al 2009). This ROS
could possibly trigger the retrograde signalling. Direct ABA/glucose involvement in retrograde
signalling has been reported. ABI4 works as a downstream element in retrograde pathways
(Koussevitzky et al 2007), and it can bind to the promoters of rbcS and Lhcb genes (Acevedo-
Hernanadez et al 2005). A mutation in ABI4 is shown to induce Lhcb expression in presence of
norflurazon (Koussevitzky et al 2007). Sugar is also involved in redox retrograde signaling.
Carbon-starved cell cultures exhibit higher Lhcb expression than the ones with sucrose
supplements (Oswald et al 2001). This starvation-induced Lhcb expression can be blocked by
DCMU, which is an inhibitor that blocks the photosynthetic electron transport (PET) system.
PET is required for ROS production. Furthermore, GPA1, a heterotrimeric G-protein that may
be involved in the retrograde redox process, and RGS1, a regulator of GPA1, are both sugar-
sensitive (Chen et al 2003). Loss of function mutations in GPA1 and RGS1 can cause
hypersensitivity and insensitivity to glucose-mediated tertiary dormancy respectively. Although
104
it is possible that this second scenario is how ABA and glucose influence retrograde signalling, it
is unlikely as this model does not explain why gun1-1 and gun4-1 show green cotyledons on
100nM ABA/4%glucose media (Figure 3.8c).
The cloning of the 4-3 mutation can help us understand how ABA and glucose trigger
retrograde signalling. Unfortunately, I was unable to clone the 4-3 mutation, as homozygous F2
lines and heterozygous F2 lines could not be well distinguished phenotypically. I believe this is
because 4-3 is a semi-dominant mutation. One candidate gene for 4-3 is ABI3, which is located
on chromosome 3. It is possible that a weak allele of ABI3 could have escaped during the re-test
process. Also, abi3 mutants show gun-like phenotype (Delmas, F. Personal Communication).
Some gun mutants showed green cotyledons on 100nM ABA/4% glucose media (Figure
3.8c). It is surprising that gun4-1 and gun5-1 behaved differently in my assay as previous
characterizations of these mutants suggested that they were involved in the same retrograde
signalling pathway (Nott et al 2006). Although it is possible that the differences I see are due to
allelic variation, it is also possible that this result suggests that using such artificial conditions
such as norflorozon treatments may be problematic for retrograde signalling studies. As 100nM
ABA and 4% glucose can reduce PhANG expression (Figure 3.7b), perhaps this condition is a
better alternative to the plastid function inhibitors when studying retrograde signalling. This
result also suggests that gun4-1 and gun5-1 could be involved in different retrograde signalling
pathways. Also, this result supports the idea that Mg-Protoporphyrin IX does not act as a
retrograde signal (Mochizuki et al, 2008, Moulin et al 2008).
105
Isolation of a long hypocotyl mutant (18-11)
Interactions between ABA and the light perception network have been suggested by some
studies. HY3 is shown to negatively regulate ABI3 gene expression (Mazzella et al 2005). In
absence of light, a pulse of red light can severely reduce ABI3 expression, whereas ABI3
expression is enhanced in hy3 mutants. Also, hypocotyl growth was enhanced in abi3 mutants in
the dark while it is reduced in ABI3 overexpressing transgenic lines (Mazzella et al 2005). In
seed, ABA levels can be influenced by red and far-red light. A pulse of red light after far-red
light can reduce ABA levels, and this reduction is absent in hy3/phyB mutants (Seo et al 2006).
Such pulses can enhance CYP707A2 expression and reduce NCED6 expression. In addition, a
genetic interaction between ABI5 and HY5 has been reported by Chen et al (2008). HY5 can
bind to the promoter of ABI5 in an ABA-dependent manner to trigger light responses. Also, hy5
mutants are insensitive to ABA and glucose at the level of germination (Chen et al 2008).
Furthermore, over-expression of ABI5 in WT can reduce the hypocotyl length under various
light conditions. Mutants, such as keep on going (keg) and 26s proteasome subunit rpn10, that
are defective in ABI5 degradation also show abnormal hypocotyl growth (Stone et al 2006,
Smalle et al 2003). These studies suggest that ABA signalling is involved in regulation of
hypocotyl elongation.
As 18-11 seedlings have two distinct phenotypes (long hypocotyl and resistance to
tertiary dormancy), it is possible that two separate mutations are responsible for causing the two
phenotypes. The result of hy3-1, hy4-2.23N and hy5-salk showing some degree of resistance to
ABA/glucose-induced tertiary dormancy hints that a single mutation in 18-11 is likely to be
responsible for both phenotypes (Figure 3.11b). However, more solid evidence is required to
evaluate this matter. I propose performing F3 progeny testing to clarify this issue. Currently,
106
about 300 F2 individual lines have been selected for the long hypocotyl phenotype. If one gene
is responsible for the both phenotypes, then the F3 progenies should show both phenotypes. I
would like to test about 100 F3 lines. It is interesting to note that while the long hypocotyl
phenotype is dominant, resistance to ABA and glucose is recessive. Genes producing both
dominant and recessive phenotypes have been reported in auxin studies (Stowe-Evans et al 1998,
Okushima et al 2005, Pekker et al 2005, Li et al 2006). One explanation of how 18-11 has both
dominant and recessive phenotypes is that its interaction with other proteins has been altered. In
other words, the mutation may have caused the protein to interact less with other ABA signalling
molecules, while causing it to interact more with the elements in the hypocotyl elongation
process.
18-11 does not behave like other hy mutants. Both hy1-100 and hy2-105 do not form
green cotyledon on 100nM ABA/4% glucose, where as 18-11 does (Figure 3.11b). Where all hy
mutants, except hy3, behaves as gun mutants (hy1,hy2: Mochizuki et al 2001; hy4,hy5: Ruckle et
al 2007), the 18-11 mutant does not show gun-like phenotypes (Figure 3.8a). However, this
result has to be examined cautiously as Ruckle et al (2007) used lincomycin instead of
norflurazon. 18-11 also behaves differently under different light conditions (Figure 3.12). In
addition, the 18-11 mutation is located in chromosome 1, whereas all HY1-HY5 genes are located
on the other chromosomes. The only HY gene present in chromosome 1 is HY8. This gene
encodes for phytochrome A, which detects far-red light (Dehesh et al 1993). 18-11 is unlikely an
allele of HY8, as hy8 mutants do not develop long hypocotyls under normal light conditions
(Dehesh et al 1993). Also, mutants defective in phyA do not germinate under constant far-red
light (Johnson et al 1994, Shinomura et al 1994), whereas 18-11 individuals germinate well.
Based on these results, 18-11 is likely a novel hy mutant.
107
The 18-11 mutation is mapped closely to the 27.3Mb region of chromosome 1(Figure
3.16b). As 18-11 mutants have long hypocotyls on blue, red and far-red light conditions, it is
most likely a signalling molecule rather than a photoreceptor. However, there is no previously
known light-response related gene located in this region. Possible candidate genes for 18-11 in
this region are HAB1 and AFP1. HAB1 is a protein phosphatases type 2C, which is located at
27.4Mb region of chromosome 1. I have sequenced the HAB1 gene in 18-11 M3 or F2 lines that
were selected for the 18-11 phenotype. 18-11 had a single base-pair change in the C-terminus
UTR region of HAB1 (Table 3.1). However, 18-11 M3 and F2 lines may have multiple
mutations that are not associated with the 18-11 phenotype as both lines are not backcrossed with
Col. Sequencing re-verification with Col backcrossed lines needs to be performed.
However, there are two problems that suggest that 18-11 does not have a defect in the
HAB1 gene. First, there is no report suggesting a long hypocotyl phenotype in hab1 mutants.
One explanation for this is how HAB1 was isolated. Instead of forward genetics screen, HAB1
was studied using reverse genetics, where it was identified as homolog of ABI1 and ABI2 (Saez
et al 2004). So far, there are only two HAB lines available to study: hab1-1, a SALK line
generated by T-DNA insertion, and hab1-OE, is a transgenic line that misexpresses HAB1. One
problem with these null and over-expression lines is that they provide phenotypes in extreme
ends, and this does not reflect the middle ground where different genetic interactions can be
dissected. Possibly, the lack of more alleles may be the reason why hypocotyl elongation in
hab1 has not been reported.
The second problem is that the 18-11 mutant is insensitive to ABA/glucose, yet hab1-1 is
hypersensitive to ABA (Saez et al 2004). Figure 3.13 shows that the mutation responsible for the
resistance to ABA and glucose effect is recessive. Since both genes are recessive, the mutants
108
should show a similar phenotype if they are both defective at the same gene. This result suggests
that HAB1 may not be defective in 18-11.
AFP1 is located at the 26Mb region of chromosome 1. AFP1 mediates a degradation of
ABI5, whose gene expression is regulated by HY5 (Chen et al 2008). As mentioned before,
since ABI5 may be involved in light signalling, it is possible that a mutation in AFP1 may result
in long hypocotyl phenotype. However, the positional cloning result suggests that HAB1 is more
likely than AFP1 (Figure 3.16b).
Future work
Future work should concentrate on completing the positional cloning of 18-11. If 18-11
is indeed HAB1, its molecular interaction with class two SNF kinases needs to be examined
carefully to understand how the long hypocotyl phenotype is caused by ABA signal transduction.
Alternatively, if 18-11 does turn out to be a novel gene involved in ABA/light interface, detailed
analysis of the expression and careful characterization need to be done. In addition, the rest of
the putative mutants need to be cloned to identify other ABA signalling components isolated
from this screen.
Since only hypocotyl tissue has been examined extensively in 18-11, other tissues, such
as the root, should be examined for other ABA defective phenotypes. Also, morphological
characterization of adult plants of 18-11 needs to be re-examined carefully. As both cotyledons
and hypocotyls are larger and longer in 18-11, cell number count and cell length in both tissues
need to be investigated.
109
This thesis has added to the understanding of the relationship between ABA, retrograde
and light signalling pathways. Here, both developmental and physiological mechanisms
involving ABA signalling have been addressed.
110
Appendices
111
Table S1. Some ecotypes show a natural resistance to the ABA/glucose growth inhibition. A) List of 65 ecotypes that were tested on 100nM ABA and 4% glucose medium to evaluate the natural variation. Hn-0, Ls-0, Ste-0, and Tu-0 showed a strong resistance to the growth inhibition, while C24, Calver, Le-0, Li-1, Oystese, RLD-1, Rsch-0, and Vi-0 showed a slightly weak resistance. Only Ls-0 was resistant to 7% glucose growth inhibition
112
Ecotype Name
Green cotyledons on 100nM/4%
Green cotyledons on 7%
Ecotype Name
Green cotyledons on 100nM/4%
Green cotyledons on 7%
Angleur N N NFA-8 N N Antwerpen N N Ob-0 N N Boot.Eskdale N N Or-0 N N C24 Y (weak) N Otterbum N N Calver Y (weak) N Oystese Y (weak) N Canterbury N N PHW-11 N N Chateandun N N PHW-13 N N Columbia N N PHW-23 N N Compiegne N N PHW-3 N N Durham N N PHW-34 N N Durham N N Pi-0 N N Ede-station N N Pr-0 N N
Ep-0 N N Proaza, Asturios N N
Goettingen30 N N Pt-0 N N Gr-1 N N Ravenscar N N Hn-0 Y (strong) N RLD-1 Y (weak) N HS-0 N N Rol-0 N N Kil-0 N N Rsch-0 Y (weak) N Kindaville N N Sapporo N N KO/n N N Sg-1 N N Kro-0 N N Si-0 N N KZr0 N N Ste-0 Y (strong) N Le-0 Y (weak) N Tossa de Mar N N Li-1 N N Tu-0 Y (strong) N Li-1 Y (weak) N Ty-0 N N Lm-2 N N Vi-0 Y (weak) N Ls-0 Y (strong) Y Wageningen N N Mc-0 N N Wei-1 N N MnZ-0 N N Weiningen N N Muhlen N N WI-0 N N N(N5) N N Zu-1 N N N10 N N Nc-1 N N New Zealand N N
113
Figure S1. Several abi and etr1-7 mutants on 7% glucose media. abi1-1, abi2-1, abi3-8 and etr1-7 mutants were able to form green cotyledons. Col, Ler, abi4-5 and abi5-6 seeds did not germinate, thus it was not possible to score the cotyledon colour. All seedlings shown were 6 day-old.
114
Col abi3-8 abi4-5 abi5-6
Ler abi1-1 abi2-1 etr1-7
115
References Acevedo-Hernandez GJ, Leon P and Herrera-Estrella LR. 2005. Sugar and ABA responsiveness of a minimal RBCS light-responsive unit is mediated by direct binding of ABI4. Plant Journal. 43:506-519 Ahmad M and Cashmore AR. 1993. HY4 gene of A. thaliana encodes a protein with characteristics of a blue-light photoreceptor. Nature. 366:162-166 Allan AC, Fricker MD, Ward JL, Beale MH and Trewavas AJ. 1994. Two transduction pathways mediate rapid effects of abscisic acid in Commelina guard cells. Plant Cell. 6:1319-1328 Allen GJ, Kuchitsu K, Chu SPI, Murata Y and Schroeder JL. 1999. Arabidopsis abi1-1 and abi2-1 phosphatase mutations reduce abscisic acid induced cytosolic calcium rises in guard cells. Plant Cell 11:1785-1798 Allen GJ, Chu SP, Schumacher K, Shimazaki CT, Vafeados D, Kemper A, Hawke SD, Tallman G, Tsien RY, Harper JF, Chory J and Schroeder JI. 2000. Alteration of stimulus-specific guard cell calcium oscillations and stomatal closing in Arabidopsis det3 mutant. Science. 289:2338-2342 Anderson JP, Badruzsaufari E, Schenk PM, Manners JM, Desmond OJ, Ehlert C, Maclean DJ, Ebert PR and Kazan K. 2004. Antagonistic interaction between abscisic acid and jasmonate-ethylene signalling pathways modulates defense gene expression and disease resistance in Arabidopsis. Plant Cell. 16:3460-3479 Arenas-Huertero F, Arroyo A, Zhou L, Sheen J and Leon P. 2006. Analysis of Arabidopsis glucose insensitive mutants, gin5 and gin6, revleas a central role of the plant hormone ABA in the regulation of plant vegetative development by sugar. Genes and Development. 14:2085-2096 Boudsocq M, Barbier-Brygoo H and Lauriere C. 2004. Identification of nin sucrose nonfermenting 1-related protein kinases 2 activated by hyperosmotic and saline stresses in Arabidopsis thaliana. Journal of Biological Chemistry. 279:41758-41766 Chen JG, Willard FS, Huang J, Liang J, Chasse SA, Jones AM and Siderovski DP. 2003. A seven-transmembrane RGS protein that modulates plant cell proliferation. Science. 301: 1728-1731 Chen H, Zhang J, Neff MM, Hong SW, Zhang H, Deng XW and Xiong L. 2008. Integration of light and abscisic acid signalling during seed germination and early seedling development. Proceedings of the National Academy of Sciences. 105:4495-4500
116
Cheng WH, Endo A, Zhou L, Penney J, Chen HC, Arroyo A, Leon P, Nambara E, Asami T, Seo M, Koshiba T and Sheen J. 2002. A unique short-chain dehydrogenase/reductase in Arabidopsis glucose signalling and abscisic acid biosynthesis and functions. Plant Cell. 14:2723-2743 Choi HI, Hong JH, Ha JO, Kang JY and Kim SY. 2000. ABFs, a family of ABA-respnosive element binding factors. Journal of Biological Chemistry. 276:1723-1730 Chory J, Peto CA, Ashbaugh M, Saganich R, Pratt L and Ausubel F. 1989. Different roles for phytochrome in etiolated and green plants deduced from characterization of Arabidopsis thaliana mutants. Plant Cell 1: 867-880 Coruzzi GM and Zhou L. 2001. Carbon and nitrogen sensing and signaling in plants: emerging ‘matrix effects’. Current Opinion in Plant Biology. 4: 247-253 Cousson A and Vavasseur A. 1998. Putative involvement of cytosolic Ca2+ and GTP-binding proteins in cyclic-GMP-mediated induction of stomatal opening by auxin in Commelina communis L. Planta 206:308-314 Creelman, RA, Mason HS, Bensen RJ, Boyer JS and Mullet JE. 1990. Water deficit and abscisic acid cause differential inhibition of shoot versus root growth in soybean seedlings: analysis of growth, sugar accumulation, and gene expression. Plant Physiology. 92:205-214 Davies SJ, Kurepa J and Vierstra RD. 1999. The Arabidopsis thaliana HY1 locus, required for phytochrome-chromophore biosynthesis encodes a protein related to heme oxygenases. Proceedings of the National Academy of Sciences. 96:6541- 6546 Davies PJ. 2004 Plant Hormones. 3rd ed. Norwell, MA: Kluwer Academic Publishers Dehesh K, Franci C, Parks BM, Seeley KA, Short TW, Tepperman JM and Quail PH. 1993. Arabidopsis HY8 locus encodes phytochrome A. Plant Cell. 5:1081-1088 Dekkers SJW. 2006. Sugar signalling during germination and early seedling establishment in Arabidopsis. PhD dissertation. Utrecht University, Utrecht, The Netherlands. Delmas F. 2008. Personal Communication de Torres-Zabala M, Truman W, Bennett MH, Lafforgue G, Mansfield JW, Egea PR, Bogre L and Grant M. 2007. Pseudomonas syringae pv. Tomato hijacks the Arabidopsis abscisic acid signalling pathway to cause disease. EMBO Journal. 26:1434-1443 Ephritikhine G, Pagant S, Fujioka S, Takatsuto S, Lapous D, Caboche M, Kendrick RE, and Barbier-Brygoo H. 1999. The sax1 mutation defines a new locus involved in the brassinosteroid biosynthesis pathway in Arabidopsis thaliana. Plant Journal. 18:303-314
117
Ezcurra I, Wycliffe P, Nehlin L, Ellerstrom M and Rask L. 2000. Transactivation of the Brassica napus napin promoter by ABI3 requires interaction of the conserved B2 and B3 domains of ABI3 with different cis-elements: B2 mediates activation through an ABRE, whereas B3 interacts with an RY/G box. Plant Journal. 24:57-66 Finkelstein RR and Somerville CR. 1990. Three classes of abscisic acid (ABA)-insensitive mutations of Arabidopsis define genes that control overlapping subsets of ABA responses. Plant Physiology. 94:1172-1179 Finkelstein RR, Wang ML, Lynch TJ, Rao S and Goodman HM. 1998. The Arabidopsis abscisic acid response locus ABI4 encodes an APETALA2 domain protein. Plant Cell. 10:1043-1054 Flors V, Ton J, van Doorn R, Jakab G, Garcia-Agustin P and Mauch-Mani B. 2008. Interplay between JA, SA and ABA signalling during basal and induced resistance against Pseudomonas syringae and Alternaria brassicicola. Plant Journal. 54:81-92 Fryer MJ, Ball L, Oxborough K, Karpinski S, Mullineaux PM and Baker NR. 2003. Control of Ascorbate Peroxidase2 expression by hydrogen peroxide and leaf water status during excess light stress reveals a functional organisation of Arabidopsis leaves. Plant Journal. 33:691-705 Fujii H, Verslues PE and Zhu JK. 2007. Identification of two protein kinases required for abscisic acid regulation of seed germination, root growth, and gene expression in Arabidopsis. Plant Cell. 19:485-494 Galvez-Valdivieso G, Fryer MJ, Lawson T, Slattery K, Truman W, Smirnoff N, Asami T, Davies WJ, Jones AM, Baker NR and Mullineaux PM. 2009. The high light response in Arabidopsis involves ABA signalling between vascular and bundle sheath cells. Plant Cell. 21:2143-2162 Gao Y, Zeng Q, Guo J, Cheng J, Ellis BE, Chen JG. 2007. Genetic characterization reveals no role for the reported ABA receptor, GCR2, in ABA control of seed germination and early seedling development in Arabdiopsis. Plant Journal. 52:1001-1013 Gilroy S and Jones RL. 1994. Perception of gibberellin and abscisic acid at the external face of the plasma membrane of barley (Hordeum vulgare L) aleurone protoplasts. Plant Physiology. 104:1185-1192 Giraudat J, Hauge BM, Valon C, Smalle J, Parcy F and Goodman HM. 1992. Isolatino of the Arabidopsis ABI3 gene by positional cloning. Plant Cell. 4:1251-1261 Godiard L, Sauviac L, Torii KU, Grenon O, Mangin B, Grimsley NH and Marco Y. 2003. ERECTA, an LRR receptor-like kinase protein controlling development pleiotropically affects resistance to bacterial wilt. Plant Journal. 36:353-365
118
Groot SPC, Van Yperen I and Karssen CM. 1991. Strongly reduced levels of endogenous abscisic acid in developing seeds of the tomato mutant sitiens do not influence in vivo accumulation of dry matter and storage proteins. Physiologia Plantarum. 81:73-78 Hrabak EM, Chan CWM, Gribskov M, Harper JF, Choi JH, Halford N, Kudla J, Luan S, Nimmo HG, Sussman MR, Thomas M, Walker-Simmons K, Zhu JK and Harmon AC. 2003. The Arabidopsis CDPK-SnRK superfamily of protein kinases. Plant Physiology. 132:666-680 Hedden P and Thomas SG. 2006. Plant Hormone Signaling. Annual Plant Reviews, Volume 24. Chennai, India: Blackwell Publishing Ltd. Illingworth CJ, Parkes KE, Snell CR, Mullineaux PM and Reynolds CA. 2008. Criteria for confirming sequence periodicity identified by Fourier transform analysis: Application to GCR2, a candidate plant GPCR? Biophysical Chemistry. 133:28-35 Ioio RD, Linhares FS, Scacchi E, Casamitjana-Martinez E, Heidstra R, Costantino P and Sabatini S. 2007. Cytokinins determine Arabidopsis root-meristem size by controlling cell differentiation. Current Biology. 17:678-682 Iuchi S, Kobayashi M, Taji T, Naramoto M, Seki M, Kato T, Tabata S, Kakubari Y, Yamaguchi-Shinozaki K and Shinozaki K. 2001. Regulation of drought tolerance by gene manipulation of 9-cis-epoxycarotenoid dioxygenase, a key enzyme in abscisic acid biosynthesis in Arabidopsis. Plant Journal. 27:325-333 Jeannette E, Ronna JP, Bardat F, Cornel D, Sotta B and Miginiac E. 1999. Induction of RAB18 gene expression and activation of K+ outward rectifying channels depend on an extracellular perception of ABA in Arabidopsis thaliana suspension cells. Plant Journal. 18:13-22 Johnson E, Bradley M, Harberd NP and Whitelam GC. 1994. Photoresponses of light-grown phyA mutants of Arabidopsis (phytochrome A is required for the perception of daylength extensions). Plant Physiology. 105:141-149 Johnston CA, Temple BR, Chen JG, Gao Y, Moriyama EN, Jones AM, Siderovski DP and Willard FS. 2007. Comment on “A G Protein-Coupled Receptor is a plasma membrane receptor for the plant hormone abscisic acid”. Science. 318:914 Karssen CM, Brinkhorst-Van der Swan DLC, Breekland AD and Koornneef M. 1983. Induction of seed dormancy during seed development by endogenous abscisic acid: studies on abscisic acid-deficient genotypes of Arabidopsis thaliana (L.) Heynh. Planta. 157:158-165 Kerk D, Bulgrien J, Smith DW, Barsam B , Veretnik S and Gribskov M. 2002. The complement of protein phosphatise catalytic subunits encoded in the genome of Arabidopsis. Plant Physiology. 129:908-925
119
Kohchi T, Mukougawa K, Frankenberg N, Masuda M, Yokota A and Lagarias JC. 2001. The Arabidopsis hy2 gene encodes phytochromobilin synthase, a ferredoxin-dependent biliverdin reductase. Plant cell. 13:425-436 Koornneef M, Jorna ML, Brinkhorst-van der Swan DLC and Karssen CM. 1982. The isolation of abscisic acid (ABA) deficient mutants by selection of induced revertants in non-germinating gibberellin sensitive lines of Arabidopsis thaliana (L.) Heynh. Theoretical and Applied Genetics. 61: 385-393 Koornneef M, Rueling G and Karssen CM. 1984. The isolation and characterization of abscisic acid-insensitive mutants of Arabidopsis thaliana. Physiologia Plantarum. 61: 377-383 Koornneef M and Karssen CM. 1994. Seed dormancy and germination, in Arabidopsis (edited by Meyerowitz EM and Somerville CR). New York: Cold Spring Harbor Laboratory Press Kuhn JM, Boisson-Dernier A, Dizon MB, Maktabi MH and Schroeder JI. 2006. The protein phosphatase AtPP2CA negatively regulates abscisic acid signal transduction in Arabidopsis, and effectcs of abh1 on AtPP2CA mRNA. Plant Physiology. 140: 127-139 Kushiro T, Okamoto M, Nakabayashi K, Yamagishi K, Kitamura S, Asami T, Hirai N, Koshiba T, Kamiya Y and Nambara E. 2004. The Arabidopsis cytochrome P450 CYP707A encodes ABA 8’-hydroxylases: key enzymes in ABA catabolism. EMBO Journal. 23: 1647-1656 Kwak JM, Mori IC, Pei ZM, Leonhardt N, Torres MA, Dangl JL, Bloom RE, Bodde S, Jones JDG and Schroeder JI. 2003. NAPDH oxidase AtrbohD and AtrbohF genes function in ROS-dependent ABA signalling in Arabidopsis. EMBO Journal. 22:2623-2633 Larkin RM, Alonso JM, Ecker JR and Chory J. 2003. GUN4, a regulator of chlorophyll synthesis and intracellular signalling. Science. 299:902-906 Larkin RM and Ruckle ME. 2008. Integration of light and plastid signals. Current Opinion in Plant Biology. 11:593-599 Leister D. 2002. Chloroplast research in the genomic age. Trends in Genetics. 19:47-56 Leon-Kloosterziel K, Gil MA, Ruijs GJ, Jacobsen SE, Olszewski NE, Schwartz SH, Zeevaart JA and Koornneef M. 1996. Isolation and chracterization of abscisic acid-deficient Arabidopsis mutants at two new loci. Plant Journal. 10:655-661 Levchenko V, Konrad KR, Dietrich P, Roelfsema MRG and Hedrich R. 2005. Cytosolic abscisic acid activates guard cell anion channels without preceding Ca2+ signals. Proceedings of the National Academy of Sciences. 102:4203-4208 Li J, Dai X and Zhao Y. 2006. A role for auxin response factor 19 in auxin and ethylene signalling in Arabidopsis. Plant Physiology. 140:899-908
120
Liu X, Yue Y, Li B, Nie Y, Li W, Wu WH and Ma L. 2007 A G Protein-coupled receptor is a plasma membrane receptor for the plant hormone abscisic acid. Science. 315:1712-1716 Lopez-Molina L and Chua NH. 2000. A null mutation in a bZIP factor confers ABA-insensitivity in Arabidopsis thaliana. Plant and Cell Physiology. 41:541-547 Lopez-Molina L, Mongrand S and Chua NH. 2001. A postgermination developmental arrest checkpoint is mediated by abscisic acid and requires the ABI5 transcription factor in Arabidopsis. Proceedings of the Nation Academy of Sciences. 98:4782-4787 Lopez-Molina L, Mongrand S, McLachlin D, Chait B and Chua NH. 2002. ABI5 acts downstream of ABI3 to execute an ABA-dependent growth arrest during germination. Plant Journal. 32:1-12 Lopez-Molina L, Mongrand S, Kinoshita N and Chua NH. 2003. AFP is a novel negative regulator of ABA signalling that promotes ABI5 protein degradation. Genes and Development. 17:410-418 Ma Y, Szostkiewicz I, Korte A, Moes D, Yang Y, Christmann A and Grill E. 2009. Regulators of PP2C phosphatase activity function as Abscisic acid sensors. Science. 324:1064-1068 MacRobbie EAC. 1995. ABA-induced ion efflux in stomatal guard cells: multiple actions of ABA inside and outside the cell. Plant Journal 7: 565-576 Marin E, Nussaume L, Quesada A, Gonneau M, Sotta B, Hugueney P, Frey A and Marion-Poll A. 1996. Molecular identification of zexanthin epoxidase of Nicotiana plumbaginifolia, a gene involved in abscisic acid biosynthesis and corresponding to the ABA1 locus of Arabidopsis thaliana. EMBO Journal. 15:2331-2342 Marion-Poll A and Lung J. 2006 Abscisic acid synthesis metabolism and signal transduction, in Plant hormone signaling. Annual Plant Reviews, Volume 24 (edited by Hedden P and Thomas SG) Chennai, India: Blackwell Publishing Ltd. Masle J, Gilmore SR, and Farquhar GD. 2005. The ERECTA gene regulates plant transpiration efficiency in Arabidopsis. Nature. 436:866-870 Mazzella MA, Arana MV, Staneloni RJ, Perelman S, Batiller MJR, Muschietti J, Cerdan PD, Chen K, Sanchez RA, Zhu T, Chory J and Casal JJ. 2005. Phytochrome control of the Arabidopsis transcrioptome anticipates seedling exposure to light. Plant Cell. 17:2507-2516 Melcher K, Ng LM, Zhou XE, Soon FF, Xu Y, Suino-Powell KM, Park SY, Weiner JJ, Fujii H, Chinnusamy V, Kovach A, Li J, Wang Y, Li J, Peterson FC, Jensen DR, Yong EL, Volkman BF, Cutler SR, Zhu JK and Xu HE. 2009. A gate-latch-lock mechanism for hormone signalling by abscisic acid receptors. Nature. In Press
121
Melotto M, Underwood W, Koczan J, Nomura K and He SY. 2006. Plant stomata function in innate immunity against bacterial invasion. Cell 126:969-980 Mishra G, Zhang W, Deng F, Zhao J and Wang X. 2006. A bifurcating pathway directs abscisic acid effects on stomatal closure and opening in Arabidopsis. Science. 312:264-266 Miura K, Lee J, Jin JB, Yoo CY, Miura T and Hasegawa PM. 2009. Sumoylation of ABI5 by the Arabidopsis SUMO E3 ligase SIZ1 negatively regulates abscisic acid signalling. Proceedings of the National Academy of Sciences. 106:5418-5423 Miyazono KI, Miyakawa T, Sawano Y, Kubota K, Kang HJ, Asano A, Miyauchi Y, Takahashi M, Zhi Y, Fujita Y, Yoshida T, Kodaira K, Yamaguchi-Sinozaki K and Tanokura M. 2009. Structural basis of abscisic acid signalling. Nature. In Press Mochizuki N, russlan JA, Larkin R, Nagatani A and Chory J. 2001. Arabidopsis genomes uncoupled 5 (GUN5) mutant reveals the involvement of Mg-chelatase H subunit in plastid-to-nucleus signal transduction. Proceedings of the National Academy of Sciences. 98:2053-2058 Mochizuki N, Tanaka R, Tanaka A, Masuda T and Nagatani A. 2008. The steady-state level of Mg-protoporphyrin IX is not a determinant of plastid-to-nucleus signaling in Arabidopsis. Proceedings of the National Academy of Sciences. 105:15184-15189 Monke G, Altschmied L, Tewes A, Reidt W, MockHP, Baumlein H and Conrad U. 2004. Seed-specific transcription factors ABI3 and FUS3: molecular interaction with DNA. Planta. 219:158-166 Moulin M, McCormac AC, Terry MJ and Smith AG. 2008. Tetrapyrrole profiling in Arabidopsis seedlings reveals that retrograde plastid nuclear signalling is not due to Mg-protoporphyrin IX accumulation. Proceedings of the National Academy of Sciences. 150:15178-15183 Muller AH and Hansson M. 2009. The barley magnesium chelatase 150-kD subunit is not an abscisic acid receptor. Plant Physiology. 150:157-166 Muramoto T, Kohchi T, Yokota A, Hwang I and Goodman HM. 1999. The Arabidopsis photomorphogenic mutant hy1 is deficient in phytochrome chromophore biosynthesis as a result of a mutation in a plastid heme oxygenase. Plant Cell. 11:335-348 Murata Y, Pei ZM, Mori IC and Schroeder J. 2001. Abscisic acid activation of plasma membrane Ca2+ channels in guard cells requires cytosolic NADPH and is differentially disrupted upstream and downstream of reactive oxygen species production in abi1-1 and abi2-1 Protein Phosphates 2C mutants. Plant Cell. 13:2513-2523 Mustilli AC, Merlo S, Vavasseur A, Fenzi F and Giraudat J. 2002. Arabidopsis OST1 protein kinase mediates the regulation of stomatal aperture by absisic acid and acts upstream of reactive oxygen species production. Plant Cell. 14:3089-3099
122
Nakamura S, Lynch TJ and Finkelstein RR. 2001. Physical interactions between ABA response loci of Arabidopsis. Plant journal. 26:627-635 Nambara E, Naito S and McCourt P. 1992. A mutant of Arabidopsis which is defective in seed development and storage protein accumulation is a new abi3 allele. Plant Journal. 2:435-441 Nambara E and Marion-Poll A. 2005. Abscisic acid biosynthesis and catabolism. Annual Review of Plant Biology. 56:165-185 Nishimura N, Yoshida T, Murayama M, Asami T, Shinozaki K and Hirayama T. 2004. Isolation and characterization of novel mutants affecting the abscisic acid sensitivity of Arabidopsis germination and seedling growth. Plant and Cell Physiology. 45:1485-1499 Nishimura N, Yoshida T, Kitahata N, Asami T, Shinozaki K, Hirayama T. 2007. ABA-Hypersensitive Germination1 encodes a protein phosphatase 2C, an essential component of abscisic acid signalling in Arabidopsis seed. Plant Journal. 50:935-949 Nishimura N, Hitomi K, Arvai AS, Rambo RP, Hitomi C, Cutler SR, Schroeder JI and Getzoff ED. 2009. Structural mechanism of abscisic acid binding and signalling by dimeric PYR1. Science. In Press Niu X and ate NJ. 2002. Maize ABI4 binds coupling element1 in abscisic acid and sugar response genes. Plant Cell. 14:2565-2575 North HM, Almeida AD, Boutin JP, Frey A, To A, Botran L, Sotta B and Marion-Poll A. 2007. The Arabidopsis ABA-deficient mutant aba4 demonstrate that the major route for stress-induced ABA accumulation is vi neoxanthin isomers. Plant Journal. 50:810-824 Oelmuller R, Levitan I, Bergfeld R, Rajasekhar VK and Mohr H. 1986. Expression of nuclear genes as affected by treatments acting on the plastids. Planta. 168:482-492 Okamoto M, Kuwahara A, Seo M, Kushiro T, Asami T, Hirai N, Kamiya Y, Koshiba T and Nambara E. 2006. CYP707A1 and CYP707A2, which encode ABA 8’-hydroxylases, are indispensable for a proper control of seed dormancy and germination in Arabidopsis. Plant Physiology. 141: 97-107 Okushima Y, Mitina I, Quach HL and Theologis A. 2005. AUXIN RESPONSE FACTOR 2 (ARF2): a ploeiotropic developmental regulator. Plant Journal. 43:29-46 Osterlund MT, Hardtke CS, Wei N and Deng XW. 2000. Targeted destabilization of HY5 during light-regulated development of Arabidopsis. Nature. 405:462-466 Oswald O, Martin T, Dominy JP and Graham IA. 2001. Plastid redox state and sugars: interactive regulators of nuclear encoded photosynthetic gene expression. Proceedings of the National Academy of Sciences. 98:2047-2052
123
Oyama T, Shumura Y and Okada K. 1997. The Arabidopsis HY5 gene encodes a bZIP protein that regulates stimulus-induced development of root and hypocotyls. Genes and Development. 11:2983-2995 Pandey S, Zhang W and Assmann SM. 2007. Guard cell signal transduction. FEBS Letters. 581:2325-2336 Pandey S, Nelson DC and Assmann SM. 2009. Two novel GPCR-type G proteins are abscisic acid receptors in Arabidopsis. Cell. 136:136-148 Park SY, Fung P, Nishimura N, Jensen DR, Fujii H, Zhao Y, Lumba S, Santiago J, Rodrigues A, Chow TFF, Alfred SE, Bonetta D, Finkelstein R, Provart NJ, Desveaux D, Rodriguez PL, McCourt P, Zhu JK, Schroeder JI, Volkman BF and Cutler SR. 2009. Abscisic acid inhibits type 2C protein phosphatases via the PYR/PYL family of START proteins. Science. 324:1068- 1071 Parks BM and Quail PH. 1993. Hy8, a new class of Arabidopsis long hypocotyls mutants deficient in functional phytochrome A. Plant Cell. 5:39-48 Paul MJ and Driscoll SP. 1997. Sugar repression of photosynthesis: the role of carbohydrates in signalling nitrogen deficiency through source: sink imbalance. Plant, Cell and Environment. 20:110-116 Pei ZM, Murata Y, Benning G, Thmine S, Klusener B, Allen GJ, Grill E and Schroeder JI. 2000. Calcium channels activated by hydrogen peroxide mediate abscisic acid signalling in guard cells. Nature. 406:731-734 Pekker I, Alvarez JP and Eshed Y. 2005. Auxin response factors mediate Arabidopsis organ asymmetry via modulation of KANADI activity. Plant Cell. 17:2899-2910 Penfield S, Li Y, Gilday AD, Graham S and Graham IA. 2006. Arabidopsis ABA INSENSITIVE4 regulates lipid mobilization in the embryo and reveals repression of seed germination by the endosperm. Plant Cell. 18:1887-1899 Pesaresi P, Schneider A, Kleine T, and Leister D. 2007. Interorganellar Communication. Current Opinion in Plant Biology. 10:600-606 Quail PH. 2002. Phytochrome photosensory signalling networks. Nature Review Molecular Cell Biology. 3:85-93 Raven PH, Evert RF, and Eichhorn SE. 1999. Biology of Plants. 6th ed. New York: W.H.Freeman and Company Raz V, Bergervoet JH and Koornneef M. 2001. Sequential steps for developmental arrest in Arabidopsis seeds. Development. 128:243-252
124
Razem FA, El-Kereamy A, Abrams SR and Hill RD. 2006. The RNA-binding protein FCA is an abscisic acid receptor. Nature. 439: 290-294 Razem FA, El-Kereamy A, Abrams SR and Hill RD. 2008. Retraction : The RNA-binding protein FCA is an abscisic acid receptor. Nature. 456:824 Risk JM, Macknight RC and Day CL. 2008. FCA does not bind abscisic acid. Nature. 456: E5-E6 Ruckle ME, DeMarco SM and Larkin RM. 2007. Plastid signals remodel light signalling networks and are essential for efficient chloroplast iogenesis in Arabidopsis. Plant Cell. 19: 3944-3960 Ruckle ME and Larkin RM. 2009. Plastid signals that affect photomorphogenesis in Arabidopsis thaliana are dependent on GENOMES UNCOUPLED 1 and cryptochrome1. New Phytologist. 182:367-379 Saez A, Apostolova N, Gonzalez-Guzman M, Gonzalez-Garcia MP, Nicolas C, Lorenzo O and Rodriguez PL. 2004. Gain-of-function and loss-of-function phenotypes of the protein phosphatase 2C HAB1 reveal its role as a negative regulator of abscisic acid signalling. Plant Journal. 37:354-369 Saez A, Robert N, Maktabi MH, Schroeder JI, Serrano R and Rodriguez PL. 2006. Enhancement of abscisic acid sensitivity and reduction of water consumption in Arabidopsis by combined inactivation of the protein phosphatases type 2C ABI1 and HAB1. Plant Physiology. 141:1389-1399 Saez A, Rodrigues A, Santiago J, Rubio S and Rodriguez PL. 2008. HAB1-SWI3B interaction reveals a link between abscisic acid signalling and putative SWI/SNF chromatin-remodeling complexes in Arabidopsis. Plant Cell. 20: 2972-2988 Saito S, Hirai N, Matsumoto C, Ohigashi H, Ohta D, Sakata K and Mizutani M. 2004. Arabidopsis CYP707As endoes (+)-abscisic acid – hydroxylase, a key enzyme in the oxidative catabolism of abscisic acid. Plant Physiology. 134:1439-1449 Santiago J, Rodrigues A, Saez A, Rubio S, Antoni R, Dupeux F, Park SY, Marquez JA, Cutler SR and Rodriguez PL. 2009a. Modulation of drought resistance by the abscisic acid receptor PYL5 through inhibition of clade A PP2Cs. Plant Journal. 60: 575-588 Santiago J, Dupeux F, Round A, Antoni R, Park SY, Jamin M, Cutler SR, Rodriguez PL and Marquez JA. 2009b. The abscisic acid receptor PYR1 in complex with abscisic acid. Nature. In Press Schwartz SH, Tan BC, Gage DA, Zeevaart JAD and McCarty DR. 1997a. Specific oxidative cleavage of carotenoids by VP14 of maize. Science. 276:1872-1874
125
Schwartz SH, Leon-Kloosterziel KM, Koornneef M and Zeevaart JAD. 1997b. Biochemical characterization of the aba2 and aba3 mutants in Arabidopsis thaliana. Plant Physiology. 114:161-166 Schwartz SH, Qin X and Zeevaart JAD. 2003. Elucidation of indirect pathway of abscisic acid biosynthesis by mutants, genes, and enzymes. Plant Physiology. 131:1591-1601 Seo M, Peeters AJM, Koiwai H, Oritani T, Marion-Poll A, Zeevaart JAD, Koornneef M, Kamiya Y and Koshiba T. 2000. The Arabidopsis aldehyde oxidase 3 (AAO3) gene product catalyzes the final step in abscisic acid biosynthesis in leaves. Proceedings of the Nation Academy of Sciences. 97:12908-12913 Seo M, Hanada A, Kuwahara A, Endo A, Okamoto M, Yamauchi Y, North H, Marion-Poll A, Sun TP, Koshiba T, Kamiya Y, Yamaguchi S and Nambara E. 2006. Regulation of hormone metabolism in Arabidopsis seeds: phytochrome regulation of abscisic acid metabolism and abscisic acid regulation of gibberellin metabolism. Plant Journal. 48:354-366 Sharp RE, LeNoble ME, Else MA, Thorne ET and Gherardi F. 2000. Endogenous ABA maintains shoot growth in tomato independently of effects on plant water balance: evidence for an interaction with ethylene. Journal of experimental botany. 51:1575-1584 Sharrock RA and Quail PH. 1989. Phytochrome sequences in Arabidopsis thaliana: structure, evolution, and differential expression of a plant regulatory photoreceptor family. Genes and Development. 3:1745-1757 Shen Q, Zhang P and Ho THD. 1996. Modular nature of abscisic acid (ABA) response complexes: composite promoter units that are necessary and sufficient for ABA induction of gene expression in barley. Plant Cell. 8:1107-1119 Shen YY, Wang XF, Wu FQ, Du SY, Cao Z, Shang Y, Wang XL, Peng CC, Yu XC, Zhu SY, Fan RC, Xu YH and Zhang DP. 2006. The Mg-chelatase H subunit is an abscisic acid receptor. Nature. 443: 823-826 Shimizu-Sato S, Tanaka M and Mori H. 2009. Auxin-cytokinin interactions in the control of shoot branching. Plant Molecular Biology. 69:429-435 Shinomura T, Nagatani A, Chory J and Furuya. 1994. The induction of seed germination in Arabidopsis thaliana is regulated principally by phytochrome B and secondarily by phytochrome A. Plant Physiology. 104:363-371 Smalle J, Kurepa J, Yang P, Emborg TJ, Babiychuk E, Kushnir S and Vierstra RD. 2003. The pleiotropic role of the 26S Proteasome Subunit RPN10 in Arabidopsis growth and development supports a substrate-specific function in abscisic acid signalling. Plant Cell. 15:965-980 Somers DE, Sharraock RA, Teppermaqa JM and Quail PH. 1991. The hy3 long hypocotyls mutant of Arabidopsis is deficient in phytochrome B. Plant Cell. 3:1263-1274
126
Stone SL, Williams LA, Farmer LM, Vierstra RD and Callis J. 2006. KEEP ON GOING, a RING E3 Ligase essential for Arabidopsis growth and development, is involved in abscisic acid signalling. Plant Cell. 18:3415-3428 Stowe-Evans EL, Harper RM, Motchoulski AV and Liscum E. 1998. NPH4, a conditional modulator of auxin-dependent differential growth responses in Arabidopsis. Plant Physiology. 118:1265-1275 Strand A, Asami T, Alonso J, Ecker JR and Chory J. 2003 Chloroplast to nucleus communication triggered by accumulation of Mg-protoporphyrinIX. Nature. 421:79-83 Suzuki M, Koa CY and McCarty DR. 1997. The conserved B3 domain of VIVIPAROUS1 has a cooperative DNA binding activity. Plant Cell. 9:799-807 Suzuki M, Ketterling MG, Li AB and McCart DR. 2003. Viviparous1 alters global gene expression patterns through regulation of abscisic acid signalling. Plant Physiology. 132:1664-1677 Tan BC, Schwartz SH, Zeevaart JAD and McCarty DR. 1997. Genetic control of abscisic acid biosynthesis in maize. Proceedings of the National Academy of Sciences. 94:12235-12240 Tan BC, Joseph LM, Deng WT, Liu L, Li QB, Cline K and McCarty DR. 2003. Molecular characterization of the Arabidopsis 9-cis epoxycarotenoid dioxygenase gene family. Plant Journal 35:44-56 Toh, S. 2009. Personal Communication Tsuchiya, Y. 2009. Personal Communication Umezawa T, Okamoto M, Kushiro T, Nambara E, Oono Y, Seki M, Kobayashi M, Koshiba T, Kamiya Y and Shinozaki K. 2006. CYP707A3, a major ABA 8’-hydroxylase involved in dehydration and rehydration response in Arabidopsis thaliana. Plant Journal. 46:171-182 Umezawa T, Sugiyama N, Mizoguchi M, Hayashi S, Myouga F, Yamaguchi-Shinozaki K, Ishihama Y, Hirayama T and Shinozaki K. 2009. Type 2C protein phosphatases directly regulate abscisic acid-activated protein kinases in Arabidopsis. Proceedings of the National Academy of Sciences. 106: 17588-17593 Uno Y, Furihata T, Abe H, Yoshida R, Shinozaki K and Yamaguchi-Shinozaki K. 2000. Arabidopsis basic leucine zipper transcription factors involved in an abscisic acid-dependent signal transduction pathway under drought and high-salinity conditions. Proceedings of the National Academy of Sciences. 97:11632-11637 Veit B. 2009. Hormone mediated regulation of the shoot apical meristem. Plant Molecular Biology. 69:397-408
127
Vinti G, Hills A, Campbell S, Bowyer JR, Mochizuki N, Chory J and Lopez-Juez E. 2000. Interactions between hy1 and gun mutants of Arabidopsis, and their implications for plastid/nuclear signalling. Plant Journal. 24:883-894 Werner T, Motyka V, Laucou V, Smets R, van Onckelen H and Schmulling T. 2003. Cytokinin-deficient transgenic Arabidopsis plants show multiple developmental alterations indicating opposite functions of cytokinins in the regulation of shoot and root meristem activity. Plant Cell. 15:2532-2550 Weyers JDB and Paterson NW. 2001. Plant hormones and the control of physiological processes. New Phytologist. 152:375-407 Xiong L, Ishitani M, Lee H and Zhu JK. 2001. The Arabidopsis LOS5/ABA3 locus endoces a molybdenum cofactor sulfurase and modulates cold stress-and osmotic stress-responsive gene expression. Plant Cell. 13:2063-2083 Yamaguchi R, Nakamura M, Mochizuki N, Kay SA and Nagatani A. 1999. Light-dependent translocation of a phytochrome B-GFP fusion protein to the nucleus in transgenic Arabidopsis. Journal of Cell Biology. 145:437-445 Yin P, Fan H, Hao Q, Yuan X, Wu D, Pang Y, Yan C, Li W, Wang J and Yan N. 2009. Structural insights into the mechanism of abscisic acid signalling by PYL proteins. Nature Structural and Molecular Biology. In Press Yoshida R, Hobo T, Ichimura K, Mizoguchi T, Takahashi F, Aronso J, Ecker JR and Shinozaki K. 2002. Plant and Cell Physiology. 43:1473-1483 Yoshida T, Nishimura N, Kitahata N, Kuromori T, Ito T, Asami T, Shinozaki K and Hirayama T. 2005. ABA-Hypersensitive Germination3 encodes a protein phosphatase 2C (AtPP2CA) that strongly regulates abscisic acid signalling during germination among Arabidopsis protein phosphatase 2Cs. Plant Physiology. 140:115-126 Yoshida R, Umezawa T, Mizoguchi T, Takahashi S, Takahashi F and Shinozaki K. 2006. The regulatory domain of SRK2E/OST1/SnRK2.6 interacts with ABI1 and integrates abscisic acid (ABA) and osmotic stress signals controlling stomatal closure in Arabidopsis. Journal of Biological Chemistry. 281:5310-5318 Zhang X, Zhng L, Dong F, Gao J, Galbraith DW and Song CP. 2001. Hydrogen peroxide is involved in abscisic acid-induced stomatal closure in vicia faba. Plant Physiology. 126:1438-1448 Zhang X, Garreton V and Chua NH. 2005. The AIP2 E3 ligase acts as a novel negative regulator of ABA signalling by promoting ABI3 degradation. Genes and Development. 19:1532-1543
128
129
Zeevart JAD and Creelman RA. 1998. Metabolism and physiology of Abscisic Acid. Annual Review of Plant Phyiology and Plant Molecular Biology. 39:439-473 Zhang X, Garreton V and Chua NH. 2005. The AIP2 E3 ligase acts as a novel negative regulator of ABA signalling by promoting ABI3 degradation. Genes and development. 19:1532-1543 Zhou L, Jang JC, Jones, TL and Sheen J. 1998. Glucose and ethylene signal transduction crosstalk revealed by an Arabidopsis glucose-insensitive mutant. Proceedings of the National Academy of Sciences. 95:10294-10299