isolation and characterization of fungal -...
TRANSCRIPT
![Page 1: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/1.jpg)
![Page 2: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/2.jpg)
ISOLATION AND CHARACTERIZATION OF FUNGAL ENDOPHYTES FROM CERTAIN MEDICINAL PLANTS AND RET
SPECIES IN WESTERN GHATS AND THEIR THERAPEUTIC POTENTIALS
FINAL TECHNICAL REPORT
BACK TO LAB PROGRAMME (Sanction No: 702/2012/KSCSTE dated 30/10/2012)
WOMEN SCIENTISTS DIVISION
KERALA STATE COUNCIL FOR SCIENCE TECHNOLOGY AND ENVIRONMENT
GOVT. OF KERALA
Project Period : 30/10/2012 to 08/04/2016
Principal Investigator: Dr. Thulasi. G. Pillai
DEPARTMENT OF FOREST PATHOLOGY
KERALA FOREST RESEARCH INSTITUTE, PEECHI
THRISSUR - 680653, KERALA
APRIL 2016
![Page 3: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/3.jpg)
- 2 -
AUTHORIZATION
The work entitled “Isolation and characterization of fungal endophytes from
certain medicinal plants and RET species in Western Ghats and their therapeutic
potentials” by Dr. Thulasi G Pillai, was carried out under the “Back to lab
programme” of Women Scientists Division, Kerala State Council for Science
Technology and Environment, Govt. of Kerala. The work was carried out at
Department of Forest Pathology, Kerala Forest Research Institute, Peechi,
Thrissur, Kerala - 680 653. The project was initiated wide sanction No:
702/2012/KSCSTE dated 30/10/2012, with scheduled completion by 29/10/2015.
The field and laboratory works were completed by October 2015, however an
additional period of 6 month was given (without additional financial
commitments) for compilation of results and preparation of final report as
required by the Principal Investigator. The project was completed on 08/04/2016
with a financial expenditure of Rs. 16.2921 lakhs.
![Page 4: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/4.jpg)
- 3 -
ACKNOWLEDGMENTS
I am deeply indebted to Kerala State Council for Science, Technology and
Environment for the financial aid through “Back to Lab program for Women” which
helped me to get an independent project with great exposure leading to career
development. I am highly obliged to Kerala Forest Research Institute for providing me
necessary facilities and logistical support for carrying out the field work as well as
laboratory experiments during the course of the project. I am grateful to Dr. K.R. Lekha,
Head, Women Scientists Division for the encouragement and support throughout the
tenure of the project. I am grateful to Dr. R. Jayaraj, Scientist mentor, KFRI for giving
consent to become the mentor of the Project.
Words are not enough to express my heartfelt gratitude to all The Directors and
Registrars of KFRI during the tenure of the project for the support to make this endeavor
a success. I am greatly indebted to Dr. K.V. Sankaran, The then Director, for the immense
help in writing and implementing the project at KFRI. I express my heartfelt gratitude to
Dr. V.V. Sudeendrakumar, Head and Program Coordinator of Forest Health Division, for
the excellent moral support, encouragement and providing all the facilities and making
all necessary arrangements for the successful completion of the Project. I am grateful to
Dr.E.A. Jayson, Research Co-ordinator, KFRI, for the timely help and valuable advice. I
am cordially obliged to Dr.E.M. Muralidharan, Head and Program Coordinator,
Department of Biotechnology, KFRI, for the immense moral support. The morale boosting
words helped to overcome many dispiriting moments.
I am extremely privileged to be associated with Dr. T. Muthukumar, Assistant
Professor, Department of Botany, Bharathiyar University, who taught me what Mycology
is. The excellent guidance, encouragement and the delightful patience are inimitable. I am
deeply obliged to Dr. D. Karunagaran, Professor and Head, Department of Biotechnology,
IIT Madras for permitting me to carry out my anti-cancer work in his lab and providing
me an excellent working atmosphere. I am grateful to Dr. N. Sasidaran, Scientist (Rtd.),
KFRI, for helping in identification and collection of plants.
I am also grateful to Dr. P.S. Easa, Director, KFRI and Shri. K. Satheesakumar,
Registrar for the great help in administrative and financial formalities for the smooth
functioning of the project. I express my sincere gratitude to Dr. T.K. Damodaran, Head
and Program Co-ordinator, Wood science and Technology, KFRI, for the excellent
support and encouragement.
I am also grateful to Dr.T.V. Sajeev, Head and Program Coordinator, Department
of Pathology, for the immense support and help in carrying out my project work. I am
also grateful to Dr. G.E.M. Swamy, Scientist, Co-mentor of the Project. I am grateful to all
the scientific and non-scientific staff of KFRI and Research fellows for their kind
cooperation.
Thulasi G Pillai
![Page 5: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/5.jpg)
- 4 -
CONTENTS
1. ABSTRACT 5
2. INTRODUCTION AND REVIEW OF LITERATURE 6
3. OBJECTIVES 20
4. MATERIALS AND METHODS 21
5. RESULTS AND DISCUSSION 27
6. SUMMARY 45
7. OUTCOMES OF THE PROJECT 47
8. SCOPE OF FUTURE WORK 48
9. BIBLIOGRAPHY 49
![Page 6: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/6.jpg)
- 5 -
ABSTRACT
True endophytes have been evolving with the host for millions of years. The
endophytes play important role in the survival and protection of the plant against
harsh environment and adverse conditions. The present study was carried out to
identify true endophytic fungi from three important medicinal plants - Aerva
lanata, Emelia sonchifolia and Cynometra travancorica, isolate and establish the
therapeutic potential of the secondary metabolites produced by them. Two true
endophytes were isolated from C. travancorica – Colletotrichum gloeospoiriodes from
leaves and Diaporthe eres from stem. Fusarium equiseti was isolated from leaves,
stem and root of A. lanata. Emelia sonchifolia did not any associations with fungi.
Secondary metabolites were isolated from C. gloeosporiodes and F. equiseti. No
metabolites were obtained from D. eres. One of the compounds isolated from C.
gloeospoiriodes, Compound A, was found to have cytotoxic activity and anticancer
activity in colon cancer cell lines SW620. The properties of compounds B isolated
from C. gloeosporiodes, and the compounds C and D isolated from A. lanata needs
further investigation. The findings suggest that the terpenoids from C.
gloeosporiodes possess significant anticancer activity and warrants further scientific
investigations. .
![Page 7: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/7.jpg)
- 6 -
1. INTRODUCTION
Endophytes are organisms that spend the whole life or part of their life cycle in
the symplast or apoplast region of healthy plant tissues without causing any
disease or pathological symptoms. These organisms include bacteria, fungi, algae
and actinomycetes. Some fungal endophytes are able to produce some bioactive
compounds which are sometimes produced by the host plants also, e.g., Fusarium
fujikorai producing gibberellins [1]. Over 8,600 bioactive metabolites of fungal
origin have been described [2]. Endophytes of medicinal plants and trees and
their potential use are a most promising resource, which awaits exploration.
Reports from the earlier studies reveal that active metabolites produced by
endophytic fungus isolated from the medicinal plants and trees have medicinal
importance. Their therapeutic application can be exploited for human diseases in
future. The Western Ghats is very rich in its medicinal plant wealth. The forests
and hills of this region is a treasure house of about 700 medicinal plants of which
some are used in traditional and folk medicine. Many are exploited commercially
for their enzymes. The limited knowledge on the varied use of the medicinal
plants, their availability and extent of distribution limits efficient use of these
resources. Endophytes of medicinal plants and their potential use are a most
promising resource, which awaits exploration.
Practical applications of endophytes are as biocontrol agents and sources of novel
metabolites for medicine. These also include plant protection and industrial uses
and as research model systems for investigations of host parasite interactions and
evolution in natural systems [3]. The present study was aimed at isolation and
characterization of endophytic fungi from 2 important medicinal plants- Aerva
lanata and Emelia sonchifolia and a rare, endangered and threatened species,
Cynometra travancorica and to explore their therapeutic potentials.
2. REVIEW OF LITERATURE
Filamentous fungi are well known producers of secondary metabolites [4]. A
literature survey covering more than 23,000 bioactive microbial products i.e.,
![Page 8: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/8.jpg)
- 7 -
antifungal, antibacterial, antiviral, cytotoxic and immunosuppressive agents
shows that fungi are the main source of these products. Reports also suggest that
endophytes elicit plants to produce enhanced amount of secondary metabolites
[5]. Endophytes have major influences on plant distribution, ecology, physiology
and biochemistry [6]. On the other hand, the factors influencing the distribution
of endophytes within and between hosts and regions are atmospheric humidity,
plant density and associations, tissue type, air pollutants, stand management
practices, anthropogenic modifications etc [7-9].
Endophytes are microorganisms that reside asymptomatically in the tissues of
higher plants and are a promising source of novel organic natural metabolites
exhibiting a variety of biological activities. The term “endophytes” includes a suite
of microorganisms that grow intra-and/or intercelullarly in the tissues of higher
plants without causing over symptoms on the plants in which they live, and have
proven to be rich sources of bioactive natural products [10, 11]. Mutualism
interaction between endophytes and host plants may result in fitness benefits for
both partners [12]. The endophytes may provide protection and survival
conditions to their host plant by producing a plethora of substances which, once
isolated and characterized, may also have potential for use in industry,
agriculture, and medicine [13-14]. Approximately 3,00,000 plant species growing
in unexplored area on the earth are host to one or more endophytes [15], and the
presence of biodiverse endophytes in huge number plays an important role on
ecosystems with greatest biodiversity, for instance, the tropical and temperate
rainforests [14], which are extensively found in Brazil and possess almost 20% of
its biotechnological source [16]. Considering that only a small amount of
endophytes have been studied, recently, several research groups have been
motivated to evaluate and elucidate the potential of these microorganisms applied
in biotechnology focusing on the production of bioactive compounds. The
production of bioactive substances by endophytes is directly related to the
independent evolution of these microorganisms, which may have incorporated
genetic information from higher plants, allowing them to better adapt to plant
host and carry out some functions such as protection from pathogens, insects, and
![Page 9: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/9.jpg)
- 8 -
grazing animals [15]. Endophytes are chemical synthesizer inside plants [17], in
other words, they play a role as a selection system for microbes to produce
bioactive substances with low toxicity toward higher organisms [15]. Natural
bioactive compounds produced by endophytes have potential uses in safety and
human health, even though there is significant demand for synthetic products in
drug industry due to economic reasons [13]. Problems related to human health
such as the development of drug resistance towards human pathogenic bacteria,
fungal infections, and life threatening virus claim for new therapeutic agents for
effective treatment of diseases in human, plants, and animals that are currently
unmet [14, 15, 17]. Recent review by Newman and Cragg [18] presented a list of
all approved agents from 1981 to 2006, reveals that a significant number of natural
drugs are produced by microbes and/or endophytes.
Endophytes provide a broad variety of bioactive secondary metabolites with
unique structure, including alkaloids, benzopyranones, chinones, flavonoids,
phenolic acids, quinones, steroids, terpenoids, tetralones, xanthones, and others
[11]. Such bioactive metabolites find wide-range of application as agrochemicals,
antibiotics, immunosuppressants, antiparasitics, antioxidants, and anticancer
agents [19]. Methods to obtain bioactive compounds include the extraction from a
natural source, the microbial production via fermentation, or microbial
transformation. Extraction from natural sources presents some disadvantages
such as dependency on seasonal, climatic and political features and possible
ecological problems involved with the extraction, thus calling for innovative
approaches to obtain such compounds [20].
Biotechnological techniques by using different microorganisms appears to be a
promising alternative for establishing an inexhaustible, cost-effective and
renewable resource for the production of high-value bioactive products and
aroma compounds. The biotransformation method has a huge number of
applications [21], for instance, it has been extensively employed for the production
of volatile compounds [21]. These volatile compounds possess not only sensory
properties, but other desirable properties such as antimicrobial (vanillin, essential
![Page 10: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/10.jpg)
- 9 -
oil constituents), antifungal and antiviral (some alkaloides), antioxidant (eugenol,
vanillin), somatic fat reducing (nootkatone), blood pressure regulating (2-[E]-
hexenal), anti-inflammatory properties (1,8-cineole), and others [22].
The anticancer properties of several secondary metabolites from endophytes have
been investigated recently. Cancer is a group of diseases characterized by
unregulated growth and spread of abnormal cells, which can result in death if not
controlled [23]. It has been considered one of the major causes of death
worldwide: 7.4 million (about 13% of all deaths) in 2004 [24]. The anticancer drugs
show nonspecific toxicity to proliferating normal cells, possess enormous side
effects, and are not effective against many forms of cancer [19]. Thus, the cure of
cancer has been enhanced mainly due to diagnosis improvements which allow
earlier and more precise treatments. There are some evidences that bioactive
compounds produced by endophytes could be alternative approaches for
discovery of novel drugs, since many natural products from plants,
microorganisms, and marine sources were identified as anticancer agents [25].
The diterpenoid “Taxol” (also known in the literature as paclitaxel) have
generated more attention and interest than any other new drug since its discovery,
possibly due to its unique mode of action compared to other anticancer agents [19,
26]. This compound interferes with the multiplication of cancer cells, reducing or
interrupting their growth and spreading. FDA (Food and Drug Administration)
has approved Taxol for the treatment of advanced breast cancer, lung cancer, and
refractory ovarian cancer [27]. Taxol (C47H51NO14) was firstly isolated from the
bark of trees belonging to Taxus family (Taxus brevifolia), its most common source
[28]. Nevertheless, these trees are rare, slow growing, and produce small amount
of Taxol, which explain its high price in the market when obtained from this
natural source [29]. Besides, in the context of environmental degradation, the use
of plant source as unique option have limited the supply of this drug due to the
destructive collection of yew trees [30]. Several reports about Taxol and its
anticancer properties were published since its discovery [31–33], as well as other
sources for production of Taxol have been investigated in the last decade. The
![Page 11: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/11.jpg)
- 10 -
isolation of Taxol-producing endophyte Taxomyces andreanae has provided an
alternative approach to obtain a cheaper and more available product via
microorganism fermentation [34]. After that, Taxol has also been found in a
number of different genera of fungal endophytes either associated or not to yews,
such as Taxodium distichum [35]; Wollemia nobilis [36]; Phyllosticta spinarum [37];
Bartalinia robillardoides [19]; Pestalotiopsis terminaliae [38]; Botryodiplodia theobromae
[39].
“Camptothecin” (C20H16N2O4), a potent antineoplastic agent which was firstly
isolated from the wood of Camptotheca acuminate Decaisne (Nyssaceae) in China
[40]. Camptothecin and 10-hydroxycamptothecin are two important precursors for
the synthesis of the clinically useful anticancer drugs, topotecan, and irinotecan
[41]. Although it have potential use in medical treatments, the unmodified
Camptothecin suffers from drawbacks that compromises its applications due to
very low solubility in aqueous media and high toxicity [42, 43]. On the other hand,
some Camptothecin derivatives retain the medicinal properties and can show
other benefits without causing further drawbacks in some cases [44, 45].
Therefore, it is desirable to develop strategies for isolation, mixture separation,
and production of Camptothecin and its analogues from novel endophytic fungal
sources. The anticancer properties of the microbial products Camptothecin and
two analogues (9-methoxycamptothecin and 10-hydroxycamptothecin) were
already reported. The products were obtained from the endophytic fungi Fusarium
solani isolated from Camptotheca acuminate [46]. Several reports have described
other Camptothecin (or analogues) producing endophytes [47-49]. Since then,
endophytes have been included in many studies purposing new approaches for
drug discovery.
“Ergoflavin” (C30H26O14), belongs to the compound class called ergochromes and
was described as a novel anticancer agent isolated from an endophytic fungi
growing on the leaves of an Indian medicinal plant Mimusops elengi (Sapotaceae)
[50]. “Secalonic acid D” (C32H30O14), a mycotoxin also belonging to ergochrome
class, is known to have potent anticancer activities. It was isolated from the
![Page 12: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/12.jpg)
- 11 -
mangrove endophytic fungus and observed high cytotoxicity on HL60 and K562
cells by inducing leukemia cell apoptosis [46].“Phenylpropanoids” have attracted
much interest for medicinal use as an anticancer, antioxidant, antimicrobial, anti-
inflammatory, and immunosuppressive properties [51]. Despite the
phenylpropanoids belong to the largest group of secondary metabolites produced
by plants, reports showed the production of such compounds by endophytes. The
endophytic Penicillium brasilianum, found in root bark of Melia azedarach, promoted
the biosynthesis of phenylpropanoid amides [52].
Two monolignol glucosides, coniferin and syringin, are produced not only by the
host plant, but were also recognized by the endophytic Xylariaceae species as
chemical signals during the establishment of fungus-plant interactions [53].
Koshino and coworkers characterized two phenylpropanoids and lignan from
stromata of Epichloe typhina on Phleum pretense [54]. “Lignans” are other kinds of
anticancer agents originated as secondary metabolites through the shikimic acid
pathway and display different biological activities that make them interesting in
several lines of research [55]. Although their molecular backbone consists only of
two phenylpropane units (C6-C3), lignans show enormous structural and
biological diversity, especially in cancer chemotherapy [42].
“Podophyllotoxin” (C22H22O8) and analogs are clinically relevant mainly due to
their cytotoxicity and antiviral activities and are valued as the precursor to useful
anticancer drugs like etoposide, teniposide, and etopophos phosphate [56-57]. The
aryl tetralin lignans, such as podophyllotoxin, are naturally synthesized by
Podophyllum sp., alternative sources have been searched to avoid the use of
endangered plant. Another study showed a novel fungal endophyte, Trametes
hirsute, that produces podophyllotoxin and other related aryl tetralin lignans with
potent anticancer properties [58]. Novel microbial sources of Podophyllotoxin
were reported from the endophytic fungi, Aspergillus fumigatus isolated from
Juniperus communis L. Horstmann [59], Phialocephala fortinii isolated from
Podophyllum peltatum [60], and Fusarium oxysporum from Juniperus recurva [61].
![Page 13: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/13.jpg)
- 12 -
Three novel “Cytochalasins”, bearing antitumor activity was isolated from the
endophyte Rhinocladiella sp. [61]. Extensive experiments identified these new
compounds as 22-oxa-12-cytochalasins. “Torreyanic acid” (C38H44O12) is an
unusual dimeric quinone isolated from the endophytic fungus Pestalotiopsis
microspora from T. taxifolia (Florida torreya) and was proven to have selective
cytotoxicity 5 to 10 times more potent in cell lines that are sensitive to protein
kinase C agonists and causes cell death by apoptosis [62].
“Gliocladicillins A” and “B” were reported as effective antitumor agents in vitro
and in vivo, since they induced tumor cell apoptosis and showed significant
inhibition on proliferation of melanoma B16 cells implanted into immunodeficient
mice [63]. Crude Extracts of Alternaria alternata, an endophytic fungus isolated
from Coffea Arabica L., displayed moderate cytotoxic activity towards HeLa cells in
vitro, when compared to the dimethyl sulfoxide-(DMSO-) treated cells [64]. The
investigation of endophytic actinomycetes associated with pharmaceutical plants
in rainforest reported 41 microorganisms from the genus Streptomyces displayed
significant antitumor activity against HL-60 cells, A549 cells, BEL-7404 cells, and
P388D1 cells [1]. The screening of endophytic fungi isolated from pharmaceutical
plants in China showed that 13.4% endophytes were cytotoxic on HL-60 cells and
6.4% on KB cells [65].
Other compounds with anticancer properties isolated from endophytic microbes
reported are cytoskyrins [66], phomoxanthones A and B [67], photinides A-F [68],
rubrofusarin B [69], and epiepoxydon [70].
Antimicrobial metabolites bearing antibiotic activity can be defined as low-
molecular-weight organic natural substances made by microorganisms that are
active at low concentrations against other microorganisms [15]. Endophytes are
believed to carry out a resistance mechanism to overcome pathogenic invasion by
producing secondary metabolites [5]. So far, studies reported a large number of
antimicrobial compounds isolated from endophytes, belonging to several
structural classes like alkaloids, peptides, steroids, terpenoids, phenols, quinines,
and flavonoids [71].
![Page 14: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/14.jpg)
- 13 -
The discovery of novel antimicrobial metabolites from endophytes is an important
alternative to overcome the increasing levels of drug resistance by plant and
human pathogens, the insufficient number of effective antibiotics against diverse
bacterial species, and few new antimicrobial agents in development, probably due
to relatively unfavorable returns on investment [72, 73]. The antimicrobial
compounds can be used not only as drugs by humankind but also as food
preservatives in the control of food spoilage and food-borne diseases, a serious
concern in the world food chain [74]. Many bioactive compounds, including
antifungal agents, have been isolated from the genus Xylaria residing in different
plant hosts, such as “sordaricin” with antifungal activity against Candida albicans
[75]; “mellisol” and “1,8-dihydroxynaphthol 1-O-a-glucopyranoside” with activity
against herpes simplex virus-type 1 [76]; “multiplolides A and B” with activity
against Candida albicans [77]. The bioactive compound isolated from the culture
extracts of the endophytic fungus Xylaria sp. YX-28 isolated from Ginkgo biloba L.
was identified as “7-amino-4-methylcoumarin” [74]. The compound presented
broad-spectrum inhibitory activity against several food-borne and food spoilage
microorganisms including S. aureus, E. coli, S. typhia, S. typhimurium, S. enteritidis,
A. hydrophila, Yersinia sp., V. anguillarum, Shigella sp., V. parahaemolyticus, C.
albicans, P. expansum, and A. niger, especially to A. hydrophila, and was suggested
to be used as natural preservative in food [74]. Another strain F0010 of the
endophytic fungus Xylaria sp. from Abies holophylla was characterized as a
producer of “griseofulvin”., a spirobenzofuran antifungal antibiotic agent used for
the treatment of human and veterinary animals mycotic diseases [78]. They
evaluated and reported high antifungal activity in vivo and in vitro of the
endophyte-produced griseofulvin against plant pathogenic fungi, controlling
effectively the development of various food crops.
Aliphatic compounds, frequently detected in cultures of endophytes, often show
biological activities. Four antifungal “aliphatic compounds” were characterized
from stromata of E. typhina on P. pratense [79]. Ester metabolites isolated from an
endophyte of the eastern larch presented antimicrobial activity. One compound
was toxic to spruce budworm (Choristoneura fumiferana Clem.) larvae, and the
![Page 15: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/15.jpg)
- 14 -
other may serve as potent antibacterial agent against Vibrio salmonicida,
Pseudomonas aeruginosa, and Staphylococcus aureus [80]. Chaetomugilin A and D
with antifungal activities, were isolated from an endophytic fungus C. globosum
collected from Ginkgo biloba [81]. Cytosporone B and C were isolated from a
mangrove endophytic fungus, Phomopsis sp. They inhibited two fungi C. albicans
and F. oxysporum with the MIC value ranging from 32 to 64 mg/ml [82].
Chlorinated metabolites such as mycorrhizin A, cryptosporiopsin isolated from
endophytic Pezicula strains were reported as strongly fungicidal and herbicidal
agents, and to a lesser extent, as algicidal and antibacterial agents [83]. Similarly,
other new chlorinated benzophenone derivatives, “Pestalachlorides A”
(C21H21Cl2NO5) and “B” (C20H18Cl2O5), from the plant endophytic fungus
Pestalotiopsis adusta, proven to display significant antifungal activity against three
plant pathogenic fungi, Fusarium culmorum, Gibberellin zeae, and Verticillium albo-
atrum [84].
The production of “Hypericin” (C30H16O8), a naphthodianthrone derivative, and
“Emodin” (C15H10O5) is believed to be the main precursor of hypericin, by the
endophytic fungus isolated from an Indian medicinal plant, was reported. Both
compounds demonstrated antimicrobial activity against several bacteria and
fungi, including Staphylococcus aureus, Klebsiella pneumonia ssp. ozaenae,
Pseudomonas aeruginosa, Salmonella enterica ssp. Enteric, and Escherichia coli, and
fungal organisms Aspergillus niger and Candida albicans [85].
An endophytic Streptomyces sp. from a fern-leaved grevillea (Grevillea pteridifolia)
in Australia was described as a promising producer of novel antibiotics,
“kakadumycin A” and “echinomycin”. Kakadumycin A is structurally related to
echinomycin, a quinoxaline antibiotic, and presents better bioactivity than
echinomycin especially against Gram-positive bacteria and impressive activity
against the malarial parasite Plasmodium falciparum [86]. More than 50% of
endophytic fungi strains residing in Quercus variabilis possessed growth inhibition
against at least one pathogenic fungi or bacteria. Cladosporium sp., displaying the
most active antifungal activity, was investigated and found to produce a
![Page 16: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/16.jpg)
- 15 -
secondary metabolite known as “brefeldin A” (C16H24O4), a lactone with antibiotic
activity. Results showed brefeldin A to be more potent than the positive control in
antifungal activity [87]. “Coronamycin”, a peptide antibiotic produced by an
endophytic fungi Streptomyces sp. isolated from Monstera sp., is active against
pythiaceous fungi, the human fungal pathogen Cryptococcus neoformans, and the
malarial parasite, Plasmodium falciparum [88].
Production of lipopeptide “pumilacidin”, an antifungal compound, by B. pumilus
isolated from cassava cultivated by Brazilian Amazon Indian tribes was described
for the first time [89]. The compounds “2-hexyl-3-methyl-butanodioic acid” and
“cytochalasin D” were isolated from the endophytic fungus Xylaria sp. isolated
from Brazilian Cerrado, and presented antifungal activity [90]. Two new bioactive
metabolites, “ethyl 2,4-dihydroxy-5,6-dimethylbenzoate” and “phomopsilactone”
were isolated from an endophytic fungus Phomopsis cassiae from Cassia spectabilis
and displayed strong antifungal activity against two phytopathogenic fungi,
Cladosporium cladosporioides, and C. sphaerospermum [91].
The polyketide “citrinin”, produced by endophytic fungus Penicillium janthinellum
from fruits of Melia azedarach, presented 100% antibacterial activity against
Leishmania sp. [92]. Among the 12 secondary metabolites produced by the
endophytic fungi Aspergillus fumigatus CY018 which was isolated from the leaf of
Cynodon dactylon, “asperfumoid”, “fumigaclavine C”,“fumitremorgin C”, “
physcion”, and “helvolic acid” were found to inhibit Candida albicans [93].
Endophyte Verticillium sp. isolated from roots of wild Rehmannia glutinosa
produced two compounds “2,6-Dihydroxy-2-methyl-7-(prop-1E-enyl)-1-
benzofuran-3(2H)-one”, reported for the first time, and “ergosterol peroxide”
with clear inhibition of the growth of three pathogens including Verticillium sp.
[94]. An endophytic fungus Pestalotiopsis theae of an unidentified tree in Jianfeng
Mountain, China, was capable of producing “Pestalotheol C” with anti-HIV
properties [95]. Other secondary metabolites with antimicrobial properties
isolated from endophytic microbes were reported are “3-O-methylalaternin” and
![Page 17: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/17.jpg)
- 16 -
“altersolanol A” [96], “phomoenamide” [97], “phomodione” [98], “ambuic acid”
[98], “isopestacin” [99], and “munumbicin A, B, C” and “D” [100].
Natural antioxidants are commonly found in medicinal plants, vegetables, and
fruits. However, it has been reported that the metabolites from endophytes can be
a potential source of novel natural antioxidants. Liu and coworkers evaluated the
antioxidant activity of an endophytic Xylaria sp. isolated from the medicinal plant
Ginkgo biloba [101]. The results collected indicated that the methanol extract
exhibited strong antioxidant capacity due to the presence of “phenolics” and
“flavonoids” compounds among 41 identified compounds. Huang and coworkers
investigated the antioxidant capacities of endophytic fungal cultures of medicinal
Chinese plants and its correlation to their total phenolic contents. They suggested
that the phenolic content is the major antioxidant constituent produced in the
endophytes [102].
“Pestacin” (C15H14O4) and “isopestacin”, 1,3-dihydro isobenzofurans, were
obtained from the endophytic fungus Pestalotiopsis microspora isolated from a plant
in the Papua New Guinea, Terminalia morobensis [103-104]. Besides antioxidant
activity, pestacin and isopestacin also presented antimycotic and antifungal
activities, respectively. Pestacin is believed to have antioxidant activity 11 times
greater than Trolox, a vitamin E derivative, primarily via cleavage of an unusually
reactive C-H bond and to a lesser extent, O-H abstraction [105].
Isopestacin possess antioxidant activity by scavenging both superoxide and
hydroxy free radicals in solution, added to the fact that isopestacin is structurally
similar to the flavonoids [106]. Polysaccharides from plants and microorganisms
have been extensively studied and considered as potent natural antioxidants [107–
110]. Liu and coworkers reported for the first time, the capacity of endophytic
microorganisms to produce polysaccharides with antioxidant. The bacterium
endophyte Paenibacillus polymyxa isolated from the root tissue of Stemona japonica
Miquel, a traditional Chinese medicine, produced “exopolysaccharides (EPS)” that
demonstrated strong scavenging activities on superoxide and hydroxyl radicals
[111]. “Graphislactone A”, a phenolic metabolite isolated from the endophytic
![Page 18: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/18.jpg)
- 17 -
fungus Cephalosporium sp. IFB-E001 residing in Trachelospermum jasminoides,
demonstrated to have free radical-scavenging and antioxidant activities in vitro
stronger than the standards, butylated hydroxytoluene (BHT) and ascorbic acid,
coassayed in the study [112].
Endophytic microorganisms are able to produce necessary enzymes for the
colonization of plant tissues, and to use, at least in vitro, most plant nutrients and
components. Endophytes have received attention as biocatalysts in the chemical
transformation of natural products and drugs, due to their ability to modify
chemical structures with a high degree of stereospecificity and to produce known
or novel enzymes that facilitates the production of compounds of interest.
Therefore, biotransformation is a useful method for production of novel
compounds; enhancement in the productivity of a desired compound; overcoming
the problems associated with chemical analysis; leading to basic information to
elucidate the biosynthetic pathway [113]. For this reason, biotransformation using
microbial cultures and/or their enzymatic systems alone has received increasing
attention as a method for the conversion of lipids, monoterpenes, diterpenes,
steroids, triterpenes, alkaloids, lignans, and some synthetic chemicals, carrying
out stereospecific and stereoselective reactions for the production of novel
bioactive molecules with some potential for pharmaceutical and food industries
[4, 114]. Although these microorganisms have high potential, studies using
endophytes in the field of biotransformation are still limited. The
biotransformation of a tetrahydrofuran lignan, ()-grandisin, by the endophytic
fungus Phomopsis sp. from Viguiera arenaria was demonstrated by Verza and
coworkers [115]. The process led to the formation of a new compound named as
“3,4-dimethyl-2-(-hydroxy-dimethoxyphenyl)-5-methoxy-tetrahydrofuran”, which
showed trypanocidal activity similar to its natural corresponding precursor
against the causative agent of Chagas disease, the parasite Trypanosoma cruzi.
Zikmundová and coworkers reported an endophytic fungus isolated from the
roots and shoots of Aphelandra tetragona, capable to transform benzoxazinones, 2-
benzoxazolinone (BOA) and 2-hydroxy-1,4-benzoxazin-3-one (HBOA), into
![Page 19: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/19.jpg)
- 18 -
different series of compounds [116]. The use of endophytic fungi in the
stereoselective kinetic biotransformation of “thioridazine (THD)”, a phenothiazine
neuroleptic drug, was investigated. Results showed that these microorganisms are
able to biomimic mammalian metabolism via biotransformation reactions [112].
Another study employed endophytic fungus on the biotransformation of
“propranolol (Prop)” to obtain 4-OH-Prop active metabolite in enantiomerically
pure form [4]. Another interesting topic in biotransformation process is the use of
endophytes in the biotransformation of terpenes for production of novel
compounds through enzymatic reactions carried out by these microbes.
“Terpenes” are large class of bioactive secondary metabolites used in the
fragrance and flavor industries, and have been extensively used in
biotransformation process by microorganisms with focus on the discovery of
novel flavor compounds and on the optimization of the process condition [3].
Microbial transformations of terpenes were published recently using limonene [5],
and α-farnesene [6], by diverse microorganisms. However, some research groups
have also investigated studies with the biotransformation of terpenes by
endophytes. Other endophytic microbes were studied for the capability to
biotransform natural products like taxoids [117], alkaloids [118], and pigment
curcumim [119].
Endophytes have proven to be rich sources of novel natural compounds with a
wide-spectrum of biological activities and a high level of structural diversity.
However, the application of microorganisms by the food and pharmaceutical
industries to obtain compounds of interest is still modest, considering the great
availability of useful microorganisms and the large scope of reactions that can be
accomplished by them. Novel antibiotics, antimycotics, immunosuppressant, and
anticancer compounds are only a few examples of what has been found after the
isolation and culturing of individual endophytes followed by purification and
characterization of some of their natural products. Isolation of rohitukine, a
chromane alkaloid possessing anti-cancer activity was reported from Fusarium
proliferatum [120].
![Page 20: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/20.jpg)
- 19 -
NEED FOR THE STUDY
Endophytes of medicinal plants and their potential use are a most promising
resource, which awaits exploration. The limited knowledge on the varied use of the
medicinal plants, their availability and extent of distribution in forest area limits
efficient use of these resources. Fungal endophytes have been found in every plant
species examined to date and appear to be important, but largely unquantified,
components of fungal biodiversity. Endophytes are especially little known in
tropical forest trees, where their abundance and diversity are thought to be greatest.
The biggest challenge for researchers and policy makers, therefore, is how the forest
would meet the global requirement at a time when there is steady decrease of
resources. Endophytic fungi capable of producing active metabolites can solve the
problem of overexploitation medicinal plants and RET plants leading to their
extinction. The study was aimed to explore the occurrence of endophytes in
medicinal plants and RET species. Only a few reports are available on isolation and
diversity of endophytic mycoflora from Indian medicinal plants and trees. Much
progress can be made in utilizing the fungal endophytes in agriculture, medicine
and food industry and hence it is worthwhile to conduct studies in this area to bring
out fruitful results.
![Page 21: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/21.jpg)
- 20 -
3. OBJECTIVES
Immense literature available had shown the importance of secondary metabolites
from endophytic fungi. The present study was carried out to identify true
endophytic fungi from different medicinal plants, isolate and to establish the
therapeutic potential of the secondary metabolites produced by them. The
following objectives were framed for the study;
1. Isolation and identification of endophytic fungi from three important medicinal plants - Aerva lanata, Emelia sonchifolia and RET species Cynometra travancorica.
2. Isolation and characterization of secondary metabolites from selected endophytic fungi.
3. Screening of the isolated molecules for their therapeutic potentials.
![Page 22: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/22.jpg)
- 21 -
4. MATERIALS AND METHODS
4.1 Plants and study area
Aerva lanata is a perennial herb of the Amaranthaceae family. It has significant
therapeutic properties such as an antioxidant, anti-hyperglycaemic, anthelmintic,
anti-hyperlipidemic and anti-microbial. It is extensively used in Ayurveda. The
chemical constituents of A.lanata include alkaloids, flavonoids, phenol, tannin,
proteins, amino acids and carbohydrates respectively.
Emelia sonchifolia is a herbaceous plant of the family Asteracae. It is a traditional
medicine used in India in Ayurveda and folklore medicine against inflammation,
rheumatism, cough, cuts and wounds. In China, the leaves are used as a cure in
fever and dysentery. It is also used as an analgesic agent and antibiotic. The aerial
part of the plant contains alkaloids and flavanoids.
Cynometra travancorica is a legume of the family Fabaceae. The plant is endemic to
Western Ghats and its distribution is now threatened by habitat loss. The bark of
the tree is used as a uterine tonic and as a substituent of Asoka.
4.2 Sample collection
Sampling of plant materials for isolating fungal endophytes was done during three
different seasons, pre-monsoon (April-May), monsoon (June-July) and post-
monsoon (October-November). Whole plants of Aerva lanata and Emelia sonchifolia
were collected from southern, northern and central parts of Kerala. A minimum of
twelve plants were collected from each locality. Leaves, stems and roots were used
for inoculation. Leaves and stems of three different trees of Cynometra travancorica
collected from different forest areas viz., Shiruvani, Shenduruny, Thamarassery and
Vellanimala, were used for isolation of fungal endophytes (Table – 1). Sixty leaves
from each site were used for the isolation. Six explants per plate were inoculated in
ten petri plates.
![Page 23: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/23.jpg)
- 22 -
No Plant Name Months collected
Sample site Materials collection
1. Aerva lanata April, June and October
Peyad, Pathanapuram, Thodupuzha, Thrissur,
Thaliparampa and Kanhangad
Whole plant
2. Emelia Sonchifolia
April, June and October
Peyad, Pathanapuram, Thodupuzha, Thrissur,
Thaliparampa and Kanhangad
Whole plant
3. Cynometra travancorica
May, July and November
Siruvani, Shendurney, Thamarassery and
Vellanimala
Leaves and stem
Table - 1: Particulars of sample collection.
4.3 Isolation of endophytes
The leaves, stems and roots were surface sterilized in 75% ethanol for 60 seconds.
Leaf bits (0. 5 cm dia and 0.5 cm long) of stem and root tissues were cut and rinsed
in sterile distilled water 3 times and allowed to surface dry in sterile conditions.
Five different media were initially used for fungal isolation to identify the best
medium for isolation in terms of growth and diversity. These were:
1. Potato dextrose agar (PDA)
2. Sabouraud’s dextrose agar
3. PDA with Rose Bengal
4. Water agar and
5. Oat meal Agar.
Of these, oat meal agar (OMA) was found to give optimum fungal growth (rapid
growth and more number of colonies) and was selected for further study. Sixty
bits of leaf, stem and root of each plant were used for plating at each sampling
time. The plant tissues were evenly placed in petri dishes containing OMA
amended with streptopenicillin, to suppress bacterial growth. Inoculated plates
were incubated for 30 days at room temperature. Tissues were observed for fungal
growth at alternate day intervals. Pure cultures obtained after subculture were
stored at -4°C on OMA slants for preservation. A total of 113 pure cultures were
obtained (Table - 2).
![Page 24: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/24.jpg)
- 23 -
Plant Part used for isolation No of pure cultures obtained
Aerva lanata Leaves 12
Stem 11
Root 15
Emelia sonchifolia Leaves 18
Stem 13
Root 14
Cynometra travancorica Leaves 12
Stem 18
Total 113
Table – 2: No of cultures obtained from different parts of the plants used for the study.
4.4 Analysis of data
a. Frequency of occurrence of endophytes (%): The fungal population
was quantified as frequency of occurrence as given below
[No of leaf discs colonised by a given fungus/total number of explants
observed] x 100 [121].
b. Colonization rate:
[Total number of explants in a sample yielding 1 isolate or more/ total
number of leaf segments in that sample] x 100 [122]
c. Isolation rate: Isolation rate was determined by Frohlich et al. [123].
[Total number of isolates yielded by a given sample/total number of
explants in that sample].
4.5 Morphological identification of true fungal endophytes
Attempts were made to identify fungi based on morphological features. It proved
to be difficult since most of the cultures remained sterile without producing any
fruiting bodies which is necessary for identification. This is a common
characteristic of fungal endophytes. Attempts were made to induce sporulation by
altering carbon source, exposing petri plates to ultraviolet radiation, starving the
fungi, incorporating sterile host tissues in the medium and exposing the plates to
![Page 25: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/25.jpg)
- 24 -
alternate cold and hot conditions. However, most strains (cultures) failed to
sporulate.
4.6 Molecular identification of ‘true’ fungal endophytes
Genomic DNA was isolated from pure endophytic culture of C. travancorica and A.
lanata using Sigma Aldrich DNA extraction Kit. D1/D2 region of LSU (Large
subunit 28S rDNA) gene was amplified by PCR from the above isolated genomic
DNA. DNA sequencing was carried out with PCR amplicon. The D1/D2 region of
LSU (Large subunit 28S rDNA) gene sequence was used to carry out BLAST with
the nr database of NCBI gene bank database.
Two fungi namely, Colletotrichum gloeosporiodes and Diaporthe eres were found
constantly associated with the leaves and stem of C. travancorica, respectively.
Likewise, Fusarium equiseti was associated with the leaves, stem and root of A.
lanata. So, these were considered as ‘true’ endophytes and not casual isolations
and were used for further studies. Emelia sonchifolia did not show such
associations with any fungi.
4.7 Isolation of secondary metabolites from endophytes
C. gloeosporiodes, F. equiseti and D. eres were cultured in bulk quantities in potato
dextrose broth at room temperature (200 C) (say the range in room temp) in 500 ml
conical flasks. The cultures were incubated for 40 days. The broth after removal of
fungal mycelium was filtered, concentrated by heating on a boiling water bath.
The concentrated broth was treated with five different solvents such as petroleum
ether, dichloromethane, ethyl acetate, methanol and water, batch wise in a
separating funnel. The extracts were separated using Thin Layer chromatography
(TLC) followed by column chromatography using suitable solvents [124]. The
eluent obtained after open column chromatography was colored when ethyl
acetate was used as solvent. Coloration can be an indication of the presence of
terpenoids or flavanoids. Single spots were observed in TLC when visualised
under UV. Two compounds each was obtained from C. gloeosporiodes (A and B)
and F. equiseti (C and D). Compound A and C were soluble in dimethyl
sulphoxide/Petroleum ether and B, D in water. No compounds were obtained
![Page 26: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/26.jpg)
- 25 -
from D. eres. The isolated compounds were characterised by IR, NMR and LC-
MS. IR was done at STIC facility, CUSAT (Cochin University of Science and
Technology), NMR and LC-MS analysis were done at SAIF, IIT, Madras, Chennai,
India.
4.8 Cell culture
SW620 cells were obtained from NCCL, Pune, cultured in complete Dulbecco's
modified eagle medium (cDMEM) composed of DMEM supplemented with
streptomycin (100 mg/ml), penicillin (100U/ml) and 10% FBS. Cells were
maintained in a humidified incubator at 370 C with 5% CO2.
4.9 Resazurin reduction assay
Cells were seeded in a 96 well plate at a density of 5000 per well and grown
overnight. Cells were treated with increasing concentration of compounds – A, B,
C and D ranging from (0, 2, 4, 6, 8 mg) in complete DMEM. Analysis of
cytotoxicity after 48 h treatment was determined by resazurin reduction assay
with slight modifications [125]. At a concentration of 0.1 mg/ml, resazurin dye
was added on to the media, incubated for 3 h, for the reduction of blue dye
resazurin to pink resorufin which is read at 570-590 nm. The data were analysed
as percent control. IC50 was obtained by determining the concentration of
compounds resulting in 50% inhibition of viability after 48h by using (Graph Pad
Software.Inc). Compound A was found to possess significant activity compared to
other three drugs. The compounds B, C and D are under further study. The rest of
the study was carried out using compound A.
4.10 Cell cycle analysis
Propidium iodide staining and flow cytometry were used to assess the cell cycle
distribution profile. The treated cells were washed with PBS-EDTA and then
harvested using 0.25% Trypsin EDTA and then suspended in cDMEM. Cells were
then washed with PBS and centrifuged at 500 x g at 40C for 5 min, and re-
suspended in 300 µl propidium iodide (2µg/ml) in the dark, incubated at 370C for
![Page 27: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/27.jpg)
- 26 -
1 h. Data from 10,000 cells were collected for each sample. Data acquisition and
analysis were performed on a flow cytometer (Beckman Coulter cell lab Quanta).
4.11 Protein isolation and Western blotting
Cells were washed with phosphate-buffered saline (PBS) 48h post treatment, and
total protein was extracted after scraping and collecting cells in radio immuno
precipitation assay (RIPA) lysis buffer [20mM Tris (pH 7.5), 150mM sodium
chloride, 1mM ethylene diamine tetra acetic acid, 1mM β-glycerophosphate, 1%
Triton X 100, 2.5mM Sodium pyrophosphate, 1mM sodium orthovanadate, 0.5%
sodium deoxycholate, 1mM phenyl methane sulfonyl fluoride, 20mM sodium
fluoride, 1% protease inhibitor, incubated for 1h, and centrifuged. Total cell
protein in the supernatant was estimated using Bradford assay, and 30μg of
protein was subjected to SDS PAGE separation followed by transfer onto
polyvinylidenedifluoride membrane. The membrane was incubated with primary
antibodies against PARP (116 kDa nuclear poly (ADP-ribose) polymerase (1:1000
dilution), or Vinculin (1:10,000 dilution) overnight, followed by incubation with
an HRP-conjugated secondary antibody. Protein bands were detected using an
enhanced chemiluminescence detection kit and visualized by using the Versa Doc
image analysis system (Bio-Rad).
![Page 28: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/28.jpg)
- 27 -
5. RESULTS AND DISCUSSION
A total of 113 fungal cultures were obtained from the tissues of the three plants.
Most strains were sterile in nature and could not be identified. The frequency of
occurrence, colonisation rate and isolation rate were more in A. lanata and E.
sonchifolia compared to C. travancorica. However, molecular techniques were
employed to those fungi which were constantly isolated from plant tissues.
Sequenced data of D1/D2 region of LSU (Large Subunit 28S rDNA) after
subjecting to BLAST with the nr database of NCBI gene bank database revealed
that endophyte from leaves of Cynometra travancorica was Colletotrichum
gloeosporioides with 100% similarity with accession number KM823608, from the
stem was D. eres with 99% similarity with accession number KM823609 and
Fusarium equiseti from leaves, stem and root with accession number KM823608. Of
these, the identity of D. eres requires further confirmation (Figure - 1, 2, 3, 4 and
Table-3). No true endophytes were obtained from E. sonchifolia. Infrequent
isolates which was not isolated from all the localities were not selected for further
studies (Table - 5, 6, 7, 8, 9 and 10).
The compound A from the true endophyte C. gloeosporioides was subjected to
structural and biological studies. The compound B from C. gloeosporioides and the
compounds C and D from Fusarium equiseti are under investigation for structural
details and biological properties.
Consensus Sequence Data of Colletotricum gloeosporioides ATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATT TGAAATCTGGCCCTAGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGTGCGGTGCCTTCCAAGTTCCCTAGA ACGGGACGCCAGAGAGGGTGAGAGCCCCGTACAGTTGGACACCAAGCCTTTGTAAAGCTCCTTCGACGAGTCGA GTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCG CACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGCACGTGAAATTGTTAAAAGGG AAGCGCTTGTGACCAGACTTGCGTCCGGTGAATCACCCAGCTCTCGCGGCTGGGGCACTTCGCCGGCTCAGGCC
![Page 29: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/29.jpg)
- 28 -
AGCATCAGCTCGCTGTCGGGGACAAAAGCTTCAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTGTTGCAT AATACCCTTCGGCGGGCTGAGGTACGCGCTCCGCAAGGATGCTGGCATAATGGTCATCAGCGA Consensus Sequence Data of D. eres AGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTC AAATTTGAAATCTGGCTTCGGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGTGCCTTCCGAGTTCCC TGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTCGGACACCAAGCCTGTGTGAAGCTCCTTCAACGAG TCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGAT AGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAA AGGGAAGCACTTATGACCAGACTTGGGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCACA GGCCAGCATCGGTTCTCGTGGGGGGATAAGACCGTCAGGAACGTAGCACCCTCCGGGGTGTGTTATAGCCTGGC GGACGATACCCCCGTGGGGACCGAGGTCCGCGCTCCGCAAGGATGCTGGCGTAATGGTCATCAGTGACCCGTCTT Consensus Sequence Data of F. equiseti AGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCG AGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTCGGGCCCGAGTTGTAATTT GTAGAGGATGCTTTTGATGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGA GGGTGAGAGCCCCGTCTGGTTGGATGCCAAATCTCTGTAAAGCTCCTTCGACGAGTC GAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATAC CGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGA AAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACT TGGGCTTGGTTAATCATCTGGGGTTCTCCCCAGTGCACTTTTCCAGTCCAGGCCAGAT CAGTTTTCGCCGGGGGATAAAGGCTTCGGGAATGTGGCTCTCTCCGGGGAGTGTTAT AGCCCGTTGCGTAATACCCTGGCGGGGACTGAGGTTCGCGCATCTGCAAGGATGCTG GCGTAATGGTCATCAACGACCCGTCT
![Page 30: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/30.jpg)
- 29 -
b. c.
Figure – 1 : Representative cultures of fungal endophytes isolated from (A) leaves, (B)
stem and (C) root of Aerva lanata.
Figure – 2 : Representative cultures of fungal endophytes isolated from (A) leaves and (B) stem of Cynometra travancorica.
Figure – 3 : Representative cultures of fungal endophytes isolated from (A) leaves, (B)
stem and (C) root of Emelia sonchifolia.
B
A B C
A B
A B C
![Page 31: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/31.jpg)
- 30 -
Table – 3 : Frequency, Colonisation and Isolation rate of endophytes from C.
travancorica, A. lanata and E. sonchifolia
Figure – 4 : (A) True fungal endophyte isolated from Cynometra travancorica -
Colletotrichum gloeosporiodes, (B) Pure culture of Diaporthe eres, (C) True fungal endophyte
isolated from Aerva lanata – Fusarium equiseti
Plant Frequency of occurrence of endophytes
(value - %)
Colonisation rate
(value - %)
Isolation Rate
(value - %)
A. lanata
Leaf – 98.8
Stem – 87.6
Root - 98.3
Leaf - 80
Stem -73.3
Root -66.6
Leaf – 86
Stem- 93.3
Root – 86.6
E. sonchifolia
Leaf - 95.5
Stem - 92.8
Root - 68.45
Leaf - 93
Stem -73.3
Root -60
Leaf – 90
Stem- 80
Root - 73
C. travancorica
Leaf –70.6
Stem –62.25
Leaf -86.6
Stem -60.0
Leaf –80
Stem-46.6
A B C
![Page 32: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/32.jpg)
- 31 -
Table - 4 : Fungal endophytes from the leaves of C. travancorica
Table – 5: Fungal endophytes from the stem of C. travancorica
Fungi/Location Vellanimala Shendurney Thamarassery Siruvani
May July Nov May July Nov May July Nov May July Nov
Colletotrichum gloeosporiodes
+ + + + + + + + + + + +
Phomopsis sp - - + + - - + + - - + + Sterile white Mycelium (with black Pigmentation)*
+ + + + + + + + + + + +
Sterile white Mycelium (without Pigmentation)**
+ + + + + + + + + + + +
*Contains a group of 5 morphotypes none of which were isolated constantly from any locality during any season.; +, present; -, absent
** Contains a group of 12 morphotypes none of which were isolated constantly from any locality during any season.; +, present; -, absent
Fungi/Location Vellanimala Shendurney Thamarassery Siruvani
May July Nov May July Nov May July Nov May July Nov
Diaporthe eres + + + + + + + + + + + +
Fusarium sp. - - - - - - + + - - - +
Sterile white mycelium*
+ + + + + + + + + + + +
*Contains a group of 17 morphotypes none of which were isolated constantly from any locality during any season.; +, present; -, absent
![Page 33: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/33.jpg)
- 32 -
Table – 6: Fungal endophytes from the leaves of A. lanata
Fungi/Location Kanhangad Thaliparamba Thodupuzha Thrissur Pathanapuram Peyad
A J O A J O A J O A J O A J O A J O
Fusarium equiseti + + + + + + + + + + + + + + + + + +
Phomopsis species
+ + + - + - - + + - - - - - - - - -
Sterile grey mycelium*
+ - + - + - + - - + + + + + + + - -
Sterile brown mycelium**
- - - - - - - - - - - - - - + - - -
*Contains a group of 3 morphotypes none of which were isolated constantly from any locality during any season.; +, present; -, absent
** Contains a group of 1 morphotype which was not isolated constantly from any locality during any season.; +, present; -, absent. A- April, J-June, O-October
Table – 7: Fungal endophytes from the stem of A.lanata
Table – 8: Fungal endophytes from the roots of A. lanata
Fungi/Location Kanhangad Thaliparamba Thodupuzha Thrissur Pathanapuram Peyad
A J O A J O A J O A J O A J O A J O
Fusarium equiseti + + + + + + + + + + + + + + + + + +
Fusarium sp. - - + - - - + + - - - + + + + + + +
Sterile grey mycelium*
+ - + - + - + - - + + + + + + + - -
*Contains a group of 3 morphotypes none of which were isolated constantly from any locality during any season.; +, present; -, absent. A- April, J-June, O-October
Fungi/Location Kanhangad Thaliparamba Thodupuzha Thrissur Pathanapuram Peyad
A J O A J O A J O A J O A J O A J O
Fusarium equiseti
+ + + + + + + + + + + + + + + + + +
Sterile grey mycelium*
+ + + + - - + + + - - - + + - - - -
Sterile white mycelium**
+ + + + + + + + - + + + + + + + + +
*Contains a group of 6 morphotypes none of which were isolated constantly from any locality during any season.; +, present; -, absent
** Contains a group of 10 morphotypes none of which were isolated constantly from any locality during any season.; +, present; -, absent. A- April, J-June, O-October
![Page 34: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/34.jpg)
- 33 -
Fungi/Location Kanhangad Thaliparamba Thodupuzha Thrissur Pathanapuram Peyad
A J O A J O A J O A J O A J O A J O
Sterile whit
mmycelium*
+ + + + + + + + + + + + - + + + + -
Sterile cottony white mycelium**
+ + - - - + + + + + + + - + - - - -
Sterile brown mycelium***
+ - - + + - - - + + + + - - - - - -
*Contains a group of 4 morphotypes none of which were isolated constantly from
any locality during any season.; +, present; -, absent
** Contains a group of 8 morphotypes none of which were isolated constantly from
any locality during any season.; +, present; -, absent
***Contains a group of 3 morphotypes none of which were isolated constantly from any locality during any season.; +,
present; -, absent. A- April, J-June, O-October
Table – 9: Fungal endophytes from the leaves of E. sonchifolia
Table – 10: Fungal endophytes from the roots of E. sonchifolia
Scanning Electron Microscope (SEM) study
SEM study of the fungal cultures revealed the presence of chlamydospores. Only
vegetative spores were found to be present. The cultures were sterile (Figure – 5 -
7).
Fungi/Location Kanhangad Thaliparamba Thodupuzha Thrissur Pathanapuram Peyad
A J O A J O A J O A J O A J O A J O
Sterile white mycelium*
+ + + + + + + + + + - + + + + + + +
Sterile grey mycelium**
- - - - + + + + + - - - + + + - - +
*Contains a group of 10 morphotypes none of which were isolated constantly from any locality during any season.; +, present; -, absent
** Contains a group of 3 morphotypes none of which were isolated constantly from any locality during any season.; +, present; -, absent. A- April, J-June, O-October
![Page 35: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/35.jpg)
- 34 -
Figure - 5 : (A) Scanning electron microscope image of mycelium of C. gloeosporiodes (B) Scanning electron microscope image of hyphae of C. gloeosporiodes.
Figure – 6 : (A) Scanning electron microscopic image of mycelium of Diaporthe eres (B) Scanning electron microscopic image of hyphae of Diaporthe eres, with Chlamydospores.
Figure – 7 : (A) Scanning electron microscopic image of mycelium of Fusarium equiseti (B) Scanning electron microscopic image of hyphae of Fusarium equiseti with Chlamydospores.
A B
A A B
A B
![Page 36: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/36.jpg)
- 35 -
The D1/D2 region of isolated fungal DNA after amplification by PCR using
universal primers obtained bands between 500-600 bp (Figure - 8 and 9). The PCR
amplicon was subjected to sequencing.
a. b.
Figure – 8: Agarose gel showing PCR amplification of DNA from (a) C. gloeosporiodes and
(b) Fusarium equiseti. M is DNA size marker of 100 bp, Lane one is amplified DNA from
the fungi.
a. b.
Figure – 9 : Agarose gel showing the PCR-amplified rDNA with Eco R1 Hind III double digest marker 125 bp from (a) C. gloeosporiodes and (b) Fusarium equisitei
![Page 37: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/37.jpg)
- 36 -
Koch’s Postulates
The true endophytes C.gloeosporioides and Fusarium equiseti inoculated in
Potato Dextrose Broth secreted secondary metabolites (Figure-10). At the same
time, D.eres did not secrete any metabolites. Koch’s postulates were confirmed for
the fungal endophytes. The inoculated cultures were successfully re-isolated from
the plants in which it was inoculated (Figure -11).
Figure – 10 : Potato Dextrose Broth inoculated with Colletotrichum gloeosporiodes for
metabolite isolation
Figure – 11 : Confirmation of Koch’s postulates to affirm the pathogenicity of the strain.
![Page 38: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/38.jpg)
- 37 -
Thin layer chromatography
Single spot was detected under UV after Thin layer chromatography confirming
the purity of compound (Figure-12).
a. Separation of metabolites using Separating funnel b. TLC of the metabolites
c. Column chromatography of the metabolites d. Thin layer chromatogram of the isolated metabolites under UV
Figure – 12 : Separation of secondary metabolites using, TLC and Column chromatography.
![Page 39: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/39.jpg)
- 38 -
IR Spectrum
From the IR spectrum the peaks of compound A, isolated from Colletotrichum
gloeosporiodes, 2042 cm-1, 2947 cm-1 and 3404 cm-1 indicate the presence of
terpenoids 3404-OH/COOH (Figure -13).
The IR spectrum of compound A exhibited diagnostic absorption bands of
hydroxyl (3443 cm−1), γ-lactone (1776 cm−1), ester carbonyl (1722 cm−1) and
conjugated ketone (1655 cm−1) functionalities.
Figure – 13: IR spectrum of Drug A
NMR spectrum
The chemical shift at 4.23 ppm indicates that the compound is aliphatic in nature
The 1H and 13C NMR spectroscopic data indicated the presence of a methyl
singlet (δH 1.08; δC 16.5, C-15), a methyl doublet (δH 1.19, J = 7.0 Hz; δC 8.5, C-19),
one exocyclic double bond (δH 5.02, 4.98, each s, H2-20; δC 112.5, C-20; δC 149.7, C-
11), one trisubstituted double bond (δH 6.89, d, J = 9.6 Hz, H-6; δC 134.5, C-5; 136.8,
C-6), four oxygenated methine protons and carbons, (δH 5.11, d, J = 7.6 Hz; δC 75.6,
C-2; δH 5.31, d, J = 9.6 Hz; δC 78.3, C-7; δH 5.60, d, J = 2.8 Hz; δC 72.8, C-9; δH 4.64, t,
J = 2.8 Hz; δC 74.1, C-14), an oxygenated quaternary carbon (δC 83.5, C-8), four
methylene carbons (δC 32.3, 24.1, 31.4, 28.9) and two methine carbons (δC 43.9 and
44.7), together with a conjugated ester carbonyl (δC 166.8, C-16) and γ-lactone
carbonyl carbon (δC 174.4, C-19) (Figure - 14 & 15).
![Page 40: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/40.jpg)
- 39 -
Figure – 14 : HNMR spectrum of drug A
Figure - 15 : 13CNMR of drug A
LC-MS
From the LC-MS spectrum the mass of the compound A is determined to be
201.05 kDa (Figure – 16).
.
![Page 41: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/41.jpg)
- 40 -
Figure – 16 : LC-MS of drug A
Cytotoxicity
Cell viability was significantly reduced in a dose-dependent manner after drug
treatment (Figure -17). The IC50 value of compound A at 48 h was found to be
4mg/ml from the resazurin assay indicating its cytotoxicity to colorectal cancer
cells. The terpenoids from the endophytic fungi was found to possess significant
cytotoxic activity at a concentration of 4mg/ml.
Cell cycle analysis
In cell cycle analysis, sub G0 population was high indicating the programmed cell
death indicating the ability of the drug to induce apoptosis. The population
distribution for control group in sub-G0, G0-G1, S and G2M phase was 2.6%,
67.90%, 14.76% and 15.24% compared to treated group with the readings 23%,
29%, 24% and 24%. The sub G0 population was 12 fold high for treated group. G0-
G1 showed reduction in treated group compared to control group (Figure – 18 a &
b).
![Page 42: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/42.jpg)
- 41 -
Figure – 17 : Resazurin assay showing IC50 of drug A in SW620 cells
Figure - 18(a). Cell cycle distribution in SW 620 cell line without treatment of Ct.
0
10
20
30
40
50
60
70
80
2 4 6 8 10
IC 5
0
Concentration of drug A in mg//ml
![Page 43: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/43.jpg)
- 42 -
Figure - 18(b). Effect of drug A on cycle cycle distribution in SW 620 cell line.
Western blot analysis
PARP protein was detected in Western analysis. In human, PARP is a 116 kDa
nuclear poly (ADP-ribose) polymerase protein having role in maintaining cell
viability and DNA repair in response to stress and considered as a marker for cells
undergoing apoptosis. During stress, the cleavage of the total PARP protein
occurs between Asp214 and Gly215, resulting in amino-terminal DNA binding
domain (24 kDa) of PARP as well as the carboxy-terminal catalytic domain (89
kDa). With stress after treatment with compound A, the total PARP level was
![Page 44: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/44.jpg)
- 43 -
found to be reduced an indication of its cleavage which results in cellular
disassembly and in apoptosis. Our findings suggest that the terpenoid isolated
from the endophytic fungus Colletotrichum gloeosportioides was found to possess
anticancer activity in colon cancer cell line, SW 620.
Endophytic fungi are a precious resource of rare and valuable compounds which
possess a broad range of therapeutic properties. After the discovery of taxol from
the endophytic fungus, Taxomyces andreanae, research on endophytes gained
importance. Tropical endophytes are a target for study in recent years but few
studies have addressed the therapeutic potentials of these fungi [121]. Present
study was undertaken to assess the therapeutic potentials of endophytic fungi
isolated from medicinal plants and a rare and endangered species occurring in the
forests of the Western Ghats, a hot spot of biodiversity. Most fungi isolated were
sterile and therefore only those strains which were constantly associated with the
tissues of the selected plants were used for further studies. Two endophytes viz.,
Colletotrichum gloeosporiodes and Diaporthe eres were isolated from the leaves and
stem of C. travancorica, respectively. Diaporthe eres, another true endophyte
isolated from the stem of C. travancorica was found incapable of producing
compounds after 40 days incubation. Studies using Colletotrichum gloeosporiodes
proved that it produces terpenoids possessing cytotoxity and anticancer activity in
colon cancer cell lines, SW620.
Studies elsewhere have shown that Colletotrichum gloeosporiodes is capable of
producing taxol, the anticancer drug [126]. Taxol is an expensive anticancer drug
extracted from the plant Pacific yew, Taxus brevifolia. Endophytic fungi capable of
producing compounds with anticancer property can be used as a substitute for
plants with these properties. This would prevent over exploitation of the plants
which may lead to extinction of such plants. The compounds produced from the
other fungus, F. equiseti isolated from A. lanata are currently being investigated.
Host-endophyte relation is a type of mutualism which helps the plants for disease
resistance, drought tolerance and growth enhancement. These mutualistic
![Page 45: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/45.jpg)
- 44 -
endophytes are considered to have evolved from parasitic or pathogenic fungi.
The interface of fungal endophyte-plant host is characterized by a finely tuned
equilibrium between fungal virulence and plant resistance. The utilization of the
fungal endophyte for therapeutic potentials demands intelligent screening.
In short, our rationale for studying endophytic microbes as potential sources of
new medicines is to tap this unexplored area of biochemical diversity. Also, the
endophytes can protect the plant by virtue of the antimicrobial compounds that
they produce. It is possible that the drugs derived out of a plant endophyte will
have reduced toxicity compared to drugs developed from chemicals. Thus, the
plants themselves serve as a storehouse of microbes having bioactive molecules
with reduced toxicity towards higher organisms. We must use modern
technologies to understand this important resource and make it available for the
benefit for the mankind.
![Page 46: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/46.jpg)
- 45 -
6. SUMMARY
A study was carried out to isolate, identify and evaluate the therapeutic potentials
of endophytic fungi from 2 medicinal plants, viz., Aerva lanata and Emelia
Sonchifolia and a rare, endangered and threatened (RET species) viz., Cynometra
travancorica in Kerala. Samples of medicinal plants for the study were collected
from southern, central and northern parts of Kerala and samples of RET species
from four different forest areas of south Western Ghats. Sampling was done
during three different seasons, pre-monsoon, monsoon and post-monsoon. In all,
one hundred and thirteen endophytic cultures were obtained from the study. Of
these, three ‘true’ endophytic fungal species viz., Colletotrichum gloeosporoides
(isolated from C. travancorica), Diaporthe eres (C. travancorica), and Fusarium equiseti
(A. lanata) were screened for secondary metabolites. Secondary metabolites from
the fungi were isolated and characterised by IR, NMR and Mass spectrum. Two
compounds each were isolated from C. gloeosporiodes (A and B) and F. equiseti (C
and D). No compounds were obtained from D.eres. All compounds were
identified as terpenoids and were subjected to cytotoxicity, cell cycle analysis and
anticancer studies employing colon cancer cell line SW620. The compound A
isolated from Colletotrichum gloeosporoides was found to possess anticancer activity
in colon cancer cell lines. The properties of compounds B isolated from C.
gloeosporiodes, and the compounds C and D isolated from A. lanata are currently
being investigated.
It is only natural that the constantly growing market demand and increasing
marketisation would encourage destructive harvesting practices. As per a study,
70% of the medicinal plant collections involve destructive harvesting practices,
leading to useful plant species becoming endangered or threatened (report of the
task force on conservation and sustainable use of medicinal plants, Planning
Commission, 2000). The biggest challenge for researchers and policy makers,
therefore, is how would the forest meet the global requirement at a time when
there is steady decrease of resources? Medicinal plants can be preserved and
used for common human ailments. These plants have secondary plant
![Page 47: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/47.jpg)
- 46 -
metabolites of different composition are grouped as alkaloids, glycosides,
terpenoids, steroids, saponin, essential oils etc. Fungal endophytes capable of
producing these metabolites can solve the problem of over exploitation of the
plants leading to extinction. The plant endophytic fungi are novel mine of natural
bioactive compounds with great potentials in agriculture, medicine and food
industry. Taking advantage of modern technologies we can better understand
and manipulate this important microorganism resource and make it more benefit
for the mankind. Thus metabolites from the fungal endophytes of several
precious herbs and plants can be developed into medicines in laboratories and
can benefit the public. Fungal endophytes have been found in every plant species
examined to date and appear to be important, but largely unquantified,
components of fungal biodiversity. Endophytes are especially little known in
tropical forest trees, where their abundance and diversity are thought to be
greatest. The study proposed is aimed to explore the occurrence of endophytes in
medicinal plants and RET species. Only a few reports are available on isolation
and diversity of endophytic mycoflora from Indian medicinal plants and trees.
Much progress can be made in utilizing the fungal endophytes in agriculture,
medicine and food industry and hence it is worthwhile to conduct studies in this
area which can bring out fruitful results. The present study had identified few
promising molecules from the true endophytes from Cyanometra travancorica and
Aerva lanata.
![Page 48: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/48.jpg)
- 47 -
7. OUTCOMES OF THE PROJECT
Salient achievements
Identified the true endophytes of Cyanometra travancorica and Aerva lanata
Identified two compounds each from the endophytic fungi C. gloeosporioides
and Fusarium equiseti – Compound A, B, C and D respectively.
Compound A, a terpenoid from C. gloeosporioides with cytotoxic activity, G0
arrest in cell cycle analysis and anticancer activity in colon cancer cell lines was
isolated.
Research publications
Thulasi G. Pillai and R.Jayaraj. Colletotrichum gloeosporioides, a true endophyte of the endangered tree, Cynometra travancorica in the Western Ghats. Journal of Plant Pathology and Microbiology.2015. 6.267-269.
Thulasi G. Pillai and R.Jayaraj. Identification of Endophytic Fungi/Opportunistic Pathogen from the Perennial Herb of Amaranthaceae Family. J. Plant Physiology and Pathology. 2015. 3.1-2.
Papers presented in Conferences Post irradiation protection and enhancement of DNA repair of beta glucan
isolated from Ganoderma lucidum. Thulasi G. Pillai et al., National conference on “Current Perspectives on Environmental Mutagenesis and Human Health” held at Bhabha Atomic Research Centre, Mumbai, from Jan 28-30, 2013.
27th International Carbohydrate Symposium organized by International carbohydrate organization at IISc, Bangalore from Jan 12-17, 2014. Thulasi G. Pillai and C. K. K. Nair. Fungal polysaccharide protects radiation induced DNA damage in human lymphocytes.
International conference on Proteomics organised by IIT, Bombay from 06.12.2016 to 11.12.2016. Thulasi G Pillai. Genomic analysis of C. gloeosporiodes from an endophytic fungi, Lifestyle transition in host.
![Page 49: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/49.jpg)
- 48 -
8. SCOPE OF FUTURE WORK
Understanding the diversity of fungal endophytes of major medicinal plants in the
Western Ghats which have therapeutic value is an area which is less explored. The
limited knowledge on the varied use of the medicinal plants, their availability and
extent of distribution in forest area limits efficient use of these resources.
Endophytes of medicinal plants and their potential use are a most promising
resource, which awaits great exploration. The present study can fill this gap to
certain extent and lay foundation for future studies.
Only a few reports are available on isolation and diversity of endophytic
mycoflora from Indian medicinal plants and trees. The fungal kingdom is species-
rich, and fungi perform a multitude of functions in the ecosystems, yet the extent
of fungal diversity is poorly known. Reports suggest that active metabolites
produced by endophytic fungi have medicinal importance. eg. The anticancer
drug, taxol is produced by the endophytic fungus Taxomyces andreanae, and the
potent antileukemia agent vincristine from leaves of Catharanthus roseus. The
forest is an integral part of a traditional life-style. Western Ghats is one of the 33
recognised sensitive zones of the world. In several ways it is most unique. The
Western Ghats and Sri Lanka biodiversity hotspot, with its unique assemblages of
plant and animal communities and endemic species, is globally important for
conserving representative areas of the Earth’s biodiversity, making it worthy of
international attention.
![Page 50: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/50.jpg)
- 49 -
9. BIBLIOGRAPHY
1. S.K.Gond., A.Mishra, V.K.Sharma, S.K Verma., J.Kumar, R.N.Kharwar, A.Kumar, Diversity and Antimicrobial activity of endophytic fungi isolated from Nycanthes arbour-tritis, a well –known medicinal plant of India. Mycoscience, vol.53, pp85-166, 2011.
2. J.Berdy. Bioactive microbial metabolites. J of Antibiot, vol.58,pp.1-26,2005. 3. M.M.Dreyfuss, and I.H.Chapela. 1994. Potential of fungi in the discovery of novel,
low molecular weight pharmaceuticals. In the discovery of natural products with therapeutic potential. Edited by U.F. Gullo. Butterworth-Heinemann, London.Pp.49-80.
4. D.Hoffmeister, N.P.Keller. Natural Products of filamentous fungi: enzymes, genes and their regulation.Nat.Prod.Rep.vol.24, pp.393-416,2007.
5. R.Tiwari, A.Kalra, M.P.Darokar, M.Chandra, N.Aggarwal, S.K.Singh, S.P.S.Khanuja. Endophytic bacteria from Ocimum sanctum and their yield enhancing capabilities. Curr. Microbiol. Vol.60, pp.167-171,2010.
6. K.R.Sridhar and N.S.Raviraj. Endophytes – a crucial issue. Current Science, vol.69, pp.570-571, 1995.
7. O.Petrini. Notes on some species of Chloroscypha endophytic in Cupressaceae of Europe and North America. Sydowia, vol.35, pp.206-222, 1989.
8. T.N.Sieber. Endophytic fungi in twigs of healthy and diseased Norway spruce and White fir. Mycological Research, vol. 92, pp.322-326,1989.
9. P.J.Fisher, O.Petrini, L.E.Petrini and E.Descals. 1993. A preliminary study of fungi inhabiting xylem and whole stems of Olea europea. Sydowia, vol.44,pp117-121, 1993.
10. J. Li, G.-Z. Zhao, H.-H. Chen et al., “Antitumour and antimicrobial activities of endophytic streptomycetes from pharmaceutical plants in rainforest,” Letters in Applied Microbiology, vol. 47, no. 6, pp. 574–580, 2008.
11. R. X. Tan and W. X. Zou, “Endophytes: a rich source of functional metabolites,” Natural Product Reports, vol. 18, no. 4, pp. 448–459, 2001.
12. K.-H. Kogel, P. Franken, and R. Hückelhoven, “Endophyte or parasite—what decides?” Current Opinion in Plant Biology, vol. 9, no. 4, pp. 358–363, 2006.
13. G. Strobel, B. Daisy, U. Castillo, and J. Harper, “Natural products from endophytic microorganisms,” Journal of Natural Products, vol. 67, no. 2, pp. 257–268, 2004.
14. G. Strobel and B. Daisy, “Bioprospecting for microbial endophytes and their natural products,” Microbiology and Molecular Biology Reviews, vol. 67, no. 4, pp. 491–502, 2003.
15. Strobel, “Endophytes as sources of bioactive products,” Microbes and Infection, vol. 5, no. 6, pp. 535–544, 2003.
16. Q. L. Souza, A. D. L. Souza, S. Astolfi Filho, M. L. Belém Pinheiro, M. I. M. Sarquis, and J. O. Pereira, “Atividade antimicrobiana de fungos endofíticos isolados de plantas tóxicas da Amazônia: Palicourea longiflora (aubl.) rich e Strychnos cogens bentham,” ACTA Amazônica, vol. 34, pp. 185–195, 2004.
17. N. L. Owen and N. Hundley, “Endophytes—the chemical synthesizers inside plants,” Science Progress, vol. 87, no. 2, pp. 79–99, 2004.
18. R.Zhang, J.An. Wang et al., “Exploring novel bioactive compounds from marine microbes,” Current Opinion in Microbiology, vol. 8, no. 3, pp. 276–281, 2005.
19. D. J. Newman and G. M. Cragg, “Natural products as sources of new drugs over the last 25 years,” Journal of Natural Products, vol. 70, no. 3, pp. 461–477, 2007.
20. A.A. L. Gunatilaka, “Natural products from plant-associated microorganisms: distribution, structural diversity, bioactivity, and implications of their occurrence,” Journal of Natural Products, vol. 69, no. 3, pp. 509–526, 2006.
![Page 51: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/51.jpg)
- 50 -
21. J. L. Bicas, A. P. Dionísio, and G. M. Pastore, “Bio-oxidation of terpenes: an approach for the flavor industry,” Chemical Reviews, vol. 109, no. 9, pp. 4518–4531, 2009.
22. K. B. Borges, W. D. S. Borges, R. Durán-Patrón, M. T. Pupo, P. S. Bonato, and I. G. Collado, “Stereoselective biotransformations using fungi as biocatalysts,” Tetrahedron Asymmetry, vol. 20, no. 4, pp. 385–397, 2009.
23. L. Bicas, F. F. C. Barros, R. Wagner, H. T. Godoy, and G. M. Pastore, “Optimization of R-(+)-α-terpineol production by the biotransformation of R-(+)-limonene,” Journal of Industrial Microbiology and Biotechnology, vol. 35, no. 9, pp. 1061–1070, 2008.
24. U. Krings, B. Hardebusch, D. Albert, R. G. Berger, M. Maróstica Jr., and G. M. Pastore, “Odor-active alcohols from the fungal transformation of α-farnesene,” Journal of Agricultural and Food Chemistry, vol. 54, no. 24, pp. 9079–9084, 2006.
25. R. G. Berger, “Biotechnology of flavours-the next generation,” Biotechnology Letters, vol. 31, no. 11, pp. 1651–1659, 2009.
26. Scopus American Cancer Society, “Cancer Facts & Figures 2009,” American Cancer Society, Atlanta, Ga, USA, 2009. WHO Mortality Database, Fact sheet No. 297. February 2009.
27. V. Gangadevi and J. Muthumary, “Taxol, an anticancer drug produced by an endophytic fungus Bartalinia robillardoides Tassi, isolated from a medicinal plant, Aegle marmelos Correa ex Roxb,” World Journal of Microbiology and Biotechnology, vol. 24, no. 5, pp. 717–724, 2008.
28. G. Pasut and F. M. Veronese, “PEG conjugates in clinical development or use as anticancer agents: an overview,” Advanced Drug Delivery Reviews, vol. 61, no. 13, pp. 1177–1188, 2009.
29. S. Firáková, M. Šturdíková, and M. Múčková, “Bioactive secondary metabolites produced by microorganisms associated with plants,” Biologia, vol. 62, no. 3, pp. 251–257, 2007.
30. M. A. Cremasco, B. J. Hritzko, and N.-H. Linda Wang, “Experimental purification of paclitaxel from a complex mixture of taxanes using a simulated moving bed,” Brazilian Journal of Chemical Engineering, vol. 26, no. 1, pp. 207–218, 2009.
31. M. C. Wani, H. L. Taylor, M. E. Wall, P. Coggon, and A. T. McPhail, “Plant antitumor agents. VI. The isolation and structure of taxol, a novel antileukemic and antitumor agent from Taxus brevifolia,” Journal of the American Chemical Society, vol. 93, no. 9, pp. 2325–2327, 1971.
32. A.Guo, Y. Wang, X. Sun, and K. Tang, “Bioactive natural products from endophytes: a review,” Applied Biochemistry and Microbiology, vol. 44, no. 2, pp. 136–142, 2008.
33. H. Lu, B. Li, Y. Kang et al., “Paclitaxel nanoparticle inhibits growth of ovarian cancer xenografts and enhances lymphatic targeting,” Cancer Chemotherapy and Pharmacology, vol. 59, no. 2, pp. 175–181, 2006.
34. S. Kakolyris, A. Agelidou, N. Androulakis et al., “Cisplatin plus etoposide chemotherapy followed by thoracic irradiation and paclitaxel plus cisplatin consolidation therapy for patients with limited stage small cell lung carcinoma,” Lung Cancer, vol. 53, no. 1, pp. 59–65, 2006.
35. S. Peltier, J.-M. Oger, F. Lagarce, W. Couet, and J.-P. Benoît, “Enhanced oral paclitaxel bioavailability after administration of paclitaxel-loaded lipid nanocapsules,” Pharmaceutical Research, vol. 23, no. 6, pp. 1243–1250, 2006.
36. A.Stierle, G. Strobel, and D. Stierle, “Taxol and taxane production by Taxomyces andreanae, an endophytic fungus of Pacific yew,” Science, vol. 260, no. 5105, pp. 214–216, 1993.
![Page 52: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/52.jpg)
- 51 -
37. J.-Y. Li, G. Strobel, R. Sidhu, W. M. Hess, and E. J. Ford, “Endophytic taxol-producing fungi from bald cypress, Taxodium distichum,” Microbiology, vol. 142, no. 8, pp. 2223–2226, 1996.
38. G. A. Strobel, W. M. Hess, J.-Y. Li et al., “Pestalotiopsis guepinii, a taxol-producing endophyte of the wollemi pine, Wollemia nobilis,” Australian Journal of Botany, vol. 45, no. 6, pp. 1073–1082, 1997.
39. R. S. Kumaran, J. Muthumary, and B. K. Hur, “Production of taxol from Phyllosticta spinarum, an endophytic fungus of Cupressus sp,” Engineering in Life Sciences, vol. 8, no. 4, pp. 438–446, 2008.
40. V. Gangadevi and J. Muthumary, “Taxol production by Pestalotiopsis terminaliae, an endophytic fungus of Terminalia arjuna (arjun tree),” Biotechnology and Applied Biochemistry, vol. 52, no. 1, pp. 9–15, 2009.
41. M. Pandi, R. Manikandan, and J. Muthumary, “Anticancer activity of fungal taxol derived from Botryodiplodia theobromae Pat., an endophytic fungus, against 7, 12 dimethyl benz(a)anthracene (DMBA)-induced mammary gland carcinogenesis in Sprague dawley rats,” Biomedicine and Pharmacotherapy, vol. 64, pp. 48–53, 2010.
42. M. E. Wall, M. C. Wani, C. E. Cook, K. H. Palmer, A. T. McPhail, and G. A. Sim, “Plant antitumor agents. I. The isolation and structure of camptothecin, a novel alkaloidal leukemia and tumor inhibitor from Camptotheca acuminata,” Journal of the American Chemical Society, vol. 88, no. 16, pp. 3888–3890, 1966.
43. S. R. Uma, B. T. Ramesha, G. Ravikanth, P. G. Rajesh, R. Vasudeva, and K. N. Ganeshaiah, “Chemical profiling of N. nimmoniana for camptothecin, an important anticancer alkaloid: towards the development of a sustainable production system,” in Bioactive Molecules and Medicinal Plants, K. G. Ramawat and J. Merillion, Eds., pp. 198–210, Springer, Berlin, Germany, 2008.
44. Q.-Y. Li, Y.-G. Zu, R.-Z. Shi, and L.-P. Yao, “Review camptothecin: current perspectives,” Current Medicinal Chemistry, vol. 13, no. 17, pp. 2021–2039, 2006.
45. A.F. S. Kehrer, O. Soepenberg, W. J. Loos, J. Verweij, and A. Sparreboom, “Modulation of camptothecin analogs in the treatment of cancer: a review,” Anti-Cancer Drugs, vol. 12, no. 2, pp. 89–105, 2001.
46. S. Kusari, S. Zühlke, and M. Spiteller, “An endophytic fungus from Camptotheca acuminata that produces camptothecin and analogues,” Journal of Natural Products, vol. 72, no. 1, pp. 2–7, 2009.
47. S.-S. Jew, H.-J. Kim, M. Goo Kim et al., “Synthesis and in vitro cytotoxicity of hexacyclic Camptothecin analogues,” Bioorganic and Medicinal Chemistry Letters, vol. 9, no. 22, pp. 3203–3206, 1999.
48. S.Shweta, S. Zuehlke, B. T. Ramesha et al., “Endophytic fungal strains of Fusarium solani, from Apodytes dimidiata E. Mey. ex Arn (Icacinaceae) produce camptothecin, 10-hydroxycamptothecin and 9-methoxycamptothecin,” Phytochemistry, vol. 71, no. 1, pp. 117–122, 2010.
49. K. Liu, X. Ding, B. Deng, and W. Chen, “10-Hydroxycamptothecin produced by a new endophytic Xylaria sp., M20, from Camptotheca acuminata,” Biotechnology Letters, vol. 32, no. 5, pp. 689–693, 2010.
50. S. Rehman, A. S. Shawl, A. Kour et al., “An endophytic Neurospora sp. from Nothapodytes foetida producing camptothecin,” Applied Biochemistry and Microbiology, vol. 44, no. 2, pp. 203–209, 2008.
51. T. Amna, S. C. Puri, V. Verma et al., “Bioreactor studies on the endophytic fungus entrophospora infrequens for the production of an anticancer alkaloid camptothecin,” Canadian Journal of Microbiology, vol. 52, no. 3, pp. 189–196, 2006.
![Page 53: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/53.jpg)
- 52 -
52. S. G. Puri, V. Verma, T. Amna, G. N. Qazi, and M. Spiteller, “An endophytic fungus from Nothapodytes foetida that produces camptothecin,” Journal of Natural Products, vol. 68, no. 12, pp. 1717–1719, 2005.
53. S. K. Deshmukh, P. D. Mishra, A. Kulkarni-Almeida et al., “Anti-inflammatory and anticancer activity of ergoflavin isolated from an endophytic fungus,” Chemistry and Biodiversity, vol. 6, no. 5, pp. 784–789, 2009.
54. J.-Y. Zhang, L.-Y. Tao, Y.-J. Liang et al., “Secalonic acid D induced leukemia cell apoptosis and cell cycle arrest of G1 with involvement of GSK-3β/β-catenin/c-Myc pathway,” Cell Cycle, vol. 8, no. 15, pp. 2444–2450, 2009.
55. L. G. Korkina, “Phenylpropanoids as naturally occurring antioxidants: from plant defense to human health,” Cellular and Molecular Biology, vol. 53, no. 1, pp. 15–25, 2007.
56. T. P. Fill, B. F. da Silva, and E. Rodrigues-Fo, “Biosynthesis of phenylpropanoid amides by an endophytic penicillium brasilianum found in root bark of Melia azedarach,” Journal of Microbiology and Biotechnology, vol. 20, no. 3, pp. 622–629, 2010.
57. H. Chapela, O. Petrini, and L. Hagmann, “Monolignol glucosides as specific recognition messengers in fungus-plant symbioses,” Physiological and Molecular Plant Pathology, vol. 39, no. 4, pp. 289–298, 1991.
58. H. Koshino, S.-I. Terada, T. Yoshihara et al., “Three phenolic acid derivatives from stromata of Epichloe typhina on Phleum pratense,” Phytochemistry, vol. 27, no. 5, pp. 1333–1338, 1988.
59. M. Gordaliza, P. A. García, J. M. Miguel Del Corral, M. A. Castro, and M. A. Gómez-Zurita, “Podophyllotoxin: distribution, sources, applications and new cytotoxic derivatives,” Toxicon, vol. 44, no. 4, pp. 441–459, 2004.
60. S. Kusari, M. Lamshöft, and M. Spiteller, “Aspergillus fumigatus Fresenius, an endophytic fungus from Juniperus communis L. Horstmann as a novel source of the anticancer pro-drug deoxypodophyllotoxin,” Journal of Applied Microbiology, vol. 107, no. 3, pp. 1019–1030, 2009.
61. A.Kour, A. S. Shawl, S. Rehman et al., “Isolation and identification of an endophytic strain of Fusarium oxysporum producing podophyllotoxin from Juniperus recurva,” World Journal of Microbiology and Biotechnology, vol. 24, no. 7, pp. 1115–1121, 2008.
62. S. C. Puri, A. Nazir, R. Chawla et al., “The endophytic fungus Trametes hirsuta as a novel alternative source of podophyllotoxin and related aryl tetralin lignans,” Journal of Biotechnology, vol. 122, no. 4, pp. 494–510, 2006.
63. A.L. Eyberger, R. Dondapati, and J. R. Porter, “Endophyte fungal isolates from Podophyllum peltatum produce podophyllotoxin,” Journal of Natural Products, vol. 69, no. 8, pp. 1121–1124, 2006.
64. M. M. Wagenaar, J. Corwin, G. Strobel, and J. Clardy, “Three new cytochalasins produced by an endophytic fungus in the genus Rhinocladiella,” Journal of Natural Products, vol. 63, no. 12, pp. 1692–1695, 2000.
65. I.C. Lee, G. A. Strobel, E. Lobkovsky, and J. Clardy, “Torreyanic acid: a selectively cytotoxic quinone dimer from the endophytic fungus Pestalotiopsis microspora,” Journal of Organic Chemistry, vol. 61, no. 10, pp. 3232–3233, 1996.
66. Y.Chen, H. Guo, Z. Du, X.-Z. Liu, Y. Che, and X. Ye, “Ecology-based screen identifies new metabolites from a Cordyceps-colonizing fungus as cancer cell proliferation inhibitors and apoptosis inducers,” Cell Proliferation, vol. 42, no. 6, pp. 838–847, 2009.
67. M. D. R. V. Fernandes, T. A. C. Silva, L. H. Pfenning et al., “Biological activities of the fermentation extract of the endophytic fungus Alternaria alternata isolated from
![Page 54: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/54.jpg)
- 53 -
Coffea arabica L,” Brazilian Journal of Pharmaceutical Sciences, vol. 45, no. 4, pp. 677–685, 2009.
68. Y. Huang, J. Wang, G. Li, Z. Zheng, and W. Su, “Antitumor and antifungal activities in endophytic fungi isolated from pharmaceutical plants Taxus mairei, Cephalataxus fortunei and Torreya grandis,” FEMS Immunology and Medical Microbiology, vol. 31, no. 2, pp. 163–167, 2001.
69. S. F. Brady, M. P. Singh, J. E. Janso, and J. Clardy, “Cytoskyrins A and B, new BIA active bisanthraquinones isolated from an endophytic fungus,” Organic Letters, vol. 2, no. 25, pp. 4047–4049, 2000.
70. M. Isaka, A. Jaturapat, K. Rukseree, K. Danwisetkanjana, M. Tanticharoen, and Y. Thebtaranonth, “Phomoxanthones A and B, novel xanthone dimers from the endophytic fungus Phomopsis species,” Journal of Natural Products, vol. 64, no. 8, pp. 1015–1018, 2001.
71. G. Ding, Z. Zheng, S. Liu, H. Zhang, L. Guo, and Y. Che, “Photinides A-F, cytotoxic benzofuranone-derived γ-lactones from the plant endophytic fungus Pestalotiopsis photiniae,” Journal of Natural Products, vol. 72, no. 5, pp. 942–945, 2009.
72. Y. C. Song, H. Li, Y. H. Ye, C. Y. Shan, Y. M. Yang, and R. X. Tan, “Endophytic naphthopyrone metabolites are co-inhibitors of xanthine oxidase, SW1116 cell and some microbial growths,” FEMS Microbiology Letters, vol. 241, no. 1, pp. 67–72, 2004.
73. A.Klemke, S. Kehraus, A. D. Wright, and G. M. König, “New secondary metabolites from the marine endophytic fungus Apiospora montagnei,” Journal of Natural Products, vol. 67, no. 6, pp. 1058–1063, 2004.
74. H. Yu, L. Zhang, L. Li et al., “Recent developments and future prospects of antimicrobial metabolites produced by endophytes,” Microbiological Research, vol. 165, no. 6, pp. 437–449, 2010.
75. J.H. Song, “What's new on the antimicrobial horizon?” International Journal of Antimicrobial Agents, vol. 32, no. 4, pp. S207–S213, 2008.
76. X. Liu, M. Dong, X. Chen, M. Jiang, X. Lv, and J. Zhou, “Antimicrobial activity of an endophytic Xylaria sp.YX-28 and identification of its antimicrobial compound 7-amino-4-methylcoumarin,” Applied Microbiology and Biotechnology, vol. 78, no. 2, pp. 241–247, 2008.
77. W. Pongcharoen, V. Rukachaisirikul, S. Phongpaichit et al., “Metabolites from the endophytic fungus Xylaria sp. PSU-D14,” Phytochemistry, vol. 69, no. 9, pp. 1900–1902, 2008.
78. P. Pittayakhajonwut, R. Suvannakad, S. Thienhirun, S. Prabpai, P. Kongsaeree, and M. Tanticharoen, “An anti-herpes simplex virus-type 1 agent from Xylaria mellisii (BCC 1005),” Tetrahedron Letters, vol. 46, no. 8, pp. 1341–1344, 2005.
79. S. Boonphong, P. Kittakoop, M. Isaka, D. Pittayakhajonwut, M. Tanticharoen, and Y. Thebtaranonth, “Multiplolides A and B, new antifungal 10-membered lactones from Xylaria multiplex,” Journal of Natural Products, vol. 64, no. 7, pp. 965–967, 2001.
80. J.-H. Park, G. J. Choi, H. B. Lee et al., “Griseofulvin from Xylaria sp. strain F0010, an endophytic fungus of Abies holophylla and its antifungal activity against plant pathogenic fungi,” Journal of Microbiology and Biotechnology, vol. 15, no. 1, pp. 112–117, 2005.
81. H. Koshino, T. Yoshihara, S. Sakamura, T. Shimanuki, T. Sato, and A. Tajimi, “Novel C-11 epoxy fatty acid from stromata of Epichloe typhina on Phleum pratense,” Agricultural Biology and Chemistry, vol. 53, pp. 2527–2528, 1989.
82. I.A. Findlay, G. Li, and J. A. Johnson, “Bioactive compounds from an endophytic fungus from eastern larch (Larix laricina) needles,” Canadian Journal of Chemistry, vol. 75, no. 6, pp. 716–719, 1997.
![Page 55: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/55.jpg)
- 54 -
83. C. Qin, Y.-M. Zhang, J.-M. Gao et al., “Bioactive metabolites produced by Chaetomium globosum, an endophytic fungus isolated from Ginkgo biloba,” Bioorganic and Medicinal Chemistry Letters, vol. 19, no. 6, pp. 1572–1574, 2009.
84. Z. Huang, X. Cai, C. Shao et al., “Chemistry and weak antimicrobial activities of phomopsins produced by mangrove endophytic fungus Phomopsis sp. ZSU-H76,” Phytochemistry, vol. 69, no. 7, pp. 1604–1608, 2008.
85. B. Schulz, J. Sucker, H. J. Aust et al., “Biologically active secondary metabolites of endophytic Pezicula species,” Mycological Research, vol. 99, no. 8, pp. 1007–1015, 1995.
86. A.Li, L. Jiang, L. Guo, H. Zhang, and Y. Che, “Pestalachlorides A-C, antifungal metabolites from the plant endophytic fungus Pestalotiopsis adusta,” Bioorganic and Medicinal Chemistry, vol. 16, no. 17, pp. 7894–7899, 2008.
87. S. Kusari, M. Lamshöft, S. Zühlke, and M. Spiteller, “An endophytic fungus from Hypericum perforatum that produces hypericin,” Journal of Natural Products, vol. 71, no. 2, pp. 159–162, 2008.
88. U. Castillo, J. K. Harper, G. A. Strobel et al., “Kakadumycins, novel antibiotics from Streptomyces sp. NRRL 30566, an endophyte of Grevillea pteridifolia,” FEMS Microbiology Letters, vol. 224, no. 2, pp. 183–190, 2003.
89. A.W. Wang, R. H. Jiao, A. B. Cheng, S. H. Tan, and Y. C. Song, “Antimicrobial potentials of endophytic fungi residing in Quercus variabilis and brefeldin A obtained from Cladosporium sp,” World Journal of Microbiology and Biotechnology, vol. 23, no. 1, pp. 79–83, 2007.
90. D. Ezra, U. F. Castillo, G. A. Strobel et al., “Coronamycins, peptide antibiotics produced by a verticillate Streptomyces sp. (MSU-2110) endophytic on Monstera sp,” Microbiology, vol. 150, no. 4, pp. 785–793, 2004.
91. A.M. P. de Melo, M. F. Fiore, L. A. B. de Moraes et al., “Antifungal compound produced by the cassava endophyte Bacillus pumilus MAIIIM4A,” Scientia Agricola, vol. 66, no. 5, pp. 583–592, 2009.
92. I.C. Cafêu, G. H. Silva, H. L. Teles et al., “Antifungal compounds of Xylaria sp., an endophytic fungus isolated from Palicourea marcgravii (Rubiaceae),” Quimica Nova, vol. 28, no. 6, pp. 991–995, 2005.
93. A.H. Silva, H. L. Teles, H. C. Trevisan et al., “New bioactive metabolites produced by Phomopsis cassiae, an endophytic fungus in Cassia spectabilis,” Journal of the Brazilian Chemical Society, vol. 16, no. 6 B, pp. 1463–1466, 2005.
94. A.M. R. Marinho, E. Rodrigues-Filho, M. D. L. R. Moitinho, and L. S. Santos, “Biologically active polyketides produced by Penicillium janthinellum isolated as an endophytic fungus from fruits of Melia azedarach,” Journal of the Brazilian Chemical Society, vol. 16, no. 2, pp. 280–283, 2005.
95. A.Y. Liu, Y. C. Song, Z. Zhang et al., “Aspergillus fumigatus CY018, an endophytic fungus in Cynodon dactylon as a versatile producer of new and bioactive metabolites,” Journal of Biotechnology, vol. 114, no. 3, pp. 279–287, 2004.
96. F. You, T. Han, J.-Z. Wu, B.-K. Huang, and L.-P. Qin, “Antifungal secondary metabolites from endophytic Verticillium sp,” Biochemical Systematics and Ecology, vol. 37, no. 3, pp. 162–165, 2009.
97. E. Li, R. Tian, S. Liu, X. Chen, L. Guo, and Y. Che, “Pestalotheols A-D, bioactive metabolites from the plant endophytic fungus Pestalotiopsis theae,” Journal of Natural Products, vol. 71, no. 4, pp. 664–668, 2008.
98. A.H. Aly, R. Edrada-Ebel, V. Wray et al., “Bioactive metabolites from the endophytic fungus Ampelomyces sp. isolated from the medicinal plant Urospermum picroides,” Phytochemistry, vol. 69, no. 8, pp. 1716–1725, 2008.
![Page 56: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/56.jpg)
- 55 -
99. V. Rukachaisirikul, U. Sommart, S. Phongpaichit, J. Sakayaroj, and K. Kirtikara, “Metabolites from the endophytic fungus Phomopsis sp. PSU-D15,” Phytochemistry, vol. 69, no. 3, pp. 783–787, 2008.
100. A.M. Hoffman, S. G. Mayer, G. A. Strobel et al., “Purification, identification and activity of phomodione, a furandione from an endophytic Phoma species,” Phytochemistry, vol. 69, no. 4, pp. 1049–1056, 2008.
101. J.Y. Li, J. K. Harper, D. M. Grant et al., “Ambuic acid, a highly functionalized cyclohexenone with antifungal activity from Pestalotiopsis spp. and Monochaetia sp,” Phytochemistry, vol. 56, no. 5, pp. 463–468, 2001.
102. U. F. Castillo, G. A. Strobel, E. J. Ford et al., “Munumbicins, wide-spectrum antibiotics produced by Streptomyces NRRL 30562, endophytic on Kennedia nigriscans,” Microbiology, vol. 148, no. 9, pp. 2675–2685, 2002.
103. W.-Y. Huang, Y.-Z. Cai, J. Xing, H. Corke, and M. Sun, “A potential antioxidant resource: endophytic fungi from medicinal plants,” Economic Botany, vol. 61, no. 1, pp. 14–30, 2007.
104. H. E. Seifried, D. E. Anderson, E. I. Fisher, and J. A. Milner, “A review of the interaction among dietary antioxidants and reactive oxygen species,” Journal of Nutritional Biochemistry, vol. 18, no. 9, pp. 567–579, 2007.
105. G. Strobel, E. Ford, J. Worapong, et al., “Isopestacin, an isobenzofuranone from Pestalotiopsis microspora, possessing antifungal and antioxidant activities,” Phytochemistry, vol. 60, no. 2, pp. 179–183, 2002.
106. A.Kardošová and E. Machová, “Antioxidant activity of medicinal plant polysaccharides,” Fitoterapia, vol. 77, no. 5, pp. 367–373, 2006.
107. D. Luo and B. Fang, “Structural identification of ginseng polysaccharides and testing of their antioxidant activities,” Carbohydrate Polymers, vol. 72, no. 3, pp. 376–381, 2008.
108. C. Sun, J.-W. Wang, L. Fang, X.-D. Gao, and R.-X. Tan, “Free radical scavenging and antioxidant activities of EPS2, an exopolysaccharide produced by a marine filamentous fungus Keissleriella sp. YS 4108,” Life Sciences, vol. 75, no. 9, pp. 1063–1073, 2004.
109. R. Yu, W. Yang, L. Song, C. Yan, Z. Zhang, and Y. Zhao, “Structural characterization and antioxidant activity of a polysaccharide from the fruiting bodies of cultured Cordyceps militaris,” Carbohydrate Polymers, vol. 70, no. 4, pp. 430–436, 2007.
110. J. Liu, J. Luo, H. Ye, Y. Sun, Z. Lu, and X. Zeng, “Production, characterization and antioxidant activities in vitro of exopolysaccharides from endophytic bacterium Paenibacillus polymyxa EJS-3,” Carbohydrate Polymers, vol. 78, no. 2, pp. 275–281, 2009.
111. Y. C. Song, W. Y. Huang, C. Sun, F. W. Wang, and R. X. Tan, “Characterization of graphislactone A as the antioxidant and free radical-scavenging substance from the culture of Cephalosporium sp. IFB-E001, an endophytic fungus in Trachelospermum jasminoides,” Biological and Pharmaceutical Bulletin, vol. 28, no. 3, pp. 506–509, 2005.
112. K. B. Borges, W. D. S. Borges, M. T. Pupo, and P. S. Bonato, “Endophytic fungi as models for the stereoselective biotransformation of thioridazine,” Applied Microbiology and Biotechnology, vol. 77, no. 3, pp. 669–674, 2007.
113. M.Doble, A. K. Kruthiventi, and V. G. Gaikar, Eds., Biotransformations and Bioprocesses, Marcel Dekker, New York, NY, USA, 2004. B. Suresh, T. Ritu, and G. A. Ravishankar, “Biotransformations as applicable to food industries,” in Food Biotechnology, pp. 1655–1690, Taylor and Francis, New York, NY, USA, 2nd edition, 2006.
![Page 57: ISOLATION AND CHARACTERIZATION OF FUNGAL - Keralaws.kscste.kerala.gov.in/site/publications/blp/Thulasi.pdf · 2016-10-25 · - 2 - AUTHORIZATION The work entitled “Isolation and](https://reader033.vdocuments.us/reader033/viewer/2022042112/5e8dde44058b8d747b166a39/html5/thumbnails/57.jpg)
- 56 -
114. K. B. Borges, W. D. S. Borges, M. T. Pupo, and P. S. Bonato, “Stereoselective analysis of thioridazine-2-sulfoxide and thioridazine-5-sulfoxide: an investigation of rac-thioridazine biotransformation by some endophytic fungi,” Journal of Pharmaceutical and Biomedical Analysis, vol. 46, no. 5, pp. 945–952, 2008.
115. J. Aleu and I. G. Collado, “Biotransformations by Botrytis species,” Journal of Molecular Catalysis, vol. 13, no. 4–6, pp. 77–93, 2001.
116. N.A. Longo and M. A. Sanromán, “Production of food aroma compounds: microbial and enzymatic methodologies,” Food Technology and Biotechnology, vol. 44, no. 3, pp. 335–353, 2006.
117. A.C. Figueiredo, M. J. Almendra, J. G. Barroso, and J. J. C. Scheffer, “Biotransformation of monoterpenes and sesquiterpenes by cell suspension cultures of Achillea millefolium L. ssp. Millefolium,” Biotechnology Letters, vol. 18, no. 8, pp. 863–868, 1996.
118. N.Verza, N. S. Arakawa, N. P. Lopes et al., “Biotransformation of a tetrahydrofuran lignan by the endophytic fungus Phomopsis sp,” Journal of the Brazilian Chemical Society, vol. 20, no. 1, pp. 195–200, 2009.
119. M. Zikmundová, K. Drandarov, L. Bigler, M. Hesse, and C. Werner, “Biotransformation of 2-benzoxazolinone and 2-hydroxy-1,4-benzoxazin-3-one by endophytic fungi isolated from Aphelandra tetragona,” Applied and Environmental Microbiology, vol. 68, no. 10, pp. 4863–4870, 2002.
120. P.Mohana Kumar, S.Zuehlke, V.Priti, B.T.Ramesha, S. Shweta, et al. Fusarium proliferatum, an endophytic fungus from Dysoxylum binectariferum Hook. f, produces rohitukine, a chromane alkaloid possessing anti-cancer activity. Antonie van Leeuwenhoek vol.101, pp323-329, 2012.
121. W.Photita, S.Lumyong, P.Lumyong, and K.D.Hyde. Endophytic fungi of wild banana (Musa acuminate) at Doi Suthep Pui National Park, Thailand. Mycological Research, vol.105,pp1508-1513, 2001.
122. O.Petrini. Notes on some species of Chloroscypha endophytic in Cupressaceae of Europe and North America. Sydowia, vol.35, pp206-222,1982.
123. J.Frohlick, K.D.Hyde, and O.Petrini. Endophytic fungi associated with palms. Mycological Research, vol.104, pp1202-1212, 2000.
124. H.Wagner. L.Horhammer L. Pharmacognosy and Phytochemistry. Springer-Verlag Berlin and Heidelberg GmbH & Co. K.1970.
125. J.O'Brien, I.Wilson, T.Orton, F.Pognan. Investigation of the Alamar Blue (resazurin) fluorescent dye for the assessment of mammalian cell cytotoxicity. European journal of biochemistry / FEBS. vol.267,pp 5421–6, 2000.
126. V.Gangadevi and J.Muthumary J. Isolation of Colletotrichum gloeosporioides, a novel endophytic taxol-producing fungus from the leaves of a medicinal plant, Justicia gendarussa. Mycologia Balcanica. Vol.5,pp1–4, 2008.