souvenir ips-nz 2012.pdf · legume (pulse) diseases under a changing climate as a case-study. the...

National Symposium on “Emerging Issues in Plant Health Management” and Annual Meeting of IPS (NZ) September 28-29, 2012

1

Invited Lectures

001 Climate change, plant diseases and their management: an overview

SURESH PANDE International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru-502324 (AP).

Email: [email protected]

The earth’s climate is a dynamic process and it has always responded to changes in the cryosphere, hydrosphere, biosphere, and other interacting atmospheric galaxies. Although the effects of climate change on plant diseases was assessed in early nineties but, how the changing climate influences the plant pathogens and the diseases gained international importance only after 1995. Soon after the presentation on “potential impact of climate change on plant–pathogen interactions” in the 7th International Congress of Plant Pathology in 1998 by Chakarborty, plant pathologists recognized that changes in climate will affect plant diseases together with other components of global change i.e. anthropogenic processes such as air, water, and soil pollution, long-distance introduction of exotic species and urbanization. Each year 10-16 per cent of the global harvest is lost to plant diseases costing US$ 220 billion, and with the emerging climate change scenario the losses caused by plant diseases are expected to be increasing by 3-4 folds. Therefore, to guide government policies and industry strategic decision making, there is urgent need to assess impact of climate change on disease induced losses in food crops. In a world where more than one billion people currently do not have enough to eat, more research is needed to understand the impact of climate change adaptation procedures available to decrease predicted disease-induced losses in crop yields. In this article, though the focus is on plant pathosystems, it also can be argued for invertebrate pests. The well-known interaction between host-pathogen-environment for plant disease epidemic development and weather based disease management strategies have been routinely exploited by plant pathologists. However, the impact of inter annual climatic variation resulting in the abundance of pathogen populations and realistic assessment of climatic change impacts on host-pathogen interactions are still scarce and there are only handful of FACE and OTC studies. Climate change predictions, point to a warmer world within the next 50 years, a trend that is increasingly being supported by ‘Ground-truth’. Climate change threatens to increase crop losses, increase in the number of people facing malnutrition, and changing the development patterns of plant diseases. Agriculture production of rainfed regions, which constitute about 65 per cent of the area under cultivation and account for about 40-45 per cent of the total production in India, varies a great deal from year to year. Therefore, in order to sustain and enhance the production of the rainfed crops, it is necessary to use the knowledge of climate variability to tailor the innovative cropping patterns and the disease management practices for location specific agro-climate zone. It is well established that temperature, moisture and greenhouse gases are the major elements of climate change. Current estimates of changes in climate indicate an increase in global mean annual temperatures of 1ºC by 2025 and 3ºC by the 2100. Variability in rainfall pattern and intensity is expected to be high. Greenhouse gases (CO2 and O3) would result in increase in global precipitation of 2 ± 0.5ºC per 1ºC warming. Overall, changes in these elements will result in i) warmer and more frequent hot days and nights ii) erratic rainfall distribution pattern leading to drought or high precipitation and iii) drying of rainfed tropics (specifically semi-arid tropics) in Asia and Africa. Temperature increase associated with climatic changes could result in following changes in plant diseases: i) Extension of geographical range of pathogens, ii) Changes in population growth rates of pathogens, iii) Changes in relative abundance and effectiveness of biocontrol agents, iv) Changes in pathogen × host × environment interactions, v) Loss of resistance in cultivars containing temperature-sensitive genes, vi) Emergence of new diseases/and pathogen forms, vii) Increased risk of invasion by migrant diseases, viii) Reduced efficacy of integrated disease management practices. These changes will have major implications for food and nutritional security, particularly in the developing countries of the dry-tropics, where the need to increase and sustain food production is most urgent. In this talk an attempt has been made to introduce climate change to plant pathologists, update knowledge on its potential impacts on host–pathogen interactions, critically review progress, and initiatives taken by ICRISAT on research needs to better manage legume (pulse) diseases under a changing climate as a case-study. The current knowledge on the main potential effects of climate change on plant pathosystems suggests that maintaining plant health across


2

diversified environments is a key requirement for climate change mitigation as well as the conservation of biodiversity and provisions of ecosystem services under global change. Climate change is one of the many ways in which the environment can move in long term from disease–suppressive to disease–conducive or vice versa. Therefore, plant diseases could be used as indicators of climate change. There is a wide spread evidence that seasonal shifts in the current CO2 concentrations (180-300 ppm) measured from ice core of 650,000 years will exceed to 400 ppm in few years. The increase in Co2 and other gases already resulted in an increase in temperature by 0.6-0.7oC over the last century consequently certain regions are experiencing shorter and warmer winters. It is assumed that by the end of 21st century the global temperature will increase by + 2 to 4o C. The increase in temperatures will affect the metabolite rates of several crop species and may make them vulnerable to existing or emerging pathogens and their forms. India being a fast growing economy is emerging as major player in climate research in recent times. ICRISAT is a center of excellence in research on rainfed dry land agriculture, and has a diverse group of researchers actively pursuing research on effect of climate change on emerging plant diseases and insect-pests, and their effect on crop production. ICRISAT scientists developed protocols to study biology and ecology of insect-pests and pathogens. They are also studying the host plant × pest × environment interactions, identifying biochemical responsible for pest resistance, molecular markers for pest resistance, pest variability, biochemical mechanisms of insect and host interactions, pest forecasting models, etc. The Center of Excellence on Climate Change Research for Plant Protection (CoE-CCRPP) initiated at ICRISAT center at Patancheru (AP), to focus on impact of climate change on disease and insect-pest problems of rainfed dry land crops. The primary aim of this project is to understand the effects of climate change on the relative abundance and diversity of insect-pests and pathogens across geographical regions, pathogen/pest-host plant-environment interactions, and its influence on insect-pest and diseases incidence and extent of losses due to diseases and pests. The major outcomes of this project will be the development of methodologies that will be required to quantify the information on emerging pest problems, their geographical distribution, and severity and damage, effect of climatic changes on expression of resistance to insect-pests and pathogens, select varieties that are resistant to diseases and insect-pests across environments, and reduce pesticide application for a safer environment. The information will be useful to scientists in India, who can use the standardized techniques for phenotyping for pest resistance to identify and develop pest resistant cultivars for genetic management of emerging and or anticipated diseases and insect-pest problems in India. The information will be useful to research planners, policy makers, scientists, and farmers for sustainable crop protection in India. The outcomes of this project will have a major bearing on pest mitigation strategies in an environment friendly manner for sustainable production of grain legumes and increasing food security in dry land areas –the region most vulnerable to climate change. In this context and because of the close interaction between global change and climate change, far too little research has addressed the effects of the latter on crop health. Global change may affect crop health in quite different ways depending on the type of disease considered. Though there have been so many new methods available for plant pathologists to analyze data. However, the availability of ground truth data on crop health is a serious issue; the collection of system-based, holistic data remains a keystone towards progress to understand and manage constantly evolving pathosystems. There is a need to create facilities, device methodologies, and develop collaborative research activities to understand the impact of climate change variables on crop health and plant diseases. Several available tools and methodologies such as simulating modeling, geographic information systems, mapping, technology targeting for efficiently implementing disease management tools as global change and climate change unfold. Actual measurement of disease in the field, their proper recording and processing is required for effective disease management as it depends on these combinations of resources, methods, and disciplines. The topic of climate change and plant diseases has not yet sparked widespread interest among plant pathologists. This may be partly because of the well understood genetic basis of host-pathogen-specificity, where many of the crop disease management options are based on host plant resistance. However, realistic assessments of climate change impacts on host-pathogen interactions are still scarce and there are only handfuls of FACE studies. Despite being interesting from a pathogen life-cycle point of view, realistic effects of high CO2 need to be considered in the context of rising temperatures and other changes projected under changing climate. New FACE facility fostering multidisciplinary research on climate change in pest and diseases in crop cropping systems should be a priority in India.


3

002 Fungicides in crop Protection: Prospects and limitations

T.S. THIND Punjab Agricultural University, Ludhiana -141004. E-mail: [email protected]

Fungicides can play an important role in ensuring crop health security by managing devastating diseases. They also provide substantial benefits on food quality and safety by indirectly reducing the levels of mycotoxins and phytotoxins in the infected plant products. Many developments have taken place in the use of fungicides ever since the discovery of Bordeaux mixture that opened a new era in chemical control of plant diseases. Several new fungicide groups have been discovered in the past years. The trend now is to develop eco-friendly compounds with least adverse effects on the crops and environment. New fungicide chemistry derived from plant or microbial products has played a helping hand in developing highly effective yet safe fungicides in the recent years. The new molecules offer better levels and duration of disease control and allow the grower more flexibility in their use. Apart from broader disease control spectrum, these are safe to users, environmentally acceptable and safe to consumers of the treated plant products. Despite the benefits derived from increased yields as an outcome of disease control through fungicide applications, much thought needs to be given for their rational and need-based use to avoid problems such as fungicide resistance, residues in edible plant parts and ill effects on the environment. The high input modern agricultural technology has, no doubt, permitted the yield potential of new varieties to be achieved, but their increased use such as that of fertilizers has enhanced the damaging attacks of several fungal pathogens. This, in turn, has increased our dependence on fungicides where other control methods are inadequate. This warrants for an update of developments in the discovery and use of fungicides that have taken place over the past few decades and the ways and means to rationalize their use. In the recent years, several compounds have been developed that are ecologically safe, have new modes of action, somewhat broad spectrum and applied at quite low dose rates. Examples of these are strobilurins (azoxystrobin), phenoxyquinolines (quinoxyfen), oxazolidinediones (famoxadone), anilinopyrimidines (cyprodinil), phenylpyrroles (fludioxonil), spiroketalamines (spiroxamine), benzamides (fluopicolide), valinamides (iprovalicarb), cyanoimidazoles (cyazofamid), thiocarbamates (ethaboxam), mandelamides (mandipropamid) and amidoximes (cyflufenamid) representing different chemistries and modes of action. Majority of these have been developed for use against oomycete pathogens (downy mildews, Phytophthora, Pythium) thus indicating the necessity to manage these pathogens. Strobilurins, launched in 1996, are now the second largest group of fungicides as a result of their widespread use. Commonly used strobilurins after azoxystrobin are kresoxim-methyl, trifloxystrobin, pyraclostrobin, kresoxim-methyl, picoxystrobin and more recent fluoxasrobin. More recently during 2010 and 2011, new fungicides with novel modes of have been launched for use against different diseases. These include fluopyram (pyridinylethylbenzamides) by Bayer against gray mold, powdery mildew, Sclerotinia and Monilia, penthiopyrad (carboxamide) by DuPont against rust, Rhizoctonia, gray mold, powdery mildew, apple scab and fluxapyroxad (carboxamide) by Agrow-BASF for seed treatment for different crops. The application of any chemical to a crop raises the question of risks and benefits. Overall, most analyses come to the conclusion that despite some adverse effects such as fungicide resistance and residues, the benefits of fungicides far outweigh the risks, if they are used carefully and according to the label recommendations. A number of fungicides belonging to different chemical groups are registered in India and these are being used against diverse diseases in fruits, vegetables, field crops and some plantation crops. As on 20.05.2012, a total of 65 antifungal products have been registered in India. Apart from contact compounds, several fungicides of the systemic groups like benzimidazoles, oxathiins, thiophanates, organophosphorus, triazoles, phenylamides, cyanoacetamide oximes, cinnamic acid derivatives are being used in India for controlling diseases on a number of crops. Some of the new generation fungicides registered in India for use against different diseases include Strobilurins (azoxystrobin, kresoxim methyl, trifloxistrobin, pyrachlostribin) against powdery mildew, downy mildew in grapevine and cucurbits and rice sheath blight, Valinamides (iprovalicarb, benhiovalicarb) against Oomycere diseases in grapevine, potato, tomato and cucurbits, Oxazolidinediones (famoxadone) against potato late blight. Imidazoles (fenamidone) against potato late blight and grape downy mildew, Phenyl-ureas (pencycuron) against rice sheath blight, black scurf of potato, Mandelamides (mandipropamid) against late blight of potato and downy mildew of


4

grapevine, Melanin biosysnthesis inhibitors (carpropamid) against rice blast and Triazolinthiones (prothioconazole) against rice blast. Fungicide mixtures, containing two or more fungicides with different modes of action, have been developed with the twin objectives of broadening the activity spectrum against diverse plant diseases and to check the development of resistance in the target pathogens. Often, these compounds have synergistic effects and enhance the efficacy levels of the individual compounds together. Some of the recently developed and commonly used fungicide mixtures are Ridomil Gold (mefenoxam+mancozeb) against downy mildews, Phytophthora and Pythium diseases, Prosaro (prothioconazole + tebuconazole) against Fusarium head scab in cereals, Input (prothioconazole + spiroxamine) against powdery mildew, Fusarium scab, Septoria, and rusts in cereals, Twinline (pyraclostrobin + metconazole) against cereal rusts, Amistar Top (azoxystrobin + difenoconazole) against various diseases on diverse crops and Luna Sensation (fluopyram+trifloxystrobin) for control of gray mould, powdery mildew, Sclerotinia and Monilia in fruits. With the over use of systemic fungicides for managing diverse fungal diseases in agricultural crops, there are ample chances of their residue build up in harvested produce. Not adhering to the recommended pre-harvest interval may further compound the problem. This not only poses health risks to consumers, but may also affect the export potential of certain commodities to the developed countries. Detection of residues of carbendazim and isoprothiolane above MRLs in basmati rice consignments exported from India to Germany in 2010 and that of tricyclazole in the consignments exported to USA in 2011 has sent warning signals among the agriculturists and traders in India. Farmers need to be educated to follow the recommended guidelines while using fungicides and other pesticides. Although fungicides play an important role in crop production, their intensive use can lead to development of fungicide resistant strains of the pathogen leading to failure of disease control. Fungicide resistance is now a widespread problem in global agriculture. Among different fungicide groups, some like benzimidazoles, dicarboximides, phenylamides and strobilurins carry high level of resistance risk. Fungicide resistance not only threatens the usefulness of fungicides, but also the farm economy because of potential yield losses from poor disease control. Fungicide resistance problems in the field have been documented for more than 100 diseases. In India too, few cases of resistance build up are documented. Strategies for managing fungicide resistance are aimed at delaying its development. Monitoring is vital, to determine whether resistance is the cause in cases of lack of disease control, and to check whether resistance management strategies are working. This threat of fungicide resistance and the fact that cross-resistance often exists to related products from different manufacturers has lead to a close collaboration between them in Fungicide Resistance Action Committee. Increasing environmental and regulatory pressures build interest in fungicides or chemicals that act indirectly by interfering with processes involved in fungal penetration into plant or by enhancing host resistance rather than the fungus such as carpropamid. Probenazole is a systemic compound that indirectly controls rice blast by stimulating the accumulation of toxins and enzymes associated with systemic acquired resistance in rice. Acibenzolar-S-methyl (Bion) has the widest spectrum of activity among the non-fungitoxic compounds developed to date. It is active against various fungi, bacteria and viruses in several crops and stimulates plant’s natural defense system. Actigard has performed best when incorporated into a program of chemical sprays, as the inherent level of disease control has seldom been sufficient when applied alone. Because these compounds do not put selection pressure directly on the pathogen population, these are unlikely to encounter resistance problem. Such compounds with indirect action against the pathogens are likely to gain prominence in future crop protection. It is expected that fungicides will continue to play a role in disease management programs, especially in intensive production systems. The need to produce more food per unit area necessitates that new fungicides will continue to be developed to protect the precious cultivars, where they do not have sufficient genetic disease resistance. However, to maintain their effectiveness and to minimize their effect on human health and on the environment, they should be used in a rational and informed way. The trend towards a more judicious use of fungicides in conjunction with disease forecast systems that has been observed in the past can be expected to continue in the future. This will help reduce the risk of adaptation by the target fungi and at the same time will reduce residues in the environment and on the produce. The balance between genetic and chemical control will therefore most likely continue and research in both areas will complement each other to assure the availability of effective combinations of host resistance and fungicides for crops that should produce ever higher yields of ever better quality.


5

003 Status of resistance in economically important wheat diseases in India INDU SHARMA, M.S. SAHARAN and SATISH KUMAR Directorate of Wheat Research, Karnal-132001, Haryana, India.

Wheat production in India had touched a record of 93.9 MT during 2011-12 from an area of 29.9 mha giving a productivity of 3.14 t/ha. The most serious constraints to wheat production are a host of biotic stresses. Among the fungal diseases, rusts (yellow, brown and black), Karnal bunt, powdery mildew, foliar blights and loose smut are important. Other region specific diseases of minor importance are head scab, flag smut, foot rot and hill bunt. Management of rusts namely, yellow rust or stripe rust (Puccinia striiformis) (Pst), brown rust or leaf rust (Puccinia triticina Eriks.) (Ptr) and black rust or stem rust (P. graminis tritici Eriks & Henn.) (Pgt). is more critical for achieving higher yields. India in particular has not faced any rust epidemic since last three and half decades because of proper deployment of rust resistance genes in different wheat growing zones of the country. A constant vigil on rusts pathotypes has been kept and pathotypes are being maintained at DWR Regional Research Station, Flowerdale, Shimla. However, threats of rusts is looming large as new pathotypes are appearing. In stripe rust, two pathotypes 78S84 and 46S119 dominated during 2011-12 crop season and most of the varieties grown in North Western Plain Zone and Northern Hill Zone became susceptible. In NWPZ, stripe rust tolerant varieties, HD 2867, DPW 621-50, PBW 644, PBW 550, DBW 17, WH 542, WH 896, PDW 233, HD 3043, PBW 502, DBW 16, WH 1021 and PDW 314 have been recommended for cultivation. For NHZ, varieties (VL 829, HS 375, HS 507, HS 490, VL 907, VL 832, HPW 155 and HS 365) possessing resistance to stripe rust and also high yielding have been recommended. As above varieties are not completely resistant so if need arises, chemical spray with fungicides is recommended. In central and peninsular zones, leaf rust and stem rust are very important. Following leaf rust (Lr1, Lr 3, Lr 10, Lr 13, Lr 18, Lr 23, Lr 24, Lr 26, Lr 28, Lr 34), stem rust (Sr2, Sr 5, Sr 7b, Sr 8a, Sr 8b, Sr 9b, Sr 9e, Sr 11, Sr 12, Sr 13, Sr 24, Sr 30, Sr 31) and stripe rust (Yr2, YrA, Yr9, Yr18, Yr27) genes have been reported in Indian wheat genotypes. Stem rust new race Ug99 and its variants have threatened the global food security. Though yet stem rust race Ug99 is not present in India but Indian wheat programme is evaluating the advance wheat genotypes every year in Kenya and Ethiopia since 2005. During 2011-12, wheat genotypes, TL 2942, TL 2969, TL 2975, LOK-1, DDK 1009, HI 8704, MACS 2971, HS 545, HI 8498, MPO 1215, HI 8715, MACS 3815 and HPW 360 showed resistance to Ug99 both at Kenya and Ethiopia. Among other major biotic constraint, spot blotch caused by Bipolaris sorokiniana is important in the hot and humid environments of North Eastern Plain Zone and Indo-gangetic plains of India also. Many genotypes viz., VL 829, HS 513, HP 1913, TL 2978, NIAW 1846, PBW 665, HD 3081, VL 971, VL 972 and PDW 314 showed high level of resistance during 2011-12. Until now, there have only been limited studies conducted on identifying molecular markers linked to spot blotch. However, microsatellite markers have been used by many researchers. Karnal bunt (KB) of wheat caused by Neovossia indica (Tilletia indica) was first reported from India by Mitra in 1931 and it continued to be a minor disease till 1968. However, in 70s and 80s of 20th century, it emerged as an important disease of wheat in the country. The incidence of Karnal bunt in Indian wheat has come down drastically over the years and many genetic stocks have been developed. Wheat genotypes, KRL 238, HS 514, HI 8704, TL 2969, PBW 639, PDW 322, WHD 946 and UAS 320 showed resistance to KB during 2009-12 crop seasons. Besides wheat, resistance was identified in S. cereale, Triticale and several accessions of Aegilops spp. HD 29 is the most frequently used KB resistant stock which was first reported from PAU, Ludhiana and registered with NBPGR. Later HD 30, KBRL 10, KBRL 13, KBRL 22, D 482, D 873, D 879 and TL 2807 were registered by PAU with NBPGR. Nine resistant loci were identified in a set of four resistant stocks (ALDAN ‘S’/IAS 58, H 567.71/3*PAR, HD 29 and W 485) and later four loci from four other genetic stocks (CMH 77.308, FRAME, HP 1531 and MRNG) were identified. Karnal bunt free NILs in the background of PBW 343 and WH 542 has been developed and KB free zones in the high productive area identified for export. Powdery mildew, a destructive foliar disease caused by Erysiphe graminis f. sp. tritici Em. Marchal has recently assumed importance in North western plain zone, northern hill zone and southern hills of India but so far not much emphasis has been given. Losses from this disease have increased in recent years in NWPZ as most of the varieties including PBW 343 do not possess sufficient level of resistance. Now Malan centre is being strengthened for systematic work on


6

powdery mildew. Keeping in view the global climate change and mycotoxin risk, work on Fusarium spp. causing head blight or head scab of wheat is in progress. Loose smut is effectively controlled with fungicide treatment. The development of resistant varieties is the only economic and effective method of managing wheat diseases. However, the expected onslaught of climate change is a worrisome aspect and breeding strategies is being reoriented to take care of the biotic stresses. The details of wheat genotypes possessing resistance to rusts and other diseases based on multilocation evaluation under AICW&BIP will be presented.

004 Analysis of plants and pathogen genome architecture in relation to host plant resistance

T.R. SHARMA National Research Centre on Plant Biotechnology, IARI, Pusa Campus, New Delhi-110012.


Genome analysis of any organism starts with high throughput genome sequencing. Many copies of the DNA pieces are randomly sequenced by generating about 500 bp sequence reads after each reaction. Hence, assembly of these reads in the form of sequence contigs is very important. DNA sequence analysis softwares are now available to assign quality value to each sequence base, detect possibility of errors of the sequenced bases and remove vector sequences from the ends of each sequence reads. By using computer softwares, assembly of the sequence reads is performed on the basis of overlaps and approximate alignment procedures. These procedures strongly favour regions of similarity that run off the ends of the 500 bp fragments. However, matches between regions internal to the fragments are not allowed. A consensus sequence is then determined for each contigs on the basis of both forward and reverse reads. These contigs are edited by the use of another set of software to remove sequence ambiguities and discrepancies in the assembly and then submitted in the public databases. The huge wealth of information in the form of DNA and protein sequences and publications on molecular biology is stored in the biological databases. Major public data bases which takes care of the DNA and protein sequences are GenBank in USA (http://www.ncbi.nlm.nih.gov), EMBL (European Molecular Biology Laboratory) in Europe (http://www.ebi.ac.uk/embl/) and DDBJ (DNA Data Bank) in Japan (http://www.ddbj.nig.ac.jp). There is a very rapid growth in these databases in the recent past. This rapid growth in DNA sequence data is because of the fact that various Collaborative International Programmes have started during the past few years to sequence complete genomes of various organisms. World over the genomes of more than 11000 (http://www.genomesonline) species are being sequenced. Storage, management and retrieval of these sequences at one place and their accessibility to the biologists working world over have sought the need of automatic information storage and retrieval systems. The genomes of large number of microorganisms and other species including human, have already been sequenced, the progress is rather slow in case of sequencing complete plants genomes. The genomes of important plant species like Arabidopsis thaliana, Oryza sativa, grape, poplar, papaya, sorghum, soybean and tomato have been completely sequenced and the data are in public domain. Simply, determining four alphabets (ATGC) of DNA sequences of any organism has no value until some meaning is derived from this by gene prediction and gene annotation. Genome sequences of these organism can be used for the in silico identification of SSR and SNP markers, mapping of different genes as well as designing gene specific primers for the cloning of genes and allele mining in related species. In case of microorganisms genomes of many agriculturally important bacteria have been sequenced. Which includes beneficial bacteria like Nitrogen fixing, Endo-symbionts, biocontrol agents etc. and plant pathogens like Xanthomonas, oryzae pv. oryzae, Xanthomonas compestris pv. compestris, Pseudomonas, Xylella and Magnaporthe oryzae and Puccinia species etc. Besides, genomes of many important plant pathogens are at different stages of sequencing. Bioinformatics tools are now being effectively used for comparative and functional genomics studies in plant species which has really revolutionized the research in biological sciences.


7

005 Prior weakening of propagules: A tool for improving control of soil-borne plant pathogens

SATISH LODHA Central Arid Zone Research Institute (CAZRI), Jodhpur-342 003 (Rajasthan).

Reduction in soil population densities of plant pathogens is achieved principally by fumigation, artificial heat treatment, soil solarizarion or use of organic amendments. The death rate of a population depends on both the dosages and exposure time, causing various degrees of reduction in viability. Studies have shown that weakening of propagules of various pathogens following sub-lethal treatments may result in reduced survivability and pathogenicity. Any management strategy, if integrated after a requisite threshold of weakening is achieved, may require less energy, time and amount for improving the control. Studies on the effect of prior weakening of resting structures of soil borne plant pathogens like Macrophomina phaseolina and Fusarium for improving the efficiency of Brassica amendments were conducted in detail at the Central Arid Zone Research Institute, Jodhpur. A series of experiments were conducted over last one and half decade in order to work out appropriate time of application of cost effective concentration of organic amendments to augment control of weakened propagules. Pathogenic propagules of Macrophomina and Fusarium were exposed to natural heating during summer months for different duration before application of Brassica amendments. This natural heating amounted to sub lethal heating, where pathogenic propagules were allowed to be weakened. Increased duration of sub- lethal heating coupled with a small rise in temperature significantly improved reduction in viable propagules of both the soil borne pathogens. Infested soil exposed to moderate temperatures under shaded conditions did not caused significant reductions in viable propagules of both the pathogens. However, continuous exposure of Macrophomina infested soil to summer heat for 60 days before application of Brassica amendments and irrigation caused 76.3- 86.8% reduction in viable propagules, which was 8.5 – 8.9% higher than that achieved in the treatment where soil was exposed for 30 days only to summer heat before application of corresponding amendments. The weakening effect depends on temperature level, exposure time and the environment into which the preheated propagules are introduced. However, a certain threshold of heating has to be reached to obtain a detectable weakening effect. Increased bacterial colonization of heat treated sclerotia has been observed in other studies. Sub lethal doses of heat treatment triggered germination of pathogenic propagules and increased their susceptibility to Trichoderma

harzianum. Further, the heat stressed spores are more vulnerable to parasitism by bacteria, fungi and actinomycetes in soil. Inoculum density, as measured immediately after treatment, does not necessarily reflect the full effect of the treatment, because it does not take into account the possible further decline of the pathogen population and consequent disease control generated by weakening. These results suggested a new approach to improve control of soil borne plant pathogens in hot arid region by combining prolonged sub- lethal heating, effective naturally available cruciferous residues as soil amendments and one irrigation.

006 Plant Pathology as a career

R.C. SHARMA College of Horticulture, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan – 173230 (HP)

Plant Pathology is a branch of agricultural science that deals with the study of fungi, bacteria, viruses, nematodes, and other microbes that cause diseases in plants. The branch focuses on understanding how hosts, pathogens, and environments interact to cause plant diseases and on understanding how to control plant diseases. Thus, a plant pathologist is a person who specializes in plant health much similar to a physician who specializes in human health or a veterinarian in animal health. More specifically, plant pathologists utilize modern scientific equipment and techniques to unravel the mysteries of how pathogens attack plants and to understand the effects of environmental conditions on disease development. Interactions between plants and their pathogens are studied at all levels of biological organization, from molecules to organisms to ecosystems. Pivotal role of a plant pathologist in a crop production system is evident from the fact that plant breeders, entomologists, seed technologists, environmentalists and weed scientists work in tandem with plant pathologists for planning and execution of various components for the development of integrated


8

environmentally sound approaches for raising crops on scientific lines. Working together with other specialists, plant pathologists contribute to the production of a stronger economy, safer foodstuffs, a cleaner environment, conservation of soil and water resources and the health of workers in farms, gardens, and landscapes. Plant pathologists and bioengineers also are collaborating closely in developing disease-resistant plant varieties, preserving food from spoilage, developing new strains of organisms for biological control, and even in developing composting processes for solid waste disposal. Employment opportunities in plant pathology include research, product development, sales, teaching, extension, administration, regulatory work, and private practice. Certain institutions also offer advanced degrees in crop protection or plant health that combine curricula in crop science, soil science, entomology, weed science, and plant pathology with practical experience to prepare graduates for careers as private or public practitioners of plant health management. The expanding interest in the quality of our global environment and increasing global demand for high-quality food, fibre, tree and ornamental plants provides many opportunities for plant pathologists. These professionals often are sought by government and non-profit organizations and corporations to participate in teams of specialists addressing international agricultural development. Such employment may be on a continuing or a consulting basis.

007 Plant clinics and plant disease diagnosis in plant health management

Y.S. PAUL Department of Plant Pathology, CSK HP Krishi Vishvavidyalaya, Palampur-176062 (HP).

Global food production must increase by 50% to meet the projected demand of the world’s population by 2050, which has crossed 700 million this month. It has been estimated that land degradation, urban expansion and conversion of crops and croplands for non-food production will reduce the total global cropping area by 8–20% by 2050. Climate change is likely to affect 25% of world cereal production in Asia by influencing water availability. Pest and disease management has played its role in doubling food production in the last 40 years, but pathogens still claim 10–16% of the global harvest. In financial terms, disease losses cost Rs 22,000 crores. Plant pathology is largely an important mission driven discipline because all nations face serious challenges in their efforts to prevent disease on cultivated plants. Pests and diseases, the prime factors causing low agricultural productivity, are mostly controlled by chemical means. The use of pesticides has helped in increasing agriculture production and also led to the development of resistance in pests, contamination of the environment and resurgence of many new pests. There are about 1000 agrochemicals in use in the world over. India accounts for about 3.7 per cent of the total world consumption. It is also of interest to know that in spite of increased consumption of plant protection chemicals, the produce loss due to insects and pests increased by 5 times during the period from 1988 to 1995. In addition, many other disadvantages of the pesticides have been recorded including the contamination of water sources, food and shift in biodiversity. Nearly seventy per cent of the healthy looking vegetables and fruits have high levels of residual pesticides. Indiscriminate and injudicious use of pesticides have resulted in several adverse affects viz. development of resistance to pests, resurgence in pests, pesticide residues in food, fodder, soil and water, pesticide poisoning and health hazards, environmental pollution and ecological imbalance. Pest and disease problems are a major source of concern for farmers around the world, and nowhere more so than in developing countries. For many subsistence farmers a healthy crop can mean the difference between a plentiful food supply and the possibility of going without. Farmers will often turn to their peers or seek advice from pesticide dealers on managing their crop problems. The help they find here can be useful, but if it is inaccurate they run the risk of losing their crops and potentially jeopardizing their livelihood. Plant health clinics advise farmers on sick plants the way a health clinic advises humans on their ailments. Diagnosis of the problem is often made on-the-spot with a prescription given to the farmer. Plant clinics give poor farmers access to national and international diagnostic expertise. They have enabled scientists to reach more farmers in a timely low-cost way. Preliminary results have shown that the plant health clinics increase incomes and crop harvests and reduce pesticide abuse. They also lay the foundation for plant health systems. Plant clinics help farmers avoid the futile costs of self medication, dosing fields with the wrong pesticides and make sure they use the right ones instead or none at all if that works best.


9

008 Emerging plant disease problems in Haryana and their management

S.K. GANDHI Department of Plant Pathology, CCS Haryana Agricultural University, Hisar-125 004 (Ha).

The incidence of plant diseases has been one of the major limiting factors in achieving the production potential of the crops. Insect pests, diseases and weeds together cause a total loss of approximately 30% of total crop production in our country. Since sustainability of agriculture growth is dependent upon crop health, concerted effects are needed to combat the challenges of climate change, pests and diseases. The disease scenario in different parts of the country differs with changes in weather and soil conditions. The introduction of new crop varieties, intensive agriculture through increased cropping intensity, heavy external inputs and changes in environment have affected the plant disease scenario ion the state of Haryana as well. Diseases which were of minor economic important earlier have become quite serious now. With the introduction of cultivars resistant to BLB and cultivation of rice in non-traditional areas, Bakanae and sheath blight have started appearing with more severity. In cotton, Para wilt, the exact etiology of which is still unknown, continues to cause heavy losses in farmer’s fields. For the last few years cotton leaf curl virus occurrence is on increase and is responsible for economic losses to the growers. In recent year blast disease in pearl millet, a major kharif crop of the state, has made its appearance and may pose a threat in seed production. Guar or cluster bean, grown widely in Haryana because of its remunerative price for its gum content, is attacked by bacterial blight, Alternaria leaf spot and root rot. Blight due to Choenophora is of recent occurrence and detailed studies on its epidemiology and management are needed. In potato, besides earlier known viral diseases, apical leaf curl virus is a newly emerging problem. Onion seed production in the state has been hampered due to lopping syndrome and onion yellow dwarf virus is one of the major causes of this syndrome. Changes in environmental conditions have also brought shift in the occurrence of diseases. Yellow rust of wheat was a major problem in wheat during 2010 and 2011 owing to prevalence of moist conditions and moderate temperature in the months of February and March. Incidence of flag smut is on increase in some districts. Further the adoption of sprinkler irrigation system has resulted in more congenial environment at ear head emergence stage for the development of Karnal bunt of wheat. With the change in the scenario, the diagnosis and management of crop diseases, besides etiology and epidemiology, has assumed a greater significance. The development of resistant varieties, proper sanitation, biological control, use of chemicals and botanicals can be explored to evolve suitable disease management strategies for newly emerging diseases. Besides traditional approaches of disease management, biotechnological techniques need to be explored more intensively especially against viral diseases, which are otherwise difficult to manage. The technology developed must express durability of resistance under field conditions, should be commercially viable and socially acceptable.

009 Current status of emerging sugarcane diseases in North India M.L. CHHABRA and B. PARAMESWARI Sugarcane Breeding Institute, Regional Centre, Karnal-132001(Ha). E-mail: [email protected]

Sugarcane is one of the important cash crops of India subjected to several diseases caused by fungi, bacteria, MLOs and viruses. Among the fungal diseases, red rot had been the major disease in the country present in most of the sugarcane growing regions. Red rot was first reported in Andhra Pradesh by Barber in 1901 and ever since the disease had been in focus in view of the epidemic nature of the disease and the potential yield losses with debilitating effect on the industry. Red rot had always been considered an important disease in view of the endemic nature of the pathogen. Its first epidemic occurred during 1938 in the popular variety Co 213, which almost decimated the sugar industry in eastern UP and Bihar. In subsequent years a number of major outbreaks have been recorded as a regular event in sub–tropical and tropical region of the country resulting in failure of several commercial sugarcane varieties. During current decade, moderate to severe incidence of red rot has been recorded in many popular varieties under cultivation in North India viz. Co 1148, Co 7717, CoS 788, CoC 671, CoC 676, CoJ 64, CoS 767, CoS 8432, CoLk 8102 and CoPant 84212.


10

In the recent years, break down of leading variety CoS 8436 due to red rot has been observed in most the cane growing areas of the zone. During the recent survey conducted in the fields of 13 sugar mills of Haryana, traces to 40.0% incidence of red rot was noticed in variety CoS 8436 in both plant and ratoon crops under Karnal, Shahabad, Yamunanagar, Bhadson, Kaithal and Sonipat area. However, during preceding year, red rot incidence was recorded up to1.0% in variety Co 89003 in Punjab. Severe incidence of red rot has also been reported in variety CoS 8436 in Uttar Pradesh. Emergence of new diseases and minor diseases becoming major diseases are not unusual to the crop. In the recent years, yellow leaf disease (YLD), pokkah boeng and wilt are emerging diseases of sugarcane in north India and many popular varieties are susceptible to these diseases. YLD is assuming far greater importance now, in view of its wide spread occurrence in all most all the sugarcane varieties. Further impact of YLD on growth and physiological parameters of variety CoPant 84211 showed that there is marked reduction in plant height, number of internodes and intermodal length in the infected canes during the grand growth than formative stage. YLD infected sugarcane plants recorded lesser photosynthetic activity and reduced mobilization of photosynthates from the leaves to stalk, thereby reducing the sucrose accumulation in the affected stalks. However, emergence of wilt disease has become a major threat for sugarcane cultivation in the north India. In early maturity high sugar varieties increased incidence of wilt was noticed, whereas, in variety Co 89003 disease complex of wilt i.e. wilt alone, wilt with root borer and wilt with red rot was noticed in Punjab and Haryana. From Bihar also such combined infections were reported on many varieties. In Uttar Pradesh also severe to moderate level of wilt in CoS 98259, CoS 92423, CoS 8432, CoS 88230, CoS 96275 and CoSe 95422 were recorded. Further, incidence of another new emerging disease i.e. pokkah boeng has been observed by 1 to 10% in almost all the varieties namely Co 0238, CoH 119, CoJ 85, CoJ 88, CoS 8436 and Co 0118 under cultivation in Punjab, Haryana and other areas during 2011 crop season. The recent survey reports revealed that, most of the popular varieties like BO 141, CoH 119, CoH 151, Co 0118, Co, 0238, Co 0239, Co 7805, Co 1148, CoJ 85, CoJ 88, CoS 767, CoS 8436, CoS 88230 and CoS 92423 under cultivation in different states were severely affected with this disease. Similarly, RSD has also been found to cause considerable yield losses in some areas.

010 Brassica crop diseases: Present status and future strategies for management

NARESH MEHTA Department of Plant Pathology, CCS Haryana Agricultural University, Hisar-125 004 (Ha).

Brassica oilseed crops have a significant role in Indian agriculture since almost each part of the plant is consumed either by human beings or animal beings depending upon the crop and its growth stage. The production and productivity of these crops is limited by a number of biotic and abiotic stresses. More than twenty five diseases are known to affect the Brassica oilseed crops all over the world. However, diseases like Alternaria blight (Alternaria brassicae), white rust (Albugo candida), downy mildew (Peronospora

parasitica), powdery mildew (Erysiphe cruciferarum) and Sclerotinia rot (Sclerotinia sclerotiorum) are of major consequences because of their widespread distribution, severity and resulting yield losses. During the recent past, disease scenario has changed as some diseases earlier rated as minor become major ones owing to intensive cropping, heavy irrigation and fertilization and climate changes. Though, lot of information has been generated on major diseases relating to geographical distribution, losses incurred, symptoms, diagnostics, disease cycle, epidemiology, resistant sources, physiological specialization and integrated disease management but still much more is required to overcome the annual losses caused by these diseases in the years to come. We need to have clear vision to achieve the goal as per our growing needs through integration of technology available with us. To achieve tangible results, we require inter/intra institutional network research projects for validation of research results especially epidemiological models to manage Brassica oilseed crop diseases more effectively. The areas which need in-depth study are epidemiology and forecasting, host resistance including nature and mechanism, physiologic specialization using conventional and molecular tools, rapid diagnostic biotechnological techniques and integrated disease management including biological control measures. It has been experienced that disease management technology has very slow percolation to the end users. Hence, concerted efforts of scientists and extension workers are required in


11

this direction. Some future priority research areas of Brassica Pathology include: standardization of host differentials and nomenclature of pathogenic races; Identification of broad-spectrum sources of resistance, resistant loci and resistant genes in each locus; identification of slow blighting, slow mildewing, slow rusting genes, tolerant, partial resistant, strong and weak genes with suitable combinations; genetics of virulence and virulence spectrum; mapping, cloning, characterization and identification of genes for resistance and virulence; development of varieties through tissue culture or micro spore culture techniques; biochemical basis and genetics of Albugo-Peronospora association. Besides this, integration of bioagents application; use of organic amendments and systemic acquired resistance (SAR) chemicals would go a long way in devising suitable IPM and IDM modules for economical management of Brassica diseases.

011 Changing disease scenario in apple orchards of Himachal Pradesh: Probable

reasons I.M. SHARMA Department of Plant Pathology, Dr YS Parmar University of Horticulture & Forestry, Nauni, Solan (HP)-173230.


Apple is attacked by number of diseases viz., scab, premature leaf fall, cankers, powdery mildew, root rot, collar rot, seedling blight, fruit rots, sooty mould, fly speck, different leaf spots and blight including viral disease namely; chlorotic leaf spot, apple mosaic and dapple apple. The scenario of these diseases in apple is dynamic since their first appearance. It is mainly attributed to the availability of inoculum, susceptible host and prevalent environmental conditions. Further, availability of inoculum, initiation of a disease and its subsequent spread is largely determined by prevalent environmental conditions. In additions, pesticide use pattern and inappropriate adoption of package of practices have also contributed in changing disease pattern. Efforts were made to correlate these factors (1993-2012) with changing disease scenario in apple at HRS Seobag, Kullu. Scab (Venturia inaequalis) which remained economically important for about two decades (1978-1998) has now almost disappeared since the crop season of 1999. The major reason for its disappearance was the occurrence of unfavourable weather conditions i.e. prolonged dry weather (6.9mm in 4 rainy days and RH 54.8%) between the period of ascospores maturity to their complete exhaustion from pseudothecia (March- May, 1999) did allow the manifestation of primary infection. Later this disease reappeared in some pockets of district Mandi, Kullu, Sirmour, Kinnaur and Shimla during 2001, 2005, 2008 and 2011. It could not flare up due to the dominance of another disease, premature leaf fall which results in defoliation of leaves before mid September (affected production of pseudothecia) and therefore it eclipsed the appearance of scab. Premature defoliation (Marssonina coronaria) first noticed in 1994 and assumed severe epiphytotic proportion during 1995-2001. Its appearance is mainly attributed to indiscriminate use of EBI fungicides particularly hexaconazole (effective against scab, powdery mildew and leaf spots) since 1991 onward. It gave sufficient time for Marssonina to build up its inoculum to appear in severe form in the following years. This disease was suppressed to a greater extent (PDI 0-12%) during 2002 due to occurrence of draught like conditions (43mm in 7 rainy days ) from mid June – mid August. Thereafter, it continued to appear in low incidence till 2005 and again appeared in severe form during 2006, 2007 and 2010 due to occurrence of sufficient rains (122.3-243.8 mm) during July–August. Further, due to non spray of EBI fungicides in the absence of scab disease after 1999 onward and occurrence of more rainfall during late rainy seasons of 2002-2006 except 2005 gave a sufficient time for the inoculum of Alternaria leaf spot and blight disease to build up and thereafter it has been appearing in moderate form. A new canker disease caused by Cryptosporiopsis corticola appeared in severe form in apple orchards during 2002 due to occurrence of slightly higher temperature (26.9oC), low humidity (52.1%) and scanty rains (2mm in one rainy day) in the month of July and took epiphytotic proportion. It did not flare up in the following years (2003-2007). It has again reported to appear in moderate form during 2012 due to less rainfall during June- July. Its fruit rot stage (bull’s eye rot) was observed in occurring moderate-severe form during 2001, 2008 and 2010. Further, moldy core and core rot (Alternaria mali, Trichothecium roseum) suddenly assumed alarming situation in apple orchards during 2005, 2007, 2008. It is attributed to sufficient availability of inoculum of these


12

pathogens due to late rains since 2002-2006 and occurrence of favourable conditions for infection (low-moderate temperature with intermittent rains) during flowering; fruit set and till the calyx end toward the sky (March-April). Occurrence of low rainfall during April-May during 1999, 2002, 2005, 2007, 2010 and 2012 accompanied with low to moderate temperature along with fewer sprays of EBI fungicides due to disappearance of scab has helped in the appearance of powdery mildew disease in higher severities since 1999. It has led to higher severity of fruit russeting during these years as well. Other diseases particularly; the cankers (high in low and moderate in mid height apple orchards), fruit rots, soil borne disease (white root rot, collar rot, seedling blight) are mostly sporadic/ endemic in their occurrence and their severity though is also affected by prevalent weather conditions but no noticeable change has been observed. During the crop season of 2007, environmental related disorders viz., winter injuries, sun scalding and russeting in apple were noticed to a greater extent.

012 Real-time ‘Mashobra- Disease- Forecast’ mechanism to predict apple scab in Himachal Pradesh

V.S. THAKUR Dr YS Parmar University of Horticulture & Forestry, Regional Horticultural Research Station, Mashobra,

Shimla-171 007 (HP). Email: [email protected]

Concerted efforts have been made to utilize the outcome of the long and dedicated research work on different aspects of apple scab with an aim to develop a system to which apple farmers can use by submitting the basic information of the orchards. The farmers (those who have scab infection during the last three years) were asked to develop data for temperature and rainfall of their orchards from leaf fall date to the maturation of overwintering inoculum on the orchards floor. The sequential development of the pathogen is standardized from the database. The forecasting criteria/equation developed for apple scab indicated highly synchronized influence of the weather conditions on the host and the pathogen. A mathematical model to predict scab was developed to compare the epidemic conditions. This model will be used to simulate the conditions that will prevail during the subsequent years for varied disease index. The derived prediction equation is indicating the effect of temperature and rainfall/snowfall during winter, that a unit change i.e. 1.0oC increase in temperature followed by rain/moisture was responsible for the epidemic conditions and increased the disease incidence by 4.766 units and 22.09 units in disease intensity which has amounted up to 84.54 per cent severity level on leaves and 44.86per cent on fruits and vice-versa. This also explains that the coefficient (%) of determination (R2) accounting for 95.86per cent and 89.42per cent variation in scab is attributed to temperature and rainfall variables. This model will help in predicting the scab disease outbreaks in future. This computer programme also has option on the control measure that relates to the initial forecast on the inoculum threshold vis-à-vis display ‘no infection’ and ‘no spray’ till such conditions met out. The technique has guided the farmers and achieved 3-4 lesser sprays during the spring and summer for the control of diseases over the years.

013 Diseases of apple and their management through chemicals J.N. SHARMA Department of Plant Pathology, Dr Y S Parmar, University of Horticulture and Forestry, Nauni, Solan (H P). Email:

[email protected]

Incidence of diseases is one of the most important factor in lowering the apple fruit production and they can cause as much as 30-50 percent loss under favourable conditions. Apart from the lowered fruit quality and yield, certain plant pathogens infecting roots and stems of the trees may cause premature decline of the orchards and death of the bearing trees resulting in total loss. White root rot (Dematophora necatrix) and collar rot (Phytophthora cactorum) are important soil borne diseases in different agro-climatic conditions


13

and are favoured by clayey soil with poor drainage of the orchards; whereas seedling blight affects the nursery stock and young trees and is particularly severe in well aerated sandy loam soils. Apart from better drainage and resistant root stock, soil drenching with carbendazim (against the white root rot), metalaxyl (against collar rot) and thiram (against seedling blight) is effective in controlling these diseases. Of late, hairy root rot (Agrobacterium rhizogenes) and crown gall have become important and responsible for rejection of apple nursery stock up to 40 per cent in some cases. Exemplary biological control of crown gall has been achieved through K 84 strain of non-pathogenic Agrobacterium radiobacter in Australia. In India, efforts are in progress to develop a native non-pathogenic strain for controlling crown gall. More than 13 canker causing fungi affecting tree trunks of apple have been isolated and found responsible for production various cankers in Himachal Pradesh. Major among them are smoky blight (Botryosphaeria obtusa), pink canker (Corticium

salmonicolor), stem brown (Botryosphaeria dothidea), stem black (Coniothecium chomatosporum), nail head (Numularia discreta), and silver leaf canker (Chondrosterium purpureum). Most of these canker fungi are known to produce leaf and fruit spots in apple and other related host plants. Cultural practices like mulching, balanced fertilization, irrigation and proper training and pruning of the trees are recommended to avoid canker diseases. Pruning wounds and other unavoidable mechanical injuries should be treated with fungicide based pastes and paints immediately. Affected portion should be scarified and cauterized with blow lamp, followed by copper based or cow dung paste for hastening the healing of the wounds. Sprays of carbendazim, benomyl and copper oxychloridein the fall and late dormancy and are effective in controlling pink canker and others in the field. Attempts have also been made to use biocontrol agents such as Trichoderma koeningii and Bacillus subtilis for the control of Nectria galligena, and Trichoderma viride against silver leaf and Valsa canker. On apple foliage, scab is the foremost disease and it is prevalent almost in all the apple

producing states of India affecting both leaves and fruits. Its incidence is quite high in J&K, Uttarakhand and Arunachal Pradesh. A protective spray schedule involving different fungicides like dithiocarbamates, benzimidazoles, captan, dodine and dithianon is recommended for the fruit growers. Sterol-inhibiting fungicides bitertanol, fenarimol, myclobutanil, haxaconazole, penconazole and difenoconazole have exhibited excellent curative and eradicative activity against V. inaequalis which have been successfully used in monitored disease control especially in epidemic situations. Marssonina blotch appeared in Himachal Pradesh early in 1990s and affected the apple plantation through out the state covering more than 90 per cent area by 1995 when it caused widespread premature defoliation of the trees. The author is credited with successful diagnosis of ‘premature leaf fall’ to be caused by Marssonina coronaria, a hitherto little known

fungal pathogen in India. Its incidence has also been recorded from J&K, Uttarakhand and Arunachal Pradesh. This disease was favoured by excessively humid conditions during fruit development and later stages of apple. A protective spray schedule, involving application of mancozeb, carbendazim, dodine and mancozeb flowable from walnut to preharvest stages of apple at 21 days intervals is recommended to control it. As both the above apple pathogens perpetuate in the infected leaf litter, its destruction by raking, collection followed by burning, and urea (5%) spray in the autumn is effective in reducing the disease incidence. Sooty blotch (Gloeodes pomigena) and fly speck (Schizothyrium pomi) cause black superficial blemishes on apple and pear fruits thereby reducing quality and ultimately the market price of the fruit produce. They can be avoided by application of dithiocarbamates, benzimidazole and captan in rainy season at regular intervals. Apple is vulnerable to postharvest decay and spoilage by different plant pathogenic fungi. Chief among them are: blue mould (Penicillium expansum), pink mould (Trichothecium roseum), bitter rot (Glomerella cijngulata), whisker’s rot (Rhizopus arrhizus), brown rot (Monilinia laxa), and core rot (Alternaria alternata) which has assumed more importance more recently. Infection of most of these pathogens takes place at harvest, handling and storage. However, some of these like bitter rot, brown rot and core rot infect fruits in the field and develop at a later stage. Proper handling, transit and storage are pivotal in their management apart from pre-harvest fungicide sprays, and dip treatments after harvest. Although, fungicides and other chemicals provide effective control of above apple diseases, an integrated disease management approach is always recommended to ameliorate their adverse effect on the environment and human beings.


14

014 Epidemiology and management of root rot and web blight of French bean

S.K. GUPTA Dr YS Parmar University of Horticulture and Forestry, Horticultural Research Station and Krishi Vigyan Kendra,

Kandaghat-173 215 (HP). Email: [email protected]

French bean (Phaseolus vulgaris L.) is an important off-season vegetable crop of Himachal Pradesh. During cultivation it is affected by several diseases of fungal, bacterial and viral nature. Among fungal diseases root rot and web blight (Rhizoctonia solani Kuhn) is an important disease which every year appear in moderate to severe form particularly in bush type beans and cause significant yield reductions. Keeping in view the importance of the diseases studies were carried out on the variability, epidemiology and management of the disease through cultural, biological and chemicals alone and in combination. Although morphological and cultural characters showed slight differences among the isolates but studies on pathogenic variability demonstrated the existence of varied aggressiveness in each cultivar. Isolates T8 and T9 were least sensitive to Bavistin while T10, T13 and T17 exhibited maximum sensitivity. On the basis of anastamosis behavior, the isolates were placed in AG-IA, AG-1 and AG-4. Isolates also produced different banding patterns for esterase as well as NADH dehydrogenase. Isolate of AG-4 varied slightly while AG-1-IB and AG-1-IA were slightly more variable. Root rot development was favoured at 80% soil moisture and 25o C, while the combination of latter with 100% RH favoured web blight. Continuous leaf wetness of 12h showed symptom development after 26 h High soil moisture, RH (>80%) and moderate temperature (25±1oC) favoured disease development under field conditions. Integration of soil solarization, soil amendment (mustard cake) + Allium sativum (ST + FS) + Bacillus subtilis (ST + FS) was most effective in reducing the incidence of pre and post emergence root rot whereas, severity of web blight was best contained by combination of soil solarization + soil amendment (mustard cake) + A. sativum (ST + FS) followed by treatment combination of soil solarization + soil amendment (mustard cake) + A. sativum (ST) + B. subtilis (ST) + carbendazim (FS). Similar trend was observed for apparent infection rate and green pod yield.

015 Potential of PGPRs as biofertilizers and biofungicides

C.K. SHIRKOT Department of Basic Sciences, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan HP-173230

E-mail: [email protected]

Plant growth promoting rhizobacteria (PGPR) include bacteria in the soil near plant roots, on the surface of plant root systems, in spaces between root cells or inside specialized cells of root nodules. PGPR could include the legume nodulating rhizobia, and as such can be separated into those that are outside plant cells (extracellular—ePGPR) and the rhizobia that live inside plant cells (intracellular—iPGPR). PGPR increase plant growth through a broad range of mechanisms which are not fully understood, but are thought to include: (a) the ability to produce plant hormones, such as auxins, cytokinins, gibberellins, and ethylene; (b) asymbiotic N2 fixation; (c) solubilization of inorganic phosphate and mineralization of organic phosphate and/or other nutrients and (d) antagonism against phytopathogenic microorganisms by production of siderophores, the synthesis of antibiotics, enzymes and/or fungicidal compounds and competition with detrimental microorganisms. Among the biological control alternatives to the extensive use of chemical pesticides, the application of non-pathogenic soil bacteria living in association with plant roots is promising. Treatment with these PGPR in many cases is associated with reduced plant diseases in greenhouse and field experiments. These PGPR strains are capable of directly antagonising fungal pathogens by competing for niche and essential nutrients, or by producing fungitoxic compounds. However, the isolation of some PGPR strains lacking the ability to exert any antagonistic activity toward pathogens has shed new light on the diversity of their modes of action, and has suggested that such strains may activate host defence systems. As bacterial treatment at the root level confers protection against foliar or systemic pathogens, such PGPR-mediated resistance has been termed induced systemic resistance (ISR). ISR is effective against a broad range of diseases, and disease control strategies based on this mechanism have been successfully applied under field conditions. The objective of the work described in this paper is to highlight the direct and indirect growth promoting potential of PGPR via antagonism against phytopathogenic microorganisms and as biological control alternatives to the extensive use of chemical pesticides in horticultural crops.


15

016 Disease control trends and challenges

EDWIN ROGBELL and RAJAN TRIVEDI Crop Protection Products, E.I.DuPont India Pvt Ltd.

Plant diseases present a major constraint in realizing the full yield potential of food and cash crops. Since the first fungicide, sulphur was used to control grape powdery mildew, production of most crops has become dependent on the use of fungicides to avoid losses due to diseases. With more intensive cropping, new diseases have arisen which are devastating if not controlled, such as soil borne plant pathogens and bacterial diseases. In addition, new races and more aggressive pathotypes of diseases have arisen. In India, out of total crop protection market size of Rs. 8000 crore, fungicides contribute Rs.1800 crore (22.5%). Out of this, major fungicides are being used to control rice diseases followed by fruit and vegetables, and potato. Though majority of the fungicides launched are targeting the oomyctes diseases of grapes and potato, the fungal diseases of rice, chilli and other vegetables also play an important role and warrants an equally effective newer molecules. The major changes in fungicide use have usually been associated with changes in the spectra of pathogens as well as in crop intensities, practices or prices. The recent thrust to export and smooth trade practices set an expectation for molecules that meet not only better efficacy but also the low toxicity, low PHI and minimum or no residues in the produce to meet the MRLs. The new generation of fungicides consists of compounds that are ecologically safe, have still new modes of action, somewhat broad spectrum and applied at quite low dose rates like strobilurins, oxazolidinediones, anilinopyrimidines, benzamides, valinamides, mandelamides, cyanoimidazoles etc., representing different chemistries and mode of action. The strobilurins are an outstanding new class of fungicides. Registrations have been obtained on a wide range of crops throughout the world, to the point where the strobilurins can now be considered to be one of the most valuable classes of single-site fungicides ever discovered by the agrochemical industry. They have set new standards in disease control and, more importantly for the grower, in the delivery of improved yields and quality. Indeed, the success of the strobilurins in the fungicide market simply reflects the benefits that they bring to those producing the crop. DuPont working on its strobilurin fungicide Picoxystrobin will bring to Indian market by early 2013 targeting rice blast and grape downy and powdery mildews. Among the challenges, the right diagnosis of crop diseases, appropriate recommendation for their management and more importantly the fungicide resistance management are vital. Resistance management strategies must combine the long-term conservation of fungicide effectiveness with an amount and pattern of use that are sufficient both to satisfy the needs of the farmer and to provide a reasonable pay-back to the manufacturer and must be applied uniformly over large areas in order to obtain their full biological benefit. The Fungicide Resistance Action Committee (FRAC) and its network play a vital role in the design and support of these strategies.

017 DNA barcode of life applications and prospects in taxonomy and disease

diagnostics

P.N. SHARMA Molecular Plant Pathology laboratory, Department of Plant Pathology, CSK HP Agricultural University. Palampur

(HP)-176 062. Email: [email protected]

Accurate identification of plant pathogens is the first and prime pre-requisite in investigation of its host-pathogen relationship and ultimately the management. Involvement of more than one species of a pathogen or pathogens further aggravates the complexicity of relationship and ultimately questions the effectiveness of management strategies. Recently, DNA barcode of life has emerged as one of the important tool in taxonomy of natural world and its application in plant pathology have simplified the identification and detection of complex pathogens in general and pathogen of quarantine importance in particular. DNA barcode of life initiated with identification and recognition of distinct animal species has currently been focused on settlement of the taxonomic anomalies of different pathogens and pests due to its robustness and advantages over conventional procedures. However, potential genomic regions (DNA barcode markers) should be tested rigorously prior to adoption in a standardized system for a given organism. DNA barcoding uses standardized 500- to 800-bp sequences to identify species of all eukaryotic kingdoms using primers that are applicable for the broadest possible taxonomic group. Reference barcodes must be derived from expertly identified vouchers deposited in biological collections with online metadata and validated by available online


16

sequence chromatograms. In fungi, the DNA barcode based system employs use 400- to 600-bp region of the nuclear large ribosomal subunit, the internal transcribed spacer (ITS region- ITS1&ITS2) cistron, partial-tubulin A (BenA) gene sequences, or partial elongation factor 1-α (EF-α) sequences, and sometimes other protein-coding genes. However, ITS region has been proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life (Schoch et al., 2012). In bacteria, various DNA target regions localized in the 16S rRNA gene, core genes and accessory genes are used in a stepwise approach. Likewise in insects, the mitochondrial gene encoding the cytochrome C oxidase subunit 1 (CO1) is useful barcode. Versatility of these target genes in pathogen detection will be discussed in this presentation.

018 Changing disease scenario in dry and cold arid temperate fruits: Future needs

and strategies

SATISH K. SHARMA, JOGINDER SINGH, PRAMOD KUMAR and ANIL KUMAR Dr YS Parmar University of Horticulture and Forestry, Regional Horticultural Research Station, Sharbo,

Kinnaur (HP) -172107. E-mail: [email protected]

Dry temperate and cold desert area of Himachal Pradesh comprising of Spiti Valley, Kinnaur and some parts of Chamba district have dissected topography, high mountains, extreme climate and poor economic conditions of the people. Extreme variations in daily and seasonal temperature along with scanty or no precipitation during spring and summer ensure short growing season with exposure to harmful infra red and ultra violet radiations. Factors such as high transpiration due to excessive heat during summer (often causing mortality), inadequate photo-hours especially during winter, injury due to frost resulting in poor seed germination, vegetative growth, root formation, deformed canopy, reduced radial growth etc. and other physical signs/phenotypic manifestations, which in turn affect the productive biomass production in the region. In this region, as a whole, the initial land use pattern was purely agriculture and traditional crops such as wheat, ogla, phafra, barley, kankani, cheena, maize, chullai, bathu, black peas, mash, rajmash, wild apricot (Chhulli), cabbage, turnips, potato, and European carrots besides some locally available wild green vegetable leaves. It has, however, changed over period of time to agri-horti-silvi-pastoral system. Horticulture in this region has emerged as an important alternate for diversification of agriculture and has proved a sustainable substitute for improving income through increased productivity, employment opportunities, enhancing export potential, and above all sustaining livelihood and ensuring food and nutritional security. The changing climatic scenario in this region has resulted in emergence of numerous serious biotic stresses. Even the traditional crop “Chulli” has succumb to Stigmina blight and gummosis due to increasing downpour and resulting in compete loss of fruits. The incidence of fruit gummosis has become a major bottleneck in successful cropping of almond. Marssonina leaf blotch has appeared in epidemic form in most of the apple orchards with 70- 80% incidence. In some of the orchards 20-30 per cent fruits have also been found infected. In Pistachionut leaf and panicle blight and rust appeared in epidemic form resulting in complete defoliation and rotting of nuts and kernels. Phytophthora crown rot in apple in nurseries as well as in fields is emerging a major constraint in the establishment of transplanted plants in the field. Heavy incidence of Phytophthora crown rot of apple on young trees of 4-5 years have been recorded in Raksham village destroying almost 70 per cent plants whereas white root rot of apple incidence is increasing year after and disease has become a major problem in some areas where the disease has been observed to killing 20-30 per cent plants every year. Brown rot of apple fruits on the trees nearing harvesting on Oregon Spur and Gale Gala apples has been observed to the tune of 20 per cent. Low lying areas in Sangla and Katgaon valley are experiencing heavy incidence of apple scab where almost 60-80 per cent fruits have been found infected in some of the orchards. The scenario of these diseases is changing year to year basis due frequent climatic changes and a blanket strategy of recommendations cannot be followed. Further, the orchardists of dry and cold arid zone are ignorant of chemical sprays. The strategies such as complete restriction on movement of nursery or seedling apple plants from lower areas to dry temperate zone, restriction on cultivation of high rising crops amongst orchard trees, modification of floor management practices such as shape of tree basins, system of irrigation, standardization of nursery production techniques, grafting height of seedlings or rootstocks, are required to be modified for tackling upcoming disease problems. Hence, under such situations


17

early forecasting strategies and integrated disease management practices based on need based use of chemical sprays are required to be developed along with creation of awareness amongst farming community in the tribal belt.

019 Emerging need to substitute dithiocarbamate fungicides on horticultural crops

I.D. SHARMA, R.S. CHANDEL and S.K. PATYAL Pesticide Residue Laboratory, Department of Entomology, Dr YS Parmar University of orticulture and Forestry, Nauni,

Solan 173 230 (HP). Email: [email protected]

The ethylene bisdithiocarbamates (EBDCs) are a group of pesticides used to control fungal diseases on a wide variety of fruits, vegetables, ornamental plants and turf grasses. They have a similar action to carbamate insecticides, except they affect the nervous system through their main metabolite, carbon disulfide (CS2). The primary concern with mancozeb is its spontaneous degradation to ethylenethiourea (ETU) in the presence of water and oxygen. ETU has been reported to develop cancer, thyroid disorders and birth defects to people who handle or apply EBDC fungicides without wearing protective clothing. However, people who eat foods containing EBDC residues in amounts found on crops at harvest time are not at risk for thyroid disorders or birth defects, but they may have an increased risk of developing cancer. The findings of different workers about ethylenethiourea (ETU), as terminal residues of EBDCs in various plant products as well as degradation product in the fungicide formulations have, however raised doubts on the use of EBDCs. The risk posed by a pesticide depends not only on its toxicity but also on the amount of it to which people are exposed. As a response to this concern and for the safety of consumers, the Pesticide Residue Laboratory of the University has been undertaking a continuous monitoring programme for the assessment of human exposure to different pesticides through consumption of fruits and vegetables following PFA and Codex Alimentarious maximum residue limits (MRLs). EBDC residues were estimated based on evolution of carbon disulphide (CS2), resulting from acid hydrolysis and measurement by spectrophotometry. For revalidation of results, xanthate formed from CS2 was subjected for observing UV-spectra at 302 nm followed by derivatization of the peak in the second order mode. A total of 842 and 410 samples of vegetables and fruits collected from different farm gates and market yards of Himachal Pradesh since 1990 were analysed for 42 pesticide residues belonging to different groups viz. organochlorines, organophosphorous, synthetic pyrethroids, EBDCs and MBC. In vegetables, the pesticide usage pattern during the decade 1990-2000 resulted in most samples laced with EBDC (>70%) followed by MBC (2%) and OC (1%) residues. Out of a total 218 EBDC contaminated samples 8 samples were found volatile. Though there was a gradual decline in residue contamination during 2001-2011, yet EBDCs were the main culprit. In apple, out of total 238 samples collected during 1990-1999, EBDC residues were detected in more than 60% samples, while presence of other contaminants was found to be 8.40, 7.14 and 5.46% for MBC, OC and OP pesticides, respectively. However, 4.62% of the EBDC contaminated samples contained residues above MRL (3 mg kg-1 CS2). There was a slight decline in sample contamination (52.22%) during 2000-2011 and none of the sample was found above MRL. The other pesticides, organochlorines and organophosphorus were found below detectable level of 0.01 and 0.05 mg kg-1, respectively, in all the evaluated samples. The study therefore, concludes that the persistent nature of EBDC has resulted in significant higher level of contamination in vegetables and fruits, though the level of contaminated samples above MRL was less than 5%. Since, mancozeb is one of the main fungicides among EBDCs being used heavily on different crops, thus require its substitution in future disease management programmes on vegetables and fruits.

020 Advances in production and storage of disease free clean ginger (Zingiber

officinale Roscoe)

N.P. DOHROO Directorate of Research, Dr YS Parmar University of Horticulture & Forestry, Nauni-173 230, Solan (HP).

Ginger (Zingiber officinale Roscoe) is an important spice crop of India. In North India, the crop is of great importance in Himachal Pradesh and NE States like Sikkim, Meghalaya, Mizoram, Manipur, etc. The crop is


18

of great significance in Himachal Pradesh because of the prevailing agro ecological conditions. In H.P., the crop is cultivated in an area of 4000 ha with the production of 30,000 MT of green ginger. In this state, the crop is grown in ten districts, viz., Sirmaur, Solan, Shimla, Bilaspur, Mandi, etc. The crop yield is mainly determined by the soil health and quality of rhizome seed. Ginger seed is not available to the farmers of N. India during planting time due to unavailability of healthy ginger seed because of its exorbitant costs. Ginger rhizomes are stored in pits, heaps and bamboo baskets for a period of four to five months during which it was found vulnerable to be attacked by biotic and abiotic stresses. Different fungi, bacteria, nematodes and insects attack the crop during its growth period causing rhizome rot thus leading to huge economic losses to the farmers as well as affecting ginger seed supply at planting time. The study revealed that mother rhizomes determined the recovery and productivity of ginger. Rhizomes having healthy sprout characteristics were important for preventing pre emergence rot and post emergence disease problems. Nematodes (Meloidogyne,

Pratylenchus, etc.) and insects (Mimegralla, Eumerus etc.) also affected the yield parameters by predisposing the rhizomes to infection by Pythium, Fusarium, Rhizoctonia etc. The variability of damage ranged with the infection and infestation by Pythium (50 %), Fusarium (25 %), insects (15 %) and nematodes (10 %). In low hills of the state, a mixed infection due to Pythium and Ralstonia or Erwinia has been recorded in areas like Pachhad, Mashu and Killore in district Sirmaur and some pockets of Bilaspur and Solan. Biologically based management techniques based on soil disinfestations have been found to re-establish a balanced soil microecology in ginger crop production. Pathogen free soil, crop rotation (avoidance of monoculture conditions), developing organically rich soil through incorporation of FYM amended with Pseudomonas

fluorescens, Bacillus subtilis and Trichoderma harzianum consortium, application of desired N, P and K levels as well as suitable mulch besides timely application of need based plant protection measures governed the healthy seed production programme. Drainage and weeding were the other cultural practices that managed the disease prevalence for clean rhizome seed production. Adoption of timely inspection procedures in the field was an important step for healthy ginger rhizome production. Some new disease free areas were identified for procurement of healthy rhizome seed for planting and such disease free clean rhizome seed was found to be of paramount importance for disease free seed production programme. The storage conditions viz., 12-14OC temperature and 65-75 % relative humidity were ideal for recovery of healthy ginger rhizome seed. The present paper deals with the advances in healthy disease free clean seed production and storage of ginger for quality and supply at planting time as well as for export.

021 Molecular characterization of native isolates of Agrobacterium radiobacter for the management of crown gall disease in Stone fruit plants

A.K. GUPTA1, RISHI MAHAJAN1, KISHORE KHOSLA2 and RUP LAL3 Department of Plant Pathology, Dr. YS Parmar University of Horticulture and Forestry, Nauni, Solan-173 230 (HP),

2

Regional Horticultural Research Station, Bajaura, Kullu-175 125 (HP), 3Molecular Microbiology Laboratory,

Department of Zoology, University of Delhi, Delhi- 110 007.

Crown gall caused by Agrobacterium tumefaciens Smith & Townsend Conn. is one of the major constraints in production and establishment of disease free stone fruit plants in nurseries. In Himachal Pradesh alone, the disease results in the losses to the tune of Rs. 16 million annually. Infected plants usually die after one or two years. The disease also affects well-grown trees where the infected trees fail to bear fruits to their maximum yield in orchards. The soil borne pathogen which cause the production of large galls on crown portion incorporates its Ti- plasmid in host genome which makes it a genetic parasite thus hampers the chances to develop resistant cultivars against this disease. Various IDM strategies have been tested which include application of soil sterilizing agents, antibacterial compounds, soil solarization, soil amendments and different antagonist like Trichoderma viride, Pseudomonas fluorescens and Bacillus subtilis which provided marginal to 60 per cent control. Agrobacterium radiobacter strain K-84 which is being used in more than 20 countries worldwide and has been reported to provide nearly complete control of crown gall and is effective only against A. tumefaciens isolate utilizing nopaline. The strain is not commercially available in India. The genetically engineered strain K1026 has some limitations as well. In view of above-mentioned limitations, therefore, an utter need was felt to find effective agrocin producing A. radiobacter isolates of Indian origin.


19

In order to achieve this objective, we initiated the research work under National Fund for Basic, Strategic and Frontier Application Research in Agriculture project “Molecular analysis of agrocin producing A.

radiobacter for biological control of crown gall in stone fruits”. Full proof protocol for isolation, identification and characterization of A. radiobacter and A. tumefaciens isolates has been developed. Isolation of Agrobacteria from rhizosphere soil of stone fruit plants is done on D1 medium, biovar characterization on 1A and 2E media. The results were authenticated by biochemical tests, scanning electron microscopy and 16S rRNA sequence analysis. Among 347 A. radiobacter isolates from stone fruit nurseries, 32 isolates were agrocin producing. Isolate 141-1A-1, Cherry 1A-7-2, Cherry 1A-10-2 and Cherry 2E-2-2 showed more inhibition of A. tumefaciens as compared to A. radiobacter strain K-84. Isolate Cherry 2E-2-2 designated as UHFBA-218 controlled crown gall by 89.1 per cent as compared to 78.0 per cent by strain K-84 as seed treatment and provided 69.8 per cent disease control as compared to 30.2 per cent control in K-84 treated plants applied as root dip on peach. On the basis of 16S rRNA sequence analysis and with the help of universal primers –VirD2 and ipt of A. tumefaciens, 141-1A-1, Cherry1A-8-2, UHFBA-218 (Cherry 2E-2-2) were identified as A. radiobacter. The results confirm that all native isolates produced either analogue of agrocin or other novel compounds, on account of which these isolates gave better control of crown gall in stone fruit nurseries than world over used strain K-84. Oligonucleotides FGPS6 (5’GGAGAGTTAGATCTTGGCT-CAG3’) and FGPL132 (5’CCGGGTTT-CCCCATTCGG3’) were used to amplify a ribosomal region containing 1,479 bp (99.5%) of the 16S rRNA, the intergenic spacer region between 16S and 23S rRNA genes, and 132bp of the 23S rRNA genes of the seventeen isolates belonging to native A. radiobacter and A. tumefaciens along with standards A. radiobacter strain K-84 and A. tumefaciens C-58 to further identify the relatedness of strains/ isolates of native A. radiobacter and A. tumefaciens with standard isolates . Amplicons were digested with TaqI, RsaI and AvaI. The studies revealed that native A.

radiobacter isolates viz., 139-1A-2, 139-1A-5-1, 1401A-7, Cherry 2E-3-2, Cherry 2E-2-2 and strain K-84 are of the same group, whereas A. tumefaciens strain C-58, Peach 2E-1, Peach 2E-3 and Peach 2E-10 have similarity with each other. In isolate UHFBA-215 (Cherry 1A-7-2) identified as A. tumefaciens (on the basis of 16S rRNA sequence analysis) a unique phenomenon where loss of Ti plasmid with acquisition of genes responsible for production of antibacterial compounds/agrocin inhibiting growth of A. tumefaciens, was observed. Results of this unique phenomenon were also ascertained by non-amplification with vir-D2 and ipt primers of tumour producing A. tumefaciens. This isolate also provided 91.17 per cent control of crown gall as seed treatment on peach, 68.91 and 52 per cent control as soil drench and root dip, respectively on cherry rootstock-Colt under field conditions. Further research to identify the novel compounds/analogues of agrocin and the gene responsible for bacteriocin production for further development of non-radioactive probe of A. radiobacter strains UHFBA-218 (Cherry 2E-2-2), UHFBA-215 (Cherry 1A-7-2) and 140-1A-7 is being carried.

022 Use of local bio-resources in plant disease management

HARENDER RAJ GAUTAM

Department of Plant Pathology, Dr.Y.S.Parmar University of Horticulture and Forestry, Nauni-173230 Solan (HP).


Green revolution in the seventies has given the self sufficiency in food grains to India with the use of high yielding varieties, chemical fertilizers and pesticides. However, imbalanced use of chemical fertilizers and indiscriminate use of chemical fertilizers have resulted in serious health concerns to human beings, other living beings and soil microorganisms. Use of chemical pesticides and their residues in the crop produce has resulted in serious health problems in India and other countries. The World Health Organization (WHO) and the UN Environment Programme estimate that each year, 3 million workers in agriculture in the developing world experience severe poisoning from pesticides and about 18,000 of whom die. According to another study of WHO, as many as 25 million workers in developing countries may suffer mild pesticide poisoning yearly. According to a report of the Ministry of Agriculture and Cooperation, about 18 per cent samples of vegetables and 12 per cent of fruits, both home grown and imported, contained pesticide residues, including banned pesticides. Pesticide toxicity can cause number of health problems including cancer, infertility, early puberty, headaches, giddiness, nausea, neuromuscular weakness and visual impairment. Consumption of


20

chemical pesticides has decreased from the peak of 90, 000 MT in 1990-91 to approximately 47, 000 MT. As pesticide consumption in India increased, resistance to pesticides also increased from 7 insect-pests and mites in 1954 to more than 500. There are number of potential alternatives to chemical pesticides which can be used for the effective management of diseases and pests which will give us safe agriculture produce. Among these alternatives, use of botanical pesticides is most important for the management of diseases and pests. Every agro-climatic zone of the country is blessed with plenty of such plant species which can be easily and effectively can be used against important plant pathogens in different crops. There are more than 200 plant species which have anti-microbial properties against many important pathogens of crops. Among botanicals, neem is one of the most important tree which has a great potential for disease and insect-pest management in India and other parts of the world. India has more than 18 million trees of neem with seed potential of 4,14,000 MT which can yield 85,000 MT of oil and 3,30,000 MT of oilcakes. Neem pesticides have been reported to control more than 200 species of insect-pests, nematodes and also effective against more than 50 diseases. Botanicals contain an array of secondary substances like phenols, flavonoids, quinones, tannins, saponins and sterol which can be exploited for their different anti-fungal properties. There are evidences where botanicals have been reported as inducers of bio-chemical defense response in the plants against pathogens. Pre-application of inducers provided protection to the tomato plant against Fusarium Wilt and reduced the disease intensity. Induction of defense-related enzymes peroxidase and polyphenol oxidase has also been reported in reduction of the diseases. Botanicals contain many active ingredients in low concentrations which have target specificity, biodegradability and low mammalian toxicity. Combination of botanical and other bio-resources like cow urine has been found effective against number of pathogens with its broad based active ingredients. A water based bio-formulation out of seed extract of Melia azedarach, leaves of Bougainvillea glabra, Artemisia roxburghiana, Ocimum sanctum, Roylea elegans, Cryptolepsis

buchanani and cow urine has resulted in 92 to 100 per cent reduction in the mycelium of Fusarium

oxysporum, Rhizoctonia solani, Sclerotium rolfsii and Botrytis cineria which infect strawberry. This formulation has also been found effective under field conditions with 85.9 per cent reduction in the fruit rot caused by Botrytis cineria and 89.5 per cent reduction in leaf spots caused by Mycosphaerell sp. and other fungi in strawberry with 81.4 per cent increase in yield. Botanical formulation has also been found effective for the management of different post-harvest diseases of apple with more than 30 days increase in the shelf life and having better quality attributes. Use of bio-pesticides has increased in India from 124 Metric Tons (MT) in 1994 to more than 2000 MT now. India has 124.07 million ha cropped area and out of which 4.3 million ha has been covered under integrated pest management (IPM) with use of bio-pesticides as one of the important component. Use of such bio-inputs and bio-pesticides will give boost to organic farming and which will protect environment, give better quality of farm produce and will also provide long-term sustainability to agricultural production and bio-diversity.

023 Diseases of Medicinal and Aromatic plants: Holistic approaches for their health

management

SUNITA CHANDEL Department of Plant Pathology, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan (HP)-173230


Use of medicinal plants dates back to Vedic era in India which is known to have glorious tradition system of health care. It is estimated that 70-80% of people worldwide rely either on traditional or herbal medicines. The global demand for herbal medicines is growing rapidly and market of Ayurveda medicines is expanding @20% annually in India. The present global herbal market is worth about US$60 billion per annum while India share is only 0.2% and the annual growth of the herbal market is about US$5trillon. The substantial cultivation process ensures abundance availability of medicinal plants and less over exploitation by industries but cultivation in large scale exposes them to various biotic stresses that are induced by fungal, bacterial and viral pathogens. Just like other plants of agriculture and horticulture importance, these plants are infected by most common diseases like leaf blight, fruit rot, root rots, etc. Few diseases have been encounetered in most demanding medicinal and aromatic crops. Solanum laciniatum develops fruit rot and leaf blight. Symptoms


21

generally appear in monsoon that affected the solasodine content used in pharmaceutical industries for preparation of contraceptives. Root rot caused by Sclerotium rolfsii infects Glaucium flavum and considered a serious disease by formation of lesions on the stem at or just near the ground level and finally leading to death of the plants. Powdery mildew growth forms on the upper and lower surfaces while rust like brown pustules formation causes yellowing and premature defoliation that reduced the yield of mint oil in Mentha spp. Large number of necrotic patches with sunken, purplish black spots observed on Digitalis sp., whereas rotting of roots is noticed on Atropa belladonna. Ring spots, anthracnose, Alternaria leaf spots are formed on Aloe vera, Helminthosporium or Cercospora leaf spots were reported to infect Dioscorea sp. Neem plant is found to be infected with damping-off pathogens. Rhizoctonia leaf web blight, Ganoderma root rot, grey mould, bacterial blight, wilt reported to induce by Bortytis cinerea, Pseudomonas syringae pv. cannabina and Erwinia trichepila. In Opium sp., leaf blight, powdery mildew, downy mildew caused by Erysiphe

polygoni and Peronospora polygoni are considered serious diseases. Therefore looking into the severity, intensity and heavy losses from these diseases different control measures are suggested that include use of resistant planting stocks, proper spacing, general sanitation and non-chemical methods using biocontrol agents, soil solarization, organic amendments, minimum pesticides application and integrated disease management strategies. Recent organic methods and biotechnological; tools help in production of organic produce of relevant contents, which is safer due to less pesticides residues. Organic farming and eco-friendly disease control methods for these plants are perhaves a holistic approach that will promote and enhance plant health related to biodiversity, nutrient bio-cycle, soil biological and microbial activities.

024 Biotechnological tools for the production of disease free plants

ANIL HANDA and P.D. THAKUR Department of Plant Pathology, Dr. Y S Parmar University of Horticulture and Forestry, Nauni, Solan–173230 (HP).


Advances in agricultural biotechnology have spearheaded novel growth and development opportunities in a diverse range of agriculture based industries. The horticulture sector has a key role to play in the world agriculture in many countries. Since, most of the fruit and ornamental crops are vegetatively propagated, a large number of viruses are transmitted through the planting material. The serious proportions assumed by virus diseases in fruit and ornamental crops make it all the more important to develop strategies for managing the spread of virus diseases and production of virus-free plants. The conventional crop disease management practices have significantly contributed for yield and quality. However, it has been realized that they have their own drawbacks and are inadequate to achieve the twin objective of increasing crop yields while protecting the environment. With the evolution of biotechnology, the research and development in biosciences has taken new turn and has raised hopes for better management of virus diseases in plants. In absence of efficient therapeutic techniques capable of eradicating viruses from infected plants, biotechnological approaches like meristem tip culture, thermotherapy and shoot tip culture have received considerable attention from researchers all over the world as these techniques are excellent tools for the production of virus free plants. Elimination of viruses at the beginning of propagation chain generally results in virus- free regenerated plants that serve as source plants for propagation. Schemes for production of virus tested and certified vegetatively propagated planting stock based on meristem tip culture and shoot tip culture are operational in many countries. However, such certification schemes for the production of virus free plants are yet to be developed in India. A fair amount of time should be devoted to streamlining the micropropagation techniques for a high level of automation. We should not lose sight of the advantages of micropropagated plants. It is not just to propagate a cultivar clonally, but is to produce a far superior product, free of viruses from highly desirable elite plants. It should give high multiplication rates, permit all the year round propagation of species that cannot be vegetatively propagated by any other means and should enable "clean" plants. Whether it does all these things, is going to depend largely on how much research effort we direct towards solving specific problems. It is also possible to use plant biotechnology to increase genetic variability in fruit and ornamental crops. Undifferentiated cells obtained from callus, cell of protoplasts culture are produced and


22

submitted to selective pressure to improve somaclonal variants. The establishment of axenic culture could be difficult when the explants are coming from hot and humid countries. Moreover, in the course of micro propagation, appearance of endogenous bacteria is of common occurrence around the globe. Interestingly, the major source of contamination is the initial explant. The microbial contamination in commercial plant tissue culture laboratories is the most important cause of losses. For this reason, the introduction of a microbiological production control strategy should be given due consideration. In vitro approaches will be the preferred method of production of virus-free plants in commercial sector. It is the job of scientists to shed light on areas of ignorance and, as the time passes, we learn more of the underlying mechanisms involved. Meanwhile, more species are being propagated by tissue culture and refinements of techniques are improving the economics of production by these techniques. The convergence of this new technology platform with the powerful biotechnology has paved the way for developing better understanding of the biology of plants and pathogens at the molecular level, enabling us to develop better strategies and approaches to deal with current and future challenges. The approach of combining environment friendly compounds in conjunction with biotechnological approaches holds the future for Green biotechnology in the 21st century.

025 Recent developments in the culturing, mass Production and commercialization of

bacterial parasite (Pasteuria penetrans) of root-knot nematodes (Meloidogyne spp.)

R.K. WALIA Department of Nematology, CCS Haryana Agricultural University, Hisar 125 004 (Ha).


Pasteuria species are gram-positive, dichotomously branched, endospore-forming bacteria with septate mycelium. So far, four nominal Pasteuria species have been reported from plant parasitic nematodes. These are – Pasteuria penetrans on Meloidogyne spp., P. thornei on Pratylenchus spp., P. nishizawae from Heterodera and Globodera spp., and P. hastmeri on Meloidogyne ardenensis. Another distinct Pasteuria species has been reported from sting nematode, Belonolaimus longicaudatus. The bacterial parasite, P.

penetrans, has become a subject of intensive research owing to its unequivocal and demonstrable potential in the management of root-knot nematodes. Application of P. penetrans in several green-house, micro-plot and field tests has reportedly enhanced plant growth and crop yields. The inability of P. penetrans to grow axenically had been its only impediment for field application, and therefore, hindered its commercial prospects. This has been overcome recently. At CCSHAU, Hisar our group has developed mass multiplication of Pasteuria spp. on aeroponic system that is an in vivo mass production system of semi-commercial nature. It is now possible to culture in vitro most strains (infecting root-knot, cyst, lance, ring and sting nematodes) of Pasteuria infecting plant parasitic nematodes. These recent developments have brightened the field use of P. penetrans and it is expected that the commercial formulations of P. penetrans for the management of major plant parasitic nematodes will be available in near future. Pasteuria Bioscience LLC has recently launched the first commercial product by the name ECONEM®. This is targeted to control sting nematode in turf grasses and a recent survey conducted on the effectiveness of Econem has shown good results. Pasteuria Bioscience as also signed an agreement with Syngenta to develop bio-nematicides based on Pasteuria (www.pasteuriabio.org).

026 Mycorrhizae: Symbiotic associations with roots playing active role in plant health

management

NARENDER K. BHARAT Department of Plant Pathology, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan–173 230 (HP).


The term mycorrhizae came from Greek words ‘myco’ means fungus and ‘rhiza’ means root which literally means fungus root and refers to the symbiotic association between roots of many plant species with fungi.


23

Mycorrhiza have been described as perhaps the ultimate in reciprocal parasitism (symbiosis) where in the fungus supplies the higher plant partner with mineral nutrients like mobilized phosphorus and other nutrients and plant growth hormones and protects the root against pathogens. Mycorrhiza are present in approximately 92 per cent plant families with 80 per cent of their species with micorrhizae which is the encestral and predominantal form and indeed most prevalent symbiotic association found in plants at all. Almost all higher plants have development of the mycorrhizal association. Endomycorrhizae also known as arbusicular-mycorrhizae are the most common form of mycorrhiza occurring in association of most of the plant species growing in different ecological regions. Arbuscular-mycorrhizal (AM) fungi have been reported in thousand genera of plants covering 200 families including agricultural and horticultural crops, shrubs and trees. 80 to 90 per cent of plants ranging from bryophytes to flowering plants have dynamic association of AM fungi. There are 120 species of AM fungi on 300 thousand receptive host plants. AM fungal symbiosis is dynamic process and their interaction affects all physiological aspect of the host. Up to 80 per cent of phosphorus and 25 per cent of nitrogen is obtained through these associations and their growth and development depend upon stimulation taken by root exudates where upto 20 per cent of carbon can be obtained by fungus. The AM fungi occur abundantly in phosphorus and other nutrient deficient soil. Colonization of plant roots by AM fungi help in increasing NPK status, water uptake, defense against biotic and abiotic stresses, yield in host plants. Arbuscular mycorrhizae –pathogen interactions follow different mechanisms by which the mycorrhizae can accomplish reduction in disease incidence. A wide variety of reports in recent years with experimental evidences have indicated that a host plant previously inoculated with a mycorrhizal fungi increased tolerance to a range of soil-borne root diseases in plants like wilts and root rots. It is speculated that infection with mycorrhizal fungi elicits a resistance mechanism by the host which may suppress the subsequent infection by fungal pathogens. Diseases caused by soil-borne fungi can be influenced by the formation of AM fungi in the root system. In general mycorrhizal plants suffer less damage by the disease and inhibit pathogen development. The diseases like white root rot and replant disease of apple, Fusarium wilt of tomato, pre-emergence rot and wilt of pea, mango wilt etc. were reduced after inoculation with AM fungi like Glomus spp. AM symbiosis must, therefore, be understood and incorporated accordingly in crop health management programme. AM fungi have potential to suppress soil borne pathogens in most of crops particularly grown in nutrient deficient soils under organic agriculture. It is important to coordinate comprehensive research on disease control mechanisms with AM fungi. Studies are also needed to identify the compatibility of AM with others management practices.

027 Mushroom cultivation and consumption in India – current status and future

prospects

MANJIT SINGH Directorate of Mushroom Research, Solan (HP)

Agriculture in our country is undergoing transformation and more and more people are looking for novel vocations. Mushrooms are a quality food and the highest protein producers per unit area per unit time. Considering that these are cultivated indoors using agricultural residues, the mushroom cultivation is an important option for landless farmers. The cultivation of mushrooms requires scientific aptitude and knowledge. The unemployed youth can very well adopt mushroom cultivation as an important vocation. In fact, mushroom cultivation as a commercial venture started in our country in late sixties and has made inroads in all parts of the country. Himachal Pradesh has been pioneer in introducing cultivation of white button mushroom in our country. In the past few decades there is sharp increase in both production and consumption of mushrooms in India as well as the world. The world button mushroom production in 60s was only 0.3 million tonnes that in four decades increased more than six million tonnes. Similarly, the total world mushroom production was only one million tonnes in late 70s that has increased to around 20 million tonnes in three decades. In the earlier stages button mushroom was the most important mushroom cultivated across the world. However, in the last few decades number of other mushrooms particularly suitable for sub-tropical and tropical conditions have been cultivated. Our country produces around 600 million tonnes of agro-wastes in addition to horticultural and forest wastes. Currently, we are using only 0.04% of these. Our


24

neighbouring country China produces around 1200 million tonnes of cereal straws and is currently producing about 70% of the mushrooms of the world. There is a global shift towards consumption of fresh mushrooms. For example, out of the total mushrooms consumed in US in late 60s, about 75% were in the form of canned products. At present, of the total mushroom consumption in US, about 85% is in the form of fresh mushrooms. Mushrooms are a quality food having number of unique properties that include high content of vitamin B3, the only vegetable source of Vitamin D2, zero cholesterol, very high potassium and low sodium, rich in minerals including copper and selenium. These attributes put the mushroom in the category of functional foods. Currently, mushrooms are cultivated in our country as a seasonal activity by small growers and also as a commercial activity by big entrepreneurs. There are number of mushrooms that can also be grown in urban and peri-urban areas at any scale including home gardening. Popularizing mushroom cultivation in urban and peri-urban areas will require designing of easy-to-carry packets, simple instruction leaflets, and also possibly few recipes as per Indian taste. Such a promotion will not only create easy availability of mushrooms of best quality but will also serve as an important measure to popularize mushroom among masses. With the shrinking land and increasing demand for fresh and quality foods, promoting mushrooms may in fact be an important viable alternative to meet the growing needs of quality food in future.

028 Medicinal mushrooms: Importance and cultivation

DHARMESH GUPTA and B.C. SUMAN Department of Plant Pathology, Dr YS Parmar University of Horticulture & Forestry, Nauni, Solan- 173 230 (HP).


Mushrooms have been valued as both food and medicine throughout the world for thousand of years besides their key ecological role. They represent one of the world’s greatest untapped resource of nutrition and palatable food of the future. Medicinal mushrooms are mushrooms that are used or studied as possible treatments for diseases. Research indicates mushrooms have potential antiviral, antimicrobial, anticancer, antihyperglycemic, cardioprotective and anti-inflammatory activities. The number of mushrooms on Earth is estimated at 140,000, yet perhaps only 10% (approximately 14,000 named species) are known. Of these about 700 species are considered as medicinal with varieties of health attributes. Edible higher Basidiomycetes are being evaluated for their nutritional value and acceptability, as well as their pharmacological properties. They make up a vast and yet largely untapped source of powerful new pharmaceutical products. In particular, and most importantly for modern medicine, they present an unlimited source of polysaccharides with anticancer and immunostimulating properties. Many, if not all, Basidiomycetes mushrooms contain biologically active polysaccharides in their fruit bodies, cultured mycelia, and culture broth. These polysaccharides are of different chemical composition; the main ones comprise the group of β-glucans. Many of us know about and use various culinary mushrooms such as portabello, button, oyster, chanterelle and others, however, ess common is the knowledge and use of medicinal type of mushrooms such as Reishi, maitake, shiitake, Cordyceps and others. These particularly medicinal variety offer potent immune system support and many other scientifically verified health benefits through the action of compounds such as polysaccharides.Species of Pleurotus are found to possess significant antioxidant,anti-inflammatory and anti-tumour activities. In the Far East countries, especially in China, Japan, and Korea, mushrooms have long been revered for their curative attributes. Paramount among these is Ganoderma lucidum (Ling zhi in Chinese; Reishi, Mannentake, or Sachitake in Japanise; and Young-zhi in Korea). It is valued for both its medicinal and spiritual properties.Other medicinally important mushroom is Cordyceps sinensis. Very important culinary-medicinal mushrooms are Lentinula edodes (Shiitake mushroom), Auricularia polytricha, Flammulina velutipes and Trametes versicolor.The total market value of mushroom dietary supplements worldwide is about US$ 5.6 Billion per year. The market value of Ganoderma mushroom-based dietary supplements alone in 1995 was estimated at US$ 1,628.4 million. Cordyceps sinensis, commonly known as keera ghas is native to high Himalayan mountains in Tibet, Nepal and India at an altitude ranging from 3000-5000m.It is an entomopathogenic fungus and is parasitic on larvae of small moth(Hepialus armoricanus,family Hepialidae).This fungus acts as aphrodisiac and have got


25

antitumour,anti-oxidation and immuno-stimulant activities. The production technology of C. sinensis is being investigated. L.edodes, A. polytricha and F. velutipes are the important culinary medicinal mushrooms and their pharmacological properties and cultivation technologies have been investigated in detail.

029 Diseases of mushrooms and their management

V.P. SHARMA and SATISH KUMAR Directorate of Mushroom Research, Chambaghat, Solan (HP) -173213. Email: [email protected]

As in agricultural crops, the commercial production of mushrooms is hampered by a variety of organisms that negatively affect crop yield. The most commonly encountered biotic disturbances include pathogenic fungi, antagonistic fungi, bacteria, viruses, insect pests, mites and nematodes,. Many of the fungi act as competitor moulds thereby adversely affecting spawn run whereas others attack the fruit bodies at various stages of crop growth producing distinct disease symptoms. Wet bubble, dry bubble, cobweb and green mould are the most important diseases encountered during button mushroom cultivation. At times there is complete crop failure depending upon the stage of infection, quality of compost and environmental conditions. At any phase of growth an undesirable growth or development of certain moulds can occur which may adversely affect the final mushroom yield. Most pests and pathogens can be managed through measures of hygiene that aim to exclude pathogens from the farm or contain them when already present. Nonetheless, some pathogens remain problematic. Especially Hypomyces perniciosus and Lecanicillium fungicola causes severe infections that result in significant crop losses. Both H. perniciosus and L. fungicola

are mycoparasites that attacks A. bisporus during its generative period. The symptoms of infection depend on the developmental stage at which A. bisporus becomes infected. The impact of H. perniciosus has increased significantly in the last one decade and has threatened the existence of Indian mushroom industry. Not many fungicides can be used for the control of mushroom disease as often also the mushroom mycelium is affected. The few fungicides that have been used are either no longer available or are becoming increasingly ineffective because of the development of fungicide resistance in the pathogen. Number of bacterial diseases has also been reported during mushroom cultivation. Bacterial diseases induce variety of symptoms like blotch, mummy, pit, drippy gill, soft rot, yellowing and immature browning. Several viruses of different shapes and sizes are also recorded in different mushrooms. However, most significant crop losses have been recorded in button mushroom. Management largely depends upon reduction of spread as there are no antibiotic or resistant strains.


26

Oral Presentations

001 Occurrence of wheat rusts on Barberry grove in Nilgiris hills

P. NALLATHAMBI, J. KUMAR, C.U. MAHESHWARI, SANDEEP KUMAR, JOHN PETER and K. JAYAKUMAR Indian Agricultural Research Institute (ICAR) Regional Station, Wellington-643231, Nilgiris (TN). E mail:

[email protected]

Systematic surveys were conducted in Thottapetta, Arakadu, Mynala, Kenthorai, Thummanahatty and Upathali area of Nilgiri hills in Tamil Nadu during June and July, 2012. Different species of Barberry were observed with rust pustules. A total of 22 random samples of leaves infected with rusts have been collected from the interior area of forests in these locations. Rust pustules containing aeciospores were cross inoculated on one week old seedlings of various species of wheat including Triticum monococcum, Triticum

dicoccum, Trticum aestivum and rye (Secale cereale). The pathogenesis studies under glass house conditions indicated the infective nature of only five isolates on Triticum dicoccum and Trticum aestivum. Both brown and black rust pathogens (uredinospores) were observed under microscope and purified further using susceptible lines of wheat (var. Agra local). This is the first report from the IARI, Wellington station to establish wheat rusts from natural barberry grove adapted in Nilgiri hills. Further research to establish koch’s postulates on barberry as well as wheat species are under progress.

002 Genetic variation among Fusarium head blight (head scab) pathogens of wheat

M. S. SAHARAN and INDU SHARMA Directorate of Wheat Research, Karnal, Haryana, INDIA-132001 email: [email protected]

Head scab or Fusarium head blight (FHB) is a destructive disease of wheat almost worldwide. Yield loss results directly from shriveling of grains and infected grains may also contain mycotoxins that are highly toxic to livestock and humans. Keeping in view global climate change, systematic research work on FHB was initiated at Directorate of Wheat Research, Karnal in 2000. All the disease management strategies based on host resistance require the knowledge of variability in pathogens. Traditional markers used to study the variability in pathogens are based on the use of differential hosts, culture characteristics, morphological markers and biochemical tests. However, these markers are highly influenced by the host age, inoculum quality and environmental conditions. Keeping this in view, genetic variation among Fusarium spp. / isolates causing head blight was studied through molecular markers. Fusarium graminearum was found most dominating spp. causing FHB in India. Extensive survey was carried out in disease prone areas (lower, mid and high Hills of Himachal Pradesh, foot hills of Punjab, Wellington-Nilgiri hills of Tamil Nadu) during 2000-2011. Fusarium spp. viz., F. graminearum, F. verticillioides, F. oxysporum, F. equiseti, F. semitectum

and F. solani were found associated with the disease. Identification of Fusarium spp./isolates was confirmed with species specific primers. Pathogenic variation was observed among Fusarium spp./isolates inoculated on a set of wheat varieties during 2000 to 2011. For knowing the presence of gene associated for toxin production, toxin specific primers were used. Randomly amplified polymorphic DNA (RAPD) was used to study genetic variation in Fusarium spp./isolates. A screening of sixty one 10-mer oligonucleotide RAPD primers revealed 17 RAPD primers to yield informative DNA amplicons by PCR. Based on multivariate analysis and coefficient of genetic similarity, all the isolates were clustered into five groups. Cluster analysis of band sharing coefficients separated fifteen isolates of F. graminearum into four clusters. This study has shown that there is a considerable pathogenic and genotypic variability among F. graminearum isolates as well as among different Fusarium spp. Four new microsatellite markers were developed for detection of genetic variation among F. graminearum isolates. The study has shown that there is considerable genetic variability among Fusarium spp./isolates causing FHB in India.The detailed results on above aspects will be presented.


27

003 Postulation of powdery mildew (Erysiphe graminis f sp. tritici E. Marschal) resistance genes in some Triticum aestivum and allied species in India.

ASHWANI K. BASANDRAI, DAISY BASANDRAI and P.D. TYAGI CSK HPKV Hill Agricultural Research and Extension Centre, Dhaulakuan, Distt. Sirmour -173001 (HP), #Department

of Plant Pathology, CSKHPKV, Palampur -176062. e.mail: [email protected]

One hundred ninety Advanced Indian Wheat Breeding Material comprising, Triticum spp. and tritcale were evaluated against seven genetically characterized virulences of Blumeria graminis f. sp. tritici and resistance genes were postulated in 37 genotypes following infection-type matching technique. Gene Pm 8 was postulated in genotypes HS 339, HS 341, HS 342, HS 343, HS 345, HPW 91,VL 744, WH 542, WH 593, HD 411, UP 2355, UP 2376, HS 240*, HUW 206, VL 733, VL 740, HUW 426, K 9000. Resistance in genotypes DL 803-2, HUW 395, HP 1705, K 8804, HPW 42 was controlled by gene Pm 8 individually or in combination with unknown gene(s). Resistance in genotypes HP1733, MP 43 and HD 2620 was attributed to genes Pm5+Pm8. Resistance in HPW 56 behaving differentially to the cultures, could not be attributed to any of the known gene(s). Five triticale genotypes HPT 6, JNIT 203, JNIT 206, JNIT 208, JNIT 213, TL 2746, TL 2780, TL2799, TL 2801 and DT 46* and T. aesivum genotype UP 2385 were resistant to all the cultures, hence in the absence of differential interaction the resistance in these genotypes could not be attributed to any of the known genes. Rest of the genotypes were susceptible to all the cultures.

004 Understanding soil moisture stress response to dry root rot of chickpea under

changing scenario of climate

MAMTA SHARMA and SURESH PANDE International Crops Research Institute for the Semi-Arid tropics (ICRISAT), Patancheru-502 324, Hyderabad (AP).

It is observed that climate is changing in rainfed ecologies more specifically in the last two decades. As a consequence of it, erratic rainfalls, occurrence of drought have become more frequent. Under this climate change scenario, a drastic shift of chickpea diseases have been recorded throughout the major chickpea growing regions in India and elsewhere. From the inception of chickpea improvement program in India, emphasis has been on development of wilt (Fusarium oxysporum f sp. ciceris) resistant varieties, as it caused significant plant mortality and yield losses. ICRISAT in collaboration with national program scientists have collected the weather and plant mortality data from several locations for the last two decades. The data was critically analysed and modelled to determine the shift in the relative importance of diseases in chickpea, if any. Interestingly, a clear cut shift in soil borne diseases of chickpea was identified and dry root rot (DRR) caused by Rhizoctonia bataticola was found as a potentially emerging constraint to chickpea production than wilt. To determine the cause of emergence of DRR, we conducted a series of experiments under controlled environment to understand the role of climate change variables (temperature and soil moisture) and epidemiological factors associated with infection, colonization and development of DRR. The DRR incidence was significantly affected by high temperature and soil moisture deficit. Out of five temperature regimes (15, 20, 25, 30 and 35ºC) and four moisture levels (40, 60, 80 and 100%), a combination of high temperature (35ºC) and soil moisture content (60%) predisposes chickpea to DRR. The study clearly demonstrates that high temperature coupled with soil moisture deficit is the climate change variables predisposing chickpea to R. bataticola infection, colonization and development. We are conducting detailed investigations to understand the impact of climate change on DRR of chickpea and devising methodologies to mitigate it with host plant resistance.

005 Bacterial blight of pomegranate: Recent understanding on T3SS effectors mediated pathogenesis

RISHIKESH KUMAR and KALYAN K. MONDAL Division of Plant Pathology, Indian Agricultural Research Institute, New Delhi.

Bacterial blight caused by Xanthomonas axonopodis pv. punicae (Xap) has emerged as a potential threat to pomegranate cultivation in India. Like other phytopathogenic Xanthomonas, Xap secretes effector proteins


28

directly to the cell of pomegranate plant through hrp encoded specialized secretion system, known as type three secretion system (T3SS). These effector proteins suppress the PAMP triggered immunity (PTI) in pomegranate. There are two classes of effectors, namely TAL (Transcription activation like domain), of the avrBs3/pthA family and xop (Xanthomonas outer protein) effectors. We identified six xop T3SS effectors, namely xopC2, xopE1, xopL, xopN, xopQ and xopZ in Xap using gene specific PCR. The functional analysis of xopN, one of the conserved T3SS effectors in phytopathogenic Xanthomonas, was carried out using a null mutant (Xap ∆xopN) generated through overlapping extension PCR and homologlous recombination strategy. A kanamycin gene was used to replace the target gene. Xap ∆xopN upon infiltration on tobacco leaf could not produce hypersensitive response (HR) even after 48h, while wild type strain could produce HR within 24 h suggesting the role of xopN in governing pathogenicity. We also observe the reduced watersoaked intensity on infiltrated pomegranate leaf with Xap ∆xopN, which further confirmed the role of xopN effector in contributing virulence to the host bacterium. Further, in planta population count revealed 19% reduced growth of Xap ∆xopN over wild strain suggesting the possible involvement of xopN in determining the growth of the pathogen. Thus the present study demonstrated the possible involvement of xopN T3SS effector in determining growth and pathogenicity to the bacterial pathogen in pomegranate.

006 Genetic diversity of Xanthomonas campestris pv. campestris causing black rot of

crucifers in India

DINESH SINGH, B. T. RAGHAVENDRA and PRIYANKA S. RATHORE Division of Plant Pathology, Indian Agricultural research Institute, New Delhi- 110 012

Black rot of crucifers caused by Xanthomonas campestris pv. campestris diseases is an important disease, which causes loss about 5- 50 % under favourable environmental conditions. To study the genetic diversity 24 isolates of X. campestris pv. campestris were collected from cole crops including cauliflower, cabbage, broccoli and knoll khol from different agro-climatic regions of India ranging from temperate to subtropical climates. The bacteria were isolated all the samples on nutrient agar medium. The yellow, mucoid colonies of bacteria grown on the medium were inoculated to the respective hosts for pathogenicity and the same colonies were used as DNA template for PCR. For molecular characterization of the bacteria, specific primers for X. campestris pv. campestris was used to amplify at 619 bp. Genetic diversity of 24 isolates of X. campestris pv. campestris was studied using REP and BOX-PCR, indicated the existence of wide range of genetic diversity among the isolates. The strains clustered into two groups at 50 % similarity coefficient and designated as Group 1 and Group 2. Majority of the strains (23 strains) clustered under Group 1 except Xcc-C120, which formed separate group (Group 2). Multi locus sequence typing (MLST) of 5 isolates of X.

campestris pv. campestris collected from different parts of India was done using gyrB, (DNA gyrase subunit B), rpoD (RNA polymerase sigma 70 factor), fyuA (Ton B- dependent isomerase ) and hrp F (hypersensitive response and pathogenicity F) genes. In the present study, genetic diversity in Indian strains of X.

campestris pv. campestris were established, which will be helpful in the development of resistant genotypes against this bacterial pathogen.

007 Kole Roga (Tip necrosis) in pomegranate fruits

A.K. SAXENA and C. GOPALAKRISHNAN Division of Plant Pathology, Indian Institute of Horticultural Research, Hessarghatta, Bangalore-560089. Email:

[email protected]

Pomegranate (Punica granatum L.) is being grown from Kashmir in the northern side to Andhra Pradesh and Karnataka in the South. Maharashtra, Karnataka, Gujarat and Rajasthan are the major pomegranate growing states. The crop is hardy in nature and involves low maintenance cost in terms of economic gains. Though, there has been a considerable increase in both the area and production of pomegranate in the country because of the good domestic and export potential for the fruits and other uses of economic importance, yet the crop suffers on account of different maladies caused by fungi, bacteria, virus, nematodes and nutritional disorders. Recently pomegranate growers witnessed a disease ‘Tip necrosis’ in pomegranate flower buds which they


29

called as ‘Kole Roga’ in the pomegranate growing areas in Karnataka. This malady had led to a lot of flower drop beginning at flower bud stage to flower bulging stage and subsequently also, resulting in huge crop loss. More than 20 -30% flower drop had occurred in severely affected orchard located in Tumkur, Chitradurga and Davangere (Karnataka state). The disease started as a minute spot or blackening of flower bud tips that extends further and later on affected tissue turned brownish or dark black. The styler end portion of the calyx was affected severely that turned necrotic and dry. The blackening is advanced to the tissue of the bigger fruits adjoining the styler end subsequently. Isolations made from the infected tissues revealed the constant association of a fungus that had colonies with white, dense, aerial mycelium which turned dull-white with the age with irregular margin; colony on the reverse side also appeared dull-white; Hyphae: hyaline and septate. Acervuli: sub-epidermal, confluent, formed of brown thick walled; pseudoparenchyma measured 156.30 ± 5.9 µm - 171.52 ± 6.58 µm; Setae: present, originating irregularly from the pseudo-parenchyma, more or less straight, un-branched, tapered to an acute apex, brown, smooth, thick walled septate and measured 56.46 ± 1.63 µm. Conidiophores: hyaline, smooth, formed from the upper cells of pseudoparenchyma. Conidia: hyaline, aseptate, guttulate, cylindrical with single oil globule, measured l5.18 ± 1. 70 µm x 3.61 ± 0.19 µm (10.35 ± 1.39 -17 .20 µm x 3.57 ± 0.12 -3.78 ± 0.34 µm), on germination formed appressoria; perithecia or ascospores were not observed. On the basis of these the associated organism was identified as Colletotrichum gloeosporioides (Penz.) Penz. & Sacc. and this was further confirmed by the Mycologist at NCFT, New Delhi. The symptomatology of the disease and associated organism revealed that Kule Roga is nothing but one of the symptom expressions of ‘Anthracnose’ in Pomegranate. The field trial conducted on pomegranate variety ‘Bhagwa’ during ‘Mrig Bahar’ (June – July flowering) revealed that timely application of Thiophanate methyl (0.1%) at flower bud initiation and development stage was most crucial in managing this disease. Subsequently, three more application at fifteen days interval with the same fungicide had provided excellent control of not only the ‘Tip necrosis’ (Kole Roga) disease but also for anthracnose and leaf fruit spot diseases. The importance and need of timely, judicious and need based application of fungicides for the disease management has been discussed in the paper.

008 Standardization of seed germination and seedling establishment of Barberry spp.

from Nilgiri hills

P. NALLATHAMBI, J. KUMAR, C.U. MAHESHWARI, M. SIVASAMY, P.JAYAPRAKASH, V.K. VIKAS and K. JAYAKUMAR Indian Agricultural Research Institute (ICAR) Regional Station, Wellington-643231, The Nilgiris, Tamil Nadu. E mail:

[email protected]

Barberry (Barberry spp) is a long-lived woody perennial in Nilgiri hills of Tamil Nadu in India. It acts as alternate host for the rust diseases in the absence of wheat cultivars. In order to maintain the potential inoculum for the research purpose, it is imperative to understand the complete biology of the rust pathogen in alternate host as well during the off season of the main crop ie. wheat. Since the information on sequential infection and maintenance of rusts in barberry is lacking, we initiated the work on establishment of uniform seedlings. Matured fruits were harvested from the random branches of barberry groves from the natural habitat at Thottapetta, Arakadu, Mynala, Kenthorai, Thummanahatty and Upathali area of Nilgiri hills in Tamil Nadu during June and July 2012. Ripened fruits were sorted out and cleaned. Two set of experiments were laid out in a completely randomized block design under glass house conditions. In first set, whole fruits were used for sowing in small pots with natural acidic soil amended with well decomposed farmyard manure (1:1) and in second set; seeds were extracted from the fruits which have been already dried under shade. Cumulative analysis of data revealed that the naked seeds expressed maximum germination than the seeds entrenched along with fruit pulp. Rapid germination was noticed in bold seeds extracted from relatively larger fruits than small fruits. Seedling vigour and uniformity were positively correlated with the size of the fruits and seeds. Overall germination percentage was ranging from 5 to 88 per cent in irrespective of the samples and location. Interestingly, all the seedlings were survived after germination without any seedling mortality, which is very common in most of the perennial species. Based on this performance, large scale multiplication of seedlings are under progress in this station for different research on wheat rust pathogens.


30

009 Directional effect on the development of Graphiola leaf spot of date palm

SUSHIL SHARMA and R.D.PANWAR* Chaudhary Charan Singh Haryana Agricultural University, Regional Research Station, Bawal – 123501 (Rewari)

*Krishi Vigyan Kendra, Jind (Ha).

A field experiment was conducted CCS Haryana Agricultural University, Regional Research Station, Bawal in randomized block design from 1999-2000 to 2006-07 to study the directional effect on Graphiola leaf spot of date palm caused by Graphiola phoenicis. The directional effect was observed on the appearance of the disease and subsequently on the number of spots/sori. The disease appeared in East and West direction early and almost at the same time except 1999-2000 where it was delayed by one week in West direction. Disease appearance in South direction was observed late i.e. by 2-3 weeks. During all the years under study, maximum numbers of spots/sori per pinnae (9-167.1) were recorded from East direction followed by North where the figures ranged from 5.1 to 86.4. The disease required high temperature (280C to 37.10C) and more sunshine hours for its speedy progress. Maximum spots/sori were recorded at Max. Temp. 35.1oC, Min. Temp.14.1oC, MRH 47 per cent, ERH 17 per cent, sunshine 10.0 hrs., wind velocity 6.1 km/hr and evaporation 10.6 mm.

010 Integrated pest and disease management strategies in Uttaranchal apple orchards

K.P. SINGH and J. KUMAR College of Forestry & Hill Agriculture, G. B. Pant University of Agriculture & Technology, Hill Campus, Ranichauri-

249 199, Uttaranchal, INDIA. e-mail [email protected]

Integrated spray schedule used in Uttaranchal apple orchards in 1989 to 2004 for management of the most important pests and diseases are described, such as Scab (Venturia inaequalis (Cke.) Wint), Powdery mildew [Podosphaera leucotricha (Ellis and Everhart)], Apple blotch [Marssonina coronaria and Alternaria mali] Canker disease complex, White root rot (Dematophora necatrix) Collar rot (Phytophthora cactorum) Sooty blotch (Gloeodes pomigera (Schw.) Colby), Fly speek (Zygophiala jamaiconsis Mason) and replant disease complex (both abiotic and biotic factors). The major pest in Uttaranchal Himalayas are European Red spider mites, San Jose scale, Woolly apple aphids, Indian gypsy moth, Blossom thrips, cut worm on apple. These diseases and insect have plagued apple cultivation in Uttaranchal Himalayas. Special attention is paid to the control of apple scab using warning services, and the biological control of pests and diseases. Several pesticidal spray schedules were evaluated for their efficacy on controlling the apple diseases and insect under cool, wet weather conditions. Urea @ 5% concentration had a significant effect on breaking of the life cycle of V. inaequalis in overwintered leaves. With the increase in area under the Delicious group of apple, the menace of apple scab has been on the increase. Combined with the scourge of scale insect, the apple production is greatly hampered leading to considerable losses. The treatment Difenaconazole (0,015%) + Phosphamidion (0.05%) where on one hand gave 78.17% and 100.00 % reduction in disease over check with respect to leaf and fruit infection also gave 76.93 and 73.91% reduction over check for scale incidence on terminals and leaves. The treatment, Difenconazole (0.015%) + Mancozeb (0.30%), a standard protectant, also gave 84.60 and 94.85% reduction in scab over check and 68.92% and 72.62% reduction in the scale incidence in terminals and leaves respectively. Flusilazole (0.02%) + Phosphamidion (0.05%) though gave excellent control (94.28 and 98.40 % reduction over check) against leaf and fruit infection of scab was not as effective (54.26 and 26.24 % reduction in terminals and leaf) when evaluated against the incidence of scale insect. Other treatments in the experiment were not significantly superior over check. The warning services are based on weather stations, grower and private consultant information and traps. Warnings are issued mainly via a call in telephone, Agriculture Govt. department, and broadcasted through radio stations. In addition, growing season kisan mela, press releases and newsletters are issued via the extension workers of University and Govt. department. The Indian Council of Agricultural Research, NATP, UCOST and University help to develop monitoring methods and test development models. The possibility of an integrated approach to control the insect and diseases menaces would be discussed.


31

011 Apple replant problem: Strategies for its management

NARENDER K. BHARAT Department of Plant Pathology, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan-173 230

(HP).Email: [email protected]

Himachal Pradesh is known as ‘Apple state’ of the country. Apple cultivation in the state has been increased many fold since last few decades and the area under apple cultivation has reached up to 99,564 hectare with annual production of 2,80,105 metric tonnes. The area under apple cultivation has increased, but the productivity has not increased accordingly. One of the reasons for low productivity is the age of orchards as most of the orchards in the state have outlived their economic bearing life. The Department of Horticulture of State Government is helping the farmers in introducing newly improved and highly productive varieties. But because of limitation of cultivated land in hilly areas growers are compelled to plant new seedlings on the old apple site. This practice makes seedling plants vulnerable to replant problem i.e. poor growth and short life of apple trees planted at sites where apple tree grew before. The apple replant problem is wide spread throughout the world and is known to be caused by various abiotic and biotic stresses. These include harmful microorganisms (biotic) and nutritional deficiencies or excesses, soil pH, phytotoxins etc. (abiotic). It was demonstrated that a fungal comlex composed of species belonging to genera like Cylindrocarpon,

Phytophthora, Pythium, Rosellinia, Rhizoctonia, Fusarium, Penicillium etc. are the dominant cause of apple replant disease. Due to its complex etiology, replant problem is very difficult to manage. The only practice adopted worldwide for its management is soil fumigation with chemical fumigants. But soil fumigation with chemicals has failed to provide a sustainable growth of new seedlings as it also destroyed beneficial soil microflora including arbuscular- mycorrhizal fungi (AMF) besides other environmental issues. Hence there is an urgent need to develop an alternative approach to check this problem in apple orchards. Use of safe chemicals specific to the dominant fungi present in affected orchards can reduce the harmful fungus and will not result in any harmful effect on the population of beneficial microflora in the soil. Application of AM fungi to the roots of newly planted seedlings or rootstock has shown encouraging results in improving the growth of inoculated seedlings than that of un-inoculated ones. Biological control agents like Pseudomonas

fluorescens, Bacillus spp., Trichoderma spp. have also shown their ability to enhance growth of apple root stocks in replant soil. Use of wheat and barley as cover crop or inter crop in apple orchards have also been found to increase the population of certain antagonistic microorganisms which reduce the population of harmful fungi. Mixing of Brassica seed meals as well as incorporation of the Brassica crop residues in the soil during summer months i.e. bio-fumigation has shown reduction in the population of harmful fungal propagules in affected soil. All these practices can be used in an integrated manner to achieve a better growth of apple plants in replant affected orchards.

012 Rejuvenation of pomegranate orchard severely affected by bacterial blight caused by Xanthomonas axonopodis pv. punicae

C. GOPALAKRISHNAN and A.K. SAXENA Division of Plant Pathology, Indian Institute of Horticultural Research, Hessaraghatta, Bangalore – 560 089.

[email protected]

Pomegranate (Punica granatum L.) cultivation has emerged as remunerative enterprise in India. However, Bacterial blight disease (BBD) caused by a bacterium, Xanthomonas axonopodis pv. punicae (Hingorani and Singh) Vauterin, Hoste, Kersters & Swings, has become cause of concern, as many farmers have lost their crops as well as plantations due to this disease. The disease is spreading fast causing a great loss to pomegranate plantation in some states. Under present investigation, an orchard which was very severely affected by BBD was adopted and rejuvenated by following the orchard health management (OHM) schedule developed under a network project. Five years old pomegranate orchard (Variety Bhagwa) at Gonihalli village, Sira Taluk, Tumkur District (Karnataka) which had 68.0 percent BBD incidence, abandoned for three years was taken up for rejuvenation. Initially, drastic pruning was given followed by removal and destruction of affected plant parts. The blight affected cankerous areas in the stems and tree trunks were


32

scrapped and treated with Bordeaux paste (10.0%). The practice of clean cultivation and orchard sanitation was also followed. The plants were kept under rest for four months and during rest period the crop was sprayed with Bordeaux mixture (1.0%) → Copper oxychloride (0.3%) + Streptocycline (500 ppm) → Bordeaux mixture (1.0%) → Copper hydroxide (0.2%) plus Bactronol 100 (500 ppm) at fortnightly interval. The crop was taken up during Hasta Bahar (September – October). Light pruning was given during September. Bordeaux paste (10%) was applied to the cut ends immediately after pruning. Ethrel (0.2%) spray was given along with urea phosphate (0.2%) for defoliation. After defoliation, the plants were thoroughly sprayed with Bordeaux mixture (1%). Fifteen days after Bordeaux mixture spray and during foliage development, as a prophylactic measure to control BBD, one spray of Streptocycline (500 ppm) plus Copper oxychloride (0.3%) along with sticker was given. Recommended doses of fertilizers (NPK) and FYM were given. Micronutrient application and soluble fertilizers were given at different stages of crop development. One more application of Bordeaux mixture (0.5%) was given 15 days after the second spray and Copper hydroxide (0.2%) plus Bactronol 100 (500 ppm) was given 15 days after the third spray. The field sanitation was maintained right from pruning till harvest and the basins were treated with bleaching powder (15g/plant) by dusting on ground to reduce the bacterial inoculum on left over plant debris in the orchard. The major fungal and insect pests were managed by applications of recommend insectides and fungicides. Periodical observations were recorded on the severity of BBD before and after the OHM schedule. Results showed that the implementation of the OHM schedule for the mitigation of BBD in pomegranate had worked very well and the disease incidence was remarkably reduced in the orchard. The incidence was gradually reduced to 10.82 per cent at the time of harvest in April, 2012. The total fruit yield obtained was 8.0 tonnes/ha.


33

Poster Presentations

Disease Development, Etiology and Epidemiology

001 Virulence frequencies of Xanthomonas oryzae pv. oryzae populations prevalent in

the state of Punjab

MANDEEP S. HUNJAN, PUSHPINDER P. SINGH AND JAGJEET S. LORE* Department of Plant Pathology, *Department of Plant Breeding and Genetics, Punjab Agricultural University,

Ludhiana -141 004. Email: [email protected]

Virulence frequencies on a particular differential were calculated as the ratio of virulent isolates of Xanthomonas oryzae pv. oryzae to the number of total isolates tested. Numerical data pertaining to disease score (0-9) was analysed by virulence analysis tool (VAT) after converting it into binary code. In our study, virulence frequencies to the resistance genes present in the standard international differentials including near isogenic lines (NILs) and local rice cultivars, were observed to be ranged between 0–1 (representing zero to 100 per cent). None of the single gene was found to be effective against all the Xoo isolates. Out of the total 105 isolates tested, 73.2 per cent could infect Xa4 gene while 72.3 per cent were virulent on xa5 gene. However, only 9 per cent of the isolates could infect xa13 gene. The combination of xa5 and xa13 (IRBB-53) was the most effective, on which none of the Xoo isolate were found to be virulent. The other two-gene combinations such as Xa4+xa5, Xa4+Xa21 and xa5+Xa21 were also found to be susceptible to one or the other isolates. The data was also correlated with distribution of Xoo virulences in different agro-ecological zones of Punjab. Among the local cultivars, the highest virulence frequency percentage was observed on cultivar PAU 201 (77.8%). The virulences for PAU 201 were highly localized and concentrated only in south and south-western districts of Patiala and Sangrur, while none was observed in western plain and northern regions of Punjab. Virulence to PAU 201 was also found to be highly correlated with virulence to xa13 gene suggesting gene deployment involving xa13 gene could be ineffective in this area. This study shows the ineffectiveness of single and two gene combinations, implying that only three gene combination can manage bacterial blight disease effectively in Punjab.

002 Evaluation of different inoculation methods for Ustilaginoidea virens (false smut) and influence of floral characteristics of rice on its incidence

P.P.S. PANNU, INDERJEET SINGH, GURPREET KAUR and HARPREET KAUR Department of Plant Pathology, PAU, Ludhiana-141 004.

False smut of rice caused by Ustilaginoidea virens occurs in moderate to severe form on certain genotypes of rice. The present investigations were conducted to standardize inoculation method and to study relationship of floral characters of rice with occurrence and development of the disease. Inoculation of rice panicles with spore suspension of Ustilaginoidea virens using different methods viz. spray inoculation at boot stage, spray inoculation at flowering stage, syringe inoculation at boot stage and inoculation using dropper method at boot stage revealed that disease incidence and disease severity greatly varied. Artificial inoculation with spore suspension of yellow colored spores at boot stage by spray inoculation method resulted in maximum disease incidence and disease severity followed by syringe inoculations at boot stage and spray inoculations at flowering stage. No disease was found when artificial inoculation was done at boot stage using dropper method. Investigations on relationship of floral characters with false smut revealed that varieties which showed higher disease incidence and severity had a longer opening duration of flowers. Maximum duration of flower opening was observed in PR 116 (65.00 min) followed by PAU 201 (53.00 min), PR 106 (48.00 min) and PR 115 (40.00 min). The results revealed that disease incidence was maximum in PR 116 (80.67%) followed by PAU 201 (45.00%), PR 106 (40.00%) and PR 115 (18.00%). The maximum angle between lemma and palea was observed in PR 116 (40.0º) followed by PAU 201 (33.0º), PR 106 (30.0º) and PR 115 (27.5º). In case of hybrids maximum duration of flower opening was observed in MRP-5445 (58.57 min)


34

followed by MRP-5401 (55.00 min), HRI-152 (49.00 min), RH-257 (45.00 min) and Pant Sankar Dhan-1 (41.00 min).The disease incidence was maximum in MRP-5445 (75%) followed by MRP-5401 (68%), HRI-152 (65%), RH-257 (58%) and Pant Sankar Dhan-1 (54.20%). Maximum angle between lemma and palea was observed in MRP-5401 (42º) followed by MRP-5445 (40.5º), HRI-152 (38.6º), RH-257 (36º) and Pant Sankar Dhan-1 (34º). It has been observed that opening duration of flower and angle between lemma and palea play important role in occurrence of false smut.

003 Gray mold caused by Botrytis cinerea on tomato and bell pepper under protected conditions in Himachal Pradesh

MEENU GUPTA and NARENDER K. BHARAT* Department of Vegetable Science, *Department of Plant Pathology, Dr YS Parmar University of Horticulture and

Forestry, Nauni, Solan (HP) 173 230.

Himachal Pradesh is a leading state in vegetable production. This hilly state is also an emerging producer of greenhouse-grown vegetables. Tomato and bell pepper are popular and important crops for greenhouse production in the state. These crops are grown under protected conditions in early summers, summers, rainy season, late summers and winters and growers produce and market fruits throughout the year and earn more. Greenhouses have congenial microclimate inside which is ideal for raising crops but at the same time ideal for many diseases and pests. Therefore, due to the prevalence of high humidity and temperature under protected conditions, these crops are severely infected with leaf and fruit spotting fungi. During 2011crop season, in some greenhouses in Solan, Bilaspur and Hamirpur areas of Himachal Pradesh, a new disease was noticed on tomato as well as on bell pepper crops. Grey-brown furry mould, first noticed on buds and flowers of tomato and bell peppers was observed. The infection spread rapidly especially under humid conditions. The infected areas expanded rapidly covering whole stems, leaves or petals. Later, these stem infections encircled the whole stem and caused the plants above the infected area to wilt and die. Flower petals were particularly susceptible. The fungus grew from the infected petals into the fruit. Halo or ghost spots were also observed on tomato fruits which were caused due to partial infections. Such fruits stop developing in size and later rotted. On bell pepper fruits rotting was more and the rotten area was covered with fungal growth. The pathogen was isolated in pure culture from tomato as well as bell pepper. On the basis of the cultural and morphological characters of the fungus, it was identified as Botrytis cinerea Pers. Fr. This constitutes the first report of Botrytis cinerea infecting tomato and bell pepper under protected conditions in Himachal Pradesh.

004 Occurrence of powdery mildew caused by Leveillula taurica in organically produced tomatoes

MEENU GUPTA, RAMESH KUMAR, NARENDER K. BHARAT*, M.L. BHARDWAJ and MANISH KUMAR Department of Vegetable Science, *Department of Plant Pathology, Dr YS Parmar University of Horticulture and

Forestry, Nauni, Solan (HP) 173 230.

Tomatoes (Solanum lycopersicum) are one of the most important fresh market vegetables grown commercially in Himachal Pradesh. Organic tomatoes are produced using pest management and fertilization methods that do not include synthetic compounds. With the rising consumer demand for organic products, organic tomatoes are an excellent prospect for local fresh market sales. In July-August 2012, severe powdery mildew infections were found on tomato plants grown organically at Vegetable Research Farm, Dr YS Parmar University of Horticulture and Forestry, Nauni. Symptoms first appeared as white circular patches on the upper leaf surface and expanded to the lower leaf surface, petioles and stems, which were finally covered by white mycelial mats. Severely affected leaves died but seldom dropped. Spots of dead tissue, sometimes surrounded by a yellow halo, eventually appeared in the blotches. There were no lesions on stems or fruits. Rarely, a gray mycelium developed on the lower leaf surface of infected leaves. Severe infections killed leaves and resulted in sunburn fruit and weakened plants. Microscopic examination showed cylindrical conidiophores consisting of two to three straight cells, with a terminal single conidium. Conidia were


35

ellipsoidal contained no distinct fibrosin bodies, and produced a sub-terminal germ tube. No cleistothecia were found. Therefore, this constitutes the first report of Leveillua taurica on organically produced tomatoes in Himachal Pradesh.

005 Bacterial canker–A new emerging bacterial disease of pepper in Himachal

Pradesh

SUMAN KUMAR, AMAR SINGH , D.K. BANYAL and Y.S. PAUL Department of Plant Pathology, CSK HPKV, Palampur (HP)-176062. Email: [email protected]

Bell pepper (Capsicum annum L.) one of the most important crop particularly under protected cultivation in Himachal Pradesh was found to be attacked by a new bacterial disease. The symptoms of the disease appeared initially on leaves as chlorosis, reduction of size and cupping of leaflets resulting into wilting of the leaves and shoots. The leaves wilt and curl but do not fall off. The wilt develops gradually from one leaflet to the next and destroys much of the foliage, however the most conspicuous symptoms consists of proliferation of stems. On stems, light coloured streaks appear usually at the joint of petioles and stems. Later cracks develop in the streaks and form the cankers. Finally the stem completely turned necrotic and died. Survey conducted at 24 locations of four districts of the State revealed the variation of disease severity from 8.50 to 29.36 percent causing around 20.06 to 74.91 percent yield losses at different locations. Based upon microscopic bacterial streaming from the lesions, positive gram staining, morphological & cultural assays, the pathogen was identified tentatively as Clavibacter sp. The pathogenicity of the isolated bacterium was also proved and the disease was identified as bacterial canker. These investigations probably constitute the first record of the disease on bell pepper from Himachal Pradesh.

006 Gray leaf spot of tomato an emerging threat under protected cultivation in

Himachal Pradesh

AMAR SINGH, D.K. BANYAL and MAMTA DEVI Department of Plant Pathology, CSK HPKV, Palampur (HP)-176 062. Email: [email protected]

Tomato as one of the most important crops grown under protected cultivation has been noticed seriously attacked by a new leaf spot disease during the year 2010-11 and 2011-12, particularly in rainy season in different districts of Himachal Pradesh. Disease distribution, symptomatology and description of the pathogen have been studied. The disease appears as circular to elongated dark specks which later develops into oval to irregular spots having gray to light centers with brownish black margins. As the disease advances several lesions coalesce which dry up the leaf and become brittle. The disease has been observed to appear in epidemic form during August- September months. The pathogen was isolated on PDA, pathogenicity was proved and was identified as Stemphylium lycopersici causing gray leaf spot of tomato. Conidiophores produced by the pathogen were mostly unbranched, erect, light pale to brown in colour, 2-11 septate having conspicuous swollen apical cells and measured 50-180(113.4) X 3-5 (4.3)µm in size. Conidia borne singly at the apex are oblong, light brown, pointed at the apex with a very small beak, round at the base having 2-3 longitudinal and 4-8 cross septa and measured 30-60(44.8) X 10-20(15.6)µm in size. The disease has been noticed in nursery during rainy season and causes 20-40% seedling mortality. The infected seedling transplanted in polyhouses result in poor plant stand, stunted and low yield. The occurrence of gray leaf spot of tomato in Himachal Pradesh may probably the first report.

007 Etiology of root rot of capsicum under protected condition in Himachal Pradesh

SONAM KUMARI, AMAR SINGH AND D.K. BANYAL Department of Plant Pathology, CSK HPKV, Palampur India-176 062. e-mail: [email protected]

Bell pepper (Capsicum annuum var. grossum) popularly known as capsicum and “Shimla Mirch” is one of the important cash crops grown under protected cultivation in Himachal Pradesh. Poly house growers are


36

facing a new problem of wilting other than bacterial wilt of bearing plants of bell pepper which they locally called as sudden death has been causing huge yield losses thus posing great threat to its cultivation under protected environment. In present investigations surveys of different polyhouses were conducted in the different districts of Himachal Pradesh to record the prevalence of root rot disease, describe symptomatology and establishment of disease etiology. Maximum disease incidence (26.4%) was recorded in Kangra district followed by 23.6% in Mandi district. Minimum disease incidence was recorded in Hamirpur (8.4%) and Bilaspur (6.3%) districts. The analyses of wilted plant samples collected during survey revealed that the wilt infected mature plant show root rot symptoms, while in some cases young infected plant also shows crown rot symptoms in addition to root rot. Phytophthora spp. were associated with 79.8 per cent infected plants followed by Rhizoctonia sp (9.0%) and Fusarium sp. (11.2%). The associated pathogen(s) were identified as Phytophthora capsici, P. nicotianae, Rhizoctonia solani and Fusarium solani. The pathogenicity against P. capsici, P. nicotianeae and R. solani for root rot wilt was proved. It was found that Phytophthora capsici was highly virulent in causing root rot wilt of bell pepper. The morphological characters of Phytophthora species were described.

008 Symptomatology and biophysical properties of a tospovirus infecting bell pepper in Himachal Pradesh

NISAR ISMAIL 1, ANIL HANDA 2, P.D.THAKUR 2 and AJAY BRAGTA2 1Division of Plant Pathology, Sher-e-Kashmir University of Agricultural Sciences & Technology, Shalimar-Srinagar

(J&K), 2Department of mycology and plant pathology, Dr YS Parmar University of Horticulture & Forestry Nauni,

Solan (HP). E-mail: [email protected]

A typical tospovirus was isolated from naturally infected bell pepper (Capsicum annuum L.) in Himachal Pradesh. The virus isolate collected from Solan district of Himachal Pradesh produced characteristic ringspots and rain drop shaped lesions on the leaves. Additionally, chlorotic and necrotic lesions, vein chlorosis and rugosity followed by leaf chlorosis were also observed on infected plants. Severely infected plants showed reduced growth and stem necrosis. Fruits produced on infected bell pepper plants were misshapen with nail head symptoms. The causal virus reacted positively with tospovirus (serogroup I, II, III) antiserum in DAS- ELISA. The information generated in this study will be useful in formulating effective control measures using different approaches for this economically important virus.

009 Host range studies of Colletotrichum capsici causing anthracnose in chilli

(Capsicum annuum)

KARTAR SINGH and S.K. KHIRBAT Department of Plant Pathology, CCS Haryana Agricultural University, Hisar- 125004 (Ha).

Five different kharif crops viz. Cowpea, Groundnut, Sesamum, Soyabean , Urd bean and five weeds viz. Kangi butti(Abutilon indica ), Bill goat(Ageratum conyzoides ), Beggar`s weed( Bidens pilosa ), Khaki butti( Alternanthera pungens ) , Ulta kanta(Achyranthes aspera ) were grown in pots under screen house condition at CCS HAU Hisar.Ten seeds of each crop were sown in each pot containing 5-5 kg soil. After germination five plants were maintained in each pot. Plants were irrigated with equal amount of water when needed. Thirty five days old plants were inoculated with spore suspension (3× 108 spore/ml) of Colletotrichum

capsici, obtained from 8 days old culture grown at 28 ± 1oC, during 2012-2013.These pots were kept in humid chamber for three days. After that pots were removed from humid chamber and sprayed with distilled water thrice in a day (Morning, noon and evening) . Observations were taken 10 days after inoculation and noted the infection on host. The fungus obtained from the anthracnose affected chilli was able to infect four kharif crops (Cowpea, Sesamum, Soyabean and Urd bean) and two weeds ( Begger`s weed and Bill goat).


37

010 Cultural, morphological and physiological variation among isolates of Rhizoctonia

solani isolated from different hosts from Himachal Pradesh

SACHIN UPMANYU, S.K. RANA and Y.S. PAUL* CSK Himachal Pradesh Krishi Vishwavidyalaya Rice and Wheat Research Centre, Malan- 176 047,

*Department of

Plant pathology, CSK Himachal Pradesh Krishi Vishwavidyalaya, Palampur – 176 062. Email ID:

[email protected]

Periodic surveys were conducted in major vegetable growing areas of Himachal Pradesh during 2008 and 2009 cropping seasons to collect Rhizoctonia solani isolates. In all, forty isolates of R. solani were isolated from different hosts across the State which exhibited variation in respect of cultural, morphological and physiological characteristics. Most of the isolates produced appressed off-white to light brown mycelium with varied patterns of sclerotial formation. Isolates produced sclerotia of varying size ranging between 1-5 mm, <1 and > 5 millimeters which were either present at the centre or periphery, scattered throughout the colony or in concentric rings. Cereal isolates of R. solani exhibited the highest number of nuclei per hyphal cell while legume isolates possessed the maximum hyphal width. Though all the isolates exhibited little variations in their growth rates, studies indicated that a temperature range between 25 and 30 OC was the most suitable for optimal growth of isolates. However, cereal isolates showed the maximum growth at 25 and 30 OC temperatures with 1.56 and 1.51 mm/h growth rate, respectively.

011 Occurrence, pathogenicity and characterization of Fusarium species inciting wilt

in cucumber

KANIKA PAGOCH, P.K. RAINA, A.P. SINGH and AMRISH VAID*

Division of Plant Pathology, Chatha, SKUAST-J, Jammu, *

Krishi Vigyan Kendra, SKUAST-J, Kathua (J &K). Email:

[email protected]

Cucumber (Cucumis sativus L.) is a crop of significant economic importance and is attacked by several fungal pathogens, and Fusarium oxysporum Schlechtend.:Fr. is the most predominant. Fusarium wilt of cucumber, caused by Fusarium oxysporum (Schlechtend.: Fr.) f. sp. cucumerinum, is manifested in young and mature plants throughout cucumber-growing regions. The disease is one of the major limiting factors for stable production of cucumber, since highly resistant cultivars have not been developed and effective control methods are not available. Cucumber wilt causes plant mortality, reduction in its yield and ultimately economic loss to the growers. Thus, a study was initiated with fourteen pathogen isolates which were recovered from major cucumber growing areas of Kathua, Jammu, Rajouri, Udhampur, Doad and Poonch districts of Jammu region in present investigation. Pathogens associated with the wilt of cucumber, isolated from root and/or stem parts of diseased seedlings and mature plants during the year 2007 and 2008 revealed the presence of Fusarium oxysporum f. sp. cucumerinum and F. solani which constituted respectively, 85.72 and 14.29 per cent of the total fourteen isolates. On testing the pathogenicity, only F. oxysporum f. sp. cucumerinum, which was dominant caused true wilt in cucumber and hence was taken for further studies.

012 Field problems of apple cultivation in Kinnaur district of Himachal Pradesh

MOHINDER SINGH, R. GUPTA and NARENDER K. BHARAT* Department of Entomology, *Department of Plant Pathology, Dr Y S Parmar University of Horticulture and Forestry,

Nauni, Solan (HP)-173 230. E-mail: [email protected]

Kinnaur district of Himachal Pradesh comes under the high hills dry temperate zone of Himachal Pradesh which is characterized by low rainfall during summers and heavy snowfall in winters. Apple is the main cash fruit crop of this area. In recent years many insect pests, diseases and nutritional deficiencies have been observed on apple in the district for which farmers require appropriate guidance to contain these problems. In present studies, the information on infested/diseased samples of apple brought by the farmers to KVK/Regional Horticultural Research Station of Dr Y S Parmar University of Horticulture and Forestry, at Sharbo/ Reckong Peo for three years from 2000-01 to 2002-03 was compiled to know the field problems of apple cultivation in Kinnaur district. Out 334 plant samples brought by the farmers during three years for


38

diagnosis and solution thereof, 46.71 per cent samples were of insect attack; 32.63 per cent of diseases; 12.28 per cent of micronutrient deficiencies and 8.38 per cent were of other problems. In insect pests, phytophagous mites accounted for 39.10 per cent of the samples followed by San Jose scale (22.44%) and woolly apple aphid (15.38%). The infestation of apple fruit moth, apple root borer, stem borers and other insect pests was recorded only in 5.13, 5.77, 5.13 and 7.05 per cent of the samples, respectively. Amongst diseases, highest samples were of cankers (28.44%) followed by root rot (23.85%), pre-mature leaf fall (15.6%) and powdery mildew (11.93%). The collar rot and viruses were recorded in 2.75 and 6.42 per cent samples, respectively. In micronutrients, zinc deficiency has been observed throughout the district, followed by calcium and boron. Some samples were found deficient in more than one micronutrient. From these studies an important feedback has been obtained for researchers, extension personnel’s and input suppliers to modify their priorities depending upon the farmer’s needs.

013 Virus diseases in apple under dry temperate conditions of Kinnaur district

BHUPESH K. GUPTA, NEERAJ SHARMA* and ANIL HANDA* Dr YS Parmar University of Horticulture and Forestry, Krishi Vigyan Kendra, Kinnaur at ReckongPeo- 172107 (HP).

*Department of Plant Pathology, Nauni, Solan – 173230 (HP).

A survey of district Kinnaur situated in dry temperate zone was conducted for recording the incidence of virus diseases in apple. Kinnaur district can be divided into three agro-ecological regions viz., high hills temperate, high hills wet temperate and high hills dry temperate region. Different villages of the district were surveyed for the presence of virus infection in apples. Based on visual indexing, disease incidence was recorded for the presence of virus (es). The symptoms observed included mosaic, cholorotic leaf spots, crinkling, puckering, translucent veins, uneven growth of leaf lamina, necrotic spots and leathery texture of leaves. Different orchards observed during the survey indicated that almost all the orchards are showing virus infection ranging between 5-40 percent. The viruses not only affect the quality and quantity of the produce but are also a major factor for declining productivity. The highest incidence of virus diseases was recorded at Pangi village with an incidence of 40 percent followed by Powari village of Kalpa block with an incidence of 33 percent. Surverys are continued to record the occurrence of new types of symptoms caused by viruses in apple in district Kinnaur.

014 Incidence of virus diseases of apple nurseries in mid hills of Himachal Pradesh

BUNTY SHYLLA1, S. K. GUPTA1 and ANIL HANDA2

Dr YS Parmar University of Horticulture and Forestry, 1Krishi Vigyan Kendra, Solan, Kandaghat (HP).

2Department of

Plant Pathology, Nauni, Solan – 173230 (HP)

Apple is the most important temperate fruit crop grown in Himachal Pradesh. Cultivation of apple has shown an exponential growth in the recent past due to increased demand in the market and for fetching good returns to the growers. This has led to the need for raising healthy disease free nurseries of apple. Mid hills of Himachal Pradesh are ideally suited for raising apple nurseries. A survey of apple nurseries at Nauni and Kandaghat in district Solan was conducted for recording the incidence of virus diseases in apple. Based on visual indexing, disease incidence was recorded for the presence of viruses. The symptoms observed included mosaic, cholorotic leaf spots, crinkling, puckering, translucent veins, uneven growth of leaf lamina, necrotic spots and leathery texture of leaves. Plants raised in nurseries observed during the survey indicated that almost all the nurseries are showing virus infection ranging between 5-23 percent.

015 Distribution of apple chlorotic leaf spot and apple mosaic viruses in Himachal

Pradesh

V.S. KATWAL, ANIL HANDA, P.D. THAKUR AND S.V. BHARDWAJ Department of Plant Pathology, Dr Y S Parmar University of Horticulture and Forestry, Nauni, Solan–173230.

Symptoms of Apple chlorotic leaf spot virus (ACSLV- a member of the genus Trichovirus and Apple Mosaic virus (ApMV- a member of the genus Ilarvirus) produce symptoms on apple (Malus pumila L.) were


39

observed on leaves of a number of trees in apple orchards located in different apple growing districts of Himachal Pradesh. Most characteristic symptoms on leaves included chlorotic and necrotic spots induced by ACLSV and pale to bright creamy spots, mosaic and yellowing on the leaves incited by ApMV. Field surveys were conducted in three major apple growing districts (Shimla, Kullu and Kinnaur) for recording the incidence of virus diseases and symptoms. Leaf samples from apple cvs. viz. Starking Delicious, Red Delicious, Vance Delicious, Golden Delicious, Granny Smith, Rich-a-Red and Red Chief were drawn for the presence of ACLSV and ApMV with double-antibody sandwich (DAS) ELISA. Incidence of ACLSV ranged between 7-83 percent in Shimla, 10-69 percent in Kullu and 5-65 percent in Kinnaur districts whereas, ApMV was recorded to be ranging between 0-99 percent, 15-85 percent and 8-73 percent in Shimla, Kullu and Kinnaur districts respectively.

016 An outbreak of blossom blight (Pseudomonas syringae pv. syringae) disease in

pear in Himachal Pradesh

USHA SHARMA, MEENU GUPTA* and J.N. SHARMA** Krishi Vigyan Kendra Shimla at Rohru, Shimla (HP)-171 207, *Department of Vegetable Science, **Department of

Plant Pathology, Dr YS Parmar, University of Horticulture & Forestry, Nauni, Solan (HP) 173 230. E mail:

[email protected]

Pear (Pyrus communis L.) is the one of important fruit crop ranking next to apple for the growers of Himachal Pradesh. During the active growing season of 2012, pear trees (cv. Bartlett) in different orchards of Shimla district of the state were observed to suffer from the symptoms resembling those produced by blossom blight disease caused by bacterium Pseudomonas syringae pv. syringae elsewhere. Characteristic symptoms exhibited by the ailing trees were partial or complete blightening of primary blossom and development of misshapen/ deformed fruits on partial infected blooms. The incidence of the disease was found up to 80 percent in pear cultivar Bartlett, whereas it was up to 10 per cent in local variety of pear commonly known as Tumba Nashpatti. The associated bacterial pathogen was isolated in pure culture and its identity was confirmed on the basis of morphological, cultural, biochemical and Gram staining assays. The association of the pathogen Pseudomonas syringae pv. syringae with the disease was further confirmed by pathogenicity tests. This is a first record of the occurrence of blossom blight disease caused by Pseudomonas syringae pv syringae in pear from India.

017 Occurrence of root and crown diseases of strawberry (Fragaria x ananassa Duch.)

in Jammu and Kashmir State

V.S. VERMA, V.K. GUPTA and C.S. KALHA Division of Plant Pathology, Sher-e-Kashmir University of Agricultural Sciences and Technology, Chatha, Jammu-

180009 (J&K)

Round the year surveys of different strawberry (Fragaria x ananassa) growing areas of Jammu and Samba districts of Jammu & Kashmir State at fifteen days interval from June, 2007 to May, 2008 revealed that root rot diseases inflicted significant losses to strawberry crop. Root rot diseases were prevalent in all the strawberry growing areas of both the districts with varying degrees. The root rot incidence was more in runner crop (7.24-19.4%) than in fruit crop (6.42-15.11%). The disease incidence in runner crop was more in Jammu (7.90-27.90%) as compared to Samba (5.80-26.30%). However, the disease incidence in fruit crop was more in Samba (2.90-25.20%) than in Jammu (2.90-19.30%). In runner crop, the root rot enhanced with increase in rainfall and relative humidity during monsoon months of July and August and reduced as the rainfall and humidity decreased with the decline of monsoon. The root rot incidence in all the strawberry growing areas of Jammu and Samba districts increased throughout the cropping season from November, 2007 onward and was highest at the end of the fruiting season in May, 2008. Fungal pathogens viz., Rhizoctonia solani, Fusarium solani, F. oxysporum f. sp. fragariae, Curvularia lunata, Sclerotium rolfsii,

Colletotrichum acutatum, C. gloeosporioides and Macrophomina phaseolina in runner as well as fruit crops were found to be responsible for causing root and crown rot in runner as well as fruit crops in Jammu, but R.


40

solani, F. solani, C. acutatum, C. gloeosporioides, M. phaseolina, F. oxysporum f. sp. fragariae were found to cause root and crown rot diseases in Samba district.

018 Occurrence of crown gall caused by Agrobacterium tumefaciens on rose

ADITI SHARMA, A.K. GUPTA, S. CHANDEL, R.C. SHARMA, RISHI MAHAJAN AND A. GUPTA Department of Plant Pathology, Dr.YS Parmar University of Horticulture and Forestry, Nauni, Solan-173 230.

Incidence of crown gall caused by Agrobacterium tumefaciens (Smith and Townsend) Conn. ranging from 18-25 per cent has been observed on rose hybrid Bordo grown under polyhouse conditions at village Basal, Solan. During 2010-2011 the incidence of crown gall on same plant material was only 1-2 per cent which indicates the slow buildup of crown gall pathogen on roses. Initial observations on the type of colonies of A. tumefaciens isolated from infected rose plants revealed that the colonies of the pathogen were yellowish brown squishy squashy and flat as compared to convex and raised colonies generally observed from isolates of stone fruit plants. Further screening of these isolates for their 3-ketolactose production confirmed that these isolates were unable to produce 3-ketolactose and are therefore, characterized as isolates belonging to biovar-2.

019 Major problems in ginger production in Sirmaur district of Himachal Pradesh

MANOJ GUPTA and PALLAVI SOOD CSKHPKV, Krishi Vigyan Kendra, Dhaulakuan (Sirmour) HP 173001

Ginger is the major spice crop in certain pockets of Himachal Pradesh especially in Sirmaur district. Disease

incidence during storage and production are emerging as the major bottlenecks in Ginger production hub of

state. This study is based upon the data collected from 60 ginger growers (48 small and 12 large) selected

randomly from ten ginger growing villages of two blocks of Sirmaur district in the year 2011-12. Average

area under ginger cultivation was 0.13 ha on small farms and 0.28 ha on large farms. Value of seed was the

major cost component followed by human labour both accounting for nearly 70 % of the total cost. Total cost

of production of ginger has been estimated at 1801/q. The productivity of ginger came out to be 139.14q/ha

on all farms. The gross returns from ginger (including mixed crops) was worked out to be 258001/ha and net

returns over total cost was found to be negative in green ginger production. The net returns per quintal in

case of dry ginger were highest followed by ginger seed and green ginger. Major problems encountered by

the ginger growers were non-availability of quality seed at the sowing time, lack of proper seed storage

system, incidence of rhizome rot, poor irrigation facilities and low prices during peak season. There is a need

to provide the cultivators with scientific and cost effective storage methods to ensure adequate supply of

quality seed. There is also a need to create awareness about disease control (rhizome rot) and balanced use of

fertilizers.

020 Mitigating thrusts of capsicum farming in naturally ventilated polyhouses

- A case study of Sirmour

PANKAJ MITTAL and MANOJ GUPTA CSKHPKV, Krishi Vigyan Kendra, Dhaulakuan (Sirmour) HP 173001

With the rise in population and fragmentation of land holdings need was being felt to generate more returns from the small land holdings to sustain the socio-economic status of the farmers. Hence, protected cultivation emerged as suitable alternative to meet this end in hill state in general and Sirmour district in particular. Present investigation was undertaken to identify the suitable hybrids of coloured/green capsicum being grown under protected conditions with high yield and best quality marketable produce. Surveys were


41

conducted during the year 2009-10 to 2010-11 in different polyhouses in the district and observations were recorded on the performance of different cultivars grown by the farmers. Capsicum hybrid Bomby was found best with highest yield and best quality four lobed oblong fruits as compared to the other hybrids. For the verification, the hybrids Bomby, Indra and Orobelle were further evaluated by conducting “On Farm Trials” during the year 2009. On an average, Bomby yielded highest marketable fruit yield of 68.50q from a unit of 500m2 followed by Orobelle and Indra i.e. 56.50 and 47.75q per unit, respectively. The gross returns, net returns and B:C ratio also followed the similar trend. It was also revealed that on an average 53.08 q of coloured capsicum can be harvested from a polyhouse unit of 500 m2 with gross and net returns of Rs. 2, 59,225 and 1,74,225 per unit, respectively when emphasis was given on the recommended production and protection technologies. Higher disease incidence and wide technological gaps were the major bottle necks in realizing the potential of capsicum under protected cultivation.

021 Detection of aflatoxins B1 and B2 in some indigenous medicinal plant products of

Jammu

DIMPLE GUPTA and Y.P. SHARMA Department of Botany, University of Jammu, Jammu – 180006. Email: dimplegupta121@yahoo. in

Species of fungi such as Aspergillus particularly A. flavus and A. parasiticus can grow on various commodities especially in hot and humid regions and become potential target for the production of aflatoxins. Several other species of Aspergillus section ‘Flavi’ A. bombycis, A. ochraceus, A. pseudotamarii, A. rambelli, A. toxicarius, A. zhaoqingensis, Emericella astellata, E. olivicola and E. venezuelensis are also known to elaborate aflatoxins. Among the approximately 20 different types of aflatoxins, only the aflatoxins B1, B2, G1 and G2 are associated with acute liver damage and cirrhosis. AFB1 is the most potent of all aflatoxins known to date and is classified by the International Agency of Research on cancer as Group I carcinogen. Medicinal plants or parts thereof have been used in the prevention and treatment of human ailments since ancient times. The unscientific practices used in harvesting, collecting, storage and marketing of the raw materials and processed herbal products coupled with humid climatic conditions promote their association with various fungi which may be responsible for spoilage and production of aflatoxin. Considering the importance of medicinal plants, the occurrence of aflatoxins B1 and B2 in dried roots of Glycyrrhiza glabra, dried seeds of Bunium persicum and dried fruits of Zanthoxylum armatum was surveyed. Seventy two samples of dried medicinal plant parts were purchased from local markets of different locations of Jammu. The samples were analysed for aflatoxin B1 and B2 by thin layer chromatography and high performance liquid chromatography. The results showed that out of 72 samples, 21 samples of Glycyrrhiza glabra, Bunium persicum and Zanthoxylum armatum were detected positive for aflatoxin. The highest contamination level of aflatoxin B1 and B2 was found in G. glabra (B1 – 1.22±1.70µg/g and B2 – 0.78±0.35µg/g) followed by B. persicum and Z. armatum This exceeds the maximum limit set by World Health Organisation (WHO) i.e. 30ppb for aflatoxin.

022 Fungus diversity in some post harvested economically important fruits

ALKA SRIVASTAVA and SANJAY KUMAR Department of Botany, Govt, MSJ College Bharatpur-321001 Rajasthan. E-mail: alka.041@ gmail.com.

Study was conducted to find out post harvested fungal diversity on important fruits like mango (Mengifera

indica), orange (Citrus sinensis), apple (Malus domestica) and guava (Psidium guajava). Infection of fruits by post harvested diseases may start before, during or after harvesting. Some time they grow up after storage. Main causes of infection are wounds, cuts, improper handling, packaging, transport and undesirable storage conditions. In present investigation, fruits samples were collected from different areas like fruit orchards, fruit market and from cold storages. Spoiled fruits were examined for the study. Different types of fungi were isolated from the infected fruits like Penicillium, Aspergillus, Monilinia, Phytopthora, Candida Albicans,

Aternaria, Diplodia, Fusarium and Colletotrichum. The fungi isolate from such spoiled fruits might be the main cause of post harvest losses. The nutrient values were also reduced on account of fungal infection


42

which further reduced their consumer acceptability. This study will provide information for evolving effective post harvested management practice to reduce the infection and production loss of important fruits after harvesting.

023 Histopathological response of selected varieties of Momordica charantia to

Meloidogyne incognita

MOHD. YAQUB BHAT1, A.H. WANI 2, NASEER HUSSAIN SHAH3 M. ASHAQ MALIK4

1and 2: P.G. Department of Botany, University of Kashmir, Srinigar 1900006, India. 3: Department of Botany ,Degree College Kupawara, Srinigar, India. 4: Department of Botany Govt. Degree College, Jammu. Email: [email protected]

An experiment was carried out to determine the response of different varities of M. charantia towards Meloidogyne incognita to and find out the resistant variety. Out of six varieties viz. Faizabadi ,Jhalarwali, Jaunpuri , PDM, Baramasi and Aligarh local , the variety Aligarh local and Baramasi exhibited highest reduction in length and weight at all intial inoculum levels as compared to control. These varieties also showed large sized galls with higher number of galls and females, however the variety fazabadi exhibited least effect to M. incognita in terms of gall size and the nemotode reproducing factor.The variety Jhalarwali showed reduced growth than Fazabadi but increased growth than Aligarh local and baramasi variety. Variety Fazabadi showed small galls with small giant cells having little cytoplasm . The anatmical study reveals no distortion of galled tissue in Fazabadi in camparsion to the other varieties which showeed large sized gall and gaint cells with maximum size in Aligarh local fallowed by Baramasi Jhalarwali, Jaunpuri and PDM.

024 Rice root knot nematode: New emerging threat in onion and garlic in India

R.K. MISHRA1, A.K. SINGH2, P.SHARMA3, S. PANDEY1 and R.P.GUPTA4 1National Horticultural Research and Development Foundation, Regional Research Station, Salaru, Karnal-132001

(Ha), 2 Division of Nematology, IARI, Pusa, New Delhi,

3 Directorate of Wheat Research, Karnal-132001 (Ha),

4

National Horticultural Research and Development Foundation, Nasik (MS). Email: [email protected]

Onion (Allium cepa L.) and garlic (A. sativum L.) is a high value crop with high demand in local and export markets. In India, onion and garlic crops are grown almost all over the country. Maharastra is the leading state accounting for more than 22.83% of area and 28.42% of production with an average yield of 12.37 t/ha. In India per hectare yields are highest in Gujarat (22.65 t/ha) followed by Punjab (22.63 t/ha). The area under garlic during 2008-09 is 0.14 million ha and production is 0.75 million tones with average productivity of 5.38 t/ha. In India per hectare yield are higher in Punjab (16.67 t/ha) followed by H.P. (13.14 t/ha) and Haryana (12.38 t/ha). The crop is attacked by many diseases, which vary from region to region, season to season and variety to variety. Various biotic factors like fungi; bacteria, viruses, phytoplasmas and nematodes are associated with onion and garlic at different stages of growth and cause considerable damage/losses in yield as well as quality. There are many diseases affecting the onion and garlic production throughout the country. These diseases can also affect at production, harvesting, processing and marketing stages, which lower the quality, reduce the yield there by increase the cost of production and export potential also. During Rabi, 2008-09 and 2009-10 season, a severe Rice root knot disease were observed in onion and garlic bulb crops at Regional Research Station of NHRD Foundation, Karnal, 60-70 day after planting (DAT). Several plants of onion (Var: ALR & ADR) and garlic (Var: G-282 & G-323) showed yellowing of the leaves and stunting of plants, wilted during the day but recovered their turgidity at night. Diseased plants were easily pulled from the soil due to almost complete destruction of the root systems. Numerous galls (av. 10-15 galls/plants) were found on affected roots, compared with healthy plants. The size of each gall is around 0.5-1.0 cm. These are round to oval in shape. The pathogen was confirmed from Division of Nematology, IARI, New Delhi.The morphological characters of second stage juveniles of root knot nematode were examined under light microscope. The average size of the eggs of is 86.1 x 29.3 um and second stage of juvenile is 430 x 14.4 um. The size of male and female is 1121 x 27 um and 498 x 369 um


43

respectively. Several species of Meloidogyne were reported in infect onion bulb crop in many other countries but in garlic it is not reported yet. However, the prevalence of Root knot nematode in onion and garlic has not been recorded in India so far. To our knowledge, this the first reports of M. graminicola causing root- knot in onion and garlic from India.

025 Plant parasitic nematodes associated with apple in Himachal Pradesh

K. PALLAVI SINGH, G.C. SHARMA and M.L. KHAN Department of Entomology, Dr Y S Parmar University of Horticulture & Forestry, Nauni, Solan, HP-173230.


Plant parasitic nematodes are one of the major limiting factors in the production of fruit crops. There are over seventy nematode species belonging to 30 genera which occur in Apple rhizosphere. The association of 5 nematode groups viz. Pratylenchus, Meloidogyne, Xiphinema, Paratylenchus and Longidorus have been shown to be of major economic importance as these cause pronounced deleterious effects on plant growth and productivity. Besides nematodes also act as vectors of apple viruses and enhance the severity of replant disease in apple. Keeping in view this problem an extensive survey was conducted during March-April, 2012 in three districts (Kinnaur, Shimla and Sirmour) of H.P for isolation and identification of plant parasitic nematodes affecting apple plants. Analysis of soil and root samples collected from thirteen different locations of the three districts revealed the presence of five main plant parasitic nematodes viz. the species of Pratylenchus (lesion nematode), Tylenchorhynchus (stunt nematode), Helicotylenchus (spiral nematode), Criconemoides (ring nematode) and Xiphinema (dagger nematode). The population densities of the above nematodes ranged between 25-570, 100-1500, 50-600, 75-100 and 50-75 per 200 cc soil, respectively. Out of all three districts Tylenchorhynchus species was most abundant with highest frequency of occurrence (78%) followed by Pratylenchus (58%), Helicotylenchus (47%), Criconemoides (40%) and Xiphinema (20%). The root knot nematode (Meloidogyne spp.) which is most prevalent on diversified flora throughout the State, could not be extracted from the apple rhizosphere of the three districts surveyed, indicating thereby that it may be a less preferable host for the nematode.

026 Performance of elephant foot under low hill conditions of Himachal Pradesh

RAVINDER SINGH, S.K. GHABRU, AKHILESH SINGH and REENA KAUSHAL CSK HPKV Krishi Vigyan Kendra Berthin, Distt Bilaspur -174029 (HP). Email: [email protected]

Elephant foot (Amorphophallus paconiifolius L.) is one of the important and new emerging crop, on which no package of practices is available in Himachal Pradesh. It is one of the profitable alternatives for monkey, wild animals and stray cattle affected areas. The investigation conducted at Krishi Vigyan Kendra Bilaspur at Berthin (HP) during kharif seasons of 2009-10 and 2010-11, revealed that planting seed corms upto 100 g is more beneficial with net return and B:C ratio of Rs. 10,56,250 and 3.4 followed by 250-500 g seed corms (Rs. 5,90,831 and 2.6) as compared to 100-250 g (Rs. 3,97,519 and 2.1), respectively, under low hill conditions of Himachal Pradesh. Storage rot caused by Fusarium solani is one of the major problems in elephant foot seed corm storage. Among different storage methods evaluated, single layer sand bed storage in well ventilated room was found to be the best method of storage with lowest disease score of 26.5 per cent followed by storage in well ventilated and airy room (27.2 %) as compared to soil pit storage (40.3 %).

027 Some epidemiological aspects of sclerotinia rot of rapeseed-mustard

SUMEET SHARMA and ASHOK KUMAR Department of Plant Pathology, CSK HPKV Palampur, (HP)-176062. Email: [email protected]

Sclerotinia rot of rapeseed – mustard caused by Sclerotinia sclerotiorum (Lib.) de Bary is emerging as an important fungal disease in most of the rapeseed - mustard growing regions of Himachal Pradesh. The growth and sclerotial formation of Sclerotinia sclerotiorum was found to be within the temperature range of 5 to 25°C, optimum being at 20 to 25°C. However, a temperature range of 15 to 20°C was found to be the


44

most favourable for number and dry weight of sclerotia whereas, size of sclerotia was maximum at 5°C and progressively decreased with the increase in temperature. One to two months duration of preconditioning showed increased myceliogenic and carpogenic germination. A temperature range of 10 to 15°C gave more pronounced and comparable effect on the germination of preconditioned sclerotia. Sclerotia of S.

sclerotiorum were found to survive more than one year in soil. Sclerotial germination showed decreasing trend with increasing soil depth under wet humid conditions. After two month at 5cm soil depth myceliogenic germination was 85 per cent which was reduced by about 50 per cent after 8 months and about 75 per cent after 12 months. Similar trend was observed at 5-10cm soil depth. At soil depth more than 10cm, myceliogenic germination after two months was 65 per cent and was reduced to 10 per cent after 12 months. Similarly, carpogenic germination was maxmimum (95 per cent) at soil depth of 5cm after two months, which reduced to 60 per cent after 8 months and 30 per cent after 12 months.

028 Relation between soil pH, organic carbon and root rot disease incidence in Nichar block of Kinnuar district

M.L. VERMA, BHUPESH K. GUPTA, RAJESH THAKUR and RAKESH SHARMA* Dr YS Parmar University of Horticulture and Forestry, KVK Kinnaur at Reckong Peo, Kinnaur – 172 107 (HP),*IBES,

Neri, Distt. Hamirpur (HP).

Twenty three locations in Nichar block were surveyed for root rot incidence. Thirty plants were selected randomly and data on disease incidence was recorded. A composite soil sample from three randomly selected trees was taken from 15 cm depth from the basin area. The disease incidence was recorded ranged between 0 – 16.67 per cent. Soil pH and organic carbon of the samples collected ranged between 5.53 to 7.18 and 0.84 to 4.56 per cent, respectively. Highest disease incidence (16.67%) was recorded in Chhota Kamba village (pH 5.53, OC 4.56%) and was followed by 13.33 percent disease incidence in Kafnoo village (pH 5.58, OC 3.02%). Least disease incidence (0.0%) was recorded in Bari village where pH was 7.18 and OC recorded was 2.70 percent. The survey and soil analysis indicated that the disease incidence was high in acidic soils with high organic carbon percentage where as disease was absent or negligible in neutral soils.

029 Seasonal abundance and life stages of Cyllodes indicus on Pleurotus sajor caju

ANJU S. KHANNA and NEETA DEVI Dr YS Parmar University of Horticulture & Forestry, Nauni, Solan (HP)-173230. Email: [email protected]

The beetle Cyllodes indicus started showing in the oyster mushroom farms immediately after the initiation of rains (somewhere in second fortnight of June), multiplied fast and peak populations were observed during August to September. C. indicus completed its life cycle in four stages i.e. egg, grub, pupa and adult. All the stages of insect except eggs were spotted. The insect remained in grub stage from six to seven days. Three larval instars were differentiated on the basis of their size. The last instar of grub buried itself preferably below the mycelium in the substrate medium prior to pupation. Pupation was also observed within the lamellae of sporocarps. The duration of pupal phase was five to six days. The longevity of adult beetles was recorded in presence as well as absence of food. Adults, when fed upon the sporocarps of oyster mushroom, lived for 19 to 21 days with an average of 20.1days. However, when kept hungry, their survival was as low as 2 to 3 days with an average of 2.7 days.

030 Agromet advisory services for crop protection: Economic impact analysis

PARMINDER K.BAWEJA* and JAGDISH THAKUR Department of Environmental Science, Dr Y S Parmar, UHF, Nauni, Solan (HP)-173230.

*Presently doing Ph.D. from Shoolini University of Biotechnology & Management Sciences, Bajhol-Solan (HP).

The present study refers to the state of Himachal Pradesh which represents unique ecological conditions of the state favour commercial production of fruits and off-seasonal vegetables. Solan district is one of such


45

zone of economic prosperity experienced through cultivation of fruits and off-seasonal vegetables. The present study on agromet-advisory services refers to Solan district and has been working since 1998. The farmers of the area are increasingly becoming aware about the modern farm inputs and advisory services. In this pursuit, the agromet- advisory services maintained under the study resulted in greater acceptance by the local farming community. The role of Agromet advisory services (AAS) is to conduct diagnostic field visits to provide appropriate and safer ways to manage the plant health problems to produce a quality food keeping in view the nutritional and health aspects of the end users. The most emerging diseases diagnosed in tomato fields were damping off, bacterial wilt, canker, leaf spots, buckeye rot and late blight. Damping off is the most damaging disease of capsicum crop at emergence stage and anthracnose causes extensive damage due to dry and cool nights with dew at fruit maturity. Attack of bacterial canker, gummosis, white scale /San jose scale and fungal peach leaf curl diseases were detected in stone fruits at dormancy stage. The AAS helps in the proper timing of the application of recommendations of crop protection against various insect/pest and diseases, the farmers could reap benefits in terms of reduced cost of production, higher productivity, increased returns, additional employment generation and sustained livelihoods. It was therefore, found advisable for non-adopters of AAS to adopt it due to significant higher returns on per acre basis. However, it was observed that some of incentives may be provided to small farmers for improvement in farming systems through effective use of agrometeorological forecasts.

031 Population dynamics of fruit flies (Bactrocera spp.) in peach and guava orchards in low hills of Himachal Pradesh

DEEKSHA SHARMA, MOHINDER SINGH and V.K. RANA* Department of Entomology, Dr Y S Parmar University of Horticulture and Forestry, Nauni, Solan (HP)-173230.

Institute of Biotechnology and Environmental Science, Neri, Hamirpur (HP).

The population of fruit flies infesting fruit crops were monitored in peach and guava orchards at IBES, Neri, Hamirpur (HP) by using bottle traps containing 100 ml solution of 0.1 percent methyl eugenol and 0.05% malathion. In peach orchard populations of two fruit fly species viz., Bactrocera dorsalis and B. zonata were recorded with former being dominating species in all the standard weeks except in 23rd standard week of 2011 and from 18th to 20th standard weeks of 2012 when the population of B. zonata was higher than B. dorsalis. Highest fruit fly catch (447.8 average number of fruit flies/trap/week) was recorded in second week of July 2011 (28th standard week) after that the catch started declining gradually with zero catch during 4th week of January 2012 to third week of March 2012 (4th to 12th standard weeks). Similar trend in populations of B. dorsalis and B. zonata as in peach was observed in guava orchards also. B. dorsalis accounted for more than 85 per cent population of total fruit flies. Highest fruit fly catch (636.8 average number of total fruit flies/trap/week) was recorded during 29th standard week (third week of July 2011 and lowest (zero catch of both the species) in second and third weeks of February 2012).

032 Studies on pests and diseases of bumble bee (Bombus haemorrhoidalis Smith) in India

AVINASH CHAUHAN, SAPNA KATNA, B.S. RANA and H.K. SHARMA Department of Entomology, Dr Y S Parmar University of Horticulture and Forestry,Nauni, Solan (HP)-173230.


Bumble bees are wild pollinators and in many countries being reared commercially for the pollination of crops grown under open field and protected conditions. In India, attempts are being made for the domestication of bumble bee, B. haemorrhoidalis. But targeted rearing success has not been accomplished till now. During the month of June-July, developing colonies of bumble bees start declining due to the attack of various pests and diseases leading to the cent per cent loss of the bumble bee population. Keeping in view the immense importance of various pests and diseases of bumble bees in the successful rearing, studies during 2010-2012 were conducted to know the different pests and diseases for cyclic domiciliation and


46

commercialization of the bombiculture in our country. Fecundated queens of bumble bee, B.

haemorrhoidalis were collected during spring season from the field. These were kept in wooden domiciles (150 x 80 x 65 mm) in the incubator at a temperature 26±1ºC and 65-70% relative humidity by feeding with fresh corbicular pollen and 50% sucrose solution. Incidence of pests and diseases was observed with the development of colonies. Dead workers and queens were dissected and slides were prepared to study the causal organism of their death. The pests were found to be nematodes, conopid flies, mites and moths. Similarly, the colonies were also found to be affected with nosema and bacterial diseases. 8.83% colonies were found unaffected and survived till mid August. Bumble bee queens (17.65%) were infected by large number of juveniles and eggs of nematode, Sphareularia spp. (Sphaerulariidae) which were found from the posterior part of the gut. This nematode causes destruction of reproductive and digestive system hence lead to cessation of egg laying and ultimately death of queens. Conopid flies were present in the abdomen of 20.58% queens resulted in their death due to degeneration of systems in the abdomen of the host. Small oval shaped reddish brown mites were located on the body (scattered) and legs (clustered on femur) of 11.76% queens which caused death in 3-4 days after capturing without initiating the colonies. While the brownish grey coloured moths were found to feed on the wax and pollen also caused losses to the 8.83% developing colonies of bumble bees. In 14.70% of queens, numerous nosema spores were found in the mid gut causing infection and finally leading their death. Rod like bacterial cells belonging to family Streptococcacae were found in gut of 17.65% colonies. Bacterial infected brood (larvae) were thrown out by the queen hence leading to poor development of bumble bee colonies. Such incidences destroyed the colonies before the end of July every year.

033 Effect of climatic change on plant pollinator interactions effecting plant health

RAJ K. THAKUR and JATIN SONI Department of Entomology, Dr YS Parmar University of Horticulture & Forestry, Nauni, Solan (HP) 173 230.


The health of green plants is of vital importance to everyone. Pollination is one of the most important ecological processes for perpetuation of species. In agro-ecosystems, pollinators are essential for orchard, horticultural and forage production, as well as in the production of seed for many root and fibre crops. A diverse assemblage of pollinators, with different traits and responses to ambient conditions, is one of the best ways of minimizing risks due to climatic change. The "insurance" provided by a diversity of pollinators ensures that there are effective pollinators not just for current conditions, but for future conditions as well. Resilience can be built in agro-ecosystems through biodiversity. Pollinators such as bees, birds and bats affect 35 percent of the world's crop production, increasing outputs of 87 of the leading food crops worldwide, plus many plant-derived medicines. It has been estimated that at least 20 genera of animals other than honeybees provide pollination services to the world's most important crops. For human nutrition the benefits of pollination include not just abundance of fruits, nuts and seeds, but also their variety and quality; the contribution of animal-pollinated foodstuffs to human nutritional diversity, vitamin sufficiency and food quality is substantial. So there is a need to conserve pollinators for the better health of the pollinators. The plant- pollinator interactions are likely to get affected by changing climatic conditions thereby disturbing the synchronization of flowering of diverse plant species and emergence of natural pollinators in the ecosystem, ultimately affecting the reproduction potential of plants and thereby adversely affecting the plant health.

034 Bumble bee contribution for the better plant health management

RAJ K. THAKUR and JATIN SONI Department of Entomology, Dr Y S Parmar University of Horticulture & Forestry, Nauni, Solan (HP) 173 230. E-mail:

[email protected]

Since the late 19th century, population all over the world increased rapidly, which demanded more food security. This made the food production as an important business. But then the production depended upon the season and weather conditions whereas the demand of the crops was throughout the year. Climate change has


47

a range of positive and negative impacts on agriculture. Climate and weather plays a predominant role in crop growth and productivity. Since human being realises the critical importance of biodiversity for his survival and well being on this planet. Agricultural biodiversity is often understood as crop genetic resources, yet agro-ecosystems hold a wide diversity of other organisms that contribute toward their productivity and sustainability. Amongst these, are pollinators that carry pollen from the male to the female parts of plants and thus ensuring fruit and seed formation. Over the past decade, the international community has increasingly recognized the importance of pollinators as an element of agricultural diversity supporting human livelihoods. In recent years, numbers of technique have been developed for increasing the agricultural productivity, but due to lack of pollination, the production is not getting up to the target level. The most reliable and efficient form of cross-pollination is through insects. Many insects such as honey bees, bumble bees, and solitary bees are in commercial use for pollination. The most out crossing fruit crops depend upon pollinators, mainly insects. There is need for conservation and augmentation of pollinators like bumblebee (Bombus sp) for pollination. Fortunately bumble bees are advantageous over the honey bees due to their long working hours, long tongue length, effectiveness in less numbers and their capacity to forage vigorously at low temperature and low light intensities. There is immense potential for bumble bees to be used as pollinating agents effectively which will further enhance crop production and food security.


48

Molecular Techniques for Diagnosis and Host Resistance

035 Molecular characterization and virulence spectrum of Rhizoctonia species associated with sheath blight complex in rice

J.S. LORE1, G. GARGAS2, J. JAIN1, M.S. HUNJAN3 and J.S. SANDHU2

1Department of Plant Breeding and Genetics,

2School of Agricultural Biotechnology,

3Department of Plant Pathology,

Punjab Agricultural University, Ludhiana-141 004. Email:[email protected]

Rhizoctonia sheath blight disease complex is composed of three Rhizoctonia species namely Rhizoctonia

solani Kühn, Rhizoctonia oryzae Ryker & Gooch, and Rhizoctonia oryzae-sativae (Swada) Mordue. Accurate identification of the closely related fungal species is essential for successful disease management; this can be achieved by designing PCR primers from the internal transcribed spacer (ITS) regions of ribosomal DNA (rDNA). We undertook this study, to identify different Rhizoctonia species associated with the rice sheath blight complex from Punjab state. The total genomic DNA of 64 isolates was extracted using the CTAB isolation method. PCR was carried out using species – specific primers namely GMRS-3/ITS1, GMROS-6/R635 and GMRO3/R635 for R.solani, R. oryzae-sativae and R. oryzae, respectively. Only fifty genomic DNA samples from 64 isolates showed amplification, and 44 were pure cultures of R. solani species (88.0%) with a single amplified product of 0.55 kb; three isolates had mixed infection of R. solani and R.

oryzae-sativae species. Five DNA isolates (10.0%) were amplified using R. oryzae-sativae species – specific primers with 0.35 kb single product; and one DNA isolate (2.0%) was amplified by the R. oryzae species – specific primers, it had mixed infection with R. solani. Thus, it is apparent that R. solani is most prevalent species causing sheath blight irrespective of the varieties cultivated. Further, among the varieties, Pusa 44 and Pusa 1121 were susceptible to two species R.solani and R. oryzae-sativae. The R. oryzae is restricted only to Nawashahar area of the state and was isolated from the cultivar HKR 47, however this cultivar is also susceptible to R. solani. Seven genotypes viz. Jasmine 85, Tetep, Te-Qing, D-256, D-6766, PR108 and PAU201 with varying levels of resistance were tested for virulence pattern of Rhizoctonia species using detached tiller method. Disease variables such as number of lesions, lesion length, disease spread on the tiller, disease severity and relative disease height were measured. Among the different genotypes tested, Tetep showed minimum disease spread (67mm) and disease severity (16.7%). Average number of lesions per tiller were recorded to be highest (6.5) in R. solani, while the mean individual lesion length was maximum in R. oryzae (12mm). The isolates belonging to R. solani were the most virulent as they produced mean disease spread of 82 cm on detached tillers which further translated into relatively higher disease severity (26.5%) as compared to R. oryzae-sativae (18.8%) and R. oryzae (25%).

036 Serological and RT-PCR detection of latent infection of viruses in various commercial cultivars of apple

MANICA TOMAR, P.D. THAKUR, ANIL HANDA, AJAY BRAKTA, PARDEEP KUMAR and MAHUL SHARMA Department of Plant Pathology, Dr YS Parmar University of Horticulture & Forestry, Nauni, Solan-173 230 (HP).

Apple (Malus domestica Borkh.) is the most important commercial fruit crop in the hill state of Himachal Pradesh. The economy of the state is largely dependent upon apple cultivation. With the introduction of new cultivars and rootstocks, improved integrated nutrient and pest management practices, Himachal Pradesh is fast emerging as a leading apple growing state in India. Apple is mainly infested by various fungal and bacterial diseases but viral diseases have also been reported to cause decrease in the quality and quantity of the produce. Of late apple trees in Himachal Pradesh have been reported to be infected with three main viruses viz., Apple Chlorotic leaf spot Trichovirus, Apple stem grooving Capillovirus and Apple stem pitting Foveavirus which are well known latent viruses. The present studies aimed at detection of latent infection of viruses in commercial cultivars of apple being grown in HP through ELISA and RT-PCR methods. The results of the present study show that both the methods detected the presence of these viruses in the commercial cultivars. Infection of ASGV and ASPV was found individually as well as in combination with


49

ACLSV. Some of the viruses which were not detected through DAS ELISA were detected through RT-PCR method. The results confirmed that the viruses that could not be detected by ELISA methods due to low titer were easily detectable by RT –PCR method thus making molecular detection a more effective tool for the detection of latent viruses.

037 RT-PCR standardization for detection of viruses in apple

SANTOSH WATPADE1, R. BASWRAJ 2, K. K. PARMANICK1, Y.P. SHARMA1, P.D. THAKUR3, ANIL HANDA3, SATISH KUMAR1 and ANKUSH KATOCH1 1IARI Regional Station, Shimla 171004,

2 CPRI Shimla,

3 Dr YSPUHF Nauni, Solan (HP).

Email : [email protected]

Apple Chlorotic Leaf Spot Virus (ACLSV; family Flexiviridae genus Trichovirus) and Apple mosaic virus (ApMV, genus Ilarvirus) are economically important viruses of apple (Malus× domestica Borkh.). Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) procedures were used to amplify coat protein gene of both viruses. Among 5 primer sets used, primer pair 5' tcgcgaacatagcgatacag 3' & 5' acgacattttcgcctcattc 3' for ACLSV and 5' acactcaccctggatcttgc 3' & 5' attcgtcggtatttgcactg 3' for ApMV were selected as it gave expected size amplification without any multiple band. The results were further validated by sequencing fragment which was amplified from ACLSV and ApMV infected leaf of apple by using selected primer sets. Comparisons with published sequences indicated that the both isolates have very high percent identity values to the corresponding region of virus isolate from apple as well as from another host like almond, apricot, wild Himalayan cherry etc. Selected primer pairs was further used for screening plants collected from apple growing areas of Himachal Pradesh (HP), India. Use of NADH dehydrogenase subunit 5 (NAD5) gene in mitochondrial mRNA of the apple as an internal control, reduced the risk of false negative results that may occur with routine RT-PCR assays.

038 Survey and detection of apple viruses from Kullu district of Himachal Pradesh

PARDEEP KUMAR, P.D. THAKUR, ANIL HANDA, MAHUL SHARMA, AJAY BRAKTA AND MANICA TOMAR Department of Plant Pathology, Dr YS Parmar University of Horticulture & Forestry, Nauni, Solan-173 230 (HP).


Apple viruses are one of the most common pathogens of apple worldwide. During field surveys in commercial plantations of apples in Kullu district of Himachal Pradesh, typical symptoms of virus etiology were observed in apple plantation. Common symptoms exhibited by the diseased trees on leaves were chlorotic spotting, leaf distortion and puckering accompanied by necrotic spots. The incidence of the disease ranged from 4-98 percent in different orchards of the valley. Leaf samples from the trees of different commercial cultivars Viz., Starking Delicious, Golden Delicious, Oregon Spur, Top Red, Red Chief, Red Fuji, and Vance Delicious were tested for the presence of viruses by DAS –ELISA. The results indicated the presence of Apple mosaic virus(ApMV), Apple stem pitting virus (ASPV), Apple stem grooving virus (ASGV) and Apple chlorotic leaf spot virus (ACLSV) alone or in mixed infection. There is a possibility of the association of mixed infection of these viruses in different proportions for producing the commonly observed symptoms.

039 Natural occurrence of pear stony pit disease in pear orchards of Himachal

Pradesh

P.D. THAKUR, ANIL HANDA, AJAY BRAKTA, USHA SHARMA and MANICA TOMAR Department of Plant Pathology, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan –173230

(HP).Email: [email protected]

Pear is the second most important temperate fruit crop after apple and is grown in North Western Himalayan region of India. Its cultivation has shown an exponential growth in the recent past due to increased demand in


50

the market and for fetching good returns to the growers. Moreover, pear production is more economical to the growers as it requires less management in comparison to apple as far as occurrence of diseases and application of agrochemicals is concerned. During a routine survey conducted in the month of June 2012 to record the diseases in temperate fruit crops, pear trees of cultivar “William’s Bartlett” bearing deformed fruits along with occasional chlorotic spots and puckering symptoms on leaves were observed in one of the pear orchard located in Salash village in Rohroo area of Shimla district in Himachal Pradesh. Critical observations on the fruits revealed deformities with the formation of depressions, corky tissues in misshapened fruits alongwith russeting similar to symptoms of pear stony pit disease known to be prevalent in other countries. About 80 per cent of the fruits borne on ailing trees in the orchard were exhibiting stony pit symptoms thus, making the produce unmarketable. Occurrence of such type of symptoms on pear fruits from different areas of district Shimla has also been communicated by the growers. Boron treatment to these trees has been observed to be ineffective in reducing the incidence, thereby suggesting the possible association of virus infection with the disease. Leaf samples drawn from such trees were subjected to double antibody sandwich enzyme linked immuno-sorbent assay (DAS-ELISA) against apple stem grooving virus (ASGV), apple stem pitting virus (ASPV) and apple chlorotic leaf spot virus (ACLSV). ELISA studies resulted in the detection of ASPV and ACLSV in the test samples. Further, RT-PCR studies by using primers targetting the coat protein region of ASPV and ACLSV, respectively also resulted in obtaining the desired amplicon of these viruses in ELISA positive samples thereby confirming the association of ASPV and ACLSV with pear stony pit disease. This is the first report of the occurrence of pear stony pit disease associated with ASPV and ACLSV infection in India.

040 Genetic transformation of apple (Malus x domestica Borkh.) rootstock M7 with chitinase gene

PARUL SHARMA and MANJU MODGIL Department of Biotechnology, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan -173 230 (HP).


Using genetic modification, characteristics of a rootstock like resistance to soil-borne diseases can be improved resulting in a substantial increase in yield. As most of the apple rootstocks are susceptible to white root rot caused by Dematophora necatrix Hartig, and to confer fungal resistance to commercially important apple rootstock Malling7, genetic transformation studies using rice chitinase gene were carried out successfully. In regeneration experiments, leaf and internodal segments resulted in 24.37% and 60.58% shoot regeneration respectively. Transformation of apple (Malus x domestica Borkh.) rootstock M7 was carried with Agrobacterium tumefaciens strain LBA4404 harboring the transforming vector pCAMBAR chi11 containing the chitinase gene (chi11) and hygromycin phosphotransferase (hpt) and phosphinothricin acetyl transferase (bar) genes. Putative transformants were selected on shoot regeneration medium containing 5 mg l-1 hygromycin and 500 mg l-1 cefotaxime. A total of 26 putative transgenic shoots were obtained which further multiplied as separate lines and rooted on root induction medium containing antibiotics. Some shoots could not survive on shoot multiplication medium and turned brown. Rest of the shoots were subjected to PCR analysis to confirm the integration of chi11 gene. Two transgenic lines were confirmed by yielding 237 bp and 584 bp amplified products after their amplification with chitinase gene specific primers. The transformants also tested positive in slot blot when probed with chitinase gene probe.

041 Molecular characterization of peach (Prunus persica) germplasm to study genetic divergence using PCR-based molecular markers

R. SHARMA, P. SHARMA, M. RANA and S.V. BHARDWAJ Department of Biotechnology, Dr YS Parmar University of Horticulture & Forestry, Nauni, Solan (HP) 173 230


Depending upon the type of the information observed from germplasm characterization, various crop improvement programmes including mining of desirable genes for genetic improvement of fruiting cultivars


51

mapping quantitative characters by identifying quantitative trait loci (QTLs), marker assisted selection (MAS) where the expression of the gene is recessive or the evaluation of the character is otherwise difficult, phylogenetic as well as evolutionary studies, germplasm conservation and its management etc. have been targeted in various crops. The use of arbitrary oligonucleotide primers in the amplification reaction facilitated the study of uncharacterized genomes. The most common of these PCR-based DNA techniques are Single nucleotide polymorphism (SNP), Amplified Fragment Length Polymorphism (AFLP), Simple Sequence Repeat (SSR), Inter-Simple Sequence Repeat (ISSR) and Randomly Amplified Polymorphic DNA (RAPD) etc. Keeping in view the above facts, the present study reveals the molecular characterization of peach (Prunus persica) germplasm collected from different locations of Himachal Pradesh using RAPD molecular markers to assess the value and magnitude of genetic divergence. Total 32 RAPD based primers were screened in all the 45 accessions taken under study. Only reproducible primers were used to score for polymorphism. The observed results are being subjected to ISSR and SSR markers for their further characterization and respective interpretation with respect to these results is under progress.

042 Partial characterization of begomoviruses associated with different crops in

Punjab

S.I. KAUR, S.S. KANG, A. SHARMA and A. GAIKWAD Department of Plant Pathology, Punjab Agricultural University, Ludhiana (Pb) - 141 004.


During the last two decades, begomoviruses have emerged as devastating pathogens causing huge economic losses and threats in agricultural production. The present investigations were planned to study the variability among begomoviruses infecting different crops on the basis of coat protein gene. For this purpose, the diseased samples of different hosts viz., chilli, okra, tomato, radish and papaya showing different type of symptoms like leaf curl, reduction in leaf size, puckering and yellow vein were collected from the fields. The association of begomoviruses with these infected samples was confirmed through Polymerase Chain Reaction (PCR) using universal degenerate primers designed particularly for begomoviruses. These samples were then processed for partial characterization studies where the coat protein gene amplified using universal primers was cloned and sequenced. The sequencing analysis revealed the association of Chilli leaf curl virus (ChiLCV) with chilli samples showing leaf curl type of symptoms. Based on highest sequence identity and phylogenetic analysis, the viruses associated with radish and papaya were found to be closely related with Tomato leaf curl virus (ToLCV) while Papaya leaf curl virus (PapLCV) was found in association with tomato and Mesta yellow vein mosaic virus (MeYVMV) with okra. These results suggested the vast variability among begomoviruses infecting different plant species.

043 Pathotypic and genetic characterization of Colletotrichum gloeosporioides isolates infecting capsicum in Himachal Pradesh

A. KATOCH and P.N. SHARMA Molecular Plant Pathology Laboratory, Department of Plant Pathology, CSK HP Agricultural University. Palampur-

176 062. Email: [email protected]

Colletotrichum gloeoporioides is the second most important pathogen amongst Colletotrichum species complex associated with capsicum fruit rot/ anthracnose disease. In the present study an attempt has been made to investigate the population structure of C. gloeosporioides based on pathogenic behavior on differential varieties and PCR based molecular markers. Based on reaction pattern on 11 differential capsicum genotypes comprising of C. baccatum, C. chinense and C. annuum species, various isolates were categorized into six pathogroups viz., Cg.A-1, Cg.A-2, Cg.A-3, Cg.A-4, Cg.A-5 and Cg.A-6. Race group Cg.A-1 possessed maximum of three isolates and were found to be most virulent infecting eight of eleven differentials. Genetic variability analysis using PCR based ISSR markers clustered thirteen isolates into four subcluster at 0.36 coefficient and ERIC 1R and BOX AIR into four clusters using eleven alleles. A combined


52

dendrogram generated using 33 alleles of ISSR, ERIC and BOX primers grouped them into two major groups with seven and three isolates at 0.30 coefficient whereas remaining three isolates showed early divergence. An exotic C. baccatum line EC631750 was found resistant to a maximum of five races of pathogen followed by a C. chinense line EC631751 and two C. annuum varieties i.e. Surajmukhi and California Wonder, each resistant to four races.

044 Agrobacterium-mediated genetic transformation of Dendranthema grandiflora

Tzvelev with rice chitinase gene

SHWETA SEN, SURINDER KUMAR, MANISHA THAKUR and MINERVA GHANI Department of Biotechnology, Dr YS Parmar University of Horticulture & Forestry, Solan 173 230 (HP).


Chrysanthemums are very popular cut flower and ornamental pot plants of high economic value. It is the second largest cut flower after rose among the ornamental plants in the global flower market. Diseases caused by fungi, bacteria, mycoplasma and viruses are responsible for poor quality of flowers and reduction in the yield. Septoria obesa Syd is one of the most important pathogen of chrysanthemum. This pathogen causes leaf spots resulting in 15-20% yield loss. The control of leaf spot pathogen by fungicides is difficult because fungicides are often in effective as the pathogen spread rapidly under favourable conditions. Major destructive fungi on the other hand developed resistance to most classes of fungicides and environmental pollution caused by these chemicals is a serious threat. Therefore, attempts have been made to develop a simple and efficient protocol for the Agrobacterium mediated transformation of chrysanthemum cv. Snow Ball with rice chitinase gene. The initiation of direct shoots was achieved from internodal segments from four weeks old aseptic cultures maintained on MS medium supplemented with 2 mg/l BA and 0.5 mg/l NAA. The rice chitinase gene harboured in the plasmid pCAMBIA-bar-ubi-chiII (13.8 kb) was delivered via the Agrobacterium-mediated method to the internodal segments followed by selection of putative transformants on the selection medium containing 10 mg/l hygromycin. Four independent putative transformed plants were recovered under stringent selection pressure. RAPD-PCR analysis of transgenic plants revealed the integration of chi II gene in four regenerated hardened plants. Transformation frequency of 2.2 % was obtained. Transgenic plants were shorter in height as compared to control.

045 Molecular characterization and phylogenetic analysis of tomato leaf curl virus

(ToLCV) in Himachal Pradesh

S.V. BHARDWAJ, PRAGUN S. SAMBYAL, ANJU SHARMA and YASHVEER S. VERMA Department of Biotechnology, Dr YS Parmar University of Horticulture and Forestry , Nauni , Solan, HP- 173230.

Email: yashveer_verma @hotmail.com

Leaf curl disease of tomato is prevalent in several areas of Himachal Pradesh. During present studies seven isolates were collected on the basis of symptoms from areas ranging from 600 -1650 mts altitude. DAS-Elisa was performed to confirm the presence of the virus. Except one isolate i.e. Nalagarh (0.252, OD value), all the other isolates Badghal, Shaya, Bajhyana, Solan, Tikari Pajehli reacted positively with the monoclonal antibodies with O.D. values 0.894, 0.812 0.943, 1.184, 0.687 respectively. These studies were further confirmed through PCR amplification using specific primer for coat protein (CP) gene (~800 bp) , replication initiator (Rep) gene (~1200 bp) and DNA B genome (~2700bp). The genome organization of CP and Rep gene resembled that of other ToLCNDV sequenced so far. Sequence comparisons with other isolates showed a high homogeneity between isolates from North India, suggesting the presence of a geographical cluster; ToLCNDV-Med, ToLCNDV-AVT1, ToLCHim V-CP (for CP gene) and ToLCHim V-Rep, ToLCNDV (Luc) for Rep gene. Phylogenetic analysis clearly showed clustering of ToLC Him V-CP and Rep gene with that of bipartite geminiviruses from North India, distinct from the monopartite geminiviruses from South India (ToLCBV), Australia, Israel and Sardinia.


53

046 Molecular characterization of Turnip mosaic virus- a potyvirus infecting radish (Raphanus sativus L.) in Himachal Pradesh

S.V. BHARDWAJ, TARUNA SHARMA and PRATIMA SHARMA Department of Biotechnology, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan- 173230.

e-mail: [email protected]

Radish is one of the important vegetable crops of family Cruciferae/Brassicaceae. Turnip mosaic virus causes great losses to both crop and ornamental cruciferous crop production worldwide. Molecular characterization of TuMV infected radish was carried out to amplify a cDNA of approximately 1185 bp with the help of degenerate primers specific for TuMV. The PCR product was subsequently cloned and sequence analyzed. The sequence of the 3´ terminal 1169 nucleotides of Indian isolate of turnip mosaic virus RNA was determined and submitted to EBI with accession numbers AM850140 & CAO98860 for nucleotide and amino acid sequences, respectively. The sequence of TuMV Indian isolate contained one partial open reading frame of 959 nucleotides, encoding 319 amino acids, followed by a stop codon and a non-translated region of 207 nucleotides. A potential polyadenylational signal motif, UAUGU was located at position 1026-1030 nucleotides upstream from the poly (A) tail in 3´ NCR of Indian isolate of TuMV. A highly conserved hexanucleotide sequence consensus AGUGUG which was common in 3´ NCRs of the potyvirus RNAs was also observed in 3´ NCR at 1049-1054 nucleotide position. The deduced amino acids sequence contained partial NIb gene and complete sequence of coat protein gene. Percent homology of the Indian isolate with the 39 other isolates of TuMV retrieved from NCBI database was 87-97% & 90-96% at nucleotide and amino acids levels, respectively.

047 Identification of quantitative trait loci for resistance to Xanthomonas campestris

pv. campestris in cabbage (Brassica oleracea var. capitata)

RAJINDER KAUR, BHAWNA SAXENA, S.V. BHARDWAJ Department of Biotechnology, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan (HP) - 173230.


The present investigation on Brassica oleracea var. capitata was carried out with the objective to identify quantitative trait loci for resistance to Xanthomanas campestris pv. campestris by employing RAPD and SSR markers. Work was also done to identify genetics of resistance to blackrot in cabbage. F2 population raised from a cross between January King Sel Improved (resistant parent) and Golden Acre (susceptible parent), was used as mapping population. 200 ml of bacterial suspension containing 6.02 X 106 bacterial cells per ml of suspension was used to screen 200 F2 plants by scissor cut method and spraying through a sprayer. 110 resistant and 90 susceptible plants were recorded. The goodness of fit of observed ratio (9:7) was tested by Chi-square test with χ2 value as 0.0625, hence, showing polygenic dominant control of resistance. Phenotypic data for 200 F2 individuals was recorded for symptom score and percentage severity towards blackrot reaction. Genotypic data was recorded on the basis of survey polymorphism in 200 F2 individuals with 80 RAPD and 120 SSR primers. After polymorphism survey and segregation distortion, genotypic data of 2 RAPD and 30 SSR markers were retained for further analysis. Both phenotypic and genotypic data were used to construct a linkage map using software MAPMAKER ver.2.0. A total of five linkage groups were constructed, spanning a distance of 1,538 cM with an average distance of 48.06 cM between loci. A total of four QTL (XccDs1-1, XccDs2-1, XccDs3-1 and XccDs3-2) were identified for symptom score and four (XccDi1-1, XccDi3-1, XccDi3-2 and XccDi5-1) for logarithm of percentage severity. QTL reported were found to be responsible for 9.4% to 31.8% phenotypic variance for disease symptom score.The detection of QTL will go a long way for marker assisted selection in crop breeding programs for resistance to black rot in cabbage.


54

048 Postulation of resistance genes for powdery mildew (Blumeria graminis tritici in Indian wheats

DAISY BASANDRAI*, ASHWANI K. BASANDRAI and P.D. TYAGI CSK HPKV Hill Agricultural Research and Extension Centre, Dhaulakuan, Distt. Sirmour -173001 (Himachal

Pradesh), #Department of Plant Pathology, CSKHPKV, Palampur -176062. Email: [email protected]

Two hundred and sixty three genotypes of advanced Indian Wheat Breeding Material comprising, Triticum spp. and tritcale were screened against ten genetically characterized virulences of Blumeria graminis f. sp. tritici and resistance genes were postulated in fifty seven genotypes showing differential reaction to the cultures. Gene Pm 5 and some other unidentified gene(s) were postulated in genotype PBW 368. Resistance in thirty five genotypes HS 365, HPW 93, UP 2359, K 8804, HP 1740, UP 2358, HW 1089, K 9210, HUW 443, K 9211, WH615, UP 2358, HUW 446, HD 2644, MP 941, HUW 435, K 8804, HUW 454, HW 1087, K 9235, PBW 369, VL 733, HP 1729, UP 2358, K 9116 was controlled by gene Pm 8 individually or in combination with unknown gene(s). Resistance in 24 genotypes, behaving differentially to the cultures, could not be attributed to any of the known gene(s). UP 2374, PBW 361, HW 1093, UP 2375, TL 2853, TL 2780, HPT 6, DT 46 were resistant and rest of the genotypes were susceptible to all the isolates.

049 Management of brown spot of rice caused by Drechslera oryzae through host

resistance and botanicals

D.S. DODAN and SATISH KUMAR CCS HAU, Rice Research Station, Kaul-Kaithal (Ha).

Brown spot of rice caused by Drechslera oryzae (Breda de Haan) Subramanian and Jain has become an important disease of scented and non-scented varieties in northern Haryana. This pathogen has also been found to cause stalk and neck rot in addition to leaf spot and grain discolouration in non-scented high yielding varieties of rice. Use of resistant varieties and botanicals are an economical and practical approach for the control of diseases. One hundred forty rice genotypes were evaluated for brown spot resistance by planting 30 days old seedlings of each genotype in two rows (2 m long) and seven botanicals were evaluated by planting 30 days old seedlings of highly susceptible cultivar HKR 46 in RBD with three replications at the farm of CCS HAU Rice Research Station, Kaul. Observations on disease development were recorded by following SES for rice (IRRI 2002). Among 140 genotypes evaluated under artificial conditions, only two genotypes viz., IR 79216-141-1-3-3, KJT 3-2-7-7-2 and four genotypes viz., HKR 08-63, OM 5240, OR 2329-22 and RPBio 110 were found highly resistant and resistant, respectively. Out of seven botanicals, Arjun tree and Mentha leaf extract proved to be most effective in controlling all the three phases (Brown leaf spot, stalk rot and neck rot) of this disease.

050 Evaluation of elite rice breeding lines for bacterial blight resistance

J.S. LORE, R. KAUR, R. KHANNA, JYOTI JAIN, NAVJOT KAUR, J. KAUR and G.S. MANGAT Department of Plant Breeding and Genetics, Punjab Agricultural University, Ludhiana-141 004.

Bacterial blight caused by Xanthomonas oryzae pv. oryzae (Ishiyama), Swings et al. is a major disease in north-western states of India including Punjab. Eighty one advanced stage breeding lines of rice developed at Punjab Agricultural University were screened for the presence of bacterial blight resistance genes Xa4, xa5,

xa13 and Xa21 using SSR markers. These lines were also evaluated against all ten pathotypes (virulent to single xa/Xa gene and gene combinations) of bacterial blight pathogen prevalent in Punjab under artificial inoculation in field conditions during kharif- 2010 and 2011. Bacterial blight resistance gene Xa4 was present in 68 lines while xa13 was present in 57 entries. The gene xa5 was found in just 8 lines. Majority of the lines had two pyramided genes. In field conditions, all 81 lines showed resistance to pathotype PbXo-7 of Xanthomonas oryzae pv. oryzae which is the most prevalent in the Punjab state of India. Fifty one genotypes were found to be resistant to all the ten pathotypes, however 31 lines showed susceptible reaction to the newly identified two pathotypes (Pt 902 and Tar 949) from the state which are virulent to Xa gene (s) and


55

gene combinations (xa13+Xa21 and Xa4 +xa5). Some elite lines viz. PAU4058-6-5-1-6 and PAU3842-52-1-2-1-1 possessed multiple diseases resistance for all the pathotypes of bacterial blight pathogen and tolerance to sheath blight, as well as false smut which are emerging as serious biotic stresses in Punjab. The highest yielding lines were PAU4061-12-2-3-8, PAU3762-3-3-2-1-1-1, PAU3842-52-1-2-1-1, PAU3832-215-6-3-1-2 and PAU4058-6-5-1-3. Out of these four lines had xa13 and Xa4 genes and showed resistance to all the ten pathotypes while PAU4058-6-5-1-3 had xa13 and possessed resistance to nine pathotypes and susceptible to pathotype Pt 902 which is also virulent to near isogenic line IRBB-13 (xa13). These genotypes can either be released as new varieties or further utilized as donors in multiple disease resistance breeding programmes.

051 Screening of maize lines against Erwinia stalk rot and brown stripe downy mildew

AKHILESH SINGH, DHANBIR SINGH* and RAVINDER SINGH CSK HPKV, Krishi Vigyan Kendra, Berthin, District Bilaspur-174029, * CSK HPKV Hill Agriculture Research and

Extension Centre Dhaulakuan- 173001 (HP).

Maize (Zea mays L.) is one of the most improtant kharif season crops of Himachal Pradesh. It is mainly used as food, feed and fodder in the state and is grown over a wide range of agro-climatic conditions. Diseases are an important constraint for maize production in the state. Among the various diseases of maize, Erwinia stalk rot and brown stripe downy mildew take a heavy toll of maize in the state. Two hundred sixty five lines/stocks received from Directorate of Maize Research, New Delhi were screened against Erwinia stalk rot and brown stripe downy mildew during kharif seasons of 2010 and 2011 under artificial epiphytotic conditions. Fourty and fourty eight stocks were found resistant to Erwinia stalk rot and brown stripe downy mildew, respectively. Eleven hybrids/composites viz. KHB-52, Parkash, BIO-265, MCH-40, MCH-38, FH-3506, FH-3478, FH-3487, Vivek QPM-9, Vivek hybrid-9 and HQPM-14 showed multiple disease resistance against these diseases. Superior resistant entries may be evaluated for release as varieties or exploited in breeding programme.

052 Field screening of kidney bean germplasm for bean common mosaic virus

JITENDER K. VERMA and J.C. RANA National Bureau of Plant Genetic Resources (NBPGR) Regional Station, Phagli, Shimla-171004 (HP).


Kidney bean (Phaseolus vulgaris L.) is major dual-purpose cash crop in the Himalaya region of India. The crop is highly susceptible to viral diseases and there are limited sources of resistance. In the present experiment, we screened 934 accessions collected from different parts of India (Indigenous Collections - 518) and from exotic sources (Exotic Collections - 416). These were grown at NBPGR Regional Station, Shimla in augmented block design along with six check varieties in kharif season of 2012. The disease severity was recorded on five point scale (0-2 resistant and 3-4 susceptible) from seedling stage onward at an interval of 15 days. Out of 934 accessions, 117 exotic and 123 indigenous accessions were found resistant as they are scored as one on five-point scale. The remaining 513 accessions were found susceptible. The geographical origin of accessions revealed that there were 58 resistant accessions from Himachal Pradesh, 12 from Jammu & Kashmir, 3 from Uttrakhand, 38 accessions from north-east states, 7 accessions from Uttar Pradesh and 5 accessions from south states of India. The top five accessions found resistant were EC002823, EC008503, EC013099, EC018609, EC018714 from exotic sources and IC280005, IC311677, IC016912, IC047858 and IC328655 from indigenous sources. There was no specific relationship between the resistant pattern and origin of the germplasm. The data was also recorded on the horticultural superiority of all the resistant accessions. We assumed that the resistant accessions coupled with horticultural superiority would be useful to plant breeders in the breeding programmes. This will facilitate easy transfer of resistance without much of linkage drag problems, which Plant Breeders generally face while making crosses and attempting selection in the segregating generations. The more rigorous screening of the resistant germplasm will be done under controlled conditions in the following seasons.


56

053 Inheritance of Alternaria leaf spot in tomato

SHIV PRATAP SINGH Department of Vegetable Science, YS Parmar University of Horticulture and Forestry, Nauni Solan- 173 230.

Tomato (Solanum lycopersicon L.) a solanaceous vegetable grown throughout the world. The agro-climatic conditions of Himachal Pradesh are ideally suitable for the production of tomato at a time when it does not grow well in the plains. During crop season in the mid hills the crop experiences rains at periodic intervals which leads to various leaf spot diseases like Alternaria leaf spot resulting in lot of reduction in the yield and increase in the cost of production of the crop. Therefore there is need to develop new varieties resistant to Alternaria leaf spot, keeping this in view a study was carried out to know the inheritance pattern of resistance to Alternaria leaf spot in tomato. Twenty-five lines of tomato were screened for resistance to Alternaria leaf spot in tomato by creating artificial epiphytotic conditions. Four lines comprising of EBR-5 (resistant), EBR-6 (resistant), Solan Gola (Susceptible and horticulturally superior) and Solan Vajr (moderately susceptible and horticulturally superior) were selected to conduct inheritance studies. Four crosses were made between Solan Gola x EBR-5, Solan vajr x EBR-5, Solan Gola x EBR-6, Solan Vajr x EBR-6 and their F2, B1 (back cross 1) and B2 (back cross 2) generations were also raised and inheritance of resistance to Alternaria leaf spot was worked out. Significance of individual scales (A, B and C) as well as joint scaling test (JST) in all the four crosses confirmed the presence of non-allelic interactions. The gene effects in the joint scaling test indicated that resistance to Alternaria leaf spot was found to be polygenic with additive, dominance and epistatic gene actions playing an important role in inheritance of Alternaria leaf spot in tomato.

054 Evaluation of bell pepper genotypes for resistance against Phytophthora blight (Phytophthora nicotianae var nicotianae)

SANTOSH KUMARI Department of Vegetable Science, Dr YS Parmar University of Horticulture & Forestry, Nauni, Solan (HP)-173230.


Bell pepper is a high value vegetable and an important cash crop of temperate regions. It is used as salad, cooked as vegetable, pickled or processed and is appreciated worldwide for its aroma, flavour and colour. Mid hills of Himachal Pradesh are leading suppliers of fresh market bell pepper of excellent quality due to congenial climate which produce big sized blocky fruits with high flavour and shiny skin, to the plains during summer and rainy season and sells at good premium, thus bringing lucrative returns to the hill farmers. Phytophthora blight (Phytophthora nicotianae var nicotianae) disease causes severe losses in mid hills of Himachal Pradesh. Phytophthora leaf blight and fruit rot has been reported to cause losses upto 100 % in hills. So there is need to screen different genotypes of bell pepper having resistance to Phytophthora blight disease. In the present investigation, fifteen genotypes of bell pepper were screened against this disease. Feroz, UHF-14, US-818 and LC-1 were found to be moderately resistant to Phytophthora leaf blight whereas, California Wonder, Solan Bharpur, HC-201, PC-1, Local Collection, Yolo Wonder and Gazio were susceptible. Kandaghat Selection, EC-579997, ACC-16, Kannaual Collection were highly susceptible to this disease. For Phytophthora fruit rot, Feroz and LC-1 were moderately resistant whereas California Wonder, Solan Bharpur, HC-201, Yolo Wonder, PC-1, Local Collection, Gazio, UHF-14 and US-818 were susceptible. Kandaghat Selection, EC-579997, ACC-16, Kannaual Collection were found to be highly susceptible to this disease.

055 In vitro selection of carnation cv. Master for resistance against Fusarium

oxysporum f. sp. dianthi

KAMLESH KANWAR, RASHMI RANADE and VIPASHA VERMA

Department of Biotechnology, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan (HP) 173230


Carnation (Dianthus caryophyllus L.) belonging to the family Caryophyllaceae is one of the most important commercial cut flowers of the world .Though carnations are attacked by a number of pathogens like fungi,


57

bacteria, viruses but vascular wilt of carnation caused by the fungus Fusarium oxysporum f. sp. dianthi is considered to be the most serious problem of carnations and it continuously causes considerable economic losses. The present investigation aims at the development of resistant cell line against Fusarium oxysporum f. sp. Dianthi through in vitro cell line selection. Micropropagation of carnation was standardized through direct regeneration of adventitious shoot buds and indirect regeneration from callus using leaf as explant. The best callus induction medium obtained for the induction of callus from leaf explants was solid MS medium supplemented with 1.0 mg/l TDZ and 0.2 mg/l NAA. The best medium for callus differentiation and shoot regeneration was MS medium supplemented with 1.0 mg/l TDZ and 1.5 mg/l TIBA. MS medium supplemented with 1.0 mg/l TDZ and 0.5 mg/l TIBA was best for direct induction of adventitious shoot buds in leaf explants. Microshoots were rooted on MS medium supplemented with 0.2 per cent activated charcoal. Cell line selection was done by using fungal culture filtrate of Fusarium oxysporum f. sp. dianthi as a selective agent. Selection and isolation of cell lines was done using calli and plantlets were regenerated from cell lines selected at 12.5% of fungal culture filtrate and the selected microshoots were rooted on the rooting medium. Rooted control as well as selected plantlets were hardened eventually. RAPD-PCR evaluation was done for the comparison of control and selected plants which revealed presence of one polymorphic band in the putative resistant plant samples. The selected plant showed resistance development to Fusarium

oxysporum f. sp. dianthi under in vivo testing.

056 Reaction of tomato genotypes to buckeye fruit rot disease and yield under Solan conditions of Himachal Pradesh

Y.R. SHUKLA, MUNISH SHARMA and S.K. GUPTA Dr YS Parmar University of Horticulture and Forestry, Horticultural Research Station, Kandaghat, Solan (HP).

Tomato (Solanum lycopersicum L.) is an important solanaceous vegetable crop grown all over the world. It is a major cash crop of mid-hill regions of Himachal Pradesh. Amongst various factors which affect growth and yield of any crop, attack of various diseases and pests is one of the important factors as tomato is prone to many important diseases and pests. Among these, buckeye rot disease (Phytophthora nicotianae var

parasitica, Dastur) is of utmost importance since tomato is grown during summer-rainy season as summer crop and climate during this period is highly congenial for the development of this disease. In the present study, the buckeye fruit rot incidence was recorded and out of twenty five genotypes, twenty two were found to be moderately susceptible while three were susceptible. In the light of above, it can be concluded that tomato genotype EC-521079 is the best in terms of yield per plant (1533.70g), buckeye rot incidence (10.45%) and has the capacity to survive approximately 90 per cent against buck eye rot disease.

057 Screening of cucumber germplasm for resistance to economically important diseases in mid-hill conditions of Himachal Pradesh

SANDEEP KUMAR, RAMESH KUMAR, Y.R. SHUKLA1, DHARMINDER KUMAR, SANDEEP KANSAL, DINESH SINGH2, B.S. DOGRA3 and M.L. BHARDWAJ Department of Vegetable Science,

1 Horticulture Research Station, Kandaghat,

2Department of Fruit Science

3Regional

Horticulture and Forestry Research Station, Bhota, Hamirpur (HP), Dr. YS Parmar University of Horticulture and

Forestry, Nauni, Solan – 173 230( HP). Email: [email protected]

Cucumber (Cucumis sativus L.) is one of the most valuable crops of the family cucurbitaceae grown commercially throughout the country. But, most of the commercially cultivated varieties of cucumber are susceptible to different diseases, because the active growth period of this crop coincides with the advent of monsoon rains, favouring the development of various diseases like powdery mildew, anthracnose and angular leaf spot in the field crop. Due to the severe incidence of these diseases production as well as the productivity of the crop is hampered. As the chemical control of the diseases of cucumber is not cost effective and ecological amenable, there is a great need of screening cucumber’s indigenous germplasm to select elite genotypes with higher yield and improved quality with disease resistant genes. Thirty diverse genotypes of cucumber collected from different growing localities of Himachal Pradesh and adjoining states


58

were evaluated at the experimental farm of the Department of Vegetable Science, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan (HP) for their response to important diseases viz. powdery mildew, anthracnose and angular leaf spot under open field conditions during kharif season of 2009. The analysis of variance revealed highly significant differences among all the genotypes for their response to different diseases. Minimum severity of powdery mildew was recorded in the genotype LC-21 (8.50%) and severity of anthracnose was least in LC-15 (7.70%), while angular leaf spot severity was noticed minimum in LC-22 (6.50%), among all the genotypes under study. Moreover, the genotype LC-15 also gave the higher yield (227.25 q/ha) than both the check cultivars viz. K-75 (192.49 q/ha) and K-90 (200.42 q/ha), while LC-21 was found superior in yield (198.14 q/ha) than one check cultivar viz. K-75 (192.49 q/ha). These genotypes can either be used as the source of resistance for future breeding programme (LC-22) or recommended for commercial cultivation (LC-15 and LC-21) after multi-location testing in different regions.

058 Screening of pea germplasm for resistance to powdery mildew disease in mid-hill conditions of Himachal Pradesh

RAKESH1, MANISH KUMAR1, NARENDER K. BHARAT2 AND R.K. DOGRA3 1Department of Vegetable Science,

2Department of Plant Pathology,

3Department of Fruit Science, Dr. YS Parmar

University of Horticulture and Forestry, Nauni, Solan – 173 230 (HP). Email: [email protected]

Pea is one of the most important vegetable grown all over the world during cool season. In India, it is grown as winter season vegetable in the Central and Northern plains and as a summer and autumn-winter crop in the hilly regions. The produce from hilly areas of Himachal Pradesh is available at a time when pea cannot be gown in plains due to high temperature and this off-season availability brings lucrative returns to the growers. But still the production per unit area of pea is low in the country especially when varieties are grown during off-season. The main reason for low productivity is high severity of powdery mildew disease on commercial cultivars. As the chemical control of this disease of pea is not cost effective and ecological amenable as well, so there is a great need of screening available pea germplasm to select elite, high yielding genotypes with powdery mildew resistant genes. Under present study, fifty four genotypes of pea collected from different geographical locations of India were evaluated at the experimental farm of the Department of Vegetable Science, Dr. YS Parmar University of Horticulture and Forestry, Nauni, Solan (HP) for recording their response to powdery mildew severity under open field conditions during 2010-11crop season. The analysis of variance revealed highly significant differences among all the genotypes for their response to powdery mildew disease. Minimum severity of powdery mildew was recorded in the genotype IC-381058 (6.26%) followed by IC-208385 (7.26%). None of the genotypes was found immune but 20 genotypes showed resistant reaction to the powdery mildew disease. The genotype 10/PMVAR-5 (138.63q/ha) and check variety Azad P-1 (120.96q/ha) also gave the higher yield than other genotypes under study. The powdery mildew resistant and high yielding genotypes selected in the present study can be further utilized in crop improvement programme to develop powdery mildew resistant varieties.

059 Evaluation of Kharif onion advance lines for resistance to stemphylium blight and

thrips

R.K. MISHRA1, S. PANDEY1 and R.P. GUPTA 1National Horticultural Research and Development Foundation, Regional Research Station, Salaru, Karnal-132001

(Ha). Email: [email protected]

Onion, (Allium cepa L.) is grown all over the world and is a favourites vegetable and spice in India. It is relished mostly as salad and Indian cuisine is incomplete without onion. India is the second largest onion producing country in the world after China with approximately 756840 ha onion growing area with an annual production of 12190680 MT during 2009-10 (Anonymous, 2010). It is susceptible to a number diseases and insect pests. Among them, Stemphylium blight incited by Stemphylium vesicarium and Thrips caused by Thrips tabaci are the most devastating and prevalent one. For management of these disease and insect pest, appropriate cultural practices, including


59

spraying of fungicides and insecticides are preventive, however, proper resistant/tolerant cultivars/lines selection are more crucial. The present study was undertaken to indentify the suitable resistant/tolerant lines for management of Stemphylium blight and Thrips during kharif season. The entries/lines received from Directorate of Onion and Garlic Research (DOGR), Pune were evaluated under All India Networking Research Project on onion and garlic at National Horticultural Research and Development Foundation, Karnal during Kharif 2008-09 and 2009-10. Total nine lines namely 913, 905, 915, 916, 902, 910, 917, 923 and 904 along with ADR (check). Ten plants were randomly selected for scoring the disease and Thrips severity on 0-5 rating scale at fortnightly intervals. Observation revealed that out of nine lines, none of the lines were found resistant against Stemphylium blight and Thrips. Lines 916, 910 and 902 were found tolerant and rest of the lines was found susceptible against Stemphylium blight.

060 Evaluation of some garlic genotypes under subtropical conditions of Himachal Pradesh

DEEPA SHARMA and KUMUD JARIAL Dr YS Parmar UHF, Institute of Biotechnology and Environmental Science, Neri, P.O. Khaggal, Distt. Hamirpur

(HP)- 177 001. Email: [email protected]

An experiment was conducted to identify promising genotypes of garlic suited for cultivation under subtropical region of Himachal Pradesh. Twenty five genotypes of garlic collected locally/from surrounding areas were evaluated at Research Farm of the Institute of Biotechnology and Environmental Science (Dr. Y.S. Parmar, University of Horticulture and Forestry), Neri, Hamirpur during winter 2010-11. The farm is located at an altitude of 620 m amsl with average mean maximum and minimum temperature levels of 31.30

C and 12.40 C, respectively and is a representative site of low hill region of Himachal Pradesh. The relative humidity levels lie around 60.9 per cent. Standard package and practices were followed for raising the crop as per the recommendations of the University. Studies were carried out in randomised block design with three replications. Observations were recorded on various horticultural traits viz. plant height, number of leaves per plant, leaf diameter, leaf length, neck thickness, bulb polar diameter, bulb perimeter, number of cloves per bulb, weight of clove, weight of bulb, total soluble solids, harvest index ,days for harvesting and total yield . The analysis of data revealed that the germplasm differed significantly as to the different morphological attributes, yield and other desirable traits. The height of the plants varied from 39.70-76.67 cm. Length and width of the individual bulb differed from 3.69-5.00 cm and 4.01 to 5.12 cm respectively. The number of cloves/bulb and individual bulb weight also varied significantly. Per hectare yield of garlic genotypes varied from 84.08 to182.69 q being lowest in NG-12 and highest in NG-25. No single accession showed resistance to Stemphylium blight disease. Considering yield and other parameters, the lines NG-1,

NG- 4, NG-11, NG-20 and NG-25 were found promising.

061 Performance of some promising poplar clones to leaf spots caused by Cercospora

sp. and Pseudocercospora sp. in Punjab

G.S. RATTAN and PARMINDER SINGH Department of Plant Pathology, Punjab Agricultural University, Ludhiana-141004.


Extremely low forest cover in Punjab along with need to diversify the state agriculture, has prompted the state to go for agro-forestry in a big way. Poplar has emerged as the main choice due to its nature. It is attacked by number of foliar pathogens which are becoming serious with the increase in area under poplar agro-forestry system. Leaf spots caused by Drechslera maydis, Pseudocercospora sp., Myrothecium roridum and Cercospora populina have gained importance, especially in the nursery and have been consistently occuring in moderate to severe form for last 5-6 years. These leaf spots cause premature defoliation resulting into poor health of the plant. Pseudocercospora sp. is a new record on poplar. The spots are dark brown in colour with a central raised dot and are round to irregular in shape. The spots usually coalesce with each


60

other to cover larger leaf area, giving blighted appearance. It can also cause necrosis of the veins along with the foliar tissue. During the months of August-September incidence and intensity of the spots is very high due to hot and humid weather conditions. To identify the promising poplar clones against the prevalent foliar pathogens, twenty five poplar clones at Phillaur and Badbar nurseries of Punjab forest department were evaluated. In the experimental area of the department of forestry and NR, PAU, Ludhiana, twenty poplar clones were also screened against these spots under natural infection conditions. Out of 25 clones screened at Phillaur and Badbar, S7C1 poplar clone was free from infection and L 70/82 clone was having 0.5 disease score (using 0-5 scale). Seventeen clones were moderately susceptible and had average disease score varying from 1.0 to 2.0 while remaining six were susceptible with the score varying from 2.0 to 3.5. Out of the poplar clones at PAU, two clones i.e. FNR 318 and FNR 50 were found promising. Three clones FNR 55, FNR 357 and FNR 405 were moderately susceptible and were having the disease score varying from 1.0 to 2.0 and the remaining fifteen were susceptible with score varying from 2.04 to 4.38.

062 Performance of some varieties against different diseases of pea in Lahaul valley –

a cold desert area of Himachal Pradesh

PARDEEP KUMAR, A.R. KHAN, S. SHARMA, S.K. SHARMA, B.S. MANKOTIA, L.K. SHARMA and J. CHAND CSK HPKV, Krishi Vigyan Kendra Lahaul & Spiti at Kukumseri (HP)-175142.

Garden pea (Pisum sativum L.) is most remunerative crop of Lahaul valley of Himachal Pradesh. The crop is grown as an off - season cash crop during summer season (April to September) and is cultivated over an area of about 1690 ha with an average productivity of 58.42 q/ha. Due to extensive cultivation the diseases like root rot/wilt complex, powdery mildew and white rot causes significant reduction in the yield and quality of harvested peas throughout the production areas of some parts especially in tribal area (Zone IV) of the state. Keeping in view the status of these destructive pathogens the trial was designed to see the performance of different pea varieties viz., Ageta, Lincon, Arkal, Palam Priya and Azad P-1 against these diseases during 2007 and 2008 at the farm of Krishi Vigyan Kendra. Pooled data of two years showed that among all the tested varieties, Ageta variety resulted minimum disease incidence of root rot/wilt (17.5%) followed by Lincon (20.0%), Arkal (26.4%), Palam Priya (26.8%) and Azad P-1(34.6%). The white rot disease incidence was maximum in Azad P-1(10.0%) and minimum in Palam Priya (4.5%) whereas powdery mildew severity was highest in Arkal (26.3%) and lowest in Palam Priya (10.0%). Highest yield 82q/ha was recorded in Ageta variety and lowest in Azad P-1 (66.5q/ha) but the No. of pods per plant were maximum in Azad P-1 (27.0) and minimum in Arkal (18.5).

063 Identification of resistance sources against bean anthracnose and angular leaf

spot

S.K. SHARMA, A.PATHANIA and S.KUMAR CSK HPKV, Mountain Agriculture Research and Extension Centre, Sangla, Kinnaur (HP).

Email. [email protected]

One hundred eighteen germplasm accessions of rajmash were evaluated against bean anthracose (Colletotrichum lindemuthianum) and angular leaf spot (Phaeoisariopsis griseola) diseases in augmented block design during 2010 and 2011 Kharif seasons under natural epiphytotic conditions at Mountain Agriculture Research and Extension Centre, Sangla, a hot spot for both the diseases. Out of one hundred eighteen lines, 19 and 22 accessions were found resistant to bean anthracnose while 16 and 40 genotypes showed resistance to angular leaf spot during both the seasons. Seven accessions namely KR-64, Sarahan Local, KR-29-2, KR 272, KR-253-A-1, AER-234 and one exotic accession EC613123 were found resistant to both the diseases during two years. Screening of resistant lines under artificial epiphytotic conditions was suggested before using them as resistant donors in different breeding programmes.


61

064 Screening of Gladiolus cultivars for Fusarium resistance

PUJA SHARMA, S.R. DHIMAN, Y.C. GUPTA, B.KASHYAP and H.R. GAUTAM* Department of Floriculture and Landscaping,*Department of Mycology and Plant Pathology,Dr YS Parmar University

of Horticulture and Forestry, Nauni, Solan (HP)-173 230. Email:[email protected]

Thirty commercial cultivars of gladiolus were evaluated and screened for incidence of Fusarium oxysporum f.sp. gladioli during Feb-July, 2012. Corms of these cultivars were planted on raised beds at 10 x 30 cm distance accommodating 30 corms/m2. The incidence of Fusarium was recorded 3.5 months after planting and per cent disease incidence was calculated. The cultivars are divided into three groups depending upon their disease reaction to Fusarium attack i.e. Group I ( Resistant: showing no mortality due to fusarium), Group II ( Fairly resistant: showing upto 5% mortality due to fusarium) and group III (Low resistant: showing more than 10% mortality due to Fusarium).The cultivars belonging to Group I are; ‘White Giant’, ‘Top Brass’, ‘Punjab Dawn’, ‘Jyotsna’, ‘Mayur’, ‘Morallo’, ‘Teach - In’ and ‘Wind Song’. The cultivars of Group II i.e. showing upto 5% mortality include ‘Pascal’, ‘Bis-a-Bis’, ‘Tiger Flame’, ‘Her Majesty’, ‘Nova Lux’, ‘Super Star’, ‘Sagar’, ‘American Beauty’, ‘Amsterdom’, ‘Sylvia’, ‘Swarnima’ and ‘Red Ginger’. Whereas Group III i.e. high disease incidence group comprises of ‘Tilak’, ‘Interpid’, ‘Vink’s Glory’, ‘Candiman’, ‘Shagun’, ‘Red Majesty’, ‘Advance Red’, ‘Shakti’, ‘Shobha’ and ‘Red Beauty’. Highest Fusarium incidence was recorded in cv. ‘Red Beauty’ which showed a mortality of 31.66%. Various growth and flowering parameters affected due to disease incidence are also discussed in detail.

065 Primary evaluation of chrysanthemum varieties against powdery mildew (Erysiphe cichoracearum) in dry temperate zone RAJESH THAKUR, BHUPESH K. GUPTA and SEEMA THAKUR* Dr YS Parmar University of Horticulture and Forestry, KVK Kinnaur at Reckong Peo, Kinnaur – 172 107 (HP), *VRS,

Kalpa, Kinnuar (HP)

Fourteen varieties of chrysanthemum were planted in Kalpa village of the dry temperate zone of Himachal Pradesh in the first week of June. These were observed for the incidence of powdery mildew (Erysiphe

cichoracearum). Ten randomly selected plants were observed for disease incidence. The disease incidence varied between 0 to 70 percent. The maximum disease incidence (70%) was recorded in Nanako variety followed by Ajay (60%). Where as Neelima and Birbal Sahni showed forty per cent disease incidence. No disease incidence was recorded in Fiji Yellow, Yellow Star, Poornima, Tata Century, Yellow Ball, Thaichin Queen, White Bouquet, Surf, Aderson Sympson and Discovery. Thus this preliminary work clearly indicates that Nanako, Ajay, Birbal Sahni and Neelima are susceptible to the disease.


62

Chemical methods in Plant Health Management

066 Nativo75WG-A new fungicide molecule for the control of yellow rust of wheat

DHANBIR SINGH and SAVITA SHARMA CSK HPKV, Hill Agricultural Research and Extension Centre, Dhaulakuan, Sirmour- 173001 (HP).

Yellow rust (Puccinia striiformis) of wheat is one of the devastating diseases in Northern states of India. It causes considerable losses in wheat production in terms of both quantity and quality. Many wheat cultivars possessing good degree of resistance have been released for cultivation in various parts of the country. However, effectiveness of resistance has been short lived due to frequent appearance and shift of virulent pathotypes. Chemical control of plant disease is an integral part of plant disease management. Therefore, there is an urgent need to find out new potent chemicals which can be effectively used in the yellow rust management package. Keeping in the view, the field experiments were conducted during rabi season of 2010-11 and 2011-12 at Experimental farm of CSKHPKV, Dhaulakuan to evaluate the field bio-efficacy of fungicides. A new fungicide, Nativo 75 WG (trifloxystrobin + tebuconazole 75 WG) @ 0.6g / l resulted in complete control of yellow rust and protected the yield losses. Contaf and Tilt also found effective in reducing the diseases severity.

067 Baseline sensitivity in Marssonina coronaria causing premature leaf fall of apple

to fungicides in Himachal Pradesh

ARJUN SINGH and J.N. SHARMA Department of Plant Pathology, Dr YS Parmar, University of Horticulture and Forestry, Nauni, Solan (HP).


Baseline sensitivity of wild isolate of Marssonina coronaria after 24 hours of incubation it ranged from 0.704µg/ml in copper oxychloride to 0.966 µg/ml in Propineb. Similarly, after 48 hours of incubation it ranged from 0.712 µg/ml in carbendazim to 0.980 µg/ml in mancozeb. Minimum Inhibitory Concentration of wild isolate ranged from 80 to 160 ppm in non-systemic and 80 ppm in systemic fungicides, which showed different levels of sensitivity to different fungicides. Ten different fungicides, viz. mancozeb, zineb, propineb, captan, dodine, metiram, chlorothalonil, copper oxychloride, carbendazim and thiophanate methyl were evaluated at different concentrations (5 to 160 ppm) for their sensitivity against five different isolates collected from Shimla district of Himachal Pradesh. All fungicides tested against different isolates were moderate to highly sensitive in respect of premature leaf fall of apple. Resistance Factor shown by fungicides increased 1 to 2 times from the baseline value, however, it did not reveal development of resistance against commonly used fungicides, which means that the isolates were still sensitive to these fungicides. On the basis of sensitivity and MIC shown by different fungicides, it concluded that dodine followed by carbendazim, metiram, chlorothalonil, propineb, mancozeb, thiophanate methyl and zineb were highly effective in controlling Marssonina coronaria causing premature leaf fall of apple while, copper oxychloride and captan were less effective against different isolates collected from Shimla district of Himachal Pradesh.

068 Studies on physical mode of action of fungicides against Marssonina blotch

causing premature leaf fall in apple

ANIL KUMAR and J.N. SHARMA Department of Plant Pathology, Dr YS Parmar, University of Horticulture and Forestry, Nauni, Solan (HP).


Fifteen different fungicides, viz. mancozeb, captan, dodine, copper oxychloride, metiram, benomyl, carbendazim, thiophanate methyl, shield, Kresoxim methyl, azoxystrobin, pyraclostrobin, hexaconazole, difenoconazole and tebuconazole were evaluated at different concentrations for their physical mode of action. Whereas, nine fungicides, viz. mancozeb, kresoxim methyl, carbendazim, difenoconazole, metiram,


63

thiophanate methyl, dodine, shield and pyraclostrobin+metiram were selected for such study in the field. Dithiocarbamate fungicides provided maximum control of Marssonina blotch disease with more effect on conidial production, germinability and viability after their protective applications on apple plants both under semi-controlled as well as under field conditions. Mancozeb formulations also showed maximum retention activity as compared to other fungicides, and registered maximum control of the disease. Strobilurin fungicides showed the strongest curative, pre-symptom and post-symptom activity against Marssonina blotch in semi-controlled as well as under field conditions. These fungicides showed inhibitory effect on conidial production, germinability and number of viable conidia as compared to other test fungicides. On the basis of prophylactic rating, dithiocarbamate fungicides were most effective protectants against Marssonina blotch of apple. The after-infection, pre-symptom and post-symptom activity of strobilurins, benzimidazoles and triazoles exceeded that of their protective activity. Strobilurin fungicides were rated best (with 1-3 rating) followed by the benzimidazoles in this respect. In field, pyraclostrobin+metiram attained the highest rating (1) followed by kresoxim methyl, carbendazim, thiophanate methyl, dodine, difenoconazole, mancozeb, shield and metiram.

069 Effectiveness of fungicide formulations for the control of various foliar and fruit diseases of apple

PANKAJ GUPTA and V.S.THAKUR Dr YS Parmar University of Horticulture & Forestry, Regional Horticultural Research Station, Mashobra, Shimla-

171007 (HP). Email: [email protected]

Different fungicide formulations namely Hindustan M-45, Stuff, Hydroman, Eurafil NT, Cabrio Top, FIL 001, Manfil, Governor, Boscalid, Trifloxystrobin, Benofit, Avtar, Wave, Batista, Nativo, Cuman L, Indofil Z-78, Captan, Bavistin, Indofil M-45, Bavistin+Indofil M-45, Companion and Contaf at different concentrations were sprayed starting from petal fall stage separately at 20 days interval at RHRS, Mashobra. For testing their effectiveness against scab, premature leaf fall and other associated diseases of apple along with any undesirable effect (phytotoxicity etc.) during the year 2011. Each fungicide was sprayed separately at different dosages on three trees starting from petal fall stage to 20 days prior to harvest at 20 days interval. In all, eight sprays were given. In control trees, only water was sprayed. The observations were recorded before applying each spray. The observations recorded at the time of harvest did not reveal the presence of apple scab, Alternaria blight even in control trees. No phytotoxicity was recorded on leaves in any of the treatments. All the fungicides exhibited control of Marssonina blotch to a varying extent. The fungicide formulations namely, Hindustan M-45 (0.30), Stuff (0.30), Hydroman (0.50), Eurafil NT(0.50), Cabrio Top(0.10), FIL 001(0.06), Manfil(0.30), Governor (0.05), Boscalid (0.03), Trifloxystrobin(0.03), Benofit(0.10), Avtar(0.30), Wave (0.0175), Batista (0.06), Nativo (0.04), Cuman L (0.30), Indofil Z-78 (0.30), Bavistin (0.05), Bavistin +Indofil M-45 (0.25) and Companion (0.25) gave maximum control of the disease. However, these fungicides at lower concentrations gave less control of the disease. Avtar followed this at 0.15 percent concentration where 79.61 percent disease control was achieved. Phytotoxicity studies were also undertaken and it was observed that no phytotoxicity on leaves as well as on fruits were observed even at higher doses of fungicides under test.

070 Occurrence of Alternaria blight on apple in Himachal Pradesh and its

management

SHALINI VERMA, J.N. SHARMA1, DHARMESH GUPTA1 and N.C. SHARMA

Temperate Horticultural and Research Station, Kotkhai, Shimla, Himachal Pradesh 171202, 1Department of Plant

Pathology, Dr YS Parmar University of Horticulture & Forestry, Nauni, Solan, Himachal Pradesh 173230.


Apple is one of the most important fruit crops of Himachal Pradesh and the economy of the state primarily depends upon this highly remunerative crop. Every season, the crop is suffered from Alternaria leaf spots in wet climate and has been appearing in moderate to severe form. It suddenly assumed an alarming situation in


64

the apple orchards during 2011. Leaf spot infection started early in the season lead ultimately to premature defoliation. The infected leaves produced reddish brown necrotic lesions. The diffusion of reddish brown pigmentation also observed surrounding the necrotic lesions. Spots coalesced to form larger brown patches giving it a blighted appearance, ultimately resulting into withering and defoliation of leaves. Due to disease, the development of leaves was checked and yields severely affected. As rainy weather prevailed, fungus caused inconspicuous fruit symptom, similar to cork spot (calcium deficiency). It produced small, circular, often zoned spot with a very tiny black spot at the centre on the fruits. The incidence of fruit infection was re la t ive ly low but in heavily defoliated orchard, fruit infection was recorded upto 35 per cent. Necrotic diseased spots on fruits and leaves yielded species of Alternaria. Based on morphological characters fungus was identified as Alternaria alternata. Protective sprays of dodine, mancozeb, dodine + hexaconazole, carbendazim + mancozeb and pyraclostrobin + metiram were found quite effective against the disease in the field.

071 Fungicidal management of Alternaria leaf spot of apple

SHALINI VERMA and I.M.SHARMA1

Apple Scab Monitoring and Research Laboratory, Kotkhai, Shimla- 171202, 1Department of Plant Pathology, Dr YS

Parmar University of Horticulture & Forestry, Nauni, Solan, HP- 173230. Email: [email protected]

Alternaria leaf spot of apple caused by Alternaria alternata (Fr.) Keissler is the most destructive foliar disease of apple causing huge losses due to mid season defoliation. Different brands of fungicide formulations were tested against this disease at Kotkhai, Himachal Pradesh. Among the test fungicides: Superstar (dodine), Hindustan M-45 (mancozeb), Eurofil NT (mancozeb flowable, Hydroman (mancozeb flowable), FIL 001 (dodine + hexaconazole), Stuff (carbendazim + mancozeb), Cabrio Top (pyraclostrobin + metiram), Ergon (kresoxin methyl), Super –75 (captan + hexaconazole) and Governor (flusilazole) were found quite effective against Alternaria leaf spot of apple in comparison to control. However, Kitazin, Proquinazid and Batista were not effective against the disease.

072 Evaluation of different combinations of fungicides for the management of premature leaf fall (Marssonina coronaria) in apple

USHA SHARMA and N.S. KAITH Krishi Vigyan Kendra Shimla at Rohru, Shimla (HP). E mail: [email protected]

Premature leaf fall in apple caused by Marssonina coronaria is well known for causing huge losses to apple production in district Shimla of Himachal Pradesh. The disease starts appearing in the month of May-June, and by the mid of August, most of the unprotected or unsprayed orchards are severely affected with typical leaf spotting and falling of leaves and ultimately fruits near maturity are generally seen hanging from defoliated branches. Management of disease is dependent on a fungicidal spray schedule, which is finalized and recommended to the growers. At each stage of spray, choice of different fungicides is given for spraying. In the present studies, sprays with different combinations of recommended fungicides were tested to evaluate the disease management with each combination at different locations of the district with an aim to popularize the technology through demonstration. All the fungicides sprayed in three different combinations during 2008-09, 2009-10 and 2010-11 were found effective in the management of premature leaf fall at different locations. However, in 2011-12 and in 2012-13, the sprays with a fungicide combination of mancozeb 500g+ carbendazim 100g at walnut stage followed by propineb 600g at fruit development stage (20 days after previous spray), dodine 150g at fruit development stage (20 days after previous spray) and carbendazim 100g at pre-harvest (20-25 days before harvest) were found to be the best combination in 20 different locations of the district with 90 percent disease control.


65

073 Efficacy of various fungicides against Marssonina blotch of apple

SHALINI VERMA and I.M. SHARMA1

Apple Scab Monitoring and Research Laboratory, Kotkhai, Shimla- 171202 1Department of Plant Pathology, Dr YS

Parmar University of Horticulture & Forestry, Nauni, Solan HP- 173230. Email: [email protected]

Marssonina blotch, incited by Marssonina coronaria (Ell. & J.J. Davis) J.J. Davis is mainly responsible for premature leaf fall in apple. It is the most destructive foliar disease of apple causing huge losses due to mid season defoliation. The spray applications of various fungicides were evaluated under field conditions for managing the disease at Kotkhai, Himachal Pradesh. Among the test fungicides, dodine, carbendazim + mancozeb, kresoxin methyl, mancozeb, pyraclostrobin + metiram, mancozeb flowable and dodine + hexaconazole were found to be quite effective against Marssonina blotch of apple in comparison to control.

074 Management of collar rot (Phytophthora cactorum) in apple

N.S. KAITH and USHA SHARMA Krishi Vigyan Kendra Shimla at Rohru, Shimla (HP)-171 207. Email: [email protected]

Collar rot in apple caused by Phytophthora cactorum is becoming a major threat in the cultivation of crop. The incidence of disease is upto 50 per cent in the orchard of district Shimla, Himachal Pradesh (India). During 2008-2009 and 2009-10, location specific trials were conducted in apple orchards of district Shimla for the management of collar rot, which included three drenching in rainy season with Bordeaux mixture @1.0%, copper [email protected] %, mancozeb @0.4% and matalaxyl (8%) + mancozeb (64%) @0.4% with Bordeaux mixture @1.0% i.e. two drenching of matalaxyl (8%) + mancozeb (64%) @0.4% and one with Bordeaux Mixture @1.0%. Beside fungicides drenching, cultural practices were improved i.e. improvement in water drainage system in tree basin, opening of collar region of affected plant and removal of infected portion of roots with application of Chaubatia paste on open cuts. Among all the treatments, maximum percent lesion healing i.e. 35 percent after 1st year of treatment was observed in plant drenched with matalaxyl (8%) + mancozeb (64%) @0.4% with Bordeaux mixture @1.0% and after three years complete lesion healing was found. Further in 2011-12 and 2012-13, treatment with (matalaxyl (8%) + mancozeb (64%) with Bordeaux mixture @1.0% was given in more other orchards in parts of district Shimla and again it was found very effective for management of the disease and curing of plants.

075 Control of storage decay fungi of apple with chemicals and antagonists

DINESH PRASAD, K. P. SINGH and R. K. PRASAD College of Forestry & Hill Agriculture, G. B. Pant University of Agriculture & Technology, Hill Campus, Ranichauri-

249 199, Uttaranchal, INDIA e-mail [email protected]

Apples have already been linked to potential health benefits ranging from reduced risk to lung cancer to lower cholesterol. But now scientists have proof that eating apple can also help fight cancer. Three important commercial cultivars of apple namely, Red, Royal, and Golden Delicious were screened against post-harvest rot causing fungi. The major fungal pathogens Trichothecium roseum, Penicillium expansum, Glomerella

cingulata, Botrytis cinerea and Monilinia spp. were responsible for fruit decay in storage. Red Delicious was recorded to be highly susceptible to most of the post-harvest pathogens. Post harvest sprays of flusilazole (0.015%) bitertanol (0.075%) and carbandazim (0.05 %) were effective in controlling storage scab and other rotting fungi. Biocontrol agents effective against P. expansum and B. cinerea were isolated from apple leaves, and a quantitative relation between antagonists and pathogens inoculum concentration was determined


66

076 Effects of water stress on wheat plants and its amelioration by application of Indole Acetic Acid (IAA)

B.K. SINHA1, SONIKA JAMWAL,2 S.A. MALLICK1, REENA2 and M. GUPTA2 1 Division of Biochemistry and Plant Physiology SKUAST-J, Chatha, Jammu-180009, 2 Dryland Research Sub Station,

SKUAST-J, Dhiansar, Bari Brahmana, Jammu-181133. Email: [email protected]

Effects of water stress on wheat plants (Triticum aestivum L.) and its amelioration by application of IAA were investigated. Two varieties (PBW-343 and RSP-81) and five gradual concentrations of IAA viz., 0, 5, 10, 20, 30 and 40 ppm were taken. Different concentration of IAA were applied at the appearance of incipient wilting at three important stages viz., tillering (stage I) milking (stage II) and tillering + milking(stage I+II). It was found that exogenous application of IAA @ 20 ppm shows significant results in amelioration of drought stress irrespective of all the three stages. Relative water content (RWC), chlorophyll content, total soluble sugar (TSS) and proline content were observed significantly higher irrespective of variety and stages. While in RSP-81, 10 & 30 ppm was also noticed RWC at par with each other at all the stages and it was found that PBW- 343 shows higher chlorophyll content @40ppm sprayed plants in stage I+II. Grain yield were also observed maximum in 20 ppm sprayed plants in both varieties whereas 30 ppm increases yield in RSP-81. Higher concentration of IAA neither showed significant growth promoting activity nor inhibiting activity.

077 Management of chickpea wilt caused by Fusarium oxysporum f. sp. ciceri with

chemicals and botanicals

SONIKA JAMWAL1, ANAMIKA JAMWAL2, V.K. SINGH1, REENA1 and B.K. SINHA3 1Dry land Research Sub-Station Dhiansar, Bari-Brahmana)-181133 (SKUAST-J), 2 Krishi Vigyan Kendra, Kathua

(SKUAST-J), 3Division of Biochemistry and Plant Physiology SKUAST-J, Chatha, Jammu-180009.

Email: [email protected],

Chickpea is one of the most important pulse crop, is affected by many diseases. Chickpea wilt incited by Fusarium oxysporum f. sp. ciceri is one of the severe disease causes heavy losses (20-100%) depending upon stage of infection and wilting. Minimizing this disease can only be accomplished by careful crop management. In this context an investigation was conducted to diminish wilt chickpea by use of chemicals and botanicals. Seed treatment with three fungicides viz. Bavistin, Captan, Thiram @ 2gm /kg seed and three plant extracts viz. Allium sativum, Neem bark extract, Neem leaf @ 5% were evaluated against Fusarial wilt of chickpea caused by Fusarium oxysporum f. sp. ciceri. Comparative analysis of various treatments revealed that seed treatment with Bavistin at the time of sowing showed minimum wilt incidence 3.0% followed by Thiram 4.8%. All the chemical seed dresser and plant extract seed dresser tested were found significantly superior over untreated control in reducing the disease incidence and increasing the yield. Among all the treatments Bavistin was the best treatment in reducing the wilt incidence of chickpea. Maximum root length (9.20cm), shoot length (25.50cm), root weight (3.60g) and shoot weight (10.86g) was recorded with Bavistin as compared with uninoculated control.

078 Evaluation of fungicides against anthracnose or fruit rots of chilli

R.K. YADAV, I.S. TOMAR, J. MORYA and M. SINGH Zonal Agriculture Research Station (RVSKVV), Jhabua (MP).

Chilli (Capsicum annuum L.) is one of the important spice/vegetable/cash crop grown in India. It is grown for its pungent fruits which are used both as green and ripe to impart pungency and flavour to the food. Chilli suffers from many diseases caused by fungi, bacteria, viruses, nematodes and also abiotic stresses. Among the fungal diseases anthracnose or fruit rot caused by Colletotrichum capsici (Sydow) Butler and Bisby is a wide spread problem limiting the profitable cultivation throughout the major chilli growing regions of India. Losses due to anthracnose of chilli varied between 66-84 per cent. So the present study was undertaken to


67

investigate the efficacy of different fungicides viz., mancozeb 75%WP, azoxystrobin 23%SC, hexaconazole 2% SC, carbendezim50%WP and chlorothalonil 75%WP against anthracnose or fruit rot of chilli in Jhabua, Madhya Pradesh. The experiment was conducted at ZARS, Jhabua during the year 2010- 2011. Results indicated that the foliar spraying of azoxystrobin @ 125g a.i./ha (PDI 1.7) recorded the minimum severity of the anthracnose disease which was at par with chlorothalonil @ 600g a.i./ha (PDI-1.87). The spraying of the carbendazim @ 150g a.i./ha and mancozeb @ 600g a.i./ha recorded PDI 3.1 and 3.5, respectively and proved the next best effective treatments which was however found superior to the treatment of hexaconazole @ 60g a.i./ha (PDI 4.0). The data on fruits rots of chilies revealed the similar results with maximum control of disease by the treatment of azoxystrobin 23%SC @ 125g a.i./ha (PDI 3.4) which was at par with chlorothalonil 75%WP @ 600g a.i./ha (PDI-4.8) i.e. 85.7 -79.7 % reduction in disease over control. Carbendazim @ 150g a.i./ha (PDI-8.4) proved next best treatment against chilli fruit rot which found at par with mancozeb @ 600g a.i./ha (PDI-8.8) during the season but significantly superior to hexaconazole @ 60 g a.i/ha(PDI 12.0).

079 Management of chickpea (Cicer arietinum L.) wilt and pod borer through

intercropping and pesticides

ANAND SINGH, ANJANA THAKUR and SANJAY KUMAR CSK Himachal Pradesh Krishi Vishvavidyalaya, Krishi Vigyan Kendra, Hamirpur (HP).

Management of chickpea wilt and pod borer (Helicoverpa armigera) through seed treatment (ST), intercropping of chickpea with wheat, coriander, mustard, linseed and garlic (6:2) and by spraying with insecticides was studied during 2007-2009 in Rabi season. Sole chickpea crop showed higher disease incidence and pod borer infestation and yield loss compared to intercropping of chickpea with all other crops. The highest equivalent chickpea yield (1925 kg/ha) obtained from chickpea intercrop with linseed alongwith ST with Bavistin+thiram (1:1) @3g/kg of seed and two spray of cypermethrin at flowering and podding stage followed by intercrop with garlic (1850 kg/ha). The wilt incidence and pod borer infestation was also less in these treatments. The yield in sole crop of chickpea along with ST and two spray of cypermethrin was 1065kg/ha.

080 Evaluation of fungicides and botanicals for management of urdbean (Vigna

mungo (L.) Hepper leaf spot

ANAND SINGH, SANJAY KUMAR and C.L.CHAUHAN CSK Himachal Pradesh Krishi Vishvavidyalaya, Krishi Vigyan Kendra, Hamirpur, (HP).

Attempts were made to manage the leaf spot of urdbean (Vigna mungo (L.) Hepper an important disease of the crop caused by Cercospora spp. Resulting yield loss up to 30-40 percent. Seven fungicides and two botanical oils when tested with potato dextrose agar medium, five chemicals and one oil showed high sensitivity against Cercospora canescens. No mycelial growth or sporulation was recorded under these treatments. All the treatments were imposed under field condition using variety UG 218 to assess the efficacy of the selected fungicides and oils. Propiconazole was recorded to be the most effective chemical when sprayed at 35 DAS (flowering stage) 50 DAS (pod formation stage). Disease scored as percent disease index (PDI) at 15 days after final spray (grain filling stage). Maximum PDI was recorded with propiconazole (32.71) followed by carbendazim (41.14), while PDI in case of control plot was 60.85. Captafal and copper oxychloride were found to be less effective fungicides against the disease and PDI recorded was 52.92 and 48.52 respectively. Among the botanicals Neem oil showed good performance against the disease and PDI recorded was 42.50 and is at par with the thiram (41.60). With regard to grain production, propiconazole yielded the maximum (1150 kg/ha) followed by carbendazim (1080 kg/ha).


68

081 An attempt to control the foam disease of citrus in sub-tropical zone of Himachal Pradesh

RAJEEV RAINA, AJAY KUMAR and ANJULY SHARMA* Dr Y S Parmar University of Horticulture & Forestry, Krishi Vigyan Kendra, Chamba, * Directorate of Extension

Education, CSK HPKV, Palampur. Email: [email protected]

Recently, the citrus industry of Himachal Pradesh has been threatened by foam disease causing great economic losses resulting in less productivity and longevity of trees. Foam disease affected plants show exudation of white foam from longitudinally cracked lesions in the bark of stem and branches. The wood underneath the affected portions turned brown and emits a characteristic smell. This exudation is totally different from the gummosis of Phytophthora. The foliage of affected trees exhibited the deficiency symptoms of micro-nutrients like Zinc, Iron, Magnesium, Manganese etc. These symptoms were more severe in June and September. The incidence was recorded maximum on Nurpur Local and Srinagar varieties of orange mandarin ranging from 10 to 45 per cent followed by Kinnow Mandarin (5 to 15%). Whereas rarely observed on lemons. In the present investigations, attempts were made to find out the suitable control strategies to combat the arising problem. In one set of experiment different salts of micronutrients viz., ZnSO4(0.5%), MnSO4(0.3%), FeSO4(0.5%) and MgSO4(1.0%) were sprayed alone or in combination and in another set of experiment, different fungicides viz., Blitox (0.3%), Ridomil MZ (0.25%), Antracol (0.25%) and Aliette (0.2%) were sprayed before and after monsoon. In first experiment, the percent control of foaming lesion was obtained maximum with the treatments having Zinc (26.2%) and Iron (22.6%), but not to the extent of significance. In second set of experiment, the maximum control of foaming lesions (54.6%) was obtained with Aliette (0.2%) followed by Ridomil MZ (49.3%). However, in next trial the micronutrients ZnSO4 (0.5%) + FeSO4 (0.5%) were sprayed on all the trees under study along with four fungicides used in the second experiment at an interval of 10 days before and after monsoon. The treatment having the combined spray of Aliette and ZnSO4 (0.5%) + FeSO4 (0.5%) has maximum controlling effect on foaming lesions (80.4%) followed by Antracol (0.25%) and ZnSO4 (0.5%) + FeSO4 (0.5%) which recoded 64.7 per cent control of foaming lesions.

082 Productivity based nutrition for judicious use of fertilizers: a tool for better health management in stone fruits

VISHAL S. RANA, A.S. REHLIA and NEERJA RANA Department of Fruit Science, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan (HP) 173230


Plant growth as well as quality production of stone fruits is dependent upon the various factors such as suitable temperature and light conditions, proper moisture, aeration, fertilizer application, insect, pests and diseases. Among these factors, fertilizer application has direct influence on the fruit yield and quality. At the same time, the consideration of pollution hazards makes it imperative that fertilizers should be used judiciously to maintain optimum level of nutrients in the plants and soil to get yield of high quality fruits. Balanced nutrition results not only in efficient and economic use of fertilizers but also results in better plant health. Keeping all these points in view, a study was undertaken to elucidate the productivity based nutrition in plum, apricot and peach orchards under mid hill of Himachal Pradesh. Three naturally suitable districts, representing mid hill zone of Himachal Pradesh viz; Kullu for plums, Solan for apricot and Sirmour for peaches were selected for laying out the experiment. Fifteen best performing orchards in the respective fruit growing regions were selected according to multistage random sampling technique and in each orchard; ten uniform and healthy trees were selected for soil and fruit sampling. A specially designed questionnaire was prepared and data pertaining to the package of practiced actually being followed by these orchardist were recorded. The soil and leaf samples of the selected orchards were collected and analysed in the laboratory. The data on fruit yield and quality characteristics were also collected from these sites. The study revealed that leaf analyses in each year and soil analyses in every alternate year is essential for balanced application of


69

fertilizers. Based on the survey of better performing peach, plum and apricot orchards, sufficient range of nutrients were developed for fertilizer recommendation.

083 Evaluation of fungicides and plant extracts against anthracnose, fruit spot and rot

diseases of pomegranate

KISHORE KHOSLA Dr YS Parmar University of Horticulture & Forestry, Horticultural Research Station, Seobagh, PO Neoli-175 138 Distt

Kullu (HP). Email: [email protected]

During last decade, the pomegranate (Punica granatum L.) cultivation has witnessed a tremendous growth potential in mid-hill zone of Kullu and Mandi districts of Himachal Pradesh. Its cultivation has now spread to other parts of the state and presently around 1200 ha area is under its cultivation. Unfortunately, the crop is adversely affected by various foliar (leaf spots), fruit (spots and rots) and soil borne (wilt) diseases resulting into huge losses to the growers. Amongst the fruit diseases, the anthracnose (Colletotrichum

gloeosporioides), fruit spots (Cercospora punicae) and rot (Botrytis cinerea) are economically important diseases. The pathogens were isolated on PDA and pure cultures were got identified from NCFT, New Delhi. To find out suitable chemicals and phytochemicals for developing integrated spray schedule for field evaluation against these pathogens, In vitro evaluation of 11 different fungicides against Cercospora punicae and Botrytis cinerea and 12 fungicides against Colletotrichum gloeosporioides at recommended doses and 9 freshly prepared plant extracts at 10 and 15 percent concentrations was done by poisoned food technique. The experiments were repeated twice with three replications for each treatment. Amongst the fungicides, combi products of captan and hexaconazole (0.05%), zineb and hexaconazole (0.15%), hexaconazole alone (0.05%) and kitazin (0.05%) exhibited complete inhibition of mycelial growth of Colletotrichum

gloeosporioides. Carbendazim (0.05%), benomyl (0.05%) and a combi product of carbendazim and mancozeb (0.25%) completely inhibited the mycelial growth of Cercospora punicae. Against Botrytis

cinerea again combi products of captan and hexaconazole (0.05%), zineb and hexaconazole (0.15%) and hexaconazole alone (0.05%) provided complete inhibition. Copper oxychloride (0.3%) treatment was however, least effective against both Cercospora (52.74%) and Botrytis (9.58%). The inhibitory effect of plant extracts increased with the increase in concentrations from 10 to 15 per cent. The leaf extract of Chestnut (Aesculus indica) was most effective against Colletotrichum with 68.25 percent inhibition of mycelial growth but walnut leaf extract was least effective where as Drake (Melia azedarach) leaf extract was effective against Cercospora exhibiting 66.67 percent inhibition while Vitex (V. nigundo) was least effective. Garlic (Allium sativum) extract was highly effective against Botrytis resulting in complete inhibition followed by Chestnut leaf extract.

084 Alternaria leaf spot of pomegranate and its control

VED RAM and DURGA PRASHAD Department of Plant Pathology, Dr YS Parmar University of Horticulture & Forestry, Nauni, Solan-173 230 HP).


The mid hills of Himachal Pradesh provides congenial climate for the cultivation of pomegranate. Besides this pomegranate also provides an opportunity for diversification of fruit crops in mid hills of the state, where presently stone fruits constitute the major part of total fruit production. During survey of pomegranate growing areas of Solan, severity of Alternaria leaf spot was found from 13.4-18.64 per cent. Disease symptoms appeared on both sides of the leaves. Both young and old leaves were found to be infected by the pathogen, yet the young leaves were found to be more susceptible. Initially numerous light brown, marginated, small circular spots appeared on the leaves. Later on, these spots coalesce to form irregular dark brown spots. Infected leaves fell off prematurely. Isolations made from infected leaves yielded a fungus which was identified as Alternaria alternata (Nees: Fr.) Keissl on the basis of morphological characters and it constitute the first report from Himachal Pradesh. Amongst various cultivars, Achikdana and Jodhpur Red were found to be moderately resistant against Alternaria leaf spot, whereas, Sindhuri was found to be highly


70

susceptible. Rest of the cultivars showed susceptible to moderately susceptible disease reaction.Nine fungicides viz. Hexaconazole (0.05%), carbendazim (0.05%), thiophanate methyl (0.05%), mancozeb (0.3%), mancozeb+carbendazim (0.25%), copper oxychloride (0.3%), copper hydroxide (0.3%), captan (0.3%) and ziram (0.25%) were evaluated under field conditions against the disease. Maximum disease reduction was found with hexaconazole (90.57%) fallowed by mancozeb (87.24%), captan (82.96%), ziram (79.36%), mancozeb + carbendazim (77.08%) and copper hydroxide (65.71%). Carbendazim was least effective in controlling the disease.

085 Evaluation of different fungicides for the management of die-back of mango in

Himachal Pradesh

RAKESH K. MANDRADIA, K. JARIAL and V.K. RANA Dr YS Parmar University of Horticulture and Forestry, Institute of Biotechnology and Environmental Science, Neri,

Hamirpur (HP) – 177011. e-mail: [email protected]

Mango (Mangifera indica L.) is second most important fruit crop of Himachal Pradesh after apple. Its cultivation has improved the socio-economic condition of farmers of lower areas. The area under mango cultivation has increased but the production is low. One of the major reasons for low productivity is the losses caused by diseases. Of the various diseases attacking mango, die- back caused by Botryodiplodia

theobromae has been relatively a threat to its successful cultivation in Himachal Pradesh. Five fungicides viz Bordeaux mixture (0.8%), Copper oxychloride (0.3%), Carbendazim (0.1%), Mancozeb(0.25%) and Chlorothalonil (0.2%) were evaluated against the disease under field conditions during 2008 and 2009. Among them, Bordeaux mixture was found to be highly effective against die- back with the disease severity of 9.37 & 11.28 percent during 2008 and 2009, respectively. Copper oxychloride was found to be quite effective with the disease severity of 14.32 and 13.84 percent during 2008 and 2009 as compared to 47.69 and 54.72 percent in control, respectively.

086 Influence of environmental factors on development of grey mould rot in strawberry and its management

I.M.SHARMA and VIJAY KUMAR Department of Plant Pathology, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan (HP) – 173230.


Grey mould rot (Botrytis cinerea Pers. ex Fr.) is most destructive disease of strawberry causing yield losses upto 90 per cent. Survey of target disease (2010-11) indicated that it occurred in moderate to severe form in all strawberry growing districts viz., Solan, Kullu, Mandi and Sirmour of Himachal Pradesh with highest incidence (31.45%) in Dhaulakuan area of district Sirmour. Studies on environmental factors on the development of disease were carried at Regional Horticultural Research Station – Dhaulakuan for two consecutive years 2010 and 2011. Perusal of data indicated that occurrence of low to moderate temperature (15-20oC) accompanied with moderate humidity (65-73%) and minimum sunshine hrs (4-6 hrs) favoured the disease development. Disease incidence was positively correlated with relative humidity (+0.49, +0.66), rainfall (+0.03, +0.12) and negatively with mean temperature (-0.49, -0.61). Multiple regression equation based on meteorological factors was also worked out. Further in management studies, evaluation of eight spray schedules against the target disease indicated that a schedule comprising three consecutive sprays starting with carbendazim (0.05%) with the first appearance of disease followed another two sprays with captan + hexaconazole (0.10%) and carbendazim + iprodione (0.15%) at an interval 14 days was highly effective (PDC 95.8%). Further, evaluation of fungicide along with cultural practices (mulch) revealed that using polythene as mulch along with two consecutive sprays of carbendazim (0.05%) starting with the first appearance of disease at an interval 15 days was most effective (PDC 96.2%) and increased the yield by 49.4 percent.


71

087 Effect of seed priming on the incidence of powdery mildew disease in cucumber (Cucumis sativus L.) cv. K-75

H.C. RATURI, Y.R. SHUKLA, S.K. GUPTA, RAMESH KUMAR and D.K. MEHTA Department of Vegetable Science, Dr YS Parmar University of Horticulture & Forestry, Nauni-173 230 Solan (HP).

Cucumber (Cucumis sativus L.) is an off-season vegetable crop of mid hills of Himachal Pradesh. The crop is sown during May-June as an off-season crop and fruits are available by june-July which are transported to northern plains where they fetch remunerative prices. Early crop is not possible in the hills as the seeds do not germinate owing to low temperature during February-March. However, priming generally overcome the germination problem as the primed seeds germinate quickly even at low temperature. With the onset of monsoon rains, this crop is severely affected by powdery mildew (Sphaerotheca fuliginea) disease which reduce the potential yield drastically. The present studies were therefore carried out to see the effect of seed priming on the severity of downy and powdery mildew diseases in cv. “K-75”. The seeds of cucumber cv. K-75 were primed with 19 treatments in seed germinator at 150 C using different salts, chemicals, fungicide and growth regulators viz. PEG-6000, KH2PO4, Na2HPO4 and GA3, carbendazim (Bavistin 50WP) and distilled water in the year 2010 with two different priming periods i.e. 24 and 48 hours. After priming, the seeds were directly sown in the field in the month of March, 2010. The field experiment was laid out in a Randomized Block Design and each treatment was replicated thrice. The data on disease severity was recorded on 0-4 scale and per cent disease severity was calculated in each treatment. Seed priming reduced the severity of powdery mildew as compared to control and increased fruit yield. Minimum disease severity (22.35%) was recorded in the seeds primed with PEG-6000 -1.5 M Pa for 24 hrs followed by PEG-6000 -1.5 M Pa for 48 hrs. These results clearly indicated that seed primed with PEG-6000 helped preventing serious damage to cucumber crop from powdery mildew disease.

088 Chemical management of Alternaria blight of tomato under protected cultivation

in Himachal Pradesh

D.K. BANYAL, PRIYANKA WALIA and AMAR SINGH Department of Plant Pathology, CSK Himachal Pradesh Krishi Vishvavidyalaya, Palampur -176062.


Tomato is an important vegetable crop grown under protected cultivation in Himachal Pradesh. The main purpose of protected cultivation is to production of quality produce while realizing its maximum potential even in adverse climatic conditions. However, under protected cultivation, tomato is infected by various diseases, of which Alternaria leaf spot (Alternaria solani) is one of the major diseases of tomato crop. Therefore, in the present investigation, to know the prevalence status of Alternaria blight a survey of polyhouses in different districts of Himachal Pradesh was conducted during 2011-2012. Maximum Alternaria leaf spot disease severity (70-80%) was observed in Kangra followed by 30-35% in Mandi and 20-25% in Hamirpur districts. For the development of chemical management of Alternaria leaf spot on tomato an experiment comprising ten fungicides viz; Contaf (hexaconazole), Boon (myclobutanil), Score (difenoconazole), Tilt (propiconazole), Folicur (tebuconazole), Indofil Z-78 (zineb), Indofil M-45 (mancozeb), Bavistin (carbendazim), Sectin (fenamidone + Mancozeb) and Saaf (carbendazim + mancozeb) was conducted during 2011 & 12. Maximum disease control & increase in yield i.e. 80% and 48%, respectively was obtained with Score followed by Folicur (74.2% and 36%), Contaf (72.6% and 36%) and Tilt (56.3% and 39%) as compared to control. Whereas, Bavistin (2.63%) followed by the application of Myclobutanil (17.3%) and Saaf (28.9%), were found least effective in managing the disease. Hence, the disease can be effectively managed with the chemicals like Score (@0.05%), Folicur (@ 0.05%), Contaf (@ 0.1%) and Tilt (@ 0.1%).


72

089 Management of angular leaf spot in French bean

H.R. SHARMA1 and ARTI SHUKLA2

Dr YS Parmar University of Horticulture and Forestry, Horticultural Research Station1 and Krishi Vigyan Kendra

2,

Kandaghat, Solan (HP). Email: [email protected]

In Himachal Pradesh, French bean (Phaseolus vulgaris L.) is grown over an area of 3295 ha with annual production of 39157 MT and Shimla, Solan, Sirmour and Mandi are the leading growing districts. Among the various biotic factors, the angular leaf spot caused by Phaeoisariopsis griseola is the major bottleneck in getting quality produce. A pole type variety ‘Zen’ of Solar seeds was sown at HRS, Kandaghat in the first week of August, 2011 at a spacing of 90x15 cm in a randomized block design with a plot size of 10.92m2 in order to evaluate the efficacy of six fungicides viz., carbendazim (Bavistin), hexaconazole (Contaf), difenconazole (Score 25 EC), propiconazole (Tilt), flusilazole (Folicur) and mancozeb (Indofil M-45) against angular leaf spot. Data on green pod yield and disease severity was recorded. For angular leaf spot, scoring was done on the basis of 0-4 scale at periodic intervals. Maximum pod yield was obtained in difenconazole (0.03%) sprayed plots i.e. 20.23 Kg/plot, whereas, minimum was recorded in mancozeb (0.25%) i.e. 16.60 Kg/plot. However, in the control plots, it was 11.56 Kg/plot. Minimum disease severity was recorded in difenconazole sprayed plots (11.76%) followed by propiconazole (13.70%). Carbendazim and hexaconazole were next in efficacy with a disease severity of 15.33 and 17.05 per cent, respectively. Mancozeb was found least effective with 28.67 per cent disease severity rating.

090 In vitro evaluation of some new fungicides and botanicals against Phaeoisariopsis

griseola causing angular leaf spot of French bean

SANDEEP KANSAL, ADIKSHITA, K.S. THAKUR and NEHA AHLUWALIA Department of Plant Pathology, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan -173230 (HP).


Angular leaf spot (Phaeoisariopsis griseola) is one of the most widely distributed and damaging disease of French bean, causing yield losses as high as 80 percent. The continuous use of conventional selective fungicide proved ineffective in limiting the disease. Thus the present study was carried out to evaluate the in

vitro efficacy of some new fungicides and botanicals. The new fungicides (Kavach, Taqat, Acrobat, Sanit, Sectin & Index) were tested at four different concentration levels (200, 400, 600 & 800 ppm) against the mycelial growth P. griseola. Similarly, the in vitro efficacy of botanicals (dharek, soapnut, garlic, agave, lantana & marigold) at four different concentration levels ( 2.5, 5,7.5 &10.0 percent) was tested against the test fungus. Amongst different fungicides, Index (mycobutanil 10% WP) and Sectin (fenamidone 10% + mancozeb 50% WG) exhibited significantly high inhibitory effect on mycelial growth of P. griseola at all the concentration levels tested. Sanit (metiram 70% WG), Kavach (chlorothalonil) & Taqat (captan 70% + hexaconazole 5% WP) also provided marked inhibition of pathogen at higher concentration (> 200ppm) while Acrobat (dimethomorph 50 WP) provided moderate inhibition at all the concentrations. Amongst the botanicals, the extracts of garlic clove exhibited significantly high inhibition followed by that of marigold leaves, lantana leaves, agave leaves. Extract of dharek seed and soapnut fruit rind also reflected considerable inhibitions on the mycelial growth of the Phaeoisariopsis griseola.

091 Evaluation of fungicides for the management of angular leaf spot and rust in French bean

ARTI SHUKLA1 and H.R. SHARMA2

Dr YS Parmar University of Horticulture and Forestry, Krishi Vigyan Kendra, Solan1, Horticultural Research Station

2,

Kandaghat, Solan (HP). email: [email protected]

French bean (Phaseolus vulgaris L.) is grown over an area of 488 ha with annual production of 7320 MT in Solan district of Himachal Pradesh. The crop is very susceptible to angular leaf spot (Phaeoisariopsis

griseola) and rust (Uromyces appendiculatus). Six fungicides viz., hexaconazole (Contaf), difenconazole


73

(Score 25 EC), propiconazole (Tilt), flusilazole (Folicur), carbendazim (Bavistin) and a new chemical Nativo were evaluated in-vivo for their efficacy against these two diseases in the mid hills of Himachal Pradesh. A field trial was laid out in randomized block design during August- October, 2011. French bean cv. Kandaghat Selection was sown in plots of 4.2x2.6m size in the first week of August and data on disease severity and yield was recorded at periodic intervals. For angular leaf spot, minimum disease severity was recorded in difenconazole sprayed plots (11.3%) which was statistically at par with propiconazole (13.03%). Flusilazole and hexaconazole were next in efficacy reducing disease severity up to 63.9 and 59.7 per cent, respectively. For bean rust, difenconazole followed by hexaconazole were found most efficacious exhibiting 9.42 and 13.2 per cent disease severity, respectively. Propiconazole and flusilazole were next in efficacy with 17.7 and 26.3 percent disease severity, respectively. Nativo and Carbendazim were found the least effective against both the diseases. Maximum green pod yield was recorded in difenconazole sprayed plots (27.59 Kg/plot) followed by propiconazole (25.79 Kg/plot). Minimum yield (17.62 Kg/plot) was recorded in Nativo sprayed plots. However, only 5.75 Kg/plot yield was obtained in control(no spray).

092 Management of downy mildew of cucumber caused by Pseudoperonospora

cubensis (Berkeley & Curtis) Rostovtsev under protected cultivation

D.K. BANYAL, AMAR SINGH and PRIYANKA WALIA Department of Plant Pathology, CSK Himachal Pradesh Krishi Vishvavidyalaya, Palampur -176062


Growing of vegetables under protected environment is becoming popular in Himachal Pradesh taking the advantage of diverse climate and off- season. Cucumber (Cucumis sativus) is one of the most important vegetable grown under protected cultivation. It is affected by large number of diseases causing serious losses to the crop. Downy mildew caused by Pseudoperonospora cubensis is the most destructive and widely prevalent around the year under polyhouse conditions in the state. Therefore, in the present investigation, survey of polyhouses was conducted during 2010 and 2011. During survey it was found that powdery mildew disease severity was 60-70% in Hamirpur, 55-60% in Bilaspur, 40-50% in Kullu, 70-75% in Kangra and 45-60% in Mandi districts. Thirteen different hybrids of cucumber were evaluated for resistance against downy mildew under polyhouse conditions. Among these ten hybrids were found to be susceptible while three hybrids were resistant. An experiment on the chemical management of Downy mildew on Cucumber using nine fungicides viz; Antracol (propeneb), Sectin (fenamidone + mancozeb), Melodyduo (iprovalicarb + propineb), Blitox (copper oxichloride), Ridomil (metalaxyl + mancozeb), Moximate (cymoxanil + mancozeb), Dithane M-45 (mancozeb), Carbio (pyraclostrobin + metiram) and Nativo (tebuconazole + trifloxystrobin) was conducted under protected conditions at Palampur. Maximum Downy mildew control was observed with application of Sectin (71.8%) followed by Ridomil (70.5%), Blitox (66.5%) and Melody duo (62.5%).

093 Intensity and management of purple blotch of onion in subtropical zone of Himachal Pradesh

K. JARIAL, R.C. SHARMA*, R.K. MANDRADIA and DEEPA SHARMA Institute of Biotechnology and Environmental Science, Neri, PO Khaggal, Hamirpur – 177001 (HP), *Directorate of

Research, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan (HP) – 173230.


Purple blotch of onion caused by Alternaria porri is one of the most important diseases of onion in subtropical zone of Himachal Pradesh. The disease starts appearing in the end of March with the rise in temperature in the region. To observe the intensity of this disease in the region, surveys were conducted during 2010-11 and 2011-12 crop seasons. The disease severity in different areas of Hamirpur, Bilaspur, Una and Kangra districts ranged between 10 to 90 per cent. As the disease was very serious in some locations, management trials were also conducted using chemical fungicides. Evaluation studies of six fungicides viz., Lurit (dimethomorph), Kitazin (kitazin), Blitox-50 (copper oxychloride), Ridomil MZ (metalaxyl + mancozeb), Score (difenoconazole) and Indofil M - 45 (mancozeb) against the disease during the two crop


74

seasons indicated that all the fungicides tested, controlled the disease to a significant level as compared to untreated plots where the disease severity recorded and pooled for two years was found to be 80.49 per cent. The mean disease severity was significantly minimum (18.35 %) in the plots sprayed with Lurit which was statistically at par with Blitox - 50 (21.21%) exhibiting 77.20 and 73.51 per cent disease control, respectively. Kitazin, Ridomil MZ, Score and Indofil M - 45 were found to manage the disease up to 69.70, 66.87, 65.13 and 63.14 per cent, respectively as compared to control. Bulb yield was found to be significantly high in all the plots sprayed with fungicides as compared to control.

094 Strategy for the management of bacterial spot of bottle gourd caused by Xanthomonas cucurbitae under low hill conditions of Himachal Pradesh

K. JARIAL, B.S. DOGRA, D. SHARMA, R.K. MANDRADIA and S. KUMAR Dr YS Parmar University of Horticulture and Forestry, Institute of Biotechnology and Environmental Science, Neri,

Hamirpur (HP) – 177 011. Email: [email protected]

To manage the bacterial spot of bottle gourd caused by Xanthomonas cucurbitae, different experiments were conducted at Institute of Biotechnology and Environmental Science, Neri Hamirpur (HP) during 2010, 2011 and 2012. Five effective chemicals viz., zineb, Bodeaux mixture, mancozeb, copper oxychloride and streptocycline selected after in vitro evaluation were evaluated as foliar sprays on bottle gourd grown under field conditions during 2010. Streptocycline treated plants resulted in development of significantly minimum disease severity (28.33%) and maximum disease control (68.45%) followed by copper oxychloride. During 2011, naturally infected seed was treated with streptocycline (100 ppm) and copper oxychloride (3000 ppm) alone and in combination with each other for 1.0, 2.0 and 3.0 hours. Ninety three to 100 per cent seed germination was recorded in all treatments as compared to control (67%). However, the bacterium was isolated from the seeds treated upto 2.0 hours in all the treatments and no bacterium was isolated from the seeds treated for three hours in any treatment. During 2011, effective seed treatments and foliar sprays were evaluated either alone or in combinations under natural epiphytotic conditions on six varieties/ lines / hybrids of bottle gourd viz., CBH-7, CBH-8, CBH-9 (all from Century Seeds), Pusa Manjari, Pusa Summer Prolific Long and a Local Selection. Mean disease severity in all the genotypes of bottle gourd ranged between 33.75 to 35.83 per cent, irrespective of the treatments used. However, irrespective of the bottle gourd genotype, a combination of seed treatment with streptocycline (0.01%) + copper oxychloride (0.3%) for 3.0 h and foliar spray with the same combination resulted in significantly minimum disease severity (20.56 %) and maximum disease control (76.34%) which was statistically at par with seed treatment with streptocycline (0.01%) + copper oxychloride (0.3%) for 3.0 h combined with alternate foliar sprays of streptocycline and copper oxychloride at 10 days interval (20.83 % disease severity and 76.03% disease control). During 2012 crop season, spray interval of two effective treatments was standardised in combination with removal of diseased parts and it was found that above seed treatment followed by the spray of streptocycline (0.01%) + copper oxychloride (0.3%) at 10 days interval alongwith the removal of diseased plant parts proved significantly most effective in managing the disease (78.35% disease control) followed seed treatment plus alternate foliar sprays of streptocycline (0.01%) and copper oxychloride (0.3%) at 10 days interval alonwith the removal of diseases plant parts(75.66% disease control).

095 Persistence and risk assessment of tebuconazole on onion

S.K. PATYAL, R.S. CHANDEL, I.D. SHARMA and R.C. MISHRA Department of Entomology, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan -173 230.

e-mail: [email protected]

Tebuconazole is a broad spectrum systemic triazole fungicide with a protective curative and eradicant activity. It is possible carcinogen and poses endocrine-disrupting effects. The onion (Allium cepa), which is known as the bulb onion or common onion is the most widely cultivated in India and consumed as salad or cooked. Tebuconazole is applied on onion to control important diseases, however also poses a threat of leaving harmful residues on the crop. The present study was undertaken to evaluate the persistence of tebuconazole residues in immature onion bulb with leaves, mature onion bulb and cropped soil following


75

three spray applications. Tebuconazole was applied at single dose 187.5 and double dose 375.0 g a.i.ha-1 on the onion crop. After treatment, samples of green onion (bulb+ leaves) were collected at 0, 3, 5, 7 and 10 days interval, whereas, matured onion bulbs and soil samples were collected at the time of harvest for analysis. Tebuconazole residues were extracted with acetone, partitioned with dichloromethane, cleaned up over silica column and estimated by gas chromatography using electron capture detector. Initial deposits of tebuconazole in immature onion bulb with leaves were 0.651 and 1.096 mg/kg and dissipated with the half-life of 2.3 and 2.9 days, at respective doses. Study suggests the safe pre-harvest intervals (PHI) for consumption of immature onion bulbs as 6.2 and 9.9 days following two respective treatments. The mature onion bulbs were found safe from residues at harvest, owing to tebuconazole residues below the determination limit (0.05 mg/kg) in mature onion bulbs and cropped soil.

096 Persistence of mancozeb residues on table onion bulbs and soil

R.S. CHANDEL, I.D. SHARMA, S.K. PATYAL and A. SHARMA, Pesticide Residue Laboratory, Department of Entomology, Dr YS Parmar University of Horticulture and Forestry,

Nauni-173 230 Solan (HP). Email: [email protected]

The active molecule, mancozeb is a fungicide in a sub- class of carbamate pesticides called dithiocarbamates and is used to protect many fruit and field crops from a wide spectrum of fungal diseases. Mancozeb has been shown to cause adverse health effects to agricultural and industrial workers, however, the exposure of general population to mancozeb and other dithiocarbamates could be higher through residues in food (Rossi et al., 2006). An American agricultural health study, indicated increased incidence of thyroid disease in female spouses of mancozeb pesticide applicators (Goldner et al. 2010). Mancozeb, as a globally important tool in chemical based disease management has been used on various field crops including onion. The aim of present study was, therefore, to study the persistence of its residues in green as well as mature onion, which are generally taken as salad. Mancozeb was applied at standard and double application rate of 1.5 and 3.0 kg a.i. ha-1 on the onion crop in the field. The green onion samples (bulb+leaves) were collected at 0, 1, 3, 5, 7, 10, 15, 20 and 30 days for onion leaves and bulbs and analysed for mancozeb residues. The mature onion and onion cropped soil were analysed at the time of harvest i.e. 40 days after pesticide application. Mancozeb residues were estimated in terms of carbon disulfide (CS2) by decomposing mancozeb residues with hydrochloric acid and observations were recorded at 302nm in UV-VIS-Spectrophotometer. Application of mancozeb led to 10.274 and 17.149 mg kg-1 initial deposits at respective doses, which persisted upto 20 days at single dose and 30 days at double dose. Initial deposits dissipated to half in 3.4 and 3.9 days at respective doses. Mancozeb residues were found below the level of determination (0.05 mg kg-1) in matured onion and soil. A safe waiting period of 8 days is suggested for safe consumption of green onion after last spray.

097 Contamination of potato tubers with mancozeb residues following foliar

application

R.C. MISHRA, I.D.SHARMA, R.S.CHANDEL and S.K.PATYAL Pesticide Residue Laboratory, Department of Entomology, Dr YS Parmar University of Horticulture and Forestry,

Nauni-173 230 Solan (HP).Email: [email protected]

Mancozeb is a widely used chemical in fungal disease management of horticultural crops including seed treatment and blights of potato. There are concerns over its toxic effect on humans, wildlife and the environment and restrictions are placed on household use. The potato in India is not primarily a rural staple, however, as a cash crop it provides significant income to rural farmers. Mancozeb is applied usually before the disease appearance and under heavy disease conditions. Due to its rapid degradation to its primary metabolite ethylenethiourea, regular application of mancozeb is required, thus increases chances of underground tubers contamination risk with manozeb. The U.S. Environmental Protection Agency lists mancozeb as a known carcinogenic. Its primary metabolite ethylenethiourea was also linked to thyroid and reproductive problems in animal studies, and concerns were raised over this occurrence in humans. Hence, the information on the residue levels of mancozeb in potato tubers and soil, which was otherwise unavailable


76

under Indian conditions has been generated. The mancozeb was applied on the foliage of the potato at application rates of 1.5 and 3.0 kg a.i. ha-1. Potato tubers were sampled at 0, 1, 3, 5, 7 and 15 days interval and soil samples were collected at 0, 10, 20 and 30 days interval after fungicide application for residues estimation. The residues were estimated in terms of CS2 which was evolved from the treated sample by decomposition with HCl, trapped in methonalic KOH and read at 302nm in UV-VIS Spectrophotometer. On the day of application, the respective mancozeb residues were detected as 0.144 and 0.265 mg kg-1 in potato tubers which declined to 0.064 and 0.135 mg kg-1 on 3rd day at two doses. Whereas, in potato cropped soil, the residues detected were 0.272 and 0.861 mg kg-1 on day zero after application and further declined to 0.073 to 0.158 mg kg-1 at respective doses on day 20. The mancozeb residues were found below the level of determination (LOD) in potato tubers and soil at time of harvest, thus concluded that consumption of mancozeb treated potato tubers are safe for consumption at harvest.

098 Water quality status under dominant landuses in Solan block of Himachal Pradesh

ANCHAL RANA, S.K. BHARDWAJ and SUDHIR VERMA Department of Environmental Science, Dr. YS Parmar University of Horticulture & Forestry,Nauni-173 230, Distt.

Solan (HP)

The present investigation was conducted during 2011-2012 to study the effect of dominant landuse systems namely agriculture, forest and urban/suburban on quality of surface and sub-surface waters in Solan block of district Solan of Himachal Pradesh. The surface and ground water samples were collected during rainy, winter and summer season and analyzed for various physico-chemical parameters. Water quality index was determined on the basis of analysed physical and chemical parameters and aquatic insect biodiversity was also determined. The pH of surface and ground water sources ranged from 6.01 to 8.39. The highest pH (8.39) was found in ground water during summer season under urban/suburban landuse system. EC ranged from 424 to 659 uS/cm. The maximum EC (659 uS/cm) was found in ground water during rainy season under agriculture landuse. The TDS ranged from 46 to 293 mg/l. The BOD for both the sources ranged from 0.35 to 3.43 mg/l. Under agriculture landuse system surface water was found with the maximum BOD of 3.43 mg/l during rainy season. The maximum COD value of 7.75 mg/l was in ground water under urban/suburban landuse in summer season. Surface water contained the maximum calcium content of 56.5 mg/l under agriculture landuse system during rainy season. The maximum Mg (29.9 mg/l) was found in surface water under agriculture landuse in rainy season. The ground water under agriculture landuse system contained maximum nitrate (40.25 mg/l) during rainy season. The highest value of Cl (176.75 mg/l) was in ground water under agriculture landuse during summer. The surface water sources contained Fe ion the range of 0.37 to 1.68 mg/l and ground water contained from 1.75 to 2.83 mg/l. The groundwater contained the maximum content of Fe (3.58 mg/l) under forest land use during winter. The highest value of Zn (1.51 mg/l) was observed in ground water under agriculture landuse during rainy season. The surface water under urban/suburban landuse system contained maximum Cd (0.35 mg/l) during summer. The water quality of surface and ground water sources of Solan block was rated as very good in case of forest and urban/suburban and good under agriculture landuse. Whereas, season wise both the sources were rated in very good quality. The aquatic biodiversity distribution varied from excellent for forest and agriculture landuse to good for urban/suburban landuse system.

099 Validation of pest management modules in summer crop of tomato in Bilaspur

district of Himachal Pradesh

DEEPIKA SUD and REENA KAUSHAL CSK Himachal Pradesh Krishi Vishvavidyalaya, Krishi Vigyan Kendra Kangra– 176001 (HP).


Six plant protection modules formulated in RKVY project (M1-M6) with respect to foliar diseases, fruit rot and borer in tomato are were evaluated at different locations of distt. Bilaspur. The results revealed


77

significant reduction in early blight and septoria leaf spot incidence as compared to untreated control, the module M1 resulted in minimum disease incidence followed by M4, Incidence of other diseases like wilt, root rot and viral diseases like leaf curl, tomato mosaic and shoe string was very low. The efficacy of different modules against fruit rot (buckeye rot) revealed the module MI to result in significantly lowest disease incidence (3.0 %) followed by M4 (4.67%), being significantly superior to untreated control after 15 days of last foliar application. However, against damage inflicted by Spodoptera sp. in all the treatments was non significant as all the treatments evaluated were targeted for Helicoverpa, which was not prevalent during the cropping period at the selected locations. Incidence of fruit fly was recorded after second spray and based upon mean value Aphids and white flies incidence was not evident on the crop.

100 Effect of fertilizer doses on the white rust in Indian mustard hybrids and varieties

SUSHIL SHARMA and BIKRAM SINGH CCS Haryana Agricultural University,Regional Research Station, Bawal – 123501 (Rewari)

*Krishi Vigyan Kendra, Jind (Ha.)

An experiment was conducted at Chaudhary Charan Singh Haryana Agricultural University, Regional Research Station, Bawal during 2009-10 to find out the effect of fertilizer doses on the white rust in Indian mustard hybrids and varieties. The study showed that there was an increase in disease intensity of white rust with corresponding increase in fertilizer doses. The hybrid DMH 1 contracted less disease (5.6%) at lower fertilizer dose (N60P22.5S30) against higher fertilizer dose (N120P45S60) where the value of disease intensity was 23.3 per cent. This hybrid proved significantly superior over other hybrids in terms of yield (27.04 q/ha) also. The disease intensity varied from 20 to 60 per cent in other hybrids viz., NRCHB 506, Kranti and PAC 437. Interestingly in varieties, the disease intensity in NPJ 112 was less at higher dose (11.6%) and almost at par (20%) in rest of three levels of the fertilizers (N60P22.5S30, N80P30S40 and N100P37.5S50). The variety NPJ 112 recorded significantly higher seed yield (22.43 q/ha) over other varieties. The range of disease intensity in

other varieties (EJ 20, JD 6, NPJ 124 and PR 2006-1) was 26.6 to 50 per cent.

101 Influence of micronutrients on fruit quality and disorders in tomato in J&K

NEERJA SHARMA and ARUN GUPTA Sher-e Kashmir University of Agricultural Sciences & Technology of Jammu, Krishi Vigyan Kendra, Poonch (J&K).

Fruit cracking is a common disorder associated with many crops particularly in tomato which causes great loss to the growers who grow crop for commercial purpose. Amongest the solanaceous vegetables, tomato crop is mostly affected by this disorder. Tomato is very good responsive to application of micronutrients. The field experiments were conducted during 2008 and 2009 at Farm of Krishi Vigyan Kendra Poonch (J&K) to study the influence of soil application of micronutrients on fruit quality and defects on tomato crop. The treatments comprised of Zinc, boron, molybdenum, iron and copper. These micronutrients were applied alone as well as in various combinations. The results for the two years indicated that mixture of all micronutrients and application of boron alone reduced the incidence of fruit cracking upto 77% and 76.5%, respectively. This also resulted in subsequent reduction in defected fruits. The quality parameter like ascorbic content was increased with the mixture of all micronutrients followed by boron application also the acidity percentage (0.75%) was decreased with these treatments. Also the application of zinc reduced the acidity

percentage and increased the ascorbic acid content in tomato fruits.

102 A refined technology for the control of rhizome rot of ginger

DHANBIR SINGH, AKHILESH SINGH and SAVITA SHARMA CSK HPKV, Hill Agricultural Research and Extension Centre, Dhaulakuan, Sirmour- 173001 (HP).

Ginger is one of the important cash crops of the Sirmour District in Himachal Pradesh. It is cultivated in an area of 2040 ha with annual production of 14570 million tonnes. The annual production of Ginger is low in Himachal Pradesh as compared to other states. Diseases and pests are the major factors which limit the ginger cultivation in Sirmour. Rhizome rot of ginger caused by Pythium spp. and Fusarium oxysprorum f. sp.


78

zinziberi has become the major bottleneck for successful cultivation of zinger crop. The existing technology has not been giving satisfactory control of rhizome rot of ginger. Therefore, the present study was undertaken with the objective to improve the existing technology by incorporating surgical cutting of seed rhizomes, row direction from east to west and wide row spacing. The trials were conducted at Sataun and Bharapur on farmer’s field with two treatments namely, existing technology and refined technology (existing technology + surgical cutting of rhizomes + row spacing + row direction). The average data of two locations indicated that refined technology resulted in significant reduction of rhizome rot, phyllosticta leaf spot, bacterial wilt and mother rhizome rot. The number of tillers in refined treatment was doubled as compared to check treatment and consequently there was significant increase in rhizome yield. The recommendation of surgical cutting of rhizomes followed by seed deep treatment in fungicidal suspension ( Bavistin @ 0.1% + Indofil M-45) for one hour and sowing of rows in east to west direction + two foliar sprays of Contaf @ 0.1% have been recommended for the effective management of rhizome rot complex and foliar diseases.

103 Bioassay of some insecticides against the greenhouse whitefly, Trialeurodes

vaporariorum (Westwood) on Tomato

ARVIND KUMAR, RAJPAL SINGH and K.C. SHARMA Department of Entomology, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan (HP)-173230.


Laboratory experiments were carried out to study the intrinsic toxicity of six insecticides namely oxy-demeton methyl, spiromesifen, cyazypyr, chlorfenapyr, buprofezin and diafenthiuron; one neem based insecticide, Neem Baan (1500 ppm) and Melia extract against first instar nymphs of the greenhouse whitefly, Trialeurodes vaporariorum (Westwood). Among chemical insecticides, spiromesifen had the maximum intrinsic toxicity against the test insect with LC50 value of 2.72 ppm followed by cyzyapyr (9.80 ppm), diafenthiuron (18.91 ppm), chlorfenapyr (22.63 ppm), buprofezin (31.45 ppm) and oxy-demeton methyl (206.99 ppm). The LC90 values in the increasing order of intrinsic toxicity obtained were 13.48, 47.79, 68.41, 85.60, 168.65, and 1148.15 ppm for spiromesifen, cyazypyr, chlorfenapyr, diafenthiuron, buprofezin, and oxy-demeton methyl, respectively. Bio-pesticides, Neem Baan and Melia extract resulted in dosage-dependent mortality with LC50 and LC90 values of 4.45 and 27.58 ppm and 2.84 and 8.60 per cent, respectively.

104 Efficacy of insecticides against shoot and fruit borer, Leucinodes orbonalis on

Brinjal (Solanum melongena)

ARCHANA KERKETTA, SUSHILA and NIVEDITA TCB College of Agriculture & Research Station Sarkanda, Bilaspur, Chhattisgarh.

Brinjal (Solanum melongena Linneus) is an important vegetable crop in all over India. It is attacked by various pests like jassid, aphid, white fly, defoliators and shoot and fruit borer at different stages of the crop. Out of these, shoot and fruit borer, Leucinodes orbonalis Guen. is serious pest and throughout the year found on the crop. Damage by the shoot and fruit borer is the major constraint in the successful cultivation of brinjal in Bilaspur district of Chattisgarh. In the present time, various insecticides with different mode of action has been found useful and in the present investigation on efficacy of insecticides viz., Profenofos (50% EC), Quinolphos (25% EC), Cartap hydrochloride (50% SP), Trizophos (40% EC), Chloropyriphos (20% EC) and Cypermethrin (10% EC) against shoot and fruit borer, Leucinodes orbonalis Guen. on Brinjal (Solanum melongena) and yield carried out at TCB College of Agriculture & Research Station Sarkanda, Bilaspur, Chhattisgarh. The result showed that the trizophos 40% EC @ 0.5kg a.i./ha was most effective and significantly superior over other treatments in controlling shoot and fruit borer(77.1%) and increasing yield (163.09q/ha) of brinjal. Cartap hydrochloride 50% SP @ 0.5kg a.i./ha and quinalphos 25% EC @ 0.25 kg a.i./ha were found to be next best insecticides in controlling shoot and fruit borer(70.0 & 62.5%) and increasing yield (151.15 & 146.47q/ha) of brinjal respectively.


79

105 Sterilization of honey bee combs infected with Melissococcus plutonius through chemicals and UV rays

DEEPAK SINGH, SAPNA KATNA, B.S.RANA and H.K. SHARMA Department of Entomology, Dr Y S Parmar University of Horticulture & Forestry, Nauni, Solan (HP)-173 230.


Honey bees are the most efficient pollinators for enhancing the productivity of agro horticulture crops. The productivity of the crops is being adversely affected by the low population of honey bees due the incidence of various diseases, one of the most important being European foul brood (EFB) in hive bees, Apis mellifera L. and A. cerana F. The causal bacterium, Melissococcus plutonius was isolated from EFB disease infected larvae of A. mellifera which inhabits the combs. Such combs are source for further spread of infection. During present studies, artificially inoculated (with M. plutonius) frames were sterilized by treating with chemicals viz., formalin, detergent, sodium hypochlorite, hydrogen peroxide + iodine monochloride and UV rays for different time exposures. Number of bacterial cells were 30,000±200 cfu/20µl. Artificial inoculation was done in empty cells of freshly raised combs using 20µl of the bacterium inoculum in each comb cell with the help of micropippette. After inoculation, frames were dried in incubator at 34 0C for 2h. Post quantification of bacteria was done by growing the extracted bacteria from post treated combs using 0.2µl inoculums per petriplate. Efficacy of the treatments was worked out in terms of mortality of M. plutonius. Acceptance of combs treated with highest doses of different treatments to honey bees was checked by giving them in A.mellifera colonies after neutralizing with ammonia solution and then thoroughly washing with water. Maximum mortality (99.00%) was observed in 4% formalin when exposed for 8.0 min. While 1% formalin plus 2% detergent treatment for 8.0 min gave 97.66% mortality. Hydrogen peroxide plus iodine monochloride (10:1) fumigation (450 ml/hive body) for 5h caused 91.78 % mortality. However, economically, this treatment is very costly because iodine monochloride is very expensive, can’t be easily adopted by beekeepers. Irradiation with UV rays for 20 min exposure caused 91.02% mortality of M.

plutonius. The colonies of A. mellifera gave normal response on the treated combs with regard to number of bees covering the frame, egg laying, hatchability and sealing of larvae. No mortality of bees was observed on treated frames. Thus these studies indicate that the sterilization of M. plutonius infected bee combs with 1% formalin plus 2% detergent is very effective, beekeeper friendly with low cost and minimum residual effect.


80

Biological Control and Cultural Methods

106 Teliospore germination inhibition of Neovossia indica by culture filtrates of

biocontrol agents

SHRVAN KUMAR, DHANBIR SINGH and P.C. SHARMA Department of Plant Pathology CSK HPKV, Palampur -176062 (H.P). Email: [email protected]

The Karnal bunt, also referred to as ‘New bunt’ or ‘Partial bunt’ caused by Neovossia indica (Mitra) Mundkur was reported first by Mitra in 1931 on wheat (Triticum aestivum L.) from an experimental seed material grown at Botanical Station, Karnal (Haryana) in India and hence the name Karnal bunt. Its widespread prevalence and effects on the quality and viability of seed has caused concern to agroscientists. Investigations on the management of Karnal bunt of wheat were undertaken to evaluate antagonists against N. indica in vitro. The culture filtrate of all bio-control agents gave significant reduction in teliospore germination compared to the control. Per cent inhibition was found to be in direct proportion to the concentration of culture filtrate of bio-control agents. However, maximum teliospore inhibition (93.15%) was achieved with culture filtrate of Trichoderma viride (Ecoderma) followed by local isolates of Trichoderma viz., T. viride (91.64%), T. koningii (88.74%) and Pseudomonas fluorescens (83.27%) at 100 per cent concentration. Bacillus subtillis and T. harzianum caused 82.77 and 81.95 per cent inhibition, respectively. Minimum teliospore inhibition was observed in culture filtrate of B. subtilis at 50 per cent concentration. In present investigation, culture filtrate of T. viride (Ecoderma) causing maximum inhibition of teliospore germination of N. Indica showing significant difference from the culture filtrates of other bio-control agents. The study will further be extended to identify a suitable bio-control agent for management of Karnal bunt disease.

107 Effect of seed dressing fungicides, botanicals and biocontrol agents on Karnal

bunt incidence

SHRVAN KUMAR, DHANBIR SINGH and S. DHANCHOLIA Department of Plant Pathology, CSK HPKV, Palampur -176062 (HP). Email: [email protected]

A field trial was conducted to examine the effect of seed dresser fungicides, phytoextracts and bio-control agents on Karnal bunt of wheat under natural conditions at Dhaulakuan, Himachal Pradesh. All the treatments supported good germination and significantly reduced Karnal bunt incidence over check. Maximum disease control was achieved with Tilt 25EC (48.72%) followed by Bavistin 50WP (48.08%), Vitavax 75WP (45.30%) and Raxil 2DS (37.61%). Among botanicals Lantana camara was adjudged to be the best with 41.88 per cent disease control. However; seed treatment with Trichoderm viride (Ecoderma) showed only 28.21 per cent disease control. In all the treatments the disease control levels ranged between 28.21 to 48.72 per cent. The findings revealed that seed treatment alone is not sufficient to contain Karnal bunt under field conditions.

108 Management of powdery mildew of wheat caused by Erysiphe graminis f.sp tritci

through different non-chemical approaches AMRISH VAID, S.AHMED, A.P. SINGH, V.MAHAJAN, A.JAMWAL, B.AJRAWAT, K.PAGOCH and N.SHARMA Krishi Vigyan Kendra, SKUAST-J, Kathua email: [email protected]

Wheat (Triticum aestivum L.) is one of the most important, widely grown and consumed food crop all over the world. The main constraints for low productivity of wheat are biotic and abiotic stresses which restrict stable yields. Among biotic stresses, powdery mildew caused by Erysiphe graminis f. sp tritici is the most serious of all the wheat diseases. Management of plant pathogens through ecofriendly methods has assumed


81

significance to manage diseases, on account of ill effects of conventional use of chemical measures for disease control. In the present investigation the attempts were made to identify the effective ecofriendly approach for management of powdery mildew of wheat through host resistance and cultural practices. In the present study eighty two (82) wheat genotypes were screened against powdery mildew of wheat, out of which PBW 550 and PBW 291 showed highly resistant reaction and genotypes viz. HD 2329 and UP 2632 were found highly susceptible to E. graminis f. sp tritici. Effect of sowing dates on disease development revealed that delayed sowing decreased AUDPC and increased yield in four different wheat varieties namely HD 2329, PBW 343, PBW 373 and RAJ 3765 sown under early, normal, late and very late conditions. Effect of seed rate revealed that higher seed rate resulted in maximum disease intensity and area under disease progress thereby resulting in low yield.

109 Preliminary screening of organic inputs against paddy blast

DIMPLE RANA and Y.S. PAUL Department of Plant Pathology, CSKHP Krishi Vishvavidyalaya, Palampur (HP)-176062.

A total of 13 organic inputs were evaluated against paddy blast pathogen Magnaporthe grisea in vitro. Six organic products namely panchgavya, vermiwash, matka khad, biosol, cow urine-fermented butter milk, compost tea and three botanicals viz. Acorus, Eucalyptus and Eupatorium were tested at three concentrations (1, 5 & 10%) by treating 15 days old culture discs and incubating them at 25±10C for 7 days. The efficacy was recorded by observing the growth of the pathogen in oat -meal agar. Neem oil was tested at three concentrations i.e 1%, 3% and 5% and its efficacy was also recorded by observing the growth of the pathogen. Different bioagents were also tested against the pathogen by dual culture method. Out of the organic inputs tested cowurine-fermented butter milk was found to inhibit the pathogen at 1% concentration while vermiwash, biosol, eupatorium were effective at 5% concentration. Compost tea and Acorus extract were effective only at 10 per cent concentration. Out of four bioagents, Trichoderma harzianum was most effective against the pathogen in dual culture.

110 Development and use of talc based formulation of Trichoderma viride for management of Fusarium wilt of tomato under protected cultivation

NARENDER K. BHARAT, S.K. GUPTA, MONICA SHARMA and A.K. GUPTA Department of Plant Pathology, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan-173 230 (HP).


Tomato is an important off-season vegetable crop grown in Himachal Pradesh.With the introduction of polyhouses, this crop is now grown throughout the year under protected cultivation conditions and fruits are available round the year. Due to the prevalence of congenial microclimate under protected cultivation conditions the incidence of Fusarium wilt caused by Fusarium oxysporum f.sp. lycopersici is increasing in polyhouses which is now causing losses to the growers. As the disease is soil-borne, it is difficult to be managed through the use of chemicals. Different antagonists were tested against the pathogen under in vitro

conditions out of which an isolate of Trichoderma viride was selected for development of its formulation. Talc based formulation was then developed using Laboratory fermenter in the Department of Plant Pathology. The formulation thus developed was tested under polyhouse. A field trial was laid out to see the effect of indigenously prepared talc based formulation of Trichoderma viride on Fusarium wilt of tomato under protected cultivation condition. The soil application of Trichoderma formulation was done by mixing it with FYM @ 1 kg/ 20 kg (w/w) at the time of transplanting of the seedlings. The observations on disease incidence and yield were recorded at the time of harvesting of fruits. It was found that the soil application of Trichoderma formulation significantly reduced the incidence of Fusarium wilt to 14 per cent in treated plots as compared to 46 per cent in untreated plots durin 2010 and 15.6 per cent in treated plots as compared to 52.0 per cent in untreated plots during 2011. The treatment also increased the fruit yield per plot significantly over control during both the crop season.


82

111 Evaluation of organic inputs in the management of buckeye rot of tomato

RAJ KRISHAN and Y.S. PAUL Department of Plant Pathology, CSK HP Krishi Vishvavidyalaya, Palampur (HP)-176062.

Fifteen organic inputs were compared with four fungicides namely section, Melody duo, Moximate and Ridomil for the management of buckeye rot of tomato caused by Phytophthora nicotianae under laboratory conditions. The fruits of the same age and size were inoculated with the pathogen culture by a. dipping the fruits in test inputs followed by inoculation; b. dipping the fruits in test inputs followed by injury with tooth prick and then inoculation and c. pricking the fruits with tooth prick followed by inoculation and then spray with the inputs after 72 hours. The fruits were incubated at 25+2oC under high humidity conditions till the fruits in control were completely covered by pathogen growth. Seven organic inputs (Panchgavya, Jeevamrit, Amritpani, Kitmar, Matkakhad, Akshwan, Agneysastra) and two fungicides viz , Sectin and Ridomil resulted in 100% control of buckeye rot when the pathogen was inoculated after dipping in inputs. Only two organic inputs viz. Panchgavya and Drekastra provided more than 40 per cent control of the disease which was at par with fungicides Melody duo and Sectin, when fruits were inoculated after injury. Once the pathogen was established, none of the treatments was effective in checking the spread of disease, however, Panchgavya, Lantana extract, Moximate and Ridomil checked the rate of disease spread and resulted in 12-21.4% reduction in the pathogen growth as compared to control.

112 Botanicals against Rhizoctonia solani and Fusarium solani causing damping off of

okra

B.R. THAKUR, Y.S. PAUL and NEERAJ SHARMA Department of Plant Pathology, CSK HPKV, Palampur (HP)-175 062.

The aqueous leaf extracts of five botanicals namely Eupatorium adenophorum, Lantana camara, Eucalyptus

globulus, Vitex negundo and Melia azedarach were evaluated at different concentrations for their fungicidal properties against Rhizoctonia solani and Fusarium solani. The plant extract of all botanicals showed effectiveness against both pathogens to a varying extent. Antifungal activities of all phytoextracts increased significantly with increase in the concentration. The pure concentrate (100%) of all phytoextracts resulted in cent per cent inhibition of mycelial growth of R. solani and F. solani. The plant extracts of all botanicals proved to be effective against R. solani at 60 per cent concentration resulting above 50% inhibition. Maximum inhibition was achieved by Melia azedarach (87.8%) followed by both Vitex negundo and Eupatorium adenophorum (87.4%), followed by Lantana camera (86.6%) and were statistically at par with each other. Eucalyptus globulus was found least effective to yield 65.2 % inhibition at this concentration. The plant extracts of all botanicals also found effective against F. solani at 60 per cent concentration resulting above 50% inhibition of mycelial growth. At 80 per cent concentration, Eucalyptus globulus

yielded maximum inhibition (95.1%) followed by Vitex negundo (92.8%), Eupatorium adenophorum (92.1%), Melia azedarach and Lantana camera (90.8%) against F. solani and were statistically at par with each other.

113 Integrated approach of Trichoderma harzianum and Paeciliomyces lilacinus with

karanj oil seed cake for the management of Meloidogyne incognita on chilli

NEETU SINGH, B.K. GOSWAMI, M.UDAYAKUMAR and ARCHANA BANA Amity center for bio-control and plant disease management, Amity University, Sec 125, Noida.


Extensive survey of chilli fields of Gulawati block of western U.P. between 2010-2011 revealed consistent association of Deuteromycetous fungi Aspergillus niger, A. terreus, Fusarium oxysporum, F. solani,

Penicillium oxalicum,Trichoderma harzinaum and Paecilomyces lilacinus with egg masses of root-knot nematode, Meloidogyne incognita These fungi were isolated, sub-cultured and finally separately tested for their toxicity and egg parasitisation. Out of which Trichoderma harzinaum was found highly toxic and P.


83

lilacinus was egg parasitic. Both the fungi grew well on medium containing dried soobabool (Leucaenia

leucocephala) leaf power, oil seed cake of karanj (pongamia glabra) and molasses. Trichoderma harzianum and P. lilacinus were selected for the management of M. incognita on chilli in glasshouse trails. The fungi, when applied together, were responsible for greatest reduction in nematode population, both in root and in soil with enhanced plant vigour. The combination of toxic and egg parasitic bioagents may be an ideal approach of managing root-knot nematodes on chilli. Trichoderma harzianum being toxic would kill J2 in the rhizosphere while egg parasite P. lilacinus, would invade the eggs of M. incognita. The karanj oilseed cake help to maintain the general plant health in addition to possessing the nematicidal properties. Integration of such methods of biological control along with organic amendments under field conditions is suggested.

114 Effect of biocontrol agents for the sustainable management of Sclerotinia

sclerotiorum (Lib.) de Bary in Bell pepper

DEEPAK SHARMA and K.S. RANA Department of Plant Pathology, CSK Himachal Pradesh Agricultural University, Palampur, Himachal Pradesh,

176062. [email protected]

Biological control with antagonistic microorganisms is a promising alternative to chemical control against Sclerotinia sclerotiorum in Bell pepper (Capsicum annum var.grosum). Six fungal isolates (Trichoderma

harzianum, Trichoderma koningii, Trichoderma viride and Penicillium spp.) were screened against Sclerotinia sclerotiorum (Lib.) de Bary in the laboratory by dual culture technique. Among these, complete mycelial growth inhibition (100%) was caused by T. koningii (JMA-11 and DMA-8). T. harzianum (JMA-4 and SMA-5) caused 86.0 per cent inhibition followed by T. viride (H3). Penicillium spp. (SAP-2) and Penicillium spp. (SAP-1) showed 76.0 per cent and 43.3 per cent mycelial inhibition respectively. In the pot experiment studies done under artificially inoculated conditions, the least disease incidence was observed while dipping the roots of nursery plant in T. koningii (JMA-11 and DMA-8) at 0.2 per cent concentration with maximum disease reduction of 56.50 per cent. Next best treatment for the control of Sclerotinia

sclerotiorum was T. harzianum (JMA-4 and SMA-5) at 0.2 per cent concentration which recorded 32.80 per cent disease control.

115 Vermiwash: Biochemical and microbial component in organic potato production

M.C. SOOD, NEELAM KUMARI, NAME SINGH and PINKY Division of Crop Production, Central Potato Research Institute, Shimla (HP)-171001.


Use of vermiwash in organic agriculture proved a best alternative as a soil conditioner. Vermiwash prepared from actively vermin-composting substrates by the action of Esiania foedita, earthworm species has an alkaline pH, contains macro and micro nutrients, growth hormones, bio-enzymes and plants beneficial bacteria. It is a quite possible to effect quick changes over for sustainable agriculture by harnessing brand new vermicompost technology to the soil.Vermicomposting mainly contains earthworm’s exceta and decomposed matter. Vermiwash was found to contain enzymes proteases, amylase, urease and phosphatase and also containing nitrogen-fixing bacteria like Azotobacter sp. and Rhizobium sp. Field trials with potato crop at Lower Lab Farm area of CPRI Shimla showed its capacity to increase the biomass and yield of potato crop accompanied by enhanced microbial activities. Applications of vermiwash in sandy loam soil enhanced 24 per cent biomass, 22 percent plant height, 15 per cent leaf areas index when applied in 1: 5 dilutions sprayed at 15 days intervals (5 sprays) after one month of potato crop in comparison to control. Potato yield was also increased significantly by 10 to 15 per cent over control. This treatment also resulted into increase of average tuber weight under large and medium size tuber in comparison to control. Vermiwash treated plots plants appeared healthy with least pest and diseases damages and large leaf size with deep leaf colour. The soil analysis also revealed that application of vermiwash increased the bacterial, fungal, and free living nitrogen fixing, phosphates soluble and Pseudomonas spp. population and dehydrogenase, urease and phosphatase enzymes activities when compared with control plots. This clearly established the fact that


84

vermiwash enhanced the soil fertility status for production of organic potatoes, beside sustainable development in agriculture biotechnology with respect to its origin, cost effectiveness, easily avaibility, time saving and eco-friendly.

116 Sustainable IPM package for the management of Fusarium oxysporum and

Melidogyne incognita on vegetables

NEETU SINGH and B.K. GOSWAMI Amity center for bio-control and plant disease management, Amity University, Noida.


A survey in the farmer’s fields between 2010-2011 in villages of western U. P showed heavy infestation of wilt fungus Fusarium oxysporum and root-knot nematode, the latter being predisposer to a wide range of vegetable crops causing disease complex with synergistic effects on the common host. Meloidogyne

incognita and Fusarium oxysporium are frequently associated in nature infecting vegetables resulting in considerably greater damage to the crop than the amount of damage caused by either of the soil borne pathogen alone. The present investigation was undertaken to switch on to sustainable management of major soil borne wilt- root-knot diseases through evolved IPM package which comprising of fungal bio-agents, oilseed cakes and botanical antagonists. The fungal bio-agents used as a nuclear component against wilt fungi and root knot nematode were Trichoderma harzianum and Paceliomyces lilacinus, respectively. The other supportive components of the package i.e. neem oilseed cake and botanical antagonist plants possess both manural and pesticidal properties. The proposed package an ideal alternative against toxic chemical farming has been proved to be very successful in improving productivity and quality of vegetable production with remarkable reduction in major soil borne pathogens.

117 Prospectus of bacterial isolate N 105 as an effective biocontrol agent for black rot

of crucifers

NIVEDITA SHARMA, NEHA GAUTAM and ANUPAMA GUPTA Microbiology Laboratory, Department of Basic Science, Dr YS Parmar University of Horticulture and Forestry, Nauni,

Solan (HP) – 173 230. E-mail : [email protected]

Cole crops are among the most widely grown vegetables in the temperate zones. Among the cole crops in India, cauliflower and cabbage are the two important cash crops grown. Of the two, Cauliflower is more important covering nearly 2.8 lakh hectare area. Other than that, broccoli, turnip and radish etc. also contribute significantly for income generation of farmers of H.P. Black rot is a serious disease of crucifers prevalent in temperate and sub-tropical zones of Himachal Pradesh caused by Xanthomonas compestris. The plants get affected by this pathogen at any time during its growth starting from youngest seedling till its maturity. The pathogen is seed borne in nature and is also known to survive in diseased plant debris. In disease manifested plants, at seedling stage a very small wilted V-shaped area appears on leaves which is followed by black or brown discoloration of veins. Afterwards, peppery leaf spots appear which finally leads to wilting and dropping of leaves on ground. This serious disease leads to the destruction of whole crop starting from seedling to mature stage. In this study, a biological control of black rot has been developed and evaluated at laboratory scale. Bacterial isolate N-105 isolated in Microbiology Research Laboratory has shown strong antagonism against X. compestris and was found to exhibit large zones of inhibition ranging upto 10 mm when lawn of pathogen was laid on specified medium in petri plate. Complete inhibition of pathogen by isolate N-105 under lab conditions have encouraged its use as an effective biocontrol agent further to escape the black rot of crucifers.


85

118 Role of antagonists in the management of plant mortality by root rot disease complex in okra (Abelmoschus esculentus L. Moench)

SATISH KUMAR and S.K. GANDHI1 Krishi Vigyan Kendra, Opposite Bhim Stadium, Bhiwani,

1Department of Plant Pathology, CCS HAU, Hisar (Ha).


Okra also known as lady’s finger or bhindi is an important vegetable crop which suffers severely from the vagary of diseases. Pre and post-emergence plant mortality by combination of R. bataticola with Meloidogyne sp. causes more damage to plants than their individual effect. Pesticides despite of being costly have undesirable effect on environment, hence, an eco-friendly way to manage the plant mortality due to root-rot disease complex using different antagonists was tried under screen house conditions. Trichoderma

viride, Gliocladium virens, Bacillus sp., Pseudomonas sp. were tested by seed treatment @ 107, 106 and 105 c.f.u./g seeds of okra cvs. Varsha Uphaar and HYB No. 2 to manage plant mortality. The efficacy of same antagonists was also tested by soil application in which fungal antagonists like T. viride and G. virens were applied @ 5, 10 and 15g/kg soil, whereas bacterial antagonists Bacillus sp. and Pseudomonas sp. were applied at 107, 106 and 105 c.f.u. /kg soil. Twenty seeds were sown per 30 cm dia pots containing loamy sand soil pre-inoculated with R. bataticola @ 1000 mg and M. incognita @ 1000 J2/kg soil. The test pathogens were inoculated three days prior to antagonists application. The data on pre and post emergence plant mortality were recorded up to 35 days of germination of seedlings. T. viride coated seeds @ 107 c.f.u./g seed provided 31.9 and 31.4 per cent followed by G. virens 25.5 and 22.2 per cent disease control in Varsha Uphaar and HYB No. 2, respectively and it was significantly better in disease management as compared to seed treatment @ 105 c.f.u./g seed irrespective of cultivars. Bacillus sp. @ 107 c.f.u./g seed showed 36.1 and 33.3 per cent followed by Pseudomonas sp. which showed 31.9 and 29.7% disease control in Varsha Uphar and HYB No. 2, respectively. Plant mortality of 60 and 70% was recorded when T. viride was applied @ 5g/kg soil in okra cvs. Varsha Uphaar and HYB No. 2, respectively and a minimum of 31.7 and 40.0 % was recorded when applied @ 15g/kg soil as compared to control where 78.3 and 90.0 per cent plant mortality was observed. G. virens applied @ 15g/kg soil significantly reduced plant mortality to 36.7 and 43.3 % in cvs. Varsha Uphaar and HYB No. 2, respectively. Bacillus sp. @ 107, 106 and 105 c.f.u./kg soil recorded a 27.6, 19.2 and 10.6% disease control, respectively in Varsha Uphaar and 27.8, 18.6 and 9.2%, respectively in HYB No. 2. Pseudomonas sp. at the same rate provided 19.2, 12.8 and 6.4% disease control respectively in Varsha Uphaar, whereas in HYB No. 2, it was 22.2, 14.8 and 5.6%, respectively.

119 Evaluation of antagonists against damping off of brinjal caused by Pythium

aphanidermatum

ANAMIKA JAMWAL1, SONIKA JAMWAL2, AMRISH VAID1, REENA2 and BERJESH AJRAWAT1 1 Krishi Vigyan Kendra, Kathua SKUAST-Jammu 184101, 2 Dry land research Sub-Station,

Bari-Brahmana 181133 (J&K). Email: [email protected]

Brinjal or egg plant is a common vegetable crop grown all over the world. The crop suffers from several biotic stresses out of which damping off, caused by Pythium aphanidermatum is an important disease of brinjal. Management of plant pathogens through biocontrol agents has become a popular strategy to manage soil borne diseases, on account of ill effects of conventional use of chemical measures for disease control. In the present investigation attempts were made to study the efficacy of three resident isolates of three fungal biocontrol agents viz. Trichoderma viride, Trichoderma harzianum and Trichoderma virens by dual culture technique against damping off caused by Pythium aphanidermatum .All the fungal biocontrol agents were found effective against Pythium aphanidermatum. Among them, highest percent inhibition of radial mycelial growth was brought out by Trichoderma viride with inhibition percentage of 69.34% over control followed by Trichoderma harzianum with inhibition percentage of 52.0%. Inhibition is due to the

volatile and non volatile metabolites and cell wall degrading enzymes produced by Trichoderma spp.


86

120 Effect of biofertilizers on angular leaf spot and anthracnose in French bean under dry temperate conditions of Himachal Pradesh

SEEMA THAKUR1, S.K. SHARMA2, RAJESH KAUSHAL3, RAJESH THAKUR4 1 Vegetable Research Station,Kalpa, 2RHRS,Sharbo, Kinnaur,H.P, 3Soil Science and Water Management,

Dr Y.S.Parmar,UHF,Nauni, 4KVK, Reckong Peo, Kinnaur (HP). E-mail: [email protected]

French bean is one of the most important vegetables intercropped with apple in Kinnaur district. An experiment was conducted during the summer seasons of 2011 and 2012 at the Experimental Farm of Vegetable Research Station, Kalpa, Kinnaur to study the effect of Rhizobium and Phosphorus Solublizing Bacteria (PSB) on the horticultural and yield traits along with disease incidence of angular leaf spot and anthracnose in French bean var. Contender. Six treatments comprising seed treatments ( with and without Rhizobium), seed treatment ( with and without PSB) along with the combination of 60 % dose of recommended quantity of CAN and 75 % dose of recommended quantity of single super phosphate and organic matter were evaluated in a Randomized Complete Block Design with three replications. The results revealed that T5 treatment i.e. Rhizobium+ PSB+ organic matter resulted in more number of pods per plant (18), pod length ( 14 cm) and pod yield/ha ( 130 Q/ha) in both the years .Different treatments were also screened for Angular leaf spot and Anthracnose. Disease incidence of angular leaf spot and anthracnose was found lowest in T3 (75%P+ PSB) and T5 treatments (Rhizobium+PSB+ organic matter).

121 Managing muskmelon wilt through biaogents in Punjab

NARINDER SINGH, NARINDER PAL and PARAMDEEP SINGH Department of Plant Pathology, PAU, Ludhiana-141004

Muskmelon wilt caused by Fusarium oxysporum f.sp. melonis is a serious disease problem in muskmelon growing areas of districts Jalandhar, Ludhiana and Kapurthala in Punjab. Soil samples from muskmelon fields of these regions were collected and analyzed for antagonistic microflora. Eighteen isolates of Trichoderm harzianum , two isolates of Trichoderma viride and twelve isolates of Pseudomonas fluorescens

were isolated and screened in vitro for antagonistic activity against Fusarium oxysporum f.sp. melonis causing muskmelon wilt. Six isolates of Trichoderma harzianum (Th3, Th13, Th11, Th17, Th19 and Th8) having highest percentage of growth inhibition and one isolate of Trichoderm viride (Tv1) and three isolates of Pseudomonas fluorescens (Pf10, Pf11 and Pf12 ) showing maximum inhibition zones against Fusarium

oxysporum f.sp. melonis in dual culture were selected for further study. Efficacy of talc based bioformulations of T. harzianum, T. viride and P. fluorescens isolates as seed dresser and soil treatment was seen against the muskmelon wilt under glass house and field conditions. Trichoderma harzianum isolate Th3 was the best as for as percent seed germination and percent post emergence mortality/wilt was concerned. In addition same isolate of T. harzianum (Th3) followed by Pseudomonas fluorescens isolate (Pf12) promoted the growth of muskmelon plant in the seed and soil treatments.

122 In vitro evaluation of botanicals and plant oils against Corticium salmonicolor, the

incitant of pink canker in apple

DURGA PRASHAD and VED RAM Department of Plant Pathology, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan (HP)-173230.

Email:[email protected]

Apple (Malus x domestica Borkh.) is the most important fruit crop grown in the temperate region of the world. Himachal Pradesh is well known as an “apple state” of the country because its cultivation has revolutionized the socio-economic condition of farmer and plays a pivotal role in the economy of the growers. Apple like other crop plants is susceptible to a number of diseases and among fungal diseases, pink canker caused by Corticium salmonicolor Berk & Br. has been predominant and destructive disease causing up to 80-90 per cent disease in Kullu and Rajgarh areas of H.P. Looking into high disease severity, it was


87

proposed to evaluate the efficacy of different botanicals and plant oils against pink canker pathogen. Out of thirteen plant oil tested under in vitro conditions, three namely olive, lemon grass and mustard oil at 100, 250, 500 and 750 ppm provided complete growth inhibition of Corticium salmonicolor followed by clove (94.14%), neem (85.81 %) and tulsi (84.11%), respectively. Rest of the plant oils like wild marigold, Artimisia sp., eucalyptus, wild apricot, castor, cedar wood oil and walnut oil were less effective. It was also observed that as the concentration of these oils increased, there was a corresponding increase in per cent growth inhibition of the pathogen with highest at 750 ppm concentration. Among twenty botanicals tested, aqueous extracts of basuti, mustard, and 4 combinations of cow urine + darek + bana + walnut leaves, cow urine + darek + bana + walnut leaves + artimisia sp + kadu , cow urine + darek + eucalyptus + bogainvellia , and cow urine + darek + bana + walnut leaves + artimisia sp. at 10, 20, 50 and 100 per cent provided complete growth inhibition of Corticium salmonicolor under in vitro conditions followed by tulsi (90 %), mentha (88.35 %), peach leaf extract (82.88 %) and kadu (76.35 % ). Hence application of plant oils and botanicals may be an important substitute for eco-friendly management of pink canker in apple.

123 Role of microbes for potato pest management

NEELAM KUMARI1, DEEPAK C. KALIA2, M.C. SOOD and V.K. CHANDLA 1Central Potato Research Institute, Shimla, HP- 117001,

2Department of Bio-Sciences, HPU, Shimla, HP-117005.


During the last few decades, agriculture has totally become artificial and chemical oriented instead of natural and organic. This has resulted in undue pressure on the farmers besides outbreaks of pest. The indiscriminate use of the chemicals insecticide has resulted in the environment pollution and health hazards. One of the immediate thrusts, which need to be made to improve the production efficiency of crop especially potato, is to manage its pest populations, which cause reduction in the potential harvest. Among soil pests, Agrotis

segetum (Denis & Schiff.) belonging to family Noctuidae and order Lepidoptera, is major pest of potato in Himachal Pradesh. The cutworm (larva of Agrotis sp.) cut off the tender stalks of young plants of potato at their basis or a few centimeters above the ground during night and feed on them. Sometimes, heavily infested fields look as if they have been grazed and losses caused them during epidemic year cross over 30 %. Considering the importance of the bio-agents in managing the population of the cutworm, efforts were made to explore the role of biological control measures in Shimla hills. Field trials were conducted at CPRI, Shimla (370N, 770E, 1885 m asl) to evaluate the role of entomopathogenic bacteria and fungus against cutworms, A. segetum. Results revealed that entomopathogenic fungus Bauveria bassiana @ 4g/m2

(1x1010conidia/g) gave maximum protection to potato crop from this pest (0.33 cutworms/plot with 1.33 per cent plant damage) followed by 0.33 cutworms/plot with 1.67 per cent plant damage after 14 days of application in the treatment of entomopathogenic bacteria, Bacillus thuringenesis @ 1g/m2 (1x1010conidia/g). These beneficial and eco-friendly microorganisms contained toxins proteins which kill the target pests and being used as potential biological alternatives in eco-friendly agriculture. Though use of biological agents (microbes) are not very popular due to constraints enumerated above in the near future it is likely to have impact in potato crop protection in the country, creating situation conducive for the safer environment.

124 Laboratory bioassay studies on some entomopathogenic fungi against greenhouse whitefly Trialeurodes vaporariorum Westwood

NISHA DEVI, K.C. SHARMA, P.L. SHARMA, R.S. CHANDEL and YOGEETA THAKUR Department of Entomology, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan (HP)-173 230.


Tomato cultivation inside the protected environment is threatened by numerous pests, among them the greenhouse whitefly, Trialeurodes vaporariorum Westwood is one of the dominating species. The integrated control concept emphasizes the importance of both chemical and biological control for pest suppression in an agriculture system. Entomopathogenic fungi, also known as mycopesticides or mycopathogens, are fungi that prey on insects. Entomopathogenic fungi are a useful component of any IPM program because they are host


88

specific, able to function in a wide range of greenhouse environment and safe to humans and environment. Laboratory bioassay study of four entomopathogenic fungi (pure culture) viz. Beauveria bassiana,

Verticillium lecanii, Metarrhyzium anisoplae and Paecilomyces sp. were carried out against the second instar nymphs of the greenhouse whitefly, T. vaporariorum on tomato leaves at spore suspension fluid of 104, 105 106, 107 and 108 conidia/ml. Mortality was recorded at 3, 7 and 10 days interval after treatment. The mortality observed to the nymphs on 3rd and 7th day at 108 conidia/ml spore suspension by B. bassiana, V.

lecanii, M. anisoplae and Paecilomyces sp. was 28.01, 27.33, 20.92, 26.58 and 53.67, 57.83, 39.76, 45.81per cent, respectively. The maximum mortality was observed on 10th day in all these fungi and it was 79.16, 72.73, 59.76 and 67.35 per cent, respectively in B. bassiana, V. lecanii, M. anisoplae and Paecilomyces sp. at 108 conidia/ml spore suspension whereas at 104 conidia/ml spore suspension the mortality was 33.96, 26.60, 16.9 and 24.21per cent, respectively.

125 Effect of different vegetable oils on the incidence of various fungi on treated seeds of pea

A. BHARDWAJ, S.C. VERMA, NARENDER K. BHARAT*and M. THAKUR Department of Environmental Science, *Department of Plant Pathology, Dr YS Parmar University of Horticulture and

Forestry, Nauni, Solan -173 230 (HP).

Effect of six vegetable oils viz. mustard, neem, karanj, cedar, apricot and olive was studied on the incidence of various fungi on the treated seeds of pea during the process of germination. Almost all the vegetable oils treatments resulted significant reduction incidence of various fungi. Irrespective of concentrations, the seeds treated with neem oil had minimum incidence of Aspergillus sp. (10.67%), followed by mustard (13.33%). Similar trend was observed in case of Alternaria sp. Where 2.67 per cent incidence was recorded on seeds treated with neem oils, though all the treatments were equally effective. Seeds treated with apricot oil had highest incidence of Alternaria sp. (5.00%). No incidence of Mucor sp. was observed in neem and mustard treated seeds, whereas, 0.67, 1.00, 1.11 per cent incidence was recorded on seeds treated with karanj, cedar and olive oils, respectively. Apricot oil treatment proved to be was least effective against Mucor sp. Mustard, neem, karanj provided almost complete protection against Fusarium sp., whereas, olive (0.22%), cedar (0.33%) and apricot (0.89%) were comparatively less effective. Hence, pea seeds treated with neem and karanj oils provided maximum protection against fungal pathogens.

126 Effect of foliar application of garlic extract on pea powdery mildew

NARENDER K. BHARAT and S.K. GUPTA Department of Plant Pathology, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan-173 230 (HP).


Pea is the most economic vegetable crop cultivated in different localities in Himachal Pradesh. Powdery mildew caused by Erysiphe pisi is the most destructive disease on this crop which requires frequent sprays of fungicides. Application of chemical fungicides not only results in environment pollution but also results in build up toxic residues in pods which may cause health problems. Hence there is urgent need to find out alternative methods for the management of this disease. Garlic is a gifted plant with many uses including its antimicrobial properties. A field experiment was therefore conducted to assess the efficacy of foliar sprays of water extracts of garlic bulbs as well as leaves along with standard fungicide hexaconazole against powdery mildew during 2010-11 and 2011-12 crop season at Nauni. Seed of pea cultivar Lincoln were sown in 2x2 m plots in the first week of November every year maintaining 60 cm row to row and 7.5 cm plant to plant spacing. Three sprays of different treatments were given at 14 days interval with first spray at the time of appearance of first symptoms of the disease. The data pertaining to per cent disease severity (on 0-4 scale) and green pod yield (kg/plot) were recorded at the time of harvesting of pods. Data revealed that all the treatments of garlic bulbs as well as leaf extracts reduced the severity of powdery mildew in comparison to control, however,less effective than that to chemical fungicide hexaconazole. Amongst various treatments, foliar sprays of garlic bulb extract @ 2 per cent was found most effective which resulted 78.74 and 76.98 per cent disease control during 2010-11 and 2011-12 season, respectively. This treatment was followed by garlic


89

leaf extract @ 4 per cent which showed 74.14 and 70.64 per cent disease control during 2010-11 and 2011-12, respectively. The plots receiving these treatments showed significant increase in green pod yield as compared to untreated control. Therefore, both these treatments can be recommended as eco-friendly management practice against pea powdery mildew.

127 Estimation of fungicidal activity of various plants / plant parts of temperate zone of Jammu region

REENA1, ANAMIKA JAMWAL2, S.K. SINGH3, B.K. SINHA4 and S. JAMWAL1 1Dryland Research Sub Station, SKUAST-Jammu, Dhiansar, Bari Brahmana – 181133, 2KVK, Kathua, SKUAST-

Jammu – 184101, 3PRSS, AICRP (Chickpea), SKUAST-Jammu – 184121, 4Div. of Biochemistry and Plant Physiology,

FOA, SKUAST-Jammu – 180009. E-mail – [email protected]

Jammu region comprises of three different agro-climatic zones; viz., sub tropical, intermediate and temperate. The temperate zone is endowed with rich floral diversity that can be explored for pesticidal properties. Twenty four plants / plant parts were collected, shade-dried, crushed and kept in plastic boxes. Methanolic extracts of these plant parts were prepared following the standard procedure of refluxing and distillation using soxhlet’s extraction apparatus. Stock concentration of these methanolic extracts was prepared. Fungicidal activity of these extracts was assessed using poison food technique against Fusarium oxysporum f. sp. ciceri. Among the twenty four extracts assessed, only four extracts exhibited > 75% inhibition at 200 ppm concentration. Arisaema flavum roots / tubers extract recorded 100% inhibition, while its stem + leaves extract showed 95.55%. The Podophyllum hexandrum fruits extract also exhibited 84.44% growth inhibition. The leaves + stem extract of Verbascum thapsus recorded 75.56% inhibition. Hexane, acetone and ethanol fractions of these four promising plants / plant parts were prepared. Fungicidal activity of these fractions was also assessed. Arisaema flavum roots and stem fractions exhibited > 87% inhibition. Hexane and acetone fractions of Podophyllum hexandrum fruits and hexane fraction of Verbascum thapsus showed > 74% inhibition

128 Eco-friendly management of soil borne diseases in greenhouses pepper

MANISH KUMAR and MANJIT SINGH Department of Vegetable Science, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan (HP).

Greenhouse production of vegetable crops is gaining popularity in India especially in hilly regions like H.P. Here low cost naturally ventilated polyhouses are being constructed to grow these crops. The colour varieties of sweet pepper are most preferred to be grown by the farmers because of getting high prices of these varieties in the oriental markets. A simple technology is being used by the farmers which comprising of selection of varieties, growing media, fertilization, training and pruning etc. The occurrence of soil borne disease in the growing media is a serious problem in the greenhouses. The chemical control of such diseases is very expensive and also polluting greenhouse enviourment and reduces the quality of the produce. This calls for a need to bring refinement in growing media using environment friendly strategies to curb the menace of soil borne diseases and reducing use of chemical fungicides. An experiment in this regard was conducted during 2010-2011 at the vegetable research farm, Department of Vegetable Science, Dr YSP UHF, Nauni (HP). Where the two modules (Module 1: M1- Refined growing media with Vermicompost + Neem manure (250gm/m2) + Trichoderma viride (5gm/m2) + cabbage leaves (2kg/m2) and (module 2: M2 –existing growing media soil: FYM: Sand, 2:1:1) were used. The observations are recorded on occurrence of various soil borne diseases. It was found that attack of such diseases was nearly 30% less in refined growing media as compared with standard practices. The observations were also recorded for yield and yield contributing traits, Which suggest more fruit yield per m2 (16.32kg), more fruit yield per plant (4.08kg), more number of fruits per plant (17) and fruit weight (240gm) in the refined growing media than over the existing growing media which recorded fruit yield per m2 (11.60kg), fruit yield per plant (2.85kg), number of fruits per plant (14) and fruit weight (190gm).


90

129 Disease management strategies for organically grown vegetable crops

S.K. SINGH and H.C. RATURI Department of Vegetable Science, Dr YS Parmar University of Horticulture & Forestry, Nauni, Solan (HP)-173230.


Disease management in conventional agriculture and horticulture crops has been considered to provide novel approaches for organic producers. There is very little quantitative information on diseases in organic vegetables and advisory literature often presents lists of diseases and how to control them with no information on their relative importance. Cultural control and rotations will remain the cornerstones of safe organic production, but recent developments in understanding interactions between soil micro-organisms, plants, pathogens and environment offer the opportunity to manage specific disease problems should they occur. The use of compost and soil amendment or cover crop appears to offer good prospects for improving disease control. The use of covers crops and mulches should provide a range of benefits particularly if used for successive crops. Biological control agents either natural occurring or introduced may be advantageous against particularly damaging or persistent problems. Similarly, plant extracts require further evaluation for specific uses. Disease problems occur throughout the production cycle from seed to propagation to the growing crop and its harvest and storage. Approaches for disease control are considered at each stage. Organic growers will almost certainly require stringent standards for seed and propagation to ensure that diseases are not introduced into their systems. A long term commitment to strategic studies of organic systems will be needed to ensure that the planned expansion in production can meet the challenges it undoubtedly faces.

130 Management of soft rot of ginger through eco-friendly methods

NEHA AHLUWALIA, SANDEEP KANSAL and N.P. DOHROO*

Department of Vegetable Science, *Directorate of Research, DrYS Parmar University of Horticulture & Forestry,

Nauni, Solan (HP)-173230. Email: [email protected]

Ginger (Zingiber officinale Rosc.) is an important commercial crop of Himachal Pradesh. The monoculture of ginger has immensely predisposed the crop to soil borne diseases especially soft rot of ginger caused by Pythium aphanidermatum resulting in 30-80% yield losses. Keeping in view of inefficacy of the costly conventional fungicides besides being their adverse effect on rhizospheric microflora, the present investigation was carried out under field conditions to evaluate the efficacy of eco-friendly methods against soft rot of ginger vis-à-vis their influence on rhizospheric microflora. Amongst all the treatments, hot water rhizome treatment at 47°C for 30 min in combination with soil application of Trichoderma harzianum @ 2.5 kg/50 kg FYM/ha at the time of planting followed by four periodic drenchings at 15 days interval with copper oxychloride @ 0.3% starting with onset of rainy season proved most efficacious in limiting the soft rot disease. The use of safer fungicides, Cabriotop (strobilurin compound) as rhizome dip treatment @ 0.2% followed by periodic drenching of copper oxychloride (0.3%) also provided good control of the disease. The treatment consisting of soil application of T. harzianum reflected the highest microbial population depicting highest count of fungus (14.33 x 103

cfu/g), bacteria (84.40x105 cfu/g) and actinomycetes (45.86x105 cfu/g). Thus, the results of the present study inferred that eco-friendly methods besides limiting the soft rot disease had also increased the microbiomic population.

131 Studies on bacterial parasite, Pasteuria penetrans (ex Thorne) Sayre & Starr on

root-knot nematode

M. UDAYA KUMAR and R.K. WALIA CCS Haryana Agricultural University, Hisar-125004. Email: [email protected]

Influence of root exudates (REs) and cell free plant root extracts (CFPREs) of brinjal, cowpea, cluster bean, garden bean, okra and tomato was tested on the germination of Pasteuria penetrans endospores. REs and CFPRE of all the plant species did not induce the germination of P. penetrans endospore. In garden bean CFPRE, cauliflower-like colonies similar to P. penetrans were observed in endospore suspension treated


91

with alcohol. In all the treatments rod-shaped lumps of bacteria were evident; they may be contaminants because intact endospores of P. penetrans were also present. Based on a laboratory bioassay, a statistical model was developed for the estimation of P. penetrans endospores in field soils. The regression equation y= 0.045x + 3.779 with R2 = 0.89 was calculated for M. javanica. In a green-house experiment, the role of P.

penetrans in the suppression of M. javanica was estimated in naturally infested field soil. Field soil was steam sterilised or treated with formalin/fungicides. Formalin and Bavistin proved to be phytotoxic. P.

penetrans alone infected 87.5% nematode females and reduced egg production by ca. ten times. Native fungal and bacteria promoted attachment of P. penetrans endospores but inhibited parasitisation of nematode females by P. penetrans in untreated soil. The development of P. penetrans under open-field and poly-house (ordinary and hi-tech) conditions was studied in winter season. Poly-houses (both ordinary and hi-tech) enabled raising the maximum temperature by 10-12 °C during day time, but there were negligible differences in the minimum temperatures. M. javanica completed it life cycle (females with egg sacs) in 60 days in hi-tech, 70 days in ordinary poly-house and 80 days in open-field conditions. P. penetrans development could not keep pace with that of nematode and it stopped at thallus stage. No mature endospores were found. P.

penetrans failed to curtail the reproduction of M. javanica even in hi-tech poly-house, although infection did take place.

132 Biomanagement of Cyllodes indicus in Pleurotus sajor caju (in vivo)

NEETA DEVI and ANJU S. KHANNA Department of Entomology, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan (HP)-173230.


Three biopesticidal formulations of plant origin viz., Max Raze @ 0.1 %, Max Cannon @ 0.1 % and NeemAzal @ 0.005 % were tried against Cyllodes indicus infesting Pleurotus sajor caju. The formulations were sprayed at referred concentrations separately in each bag, two days prior to pin head formation. The adults of C. indicus were released @ 20 individuals per bag at the time of pin head formation stage. Untreated insect free bags were maintained as control I and insect released but untreated bags were maintained as control II. Minimum mean count of 30.08 insects (in 50 g sporocarps) was recorded in Max Raze treated bags during third and fourth weeks followed by 62.91 and 73.50 insects recovered in Max Cannon and Neem Azal treated bags respectively. Statistically, the insect count in Max Raze treated bags only was significantly lower ass compared to control. Mean insect population recovered in the bags treated with Max Cannon and Neem Azal were statistically at par with the count of insects retrieved in control bags. Among the tested formulations, Max Raze yielded best results with minimum insect count and highest sporocarp yields (1338.0g) followed by Max Cannon. Though, NeemAzal was recorded to be least effective among the three, the yield improvement by this formulation was also significant. Visually, no infestation of sporocarps was observed during first and second week, but with the reducing efficiency of biopesticides, more and more sporocarps got infested. Highest sporocarp infestation among the treated bags was observed in NeemAzal treated bags.

133 Biology of indigenous strains of entomopathogenic nematodes Heterorhabditis

bacteriophora Poinar and Steinernema feltiae (Filipjev) Poinar

MOHINDER SINGH and M.L. KHAN Department of Entomology, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan, (HP)-173 230


The biology of the indigenous strains of entomopathogenic nematodes, Heterorhabditis bacteriophora Poinar (Rhabditida: Heterorhabditidae) and Steinernema feltiae (Filipjev) Poinar (Rhabditida: Steinernematidae) isolated from fruit orchards in Himachal Pradesh was studied under laboratory conditions on rice moth, Corcyra cephalonica Stainton larvae. The infective juvenile were characterised by a closed stoma and sharp pointed tail. The infective juveniles of H. bacteriophora penetrated the Corcyra larvae through mouth, anus and spiracles/cuticle. No significant difference in port of entry i.e. through mouth, anus and spiracles/cuticle was found. After reaching the insect haemocoel the infective juveniles released their


92

associated bacterium, killing the insect host in 24-48 hours by septicaemia. The infective juveniles became parasitic third stage juveniles (L3). The parasitic third stage was characterised by presence of sclerotized dorsal tooth and ventral plate in the lip region. The parasitic L3 was found in the insect cadaver after 24-48 hours. The cadaver of the dead host assumed red colour which turned brick red with time. L3 gave rise to L4 (pre-adult female) in 24 hours later. In 3-4 days after infection large hermaphroditic females were formed. The hermaphroditic females laid eggs which developed in to first stage larvae (L1). L1 hatching from laid eggs developed directly to L4 (pre-adult males and females of second generation). The adults of second generation were formed in 6 days after infection. The average male: female ratio was 1:6.The eggs from second generation females developed in to L2 inside the female body. The development of L2 in both the females was completed in 10-12 days after infection. The emergence of infective juveniles from host cadaver started after 11-12 days of infection. Two generations were completed in full grown Corcyra larvae. The biology S. feltiae was similar to that of H. bacteriophora except for minor differences. The dauers (infective juveniles) of H. bacteriophora developed in to hermaphroditic females, whereas, the dauers of S. feltiae developed in to males and females and mating was necessary to reproduce. The average male: female ratio in S. feltiae was 1:2. Also the cadaver of S. feltiae infected insect assumed yellowish brown colour.

134 Effect of irrigation water on the severity of soft rot (Erwinia carotovora) of lettuce

(Lactuca sativa L.) under protected conditions

Y.R. SHUKLA, SANJAY KUMAR ACHARYA, DEEPA SHARMA and RAJENDER SHARMA Dr YS Parmar University of Horticulture and Forestry, Horticultural Research Station, Kandaghat-173 215(HP).

Lettuce (Lactuca sativa L.) is one of the most important leafy salad vegetable crops due to its nutritional value, production potential and generation of income to the growers. Irrigation water is an essential input for successful production of lettuce. It is main constituent of protoplasm comprising up to 90 to 95 per cent of its total weight. Lettuce crop is affected by so many diseases like soft rot caused by Erwinia carotovora as the conditions inside the polyhouse are more congenial for the development of diseases especially the bacterial one which is highly favoured by the amount of water and humidity inside the poly house. An experiment was carried out in a naturally ventilated poly house in the Department of Vegetable Science, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan (HP) during 2009-10 and 2010-11. Twelve treatment combinations comprising of three depths of irrigation water (1.0, 1.5 and 2.0 cm) and four irrigation intervals (4, 6, 8 and 10 days). The disease severity decreased as the depth of irrigation water decreased. Similarly, when the irrigation interval was increased from 4 days to 10 days, the disease severity decreased. Minimum disease severity (6.95%) was recorded with 1.0 cm of irrigation water was applied as compared to 1.5 cm (14.16%) and 2.0cm (26.68%). The effects of different irrigation intervals were also significant with minimum values (14.18%) recorded when water was applied after 10 days interval and maximum (17.15%) when water was applied after 4 days interval. The interaction effects (D×I) were also statistically significant. Minimum disease severity (5.42%) was recorded when 1.0 cm of irrigation water was applied after 10 days interval and maximum (30.85%) in D3I1 (2.0 cm of irrigation water after 4 days interval). About 21.50 cm of irrigation water was consumed for producing 43.10 tones/ha yield with optimum water productivity of 2.00 tones/ha/cm in the treatment combination involving 1.5 cm of irrigation water applied after 8 days interval and this treatment combination was also rated best in producing maximum net returns and B:C ratio.

135 Effect of integration of bio-control agents and soil amendments on incidence of

stem rot and plant growth parameters in carnation

SUSHMA SHARMA and SUNITA CHANDEL Department of Plant Pathology, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan (HP)-173230.

Email:[email protected]

Stem rot caused by Rhizoctonia solani is a serious soil borne disease of carnation. Field experiment was carried out in Randomized Block Design under polyhouse in experimental farm during 2010 to know the effect of integration of bio-control agents and soil amendments on incidence of stem rot, plant growth and flower parameters. Integration of Melia azedarach seed (powder) along with Trichoderma viride as well as


93

Neem cake with T. viride and T. harzianum gave maximum reduction in disease incidence of stem rot with minimum disease incidence (6%), in comparison to 24.67 per cent in control. Rest of the treatments except control were able to minimize the disease upto (12.67%) which was less compared to above cited best treatments. However, the average plant height (82.32 cm, 81.05 cm), stem length (76.64 cm, 75.91 cm), number of flowers per plant (3.79, 3.68), flower size (7.20 cm, 7.17 cm) were maximum in treatments, T.

viride + Melia azedarach and B. subtilis + Melia azedarach, respectively. Manipulation of soil with biocontrol agents and soil amendments in controlling the stem rot infection in carnation indicating that these combinations helped in checking the disease and improving the plant health.

136 In vitro bioefficacy of bacteria present in organic composts against soil-borne

pathogens

ASHLESHA and Y.S. PAUL Department of Plant Pathology, CSK Himachal Pradesh Krishi Vishvavidyalaya, Palampur (HP) – 176062.


Five organic composts viz, vermicompost, panchgavya, matka khad, biodynamic compost and cow pat pit compost when streaked on potato dextrose agar and nutrient agar media, exhibited the presence of number of microbes. These microbial isolates were purified by culturing a single colony and maintained on nutrient agar. Among these isolates, twelve showed strong antifungal activity against major soil borne pathogens namely Sclerotinia sclerotiorum, Sclerotium rolfsii, Rhizoctonia solani, Fusarium oxysporum and F. solani. Based on morphological and biochemical tests, these were identified as species of Bacillus (6), Actinomycetes (2), Serratia (1) and Pseudomonas (2). In vitro evaluation of these bacterial isolates at different concentrations ranging from 10-1 - 10-6 revealed that all the species of Bacillus were found most inhibitory to S. sclerotiorum (99.7%) followed by F. oxysporum and F. solani (92.0 – 97.0 %). R. solani and S. rolfsii were less sensitive to Bacillus with inhibition ranged between 73.3 – 91.8%. Actionomycetes-I and II showed mycelial inhibition to the tune of 79.7 - 99.9 and 79.5 - 97.5% respectively against all the test pathogens. Species of Serratia caused 97.0% inhibition in mycelial growth of S. sclerotiorum, F. oxysporum

and F. solani and 92.7% inhibition of S. rolfsii but was found less effective against R. solani. Similarly, Pseudomonas-II possessed good antifungal property against S. sclerotiorum, F. oxysporum, F. solani, R.

solani and S. rolfsii at all concentrations whereas Pseudomonas-I was least effective against all the tested pathogens. Also, with a decrease in concentration of bacteria corresponding increase in mycelial growth was noticed.

137 Evaluation of organic inputs against Ralstonia solanacearum – a bacterial wilt pathogen of capsicum

ASHLESHA and Y.S. PAUL Department of Plant Pathology, College of Agriculture, CSK Himachal Pradesh Krishi Vishvavidyalaya, Palampur

(HP) – 176062. Email: [email protected]

Seven organic inputs viz; biosol, matka khad, fermented buttermilk, panchgavya, biodynamic compost tea, cow urine and vermiwash were evaluated in vitro against Ralstonia solanacearum causing bacterial wilt of capsicum. Tetrazolium chloride medium (TZC) was amended with both sterilized and unsterilized organic inputs at different concentrations (0.5-4.0 %). Unsterilized biodynamic compost tea showed 91.30 % inhibition at 2.0 % and 95.60% inhibition at 4.0 % concentration in the bacterial growth whereas biosol (unsterilized) was also found effective in inhibiting bacterium with 92.30%. Combination of biosol, cow urine, fermented butter milk, biodynamic compost tea, vermiwash and homa ash enhanced the survivability of seedlings upto 13.65 days at 1:10 ratio after 1 hr dip duration when seedlings were tested in Hoagland’s solution. All organic inputs were evaluated under polyhouse conditions against bacterial wilt of capsicum at three locations in district Kangra. Among these organic inputs, drench with mixture of five organic inputs named as orguard before and after transplanting along with seedling dip in biosol for 10 min. before transplanting provided 86.64, 85.22 and 84.64 per cent disease control at Rajol, Palampur and Sungal areas of Kangra.


94

138 Purification of an antifungal protein from kiwifruit for biological control of fungal diseases

NEERJA RANA, ABHISHEK WALIA, C.K. SHIRKOT and VISHAL S. RANA*

Department of Basic Sciences, *Department of Fruit Science, Dr YS Parmar University of Horticulture and Forestry,

Nauni, Solan (HP)-173230. E mail:[email protected]

The fungal diseases in plants are controlled by several cultural management techniques. Unfortunately, in many cases we rely exclusively on the use of chemicals. These chemicals are costly and become less effective after evolution of pathogens. Moreover, their use is potentially harmful to the environment. Therefore, there is need to find innovative ways for controlling fungal diseases without using chemicals. Certain newly developed technologies in plant breeding such as gene transfer technology can be used to develop resistant cultivars. Thus, there is an extensive search for genes that encode proteins with a direct inhibitory effect on the growth of fungal pathogens. Some plants are known to contain a variety of pathogenesis related (PR) proteins. A study was conducted to isolate antifungal protein from four commercial kiwifruit cultivars viz., Allision, Bruno, Hayward and Monty grown under mid hill conditions of Himachal Pradesh. A low molecular weight (25 KDa) antifungal protein was purified from Hayward variety of kiwifruit. It was purified to apparent homogeneity involving saline extraction, (NH4)2SO4 precipitation, anion exchange chromatography on DEAE-cellulose and gel filtration on Sephadex G-100, respectively. The protein isolated from kiwifruit exhibited antifungal activity against fungal plant pathogens like Fusarium

oxysporum and Rhizoctonia solani but did not exhibit inhibitory effect against Dematophora necatrix.

139 Efficacy of Beauveria bassiana (Balsamo) alone and in combination with endosulfan and deltamethrin against Spodoptera litura (Fabricius)

P.L. SHARMA and AJAY SHARMA Department of Entomology, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan (HP).

Efficacy of Beauveria bassiana (Balsamo) alone and in combination with endosulfan and deltamethrin was studied in the laboratory by larval- and leaf-dip method against the tobacco caterpillar, Spodoptera litura (Fabricius), an important pest of many economically important crops. Treated larvae of different stages died due to mycosis in 7-11 days. The cumulative mortality recorded was 16.7-46.7, 13.3-43.3, 20.0-36.7, 10.0-33.3 and 12.3-30.0 per cent in first, second, third, fourth and fifth instar larvae, respectively, when treated at 103 - 108 conidia/ml. Endosulfan (0.005 and 0.01%) and deltamethrin (0.0007 and 0.0014%) inhibited the growth of B. bassiana by 27.84, 35.31, 18.10 and 32.79 per cent, respectively. B. bassiana, however, when applied at 103-108 conidia/ml fortified with endosulfan (0.005%) and deltamethrin (0.0007%) resulted in slightly higher mortality of 6.7-50.0 and 13.3-50.0 per cent in second and 6.7-40.0 and 13.3-46.7 per cent in fourth instar than applied alone (13.3-43.3 and 10.0-33.3 %, respectively). Both the insecticides, though, inhibited the growth of the fungus in plates, but, enhanced the efficacy of the fungus which may be attributed to the stress created by the insecticides to the treated larvae.

140 Fruit rot (Phytophthora Capsici) incidence in bell pepper (Capsicum annuum L.) as influenced by different transplanting dates and spacing

NAVAL KISHOR, H. DEV SHARMA, RAMESH KUMAR, NAVJOT SINGH and SANDEEP KUMAR Department of Vegetable Science, Dr YS Parmar University of Horticulture & Forestry, Nauni, Solan-173 230 (HP).

Fruit rot (Phytophthora Capsici) is a major disease of bell pepper, which influences yield and quality of produce. The agro-climatic condition of the low and mid hills of Himachal Pradesh offer the wide scope for quality produce of the crop, but the quality of the produce infected by fruit rot during rainy season, which further affect the yield. So, there is need to standardize the most suitable planting time and spacing for obtaining quality produce. Therefore, present investigation was carried out at Vegetable Research Farm of the Department of Vegetable Science, Dr. YS Parmar University of Horticulture and Forestry, Nauni, Solan (HP) during Kharif season of 2011. The experiment was laid out in Randomized Block Design Factorial,


95

comprising of 24 treatment combinations of different planting time (P1 :April 04; P2 :April 11; P3 :April 18; P4 :April 25; P5 :May 02; P6 :May 09; P7 : May 16 and P8:May 23) and spacings (60 x 45 cm, 45 x 45 cm and 45 x 30 cm). Among all the treatment combinations, S1 x P2 (April 11 & 60 x 45 cm) resulted in minimum fruit rot incidence with good quality produce. Hence, for obtaining disease free quality produce, this combination can be recommended for commercial cultivation after multilocation testing.

141 Effect of integrated nutrient management on seed yield of radish cv. Chinese Pink

vis-à-vis soil health and incidence of white rust

RAJENDER SHARMA, SAPANA MEHTA and Y.R. SHUKLA Dr YS Parmar University of Horticulture & Forestry, Krishi Vigyan Kendra, Shimla at Rohru- 171 207 (HP).


The present investigation was conducted at Vegetable Research Farm, Department of Vegetable Science, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan (HP) during 2008-2009. The treatments comprised of 15 combinations of inorganic fertilizers (NPK) and bio-fertilizers (Azospirillum, phosphorus solubilizing bacteria and arbuscular-mycorrhizal fungi). Each treatment was replicated thrice in RBD. The studies revealed that most of the yield contributing characters and seed yield were significantly influenced by different treatment combinations and number of branches per plant, seeds per pod, pod length and ultimately seed yield were recorded maximum following application of Azospirillum (5 kg/ha) and recommended doses of NPK. The highest seed yield recorded for the said treatment combination was 10.2q/ ha. Maximum amount of available nitrogen (558.96 kg/ha) was also observed in the treatment resulting in highest seed yield. However, maximum value of available P was 50.84 kg/ha recorded in treatment PSB + recommended NPK. There was no influence of different treatments on available K content of the soil after harvest. The study revealed that there were no significant differences among different treatments for white rust incidence. In general, the white rust incidence was observed to be less in all the treatments including control due to the prevalence of non-congenial climatic conditions. The incidence of rust varied from 2.08 per cent to 6.25 per cent in treatments receiving different combinations of inorganic and bio-fertilizers. However, maximum (10.41 %) incidence of white rust was observed in control.

142 Effect of integrated nutrient management practices on incidence of white rust,

seed yield and quality of radish

PRINCE KUMAR, Y.R. SHUKLA, R.KUMAR, S.KANSAL, SANDEEP KUMAR and VIJAY KUMAR Department of Vegetable Science, Dr YS Parmar University of Horticulture and Forestry, Nauni-Solan-173 230 (HP).

email: [email protected]

Radish (Raphanus sativus L.) is very popular vegetable crop due to its nutritional as well as economic importance. The crop has special significance in Himachal Pradesh as it is grown round the year to fetch higher returns. Round the year cultivation of radish require huge quantity of quality seed to boost its production. White rust (Albugo candida) of crucifers is the most serious disease in seed crop of radish which is responsible for qualitative as well as quantitative losses to farmers who are engaged in seed production programme. Indiscriminate use of synthetic fertilizers, fungicide and other pesticide causes ecological hazards, resistance against fungicide and increased cost of production. Therefore, a study was conducted to assess the effect of integrated nutrient management on incidence of white rust, seed yield and quality of radish cv. Chinese Pink at research farm of Department of Vegetable Science, Dr YS Parmar university of Horticulture and Forestry, Nauni, Solan (HP) during rabi season of 2009-10. There were fifteen combinations of different treatments comprising of organic sources (vermicompost, biovita liquid and granules), biofertilizers (Azotobacter and PSB) and inorganic fertilizers (NPK). All the treatments were replicated thrice in RBD. Significant differences were obtained among all the character under study. Minimum incidence of white rust was recorded with the application of vermicompost + biovita (l) +75% recommended dose of NPK. Maximum seed yield (11.52q/ha) was recorded with the application of vermicompost + biovita (l) +75% recommended dose of NPK.


96

143 Effect of conjoint application of organic and inorganic sources of nutrients on disease incidence in capsicum (Capsicum annuum L.)

K.S. THAKUR, S.KANSAL, D.K. MEHTA* and DHARMENDER KUMAR Department of Vegetable Science, *Seed Technology & Production Centre, Dr. YS Parmar University of Horticulture and Forestry, Nauni- Solan (HP)-173230. E-mail: [email protected]

Capsicum is an important cash crop and widely grown vegetable crops in mid hills of Himachal Pradesh. Heavy cost is being incurred by the farmers with the usage of inorganic fertilizers in indiscriminate manner, predisposing this crop to the invasion of various diseases. The present study aims to evaluate the effect of different sources of organic and inorganic fertilizers on the incidence of various diseases in capsicum crop. The study was conducted during March to September 2010 in the Vegetable Research Farm of the Department of Vegetable Science, Dr Y S Parmar University of Horticulture and Forestry, Nauni, Solan (H P). Nine combinations of inorganic (N, P and K) and biofertilizers (Azotobacter, PSB and PGPR) were replicated thrice in a plots having dimensions of 2.40 m X 2.70 m. The experiment was laid out in a randomized block design and a spacing of 60 cm X 45 cm was followed. Crop was transplanted on 4th May, 2010. Disease incidence of Phytopthora fruit rot was significantly reduced to the tune of 6.44% with the application of biofertiolizers viz. Azotobacter and PSB along with 75% N & P + 100% K. However, maximum fruit rot incidence (10.07%) was recorded when the recommended doses of NPK were applied. The periodic observations for phytophtora blight severity revealed that disease appeared in a very low proportion (less than 5%) in different treatments under study, indicating a non-significant effect of treatments over the leaf blight severity.

144 Raising healthy chrysanthemums- a management perspective

MEENAKSHI BASOLI, S.R. DHIMAN, P.SHARMA, B.KASHYAP, Y.C. GUPTA and H. R. GAUTAM* Department of Floriculture and Landscaping, *Department of Mycology and Plant Pathology,Dr YS Parmar University

of Horticulture and Forestry, Nauni , Solan, H.P. 173 230. Email: [email protected]

Raising healthy crop is the first and faremost requirement of any crop production programme. Effective crop husbandry management includes various operations like site selection and soil preparation, raising of mother block, preparation of healthy planting material, application of manures and fertilizers through Integrated Nutrient Management approach, irrigation, intercultural operations like pinching, disbudding, deshooting and staking etc., and control of diseases and insect-pest. Experience gained related to these reveal that chrysanthemum should be cultivated in sunny areas having well-drained, sandy –loam soils with pH 6.2 to 6.5. The soil should be sterilized thoroughly. Cuttings should be taken from healthy disease and insect-pest free mother plants. Integrated nutrient management approach should also be followed for raising healthy plants. One week before planting vermicompost, full dose of P and K and half dose of N should be incorporated into the beds. The remaining half dose of nitrogen should be applied after 30 days of planting. Azotobacter and PSB should be applied by dipping the roots of cuttings into a slurry of 200 g of the inocula dissolved in one litre of 10 % sugar solution at the time of planting whereas, VAM (2g/plant) should be applied in the planting pit. Findings revealed that application of 22.5 g/m2 each of NPK + Vermicompost (1 kg/m2) + biofertilizers results in healthy and better flower production of chrysanthemum. Disease like septoria leaf blight was mainly observed in crop especially during rainy season. And aphids, cutworms and mite were main insect-pest from which crop should be protected.

145 Effect of soil solarization on pathogenic potential of Fusarium oxysporum f.sp.

dianthi causing wilt of carnation

H.S. NEGI and HARENDER RAJ

Department of Plant Pathology, Dr YS.Parmar University of Horticulture and Forestry, Nauni, Solan-173230 (HP).


Carnation is infected by many diseases but, wilt caused by Fusarium oxysporum f.sp. dianthi is the most prevalent and destructive disease in India. Soil solarization is one of the most effective and eco-friendly


97

methods for controlling soil-borne diseases. Soil solarization with transparent polyethylene sheet (25 µm thick) and biodegradable plastic sheet (25 µm thick) for 40 days resulted in an increase of 5.6 and 3.0°C in average maximum soil temperature, respectively at 5 cm soil depth in comparison to unsolarized soil in the polyhouse. As the duration of the soil solarization of the culture increased from 20, 30 to 40 days the incubation period was increased by 27.17, 42.86 and 47.10 per cent in transparent polythene sheet and 16.67, 30.95 and 33.86 per cent in biodegradable plastic sheet, respectively at 5 cm soil depth in comparison to the culture of the pathogen retrieved from unsolarized plots. Soil solarization of the culture of wilt pathogen retrieved from 5 cm soil depth after 20, 30 and 40 days resulted in 30.77, 50.0 and 81.82 per cent reduction in the wilt incidence in transparent polyethylene sheet and 23.08, 25.0 and 63.63 per cent reduction in biodegradable plastic sheet, respectively in comparison to the incidence of wilt when cultures were retrieved from unsolarized plots at the same depth.

146 Enhancing efficacy of soil solarization with soil amendments, bio-fumigants and

biological control agents for the management of wilt of chrysanthemum

HARENDER RAJ1, SHALINI CHANDEL1 and S.R.DHIMAN2

1Department of Plant Pathology;

2Department of Floriculture and Landscaping, Dr YS Parmar University of

Horticulture and Forestry, Nauni-173230, Solan (HP).

Wilt (Fusarium oxysporum) and stem rot (Rhizoctonia solani) are serious problem in chrysanthemum which result in lot of mortality. It is difficult to control the disease with drenching with chemical fungicides. Soil solarization is an effective method for the management of soil-borne pathogens and the technique was integrated soil amendments, bio-fumigants and biological control agents for the management of wilt and other soil-borne pathogens. Integration of soil solarization with soil amendments, bio-fumigants and biological control agents was found effective for the management of wilt in the field. Soil solarization with transparent polyethylene mulch (25 µm thick) resulted in 8.7 oC increase in average maximum soil temperature at 5 cm soil depth with average maximum temperature of 38.7oC. Integration of soil solarization with soil amendment of Neem cake and with drenching with Quintal and SAAF was found equally effective and statistically at par with no incidence of the disease in solarized plots. Soil solarization alone was also found effective with 54.7 per cent reduction in the disease incidence. Integration of soil solarization with bio-fumigant cabbage leaves was also found effective with 1.6 per cent incidence of the disease. Integration of soil solarization with neem cake resulted in highest shoot length of 54.3 cm in comparison to 50.3 in drenching with Quintal and 42.5 cm in solarized control. Though, chemical fungicides were found effective in complete control of the disease in solarized plots yet the flower yield and quality was better in treatment combination of soil solarization with soil amendment of neem cake.

147 Bio-agents used against ecto-parasitic mite, Varroa destructor Anderson and Trueman, in Apis mellifera L. colonies

JATIN SONI, R.K. THAKUR AND J.K. GUPTA Department of Entomology, Dr YS Parmar University of Horticulture & Forestry, Nauni, Solan (HP). 173 230.


Varroa destructor Anderson and Trueman is an important ecto-parasite of the European honey bee, Apis

mellifera L. At present, the mite is controlled with chemical pesticides, but resistance has already been recorded against different acaricids. Thus, there is a need to search for alternate methods of mite management in honey bee colonies including use of biological agents. The paper reports the efficacy of some bio-agents, like Metarhizium anisopliae, Verticillium lecanii, Beauveria bassiana and Bacillus thuringinensis

var. kurstaki using different methods of application. Three methods of dose administration, viz. strip, spray and direct feeding were evaluated. The bio-agents were administered @ 108 spores/ colony by strip and spray method and 107 spores/ colony by direct feeding method. The results showed variations in mite infestation in experimental colonies which varied between 4.27 to 7.52 per cent. Out of bio-pesticides included in the study, on M. anisopliae administered by strip method was effective in trapping the mites while spray method failed in trapping the mites.


98

148 Honey bee Apis mellifera (Hymenoptera: Apidae) safety against entomopathogenic bioagents

JATIN SONI, R.K. THAKUR and J.K. GUPTA Department of Entomology, Dr Y S Parmar University of Horticulture and Forestry, Nauni, Solan (HP)173230.


A variety of bioagents including fungi are being used for controlling insect pests of crops in different parts of the world. The safety of these bio-agents to non target organisms including honey bees need to be worked out under different environmental conditions. Therefore, studies were conducted on safety of three Entomopathogenic fungi, Metarhizium anisopliae, Verticillium lecanii and Beauveria bassiana to workers of Apis mellifera by feeding experiment in hoarding cages (dose rate 107 spores/ 50 bees). There was no significant difference in the bee mortality in the control and bees fed with spores of M. anisopliae. The LT50 values were 5.6 and 4.7 days in the control and treatment, respectively. However, significant differences were observed in the bee mortality when bees were fed spores of V. lecanii and B. bassiana. The respective LT50 values were 5.3, 3.2 and 6.4, 4.8 days in the control and treatment. All the three biopesticides when used inside the bee colonies by “strip method” (108 spores/colony) did not, cause significant mortality in the experimental colonies. The application of these biopesticides inside bee colonies resulted in increasing the dead mite count of parasite Varroa. By using M. anisopliae, 68.08 per cent of the mite population dropped on the bottom boards as compared to 26.61 per cent in the control indicating potential of using and further testing this fungus for control of Varroa which is at present threatening bee industry in India.

149 Attack of ecto-parasitic mite (Varroa destructor Anderson and Trueman) in Apis

mellifera L. colonies in Himachal Pradesh

R.K. THAKUR, SUMAN BALA and JATIN SONI Department of Entomology, Dr YS Parmar University of Horticulture & Forestry, Nauni, Solan (HP) 173 230.


Varroa destructor Anderson and Trueman is an important ecto-parasite of the European honey bee, Apis

mellifera L. The attack of Varroa mite coupled with unscientific beekeeping practices have badly affected honey production in Himachal Pradesh. Outbreak of Varroa mite has alone destroyed over 50 per cent honey bee colonies in state, causing considerable economic loss to small and marginal farmers engaged in honey production. Alone in Chamba, kangra and Paonta valley the mite has damaged over 60 percent colonies of the honey bees. Honey bees known as the best natural pollinator has been playing major role in enhancing the production of various agriculture and horticulture crops since time immemorial. About 50 million hectare of cultivated land was fully dependent for pollination in crops on honey bees and other natural pollinators; the attack of mite was causing considerable loss to the yield. Beekeepers should immediately follow complete package of scientific management to save the honey bee colonies from this harmful mite and the best management is to select a breed Varroa tolerant bees, based on inherent natural defence traits of honey bee Apis mellifera in the state. The mite could also be controlled by destroying drone brood, trapping Varroa

on drone brood, use of sticky papers and dusting powdered sugar on bee frames.

150 Effect of partial substitution of chemical fertilizers with vermicompost on growth

and yield performance of Andrographis paniculata Wall. Ex. Nees under plum based agroforestry system

C.L. THAKUR, SILPA V. KUMAR, ANJU THAKUR* and D.R. BHARDWAJ Department of Silviculture and Agro-forestry, * Department of Basic Sciences, Dr Y.S. Parmar University of

Horticulture and Forestry, Nauni- Solan 173 230 (H P).

The present investigation was carried out at experimental field of the Department of Silviculture & Agroforestry, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan (HP) during the year 2010. The experiment was laid out in a randomized block design comprising of seven treatments of


99

fertilizers and vermicompost. The plot size was 2m x 1m and spacing of 30x30 cm for Andrographis paniculata was maintained. Seedlings were transplanted in the month of July, 2010. The observations were recorded on growth, yield and physiological parameters of the species and soil physico-chemical characteristics. The effect of different doses of vermicompost on growth, yield and physiological parameters on the species was found significant. The plum trees had a positive effect on growth and yield performance of Andrographis and also found healthier and more thriving underneath plum condition than in open conditions. Among the different doses of organic manures tried, 60% recommended dose + 40% vermicompost for Andrographis was found to be most efficient. The use of organic manure + chemical fertilizers has been found to be more efficient than organic manures alone. Different doses of organic manures and chemical fertilizers were found to have influence on soil pH, bulk density, organic carbon, available NPK in the surface as well as subsurface soils. The bioeconomics of the plum based agroforestry system intercropped with Andrographis paniculata revealed that the total net return was Rs. 89,939/- per hectare. It is suggested that the cultivation of medicinal herbs by supplying organic manures in combination with inorganic fertilizers under plum based agroforestry systems may be recommended for better economic returns.


100

PGPRs, Mycorrhizae and Fleshy Fungi

151 Screening of fluorescent Pseudomonas isolates from the rhizosphere of apple and

pear against the phytopathogenic fungi

DEEPSHIKHA THAKUR, MOHINDER KAUR, RAJESH KAUSHAL and VINEET SHYAM Department of Basic Science, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan (HP) -173230.


Phytopathogenic microbes have an immense effect on the agricultural productivity, greatly reducing crop yields and sometimes even causing total crop loss. Fungicides being used for control measures have the negative effects not only on the environment and human health but also on the resistance problems. In this context, biological control of plant diseases employing bacterial/ fungal isolates is gaining attention as an alternative method to control pathogenic fungi. Rhizosphere microorganisms provide an initial barrier against pathogen attack to the root. Among the rhizospheric microorganisms, Pseudomonas fluorescens has a great potential against majority of plant pathogens. Antibacterial and antifungal properties of Pseudomonas species are due to antibiotics and bacteriocins produced by them. In this investigation, total thirty Pseudomonas isolates were isolated from the different orchards of apple and pear i.e. normal and replant sites at various locations in Distt. Shimla of Himachal Pradesh and were characterized for the production of antifungal activity against two indicator fungi viz. Fusarium oxysporum, Alternaria spp. Out of thirty isolates, nine showed antifungal activity against Fusarium oxysporum and six isolates showed antifungal activity against Alternaria spp. Thus, it can be concluded that Pseudomonas offers an attractive way to replace chemical fertilizers, pesticides, and supplements due to its natural biocontrol ability.

152 Antifungal activity of Bacillus spp. isolated from rhizosphere of cherry (Prunus

avium) against different phytopathogenic fungi

VINEET SHYAM, RAJESH KAUSHAL* and DEEPSHIKHA THAKUR*

Ministry of Health and Food Safety, FSSAI, Chandigarh, *Department of Basic Science, Dr. YS Parmar University of

Horticulture and Forestry, Nauni, Solan (H.P) -173230. Email: [email protected]

Prunus avium L. (sweet cherry) is a member of Rosaceae family, being fairly distinct stone fruit, commercially grown in the states of Jammu and Kashmir, Himachal Pradesh. In Himachal Pradesh, 2000 hectares of land is under cherry cultivation with production of 438 tons. The nutritional and soil borne pathogenic diseases are the major bottleneck of lower production of cherry production. The indiscriminate use of chemical pesticides/ fungicides being used has several negative effects i.e. development of resistance and their non target environmental impacts. In this scenario, the effective option is to employ the pathogen’s natural enemies, which are less destructive and more environmental friendly than chemical inputs. Rhizosphere microorganisms, in general, provide an initial barrier against pathogen attack to the root system. Among these rhizospheric microbial population, Bacillus spp. has a great potential against plant pathogens. In the present investigation about 50 bacterial isolates were isolated from rhizosphere and roots of cherry plants from various locations of H.P and out of them three efficient isolates viz. VS2, VS6 and VS9 with multifarious plant growth promoting traits viz. Phosphorous solubilisation, nitrogen fixation, siderophore production etc. were characterized for the production of antifungal activity against the indicator fungi viz. Fusarium oxysporum, Rhizoctonia solani, and Pythium aphanidermatum. All the three isolates were found to have antifungal activity against these test fungi. The growth inhibition under in vitro condition varied from 78.33% to 90.57% against Fusarium oxysporum, Rhizoctonia solani, and Pythium aphanidermatum. Thus, the isolates can be used as biocontrol for diseases caused by the test fungi and thereby reducing the use chemical inputs.


101

153 Antagonistic activity of plant growth promoting rhizobacteria isolated from tomato rhizosphere against soil borne fungal plant pathogens

ABHISHEKWALIA, PREETI MEHTA, ANJALI CHAUHAN and C.K. SHIRKOT

Department of Basic Sciences, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan (HP)-173230.


The use of single strain inoculum with multiple plant growth promoting activities offers a new concept to address multiple mode of action by combined use of multi-strain inoculum of PGPR each with specific capability and function. In the present work, bacterial isolates with plant growth promoting activities like P-solubilization, IAA production, siderophore production and broad spectrum antifungal activity against Fusarium oxysporum, Rhizoctonia solani and Sclerotinia sclerotiorum were isolated from the rhizosphere soil of tomato seedlings. In vitro antifungal antibiotic study revealed that among eleven isolates N11 showed maximum inhibition against Fusarium oxysporum (82.85%), Rhizoctonia solani (76.45%) and Sclerotinia

sclerotiorum (74.71%) after seven days of incubation. The per cent growth inhibition increased with increase in bacterial cell density from O.D 0.25 to 1.50. The novelity of the isolates is that the antibiotic production is induced only in the presence of fungal host and lack of antifungal activity in culture filtrate. Bacterial isolate N11 showing maximum plant growth promoting activities and was identified to species level by biochemical characterization and 16S rRNA gene sequencing. Preliminary identification of bacterial isolate was made on the basis of morphological and biochemical characters and confirmed by partial 16S rRNA gene sequencing, which validated isolate N11 as Bacillus subtilis strain CKT1.Thus, the present study concludes that these bacterial isolate could serve as a proficient biocontrol PGPR inoculant in the integrated management of soil borne diseases of tomato.

154 Effect of antagonistic PGPR isolates on control of soil borne diseases of capsicum (Capsicum annuum L.) for enhanced growth and yield

SHWETA GUPTA, RAJESH KAUSHAL and R.S. SPEHIA*

Department of Basic Sciences, *Department of Soil Science, Dr YS Parmar University of Horticulture and Forestry,

Nauni, Solan-173 230 (HP). E-mail: [email protected]

Indiscriminate use of pesticides not only leads to environmental pollution and residual toxicity to humans, animals and plants but also has ill effects on beneficial soil microbial community. This phenomenon has promoted considerable interests in field of biological control of plant insects pests and diseases. Biological control offers eco-friendly, cheap, non-phytotoxic alternative in the framework of ecological organic farming. Under present study, rhizosphere soil and root samples of capsicum were collected from low and mid hills of H.P. during 2010-11 by selecting four locations i.e. Taradevi, Theog, Nauni and Lanachetah in Shimla and Sirmour districts of state. A total of 56 isolates were isolated by using modified replica plate method. On basis of colony morphological similarities, only 10 isolates were screened for possession of multifarious plant growth promoting traits (growth promotion and inhibition of soil borne pathogens). All 10 PGP isolates had inhibitory effect on development of at least one or more soil borne fungus under in vitro conditions. The strongest antagonism was observed for RS7 isolate with growth inhibition of 41.77%, 42.46% and 40.04% against Pythium spp., Phytophthora spp. and Colletotrichum spp., respectively followed by RS2 isolate with percent growth inhibition by 40.04% of Pythium spp. and 37.85% of Colletotrichum spp. Similar observations were recorded for RS4 isolate against Pythium spp. and Phytophthora spp. On basis of morphological, physiological and biochemical characteristics, the RS7 isolate was tentatively identified as Bacillus spp. and used for seed and soil treatment which has significantly increased plant growth and yield of crop over uninoculated control. Efficacy of RS7 isolate as seed treatment is equivalent to standard fungicide treatment. The present results provide base line for future research on bacterial biological control of soil borne fungal diseases in vegetable crops under ecological organic farming system.


102

155 Biocontrol and plant growth promoting traits (PGPT) in bacterial isolates isolated from tomato growing in mid hills of Himachal Pradesh

RASHMI SHARMA, PARUL SHARMA and C.K. SHIRKOT

Department of Basic Sciences (Microbiology Section), Dr Y S Parmar University of Horticulture and Forestry, Nauni,

Solan (HP) 173230. Email: [email protected]

A bacterial collection of a hundred native bacterial isolates, isolated from rhizosphere of tomato grown in Mid Hills of Himachal Pradesh was established. From this collection a screening to identify bacterial isolates exhibiting different plant growth promoting traits and biocontrol activities was performed. A total of twenty six isolates were screened by replica plating out of which ten native strains displaying significant plant growth promoting traits viz. Phosphprus solubilization, IAA production, siderophore production, growth on nitrogen free medium as well as biocontrol activity against phytopathogenic fungi belonging to Alternaria

sp., Fusarium oxysporium, Dematophora necatrix, Sclerotium rolfsii, Phytophthora sp., and Pythium

aphanidermatum were selected for studying growth promotion of tomato in growth chamber. Isolates S2, S8, S16, S19, S25, E1 and S2, S17, S21and S25 showed a significant increase in root and shoot length respectively. Significant increase in root and shoot dry weight was also observed. Isolate S25 exhibiting maximum phosphate solubilization (345 µg/ml), IAA production (95 µg/ml), and siderophore production (110.66 % S.U.) showed maximum increase in various root shoot parameters.

156 In vitro evaluation of PGPRs against soil borne pathogens of cauliflower

BHAWNA DIPTA, RAJESH KAUSHAL and DEEPSHIKHA THAKUR Department of Basic Sciences, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan (HP)-173 230.


Cauliflower (Brassica oleracea var. botrytis L.) is an important and widely consumed Cole crop. In Himachal Pradesh, it is grown throughout the year for raw vegetable and seed production purpose in different agro-climatic zones. Soil-borne plant pathogens like Sclerotinia sclerotium and Pythium ultimum often attack this crop and cause severe losses. Indiscriminate use of chemical fertilizers and pesticides has adverse affect not only on nutritive value of crops but also on soil health. In the organic agriculture scenario, an effective alternative to reduce environmental hazards is the use of biofertilizers/PGPRs as they are eco-friendly. It also contributes towards sustainable production without hampering the human health and environment. The present investigations focused on the evaluation of four bacterial isolates viz. MK5, MK7, MK9 and VG1 for their in vitro antagonistic activity against the selected fungal pathogen of the crop. The growth inhibition by the application of the bacterial isolates under in vitro conditions varied from 25 to 33 per cent against Sclerotinia sclerotium and 28 to 35 per cent against Pythium ultimum. All the four bacterial isolates showed inhibitory effects against the test pathogens and also showed multifarious plant growth promoting trait, hence can be used as biofertilizers as well as biocontrol agents.

157 Antagonism of bacillus subtilis (strain ckt5) towards Fusarium oxysporum

ANJALI CHAUHAN, SEEMA VERMA, RISHI MAHAJAN, A.WALIA and C.K. SHIRKOT Department of Basic Sciences, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan (HP)-173230. E-

mail: [email protected]

A rhizospheric soil bacterium, Bacillus subtilis strain CKT5, isolated from the rhizosphere of tomato, showed high antagonistic activity against Fusarium oxysporum. Phylogenetic characterization of rhizosperic isolate CKT5 based on sequence homology of a partial 1375 bp fragment of 16S rDNA amplicon, with the ribosomal database sequences NCBI Genbank (www.ncbi.nlm.nih.gov/Genbank/submit.html) under accession number GQ980012 validated the strain as Bacillus subtilis. A clear inhibition zone of 2.7 cm was observed in dual plate assay. The strain CKT5 had shown a considerable antifungal potential against Fusarium oxysporum along with different plant growth promoting traits like phosphate solubilization, IAA production, HCN production, Siderophore production and chitinase activity. After 8 days of incubation, the


103

bacterial strain grew over the fungal mycelial surface and multiplied extensively on it. In dual cultures, Bacillus subtilis strain CKT5 inhibited the Fusarium oxysporum up to 60% in terms of dry weight. This strain also produced a clear halo region on chitin agar medium plates containing 0.5% colloidal chitin, indicating that it excretes chitinase.

158 PGPR: boon for sustainable agriculture

SHWETA SHARMA and MOHINDER KAUR Department of Basic sciences, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan (HP)-173230.

Email: shweta_85sharma @ rediffmail.com

Plant growth promoting rhizobacteria (PGPR) are root associated bacteria representing many different genera and species viz., Cyanobacteria, Actinobacteria, Bacteroidetes, Firmicutes, and Proteobacteria that colonize the rhizosphere, rhizoplane and improve plant growth when artificially introduced onto seeds, seedlings, roots, or into soil. PGPR improve plant growth by one or more mechanisms: direct stimulation of plant growth; enhancement of nutrient uptake; suppression of plant pathogens; and/or induction of resistance in host plants against pathogens. The beneficial effect of these bacteria have been variously attributed to their ability to produce various compounds including phytohormones, organic acids and siderophores, fixation of atmospheric nitrogen, phosphate solubilization, antibiotics that suppress deleterious rhizobacteria or to some other unidentified mechanisms Today, many economically important agricultural, horticultural and ornamental crop plants are attacked by various soil borne and foliar diseases, resulting in billions of dollars in crop losses. Currently, the most widely used disease management strategy is the use of chemical fungicides. However, the use of these fungicides has encountered problems, such as development of resistance by pathogen to fungicides and rapid degradation of the chemicals. PGPR potentiality in agriculture which is steadily increased as it offers an attractive way to replace the use of chemical fertilizers, pesticides and other supplements. Recent progress in our understanding on the diversity of PGPR in the rhizosphere along with their colonization ability and mechanism of action should facilitate their application as a reliable component in the management of sustainable agricultural system. Plant growth promoting rhizobacteria (PGPR) have gained worldwide importance and acceptance for agricultural benefits. This is due to the emerging demand for dependence diminishing of synthetic chemical products, to the growing necessity of sustainable agriculture within a holistic vision of development and to focalize environmental protection.

159 Characterization of Bacillus isolates from tomato rhizosphere and their potential PGPR traits

ANJALI CHAUHAN, RISHI MAHAJAN, S.VERMA, A.WALIA, P.MEHTA and C.K. SHIRKOT Department of Basic Sciences, Microbiology, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan

(HP)-173230. E-mail: [email protected]

Bacillus spp. are well known rhizosphere residents of many crops and usually show plant growth promoting (PGP) traits that include biocontrol capacity against some phytopathogenic fungi. Tomato is most remunerative cash crop of mid hills of Himachal Pradesh being grown as an important off-season vegetable

for fresh market supply to the plains of northern India. Tomato crop has many nutritional and

phytopathogenic problems that have a significant impact on production. In this context is important to investigate the natural presence of these microorganisms in the tomato rhizosphere and propose a selective screening to find promising PGP strains. In this study, thirty Bacillus strains isolated from the rhizosphere of native tomato varieties growing in the Himachal Pradesh were screened for in vitro antagonism against Rhizoctonia solani and Fusarium solani, Alternaria spp., Sclerotium rolfsii and Dematophora necatrix. A high prevalence (81%) of antagonists against R. solani was found. Fifty six percent of those strains also inhibited the growth of F. solani, Alternaria spp, Sclerotium rolfsii and Dematophora necatrix. The antagonistic strains were also tested for other plant growth promotion traits. Seventy four percent produced some level of the auxin indole-3-acetic acid, and 70% solubilized tricalcium phosphate. Phylogenetic analysis revealed that the majority of the strains belonged to B. subtilis. The results suggested that the


104

rhizosphere of native tomato growing in their natural habitat in Himachal Pradesh is a rich source of Bacillus

fungal antagonists, which have a potential to be used in the future as PGP inoculants to improve tomato crop.

160 Biocontrol and plant growth promoting rhizobacterial traits (PGPRT) in Podophyllum hexandrum collected from high hills of Himachal Pradesh

PARUL SHARMA, RASHMI SHARMA and C.K. SHIRKOT

Deptartment of Basic Sciences (Microbiology Section), Dr YS Parmar University of Horticulture and Forestry, Nauni,

Solan (HP) 173230. Email: [email protected]

Podophyllum hexandrum is an important medicinal plant found in Himalayan region. A study was undertaken to isolate and screen bacterial isolates from rhizosphere and endophytic region of the plant. Forty bacterial strains were isolated from rhizosphere of plants collected from site Chuddharin district Sirmour. All the isolates were screened for PGPR activities like phosphate solubilisation, siderophore production, IAA production, nitrogen fixation and antifungal activity against Alternaria, Phytopathora sp., Pythium aphanidermatum, Dematophora necatrix, Fusarium oxysporum, Sclerotium rolfsii. Ten isolates showing maximum PGPR traits were further investigated for growth promotion of tomato. They were further evaluated for their plant growth promotion effects in terms of seed germination, root and shoot length elongation and plant biomass. Isolates 2a1, 1a1*, 2b2* significantly increased the plant biomass and other growth parameters. Isolate 2a1 exhibited maximum increase by 130.77% in root dry weight and by 334.46% in shoot dry weight as compared to control.

161 Phosphate solubilizing bacterial isolates associated with mushroom compost and their role in plant growth promotion

RUCHI SHARMA, M.K. GUPTA* and RAJESH KAUSHAL Department of Basic Sciences, Dr YS Parmar University of Forestry and Horticulture, Nauni, Solan (HP)-173230,

*Department of Microbiology, College of Basic Sciences, CSK HPKV, Palampur-176062.


Plant growth-promoting bacteria (PGPB) are rhizosphere bacteria that can benefit plant growth by different

mechanisms. The ability of these bacteria to convert insoluble phosphorus (P) to plant accessible form, various orthophosphate ions, is an important trait in a PGPB. The application of these phosphate solubilizing bacteria as inoculants increases P-solubilization and its subsequent uptake by the plant which enhance the crop yields. In the present investigations, a total number of 30 bacterial isolates were isolated from the mushroom compost samples, i.e. pasteurized compost, during cropping viz., at the time of spawning, after complete spawn run, at the time of casing and during first, second and third flush. On the basis of qualitative (clear zone) and quantitative (amount solubilized) two isolates PC-PSB1 and CS-PSB1 were found to be best P-solubilizing bacterial isolates which solubilizes about 485.0 µg/ml and 539.0 µg/ml of phosphorus over control. Application of such native organisms isolated from the compost would be much more useful in cultivation of mushroom and the use of spent compost in grain culture production.

162 Screening of siderophore producing plant growth promoting rhizobacteria with potential biocontrol efficacy

SHALINI CHANDEL, RISHI MAHAJAN, ANJALI CHAUHAN and C.K. SHIRKOT Department of Basic Sciences, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan (HP)- 173230.


Siderophore are compounds secreated under low iron stress, which act as specific iron chelating agents, making iron unavailable to soil borne fugal pathogens and thereby making it available to plant roots and thus benefit plant growth. In the present study, 56 siderophore producing bacterial isolates, possessing multifarious plant growth promoting traits (30 endophytic and 26 rhizospheric) were selected (by modified


105

replica plating technique) from the rhizosphere soil and roots of the four cultivars of apple viz. Starking Delicious, Golden Delicious, Red Chief and Red Golden. Siderophore production varied among isolates along with variation in type (Hydroxamate, carboxylate, catecholate) of siderophore produced. These siderophore producing isolates exhibited an average 45.80% growth inhibition against Phytopathora sp., 50.39% against Pythium aphanidermatum, 53.72% against Dematophora necatrix, 50.03% against Fusarium oxysporum and 48.62% against Sclerotium rolfsii.The present study, therefore, suggests the use of siderophore producing PGPR as bio-inoculants for raising quality disease free apple nursery and in long term to develop cost effective ecofriendly sustainable system in the management of horticultural problems.

163 Biodiversity of endophytic mycorrhiza in some medicinal plants of Himachal

Pradesh

ADITYA KUMAR1, CHHAVI MANGLA2 and ASHOK AGGARWAL2

1School of Biological and Environmental Sciences, Shoolini University, Solan, Himachal Pradesh- 173229,

2Department of Botany, Kurukshetra University, Kurukshetra (Ha)-136119.Email: [email protected]

The present investigation was carried out to study the endomycorrhizal status of some medicinal plants of Himachal Pradesh and to select the predominant AM fungi for future inoculation studies for production of quality seedling of important plants in nurseries and their better survival in adverse conditions. The study was undertaken at different sites located in Himachal Pradesh. Root samples were examined by rapid clearing and staining method of Phillips and Hayman (1970) and rhizospheric soil samples were wet- sieved for AM spores using the technique of Gerdemann and Nicolson (1963). The identification was based on morphological characters like spore colour, shape, wall structure, surface ornamentation, bulbous suspensor, number and arrangement of spores in sporocarp, nature and size of subtending hyphae. Root samples of all the plant species showed a wide range of variation in terms of AM root colonization. AMF root colonization ranged from 0.0±0.0 to 100±0.0 percent. The plants showing 100% AMF colonization were Cichorium

intybus, Euphorbia heleoscopia, Leucas malliisima, Ocimum gratissimum and Tylophora asthalmatica. The plant lacking mycorrhizal infection was Achyranthes aspera (0.0±0.0). Likewise, the families like Asteraceae, Euphorbiaceae, Lamiaceae and Asclepiadaceae showed 100%AM root colonization. The AM spore density ranged from 25.66±3.00 to 841±25.9. The highest spore population was recorded in the rhizospheric soil of Rosmarinus officinalis (841.0±25.9) and the lowest was recorded in Aloe vera (25.66±3.00). Sixty seven AM fungal taxa belonging to six genera i.e. Acaulospora, Entrophospora, Glomus, Gigaspora, Sclerocystis and Scutellospora were isolated. AM fungi belonging to genus Glomus were dominant and Scutellospora was rare. Agricultural sustainability could be viewed as ‘maximum plant production with minimum soil loss’. This type of study could be the beginning of further research pursuits that will utilize such symbiotic fungi to manipulate the host in different ways.

164 Studies on AM and mycorrhizosphere fungi of Almond (Prunus dulcis)

J.S. THAKUR Vallabh Government College, Mandi (HP).

Studies on AM and mycorrhizosphere fungi of 10 year old almond trees were carried out in district Kullu, H.P. Soil samples were collected in four different seasons and analyzed by wet sieving and decanting method for collection of VAM spores where as, isolation of mycorrhizospheric fungi was done by dilution plate method. The identification of AM spores showed the presence of six species of Glomus and one species of Acaulospora in the rhizosphere. Eleven mycorrhizospheric fungi were isolated in which nine were from Deuteromycotina and two from Zygomycotina. Aspergillus flavus, Mucor spp, Penicillium chrysogenum and

Rhizopus nigricans were most predominant in all the four seasons.


106

165 Indole derivatives production by the root endophyte Piriformospora indica and its role in colonization of barley roots

MONICA SHARMA1, MAGDALENA HILBERT2, ALGA ZUCCARO2 and KARL-HEINZ KOGEL3

1Department of Plant Pathology, Dr. YSP UHF, Nauni, Solan, HP, India;

2Department of Organismic Interactions, Max

Planck Institute for Terrestrial Microbiology, Karl von Frisch Str. 10, 35043 Marburg, Germany; 3Institute of

Phytopathology and Applied Zoology, Justus-Liebig University, Giessen, Germany.

The endophytic fungus Piriformospora indica (Basidiomycota, Sebacinales) colonizes the roots of a broad range of plants with beneficial effects to its hosts. Biochemical analyses of the underlying biosynthetic pathways for auxin production have shown that, upon tryptophan feeding, P. indica can produce the phytohormones indole-3-acetic acid (IAA) and indole-3-lactate (ILA) through the intermediate indole-3-pyruvic acid (IPA). A gene designated piTam1 is the key player in production of indole derivatives and colonization of barley roots with P. indica. The results suggested that IAA is involved in the establishment of biotrophy in P. Indica - barley symbiosis and might represent a compatibility factor in this system.

166 Diversity of macrofungi in Sirmour district of Himachal Pradesh, India

DHARMESH GUPTA, B.C. SUMAN and MANJU SHARMA Department of Plant Pathology, Dr YS Parmar University of Horticulture & Forestry, Nauni, Solan- 173 230 (HP).


Himachal Pradesh lies between 30o22’44’’ North to 30o12’40’’North latitude and its longitudinal extent is 75o45’55’’East to 79o04’20’’East. The forests of Himachal Pradesh are rich in biodiversity and play a vital role in preserving the fragile Himalayan ecosystem. Studies on the diversity of macrofungi are gaining importance, as many macrofungi are becoming extinct and facing threat of extinction because of habitat destructuion. Therefore, fungal forays were undertaken during monsoon season of 2011-2012 to various forests of Nohradhar of Sirmour district, Himachal Pradesh.Various fungi collected were Ramaria spp.(Coral fungi), Cantharellus cibarius (Golden chanterelles), Boletus spp., Agaricus spp., Russula spp. and Ganoderma lucidum. Except G lucidum, all the wild mushrooms were eaten by the local people. The taxonomic details with respect to cap morphology, colour, cap diameter, gill attachment, vegetational community were studied.

167 The Coprinoids from dry temperate zone of Lahoul valley in Himachal Pradesh

S. DHANCHOLIA Center for Mushroom Research and Training, department of Plant Pathology, CSK Himachal Pradesh Krishi

Vishwavidyalaya, Palampur- 176062 (H.P.)

The genus Coprinus is found to be polyphyletic and is separated into three distinct clades. Most Coprinus taxa belong to the first two clades, which together form a larger monophyletic group with Lacrymaria and Psathyrella in basal positions. A third clade contains members of Coprinus section Comati as well as the genus Leucocoprinus, Podaxis pistillaris, Montagnea arenaria, and Agaricus pocillator. This third clade is separated from the other species of Coprinus by members of the families Strophariaceae and Bolbitiaceae and the genus Panaeolus. The majority of species of Coprinus were therefore reclassified into three genera placed in Psathyrellaceae: Coprinellus, Coprinopsis, and Parasola. Coprinus and these segregate genera are now referred to collectively as coprinoid fungi. During the years from 2010 to 2011 six species of the Coprinaceous fungi were collected from different places in Lahoul valley In this communication the commonly encountered mushrooms of Coprinaceae are described and illustrated. Coprinellus impatiens

Coprinellus micaceus Coprinopsis atramentaria, Coprinus comatus, Coprinus lagopides, Coprinus

sterquilinus are being reported for the first time from Lahoul valley. Frequency occurrence of Coprinus

atramentarius (Bull. Ex Fr.) Fr. was more at Kargha, Jagla, Khangsar, Madgran, Shakoli and Tamlu. These are the places where the herds generally have overnight stay and the cattles shed their droppings in huge amounts thereby giving way for generation of the coprophilous mushrooms. It was observed that these


107

mushrooms appear late in the season after the snow melts and there is flow of shepherds from the plains to the pastures in the high hills. The droppings’ are laid in huge amounts around the grazing grounds. Coprinus

comatus, the shaggy ink cap, lawyer's wig, or shaggy mane was often seen growing in grass, along road sides. Coprinellus micaceus typically grows in clusters on or near rotting stumps or underground tree roots.

168 Evaluation of selected white and brown strains of Agaricus bisporus

B.C. SUMAN, DHARMESH GUPTA and MANJU SHARMA Department of Plant Pathology, Dr YS Parmar University of Horticulture & Forestry, Nauni, Solan- 173 230 (HP).


The accessions comprised of four white (SSI-1,SSI-2,SSI-3 and SSI-5) and five brown (SSI-6, SSI-7,SSI-8,SSI-9 and SSI-10) high yielding strains of Agaricus bisporus. The accessions were evaluated on short method pasteurized compost. Evaluation of white strains showed the maximum yield of 13.86 Kg/100 Kg compost in SSI-2 which was at par with SSI-3.Among brown strains,SSI-7 recorded a highest yield of 23.18 Kg followed by SSI-6 of 18.33 Kg. Days taken for spawn run ranged between 19-20 days in all the strains. Time taken for first harvest(days post casing) ranged between 22-23 days in white strains and it was 21 days in brown strains. The quality parameters of all the strains were also evaluated in terms of average fruit body weight. Amongst white strains, he maximum fruit body weight of 12.0g was recorded in SSI-3 while in brown strains, maximum fruit body weight was recorded to be 12.7 g in strain SSI-7.Number of open mushrooms were highest in SSI-8(29) in brown strain while in white strain, number of open mushrooms were least(3) in SSI-2.

169 Comparative yield performance of different species of oyster mushroom on locally

available substrates under cold desert conditions of Himachal Pradesh

R.S. JARIAL, C.L. SHARMA and DHARMESH GUPTA* Regional Horticultural Research Sub Station, Tabo, Lahaul and Spiti (HP)-172113, *Department of Plant Pathology,

Dr YS Parmar University of Horticulture and Forestry Nauni, Solan (HP) -173230.


Suitability of twelve locally available plant materials of Spiti Valley of Himachal Pradesh was tested as substrates for the production of four species of oyster mushroom viz. Pleurotus –sajor- caju, P. ostreatus, P.

florida and P. eringii. Fallen and dried leaves of Salix fragilis (vern. changma), Lactuca sericola (vern. nechaapa), Poplus ciliata (poplar), Prunus amygdalus (almond) and Malus domestica (apple); whole plant parts of Solanum melongena (brinjal), Brassica oleraea var. botrytis (cauliflower), Pisum sativum (pea), Solanum lycoperisici (tomato), Iris sp. (vern. thehma) and one local grass called Congsasa Grass as well as dried straw of Hordeum sp. (vern. Gandhum) were used along with standard check i.e. wheat straw during the year 2011. The experiment was conducted under cold desert conditions at Regional Horticultural Research Sub Station, Tabo, Spiti. The data were recorded in terms of time taken for spawn run, days for first flush, number of fruit bodies and yield. The biological efficiency was also calculated as per cent of fresh mushroom yield to dry substrate weight at spawning. Among the four Pleurotus spp., P. sajor caju

performed the best exhibiting maximum average number of fruit bodies (53.84) and yield (0.726 kg / 5kg substrate) irrespective of substrate used significantly followed by P. florida, P. ostreatus and P eryngii. Out of all the substrates used Hordeum sp. supported significantly maximum average number of sporocarps (69.92) and average yield (0.910 kg/5kg substrate) irrespective of the mushroom species followed by S.

fragilis and P.ciliata. Pea, brinjal and cauliflower leaves were significantly least supportive for mushroom production followed by tomato and these supported the production of P sajor caju only. However, all the treatments were rated below the standard check where average number of fruit bodies (81.83) and average yield (1.257 kg/5kg substrate) were maximum. The biological efficiency of different Pleurotus species was recorded to be maximum in case of wheat straw in all the tested species followed by gandhum, changma and poplar. As far as the time taken for spawn run and first flush was concerned, it was delayed in all the treatments including standard check and ranged between 22-31 and 27-40 days, respectively in different treatments.


108

170 Effect of different grain substrates on spawn growth and yield of Pleurotus

djamor

PRANEET CHAUHAN and DHARMESH GUPTA Department of Plant Pathology, Dr YS Parmar University of Horticulture and Forestry, Nauni-73230 Solan (HP).


Studies were undertaken to determine the best grain substrate for spawn production of Pleurotus djamor and its effect on yield. The cereal grains of Jowar (Sorghum bicolor), Kodo (Paspalum scrobiculatum), Maize (Zea mays),Wheat (Triticum aestivum), Bajra (Pennisetum typhoides), Oat (Avena fatua) and Barley (Hordeum vulgare) were evaluated as spawn substrate. Observations were recorded for number of days taken for spawn development. Spawn raised on different grains was also used for cultivation on wheat straw substrate, to assess the period of spawn run, number of days taken for primordial formation and weight of sporophores. The shortest period for spawn development (8 days) was obtained with Kodo grains indicating its suitability for effective spawn production. The different grains also influenced the duration of spawn run and pin head formation including the biological efficiency of Pleurotus djamor on wheat straw. The yield of Pleurotus djamor did not vary significantly with the kind of grains used for spawn development. The overall biological efficiency was highest on wheat grain spawn. The highest yield of Pleurotus djamor was recorded on wheat straw.

171 Cultural studies on a new Pleurotus species

NAIYA SHARMA and S. DHANCHOLIA Centre for Mushroom Research and Training, Department of Plant Pathology, CSK HPKV, Palampur (HP)-176062.

During the year 2011 a new species of Pleurotus was collected from Lahaul valley.New species of Pleurotus is highly delicious and grows in association with the threatened plant of Ferula jaeschkeana Vatke at an altitude of 4000mts and above in the Himalayas. The species differs from other Pleurotus species in having fleshy fruit bodies with pileus size ranging from 2.5 to 23 cm, 0.5 to 4.5 cm thick in the centre.White to creamy white surface, glabrous with multiple cracks to expose the white flesh beneath. Lamellae decurrent to strongly decurrent, white to cream. Stipe 1.2 - 9 cm long and up to 3.4 cm thick, centric to excentric, smooth. Preleminary attempts have been made to study the different growth media, temperature and pH requirement for vegetative growth of the mycelium.Fruit bodies of the mushroom were collected from ten different locations in the valley and pure cultures of those isolates were raised on PDA. Mycelial growth and cultural characterstics were studied on different culture media , it was observed that the mycelial run was fast on PDA and Malt extract media. Further studies relating to temperature were conducted on Malt extract. The culture on Malt Extract was subjected to different temperature ranging from 50C to 300C it was observed that the optimum temperature for rapid mycelial growth was 280C.In order to assess the optimum pH requirement for mycelial growth the pH was set in Glucose peptone liquid medium ranging from 4-9,the pH of 6 favoured maximum mycelial growth.

172 Mitochondrial rDNA and SSR based diversity analysis of Pleurotus populations in

Himachal Pradesh

RISHU SHARMA, B.M. SHARMA and P.N. SHARMA Department of Plant Pathology, College of Agriculture, CSKHPKV , Palampur (HP) - 176062.

Pleurotus called as ‘Oyster mushroom’ is a lignocellulosic fungus of common recurrence in Himachal Pradesh. Pleurotus comprises of a species complex mainly based on morphological traits needs taxonomic expertise to come to some conclusions about the identity of a given species. Hence keeping in view the importance of molecular markers in settling the taxonomic status of the complex populations, present study was undertaken to establish the taxonomic status of wild isolates of Pleurotus using mitochondrial SSU rDNA region. Thirty one isolates comprising 16 wild collections and nine procured species viz. P. ostreatus,

P. florida, P. flabellatus, P. sapidus, P. sajor-caju, P. eryngii, P. pulmonarius, P.citrinopileatus. and P.


109

hypsizygus with variable number of isolates belonging to each identified species.Isolates were primarily grouped into nine species on the basis of morphological and cultural traits. Sequence analysis of twelve test isolates of nine Pleurotus species using mitochondrial SSU rDNA amplified by V6 and V9 domain specific markers showed insertion/ deletion between various regions 94-149 and 149-231 bp respectively. The present study confirmed that the sequences of the two domains are species specific. The phylogenetic analysis categorized various species isolates into three major groups i.e. A, B and C. The test isolates were categorized in group A and B as per the reference source of Gonzalez and Labarere, 2000 while none of the isolate was placed in group C. An additional species P. hypsizygus, from present study has been included in group B alongwith eight other speices(P. ostreatus, P. floridanus, P. columbinus, P. sapidus, P. sajor-caju,

P. eryngii, P. pulmonarius and P. citrinopileatus).The isolates belonging to a given species were placed in the same group with small phenetic distances. Intra species variation among Pleurotus ostreatus isolates studied by simple sequence repeats markers (SSR) showed a wide variation and categorized various isolates into 9 groups.

173 Effect of supplementation of wheat substrate for increasing yield of Pleurotus eous

SACHIN GUPTA, V.S. VERMA, DEEPAK KUMAR and V.K. RAZDAN Division of Plant Pathology, FOA-Chatha, Sher-e-Kashmir University of Agricultural Sciences and Technology of

Jammu-180009 (J&K). [email protected]

Effect of different supplements on the yield and related parameters of Pleurotus eous was evaluated. The supplements were added to wheat straw which was used as the substrate. Use of supplements in the substrate resulted into significant increase in yields of fruiting bodies of Pleurotus eous. Of all the supplements and their combinations tried, wheat bran @ 3% (w/w) was found to be the the best treatment in increasing the number of sporophores, fruit body weight, number of fruit bodies and total yield. In terms of B:C ratio also wheat bran was the best treatment.

174 Influence of different lignocellulosic substrates on the cropping period of blue oyster mushroom (Hypsizygus ulmarius (Bull.) Redhead)

SAVITA VERMA and P.K. RAINA*

Department of Plant Pathology, Dr YS Parmar University of Horticulture & Forestry, Nauni, Solan (HP). *Sher-e-

Kashmir University of Agricultural Sciences and Technology, Jammu, Division of Plant Pathology, FOA, Udheywalla

– 180002. Email: [email protected]

Cultivation studies on blue oyster mushroom (Hypsizygus ulmarius (Bull.) Redhead) on different lignocellulosic wastes, were carried out under natural growing conditions. The studies aimed at generating data on the influence of different lignocellulosic substrates on the cropping period of blue oyster mushroom (Hypsizygus ulmarius). The effect of different substrates on cropping period revealed that spawn run period after spawning varied between 18.80 days in maize straw to 32.00 days in dehulled maize cobs. Saw dust substrate did not complete spawn run after initial initiation of mycelial growth around spawn grains. Similar trend was observed with primoridia formation. Early primordia formation in 5 days occurred in maize straw and late in 15 days with dehulled maize cobs. This trend continued and early harvest in 7 days was registered with maize straw and late in 10 days with dehulled maize cobs. Influence of different substrates on the cropping period of H. ulmarius revealed that maize straw substrate registered the early spawn run early primordia formation and early first harvest while as delayed spawn run, delayed primordia formation and delayed first harvest was observed with dehulled maize cobs. The overall cropping period varied bet 48.20 to 72.80 days. Out of six substrates tested, wheat straw, paddy straw and maize straw gave their full yield potential in three flushes, sugarcane baggase in two and dehulled maize cobs and wood shavings in one flush only.


110

175 Cultivation of shiitake on various agrowastes MANJU SHARMA, B. C. SUMAN and DHARMESH GUPTA Mushroom Research Laboratory, Department of Plant Pathology, Dr.Y.S.Parmar University of Horticulture and

Forestry, Nauni, Solan (HP) 173 230. E-mail: [email protected]

Shiitake (Lentinula edodes) is a valuable temperate medicinal mushroom having anticancerous properties because of a polysaccharide Lentinan which is present in higher quantities. The action is basically immune response modifier which is enhanced by giving preparations of this mushroom after chemo or radio-therapy. Environmental management plays a key role in getting good harvest and better quality. Being a temperate mushroom by nature,the optimum temperature ranging from 18-22oC and relative humidity in the range of 85-90% is required for its growth. In the present investigation various substrates namely saw dust of Toona

ciliata, straw of Triticum aestivum, Pine needles of Pinus roxburghii, wood chips of Lantana camara and Parthenium hysterophorus alone and in various combinations were screened. The minimum time (90 days) for pinning was observed on the combinations of saw dust (60%) + wood chips (20%) + rice bran (20%) substrates. Maximum yield (680 g) was recorded on the mixture of substrates namely saw dust (60%) + wood chips (20%) which was supplemented with rice bran (20%) and minimum yield (24 g) was obtained on the combinations of wheat straw (50%) + saw dust (50%). Whereas no yield was there in the treatments where Parthenium and wheat straw were used at higher concentration in different combinations of substrates.

176 Studies on medicinal mushroom Ganoderma lucidum (W. Curt.:Fr.) P. Karst.

SAVITA JANDAIK and SHEETAL MEHTA Department of Biotechnology,Shoolini University of Biotechnology and Management Sciences, Bajhol, Solan-173229

Email [email protected]

Ganoderma lucidum is one of the most popular mushroom in oriental medicines, and is widely known for its use as a remedy for many types of diseases and has number of pharmaceutical effects. In the present study, temperature of 25 °C, pH 5.5 and inoculum density of 20ml of homogenized inoculum per 50ml of medium supported the highest biomass production of G. lucidum. Constantly more level of aeration was found to be better for mycelial production as compared to stationary condition. Among different carbon and nitrogen sources used in the study glucose and peptone were found to be the best, respectively for biomass production. Among selected microelements and vitamins used in the study, iron and thiamine respectively, were found to enhance the vegetative growth of G. lucidum as compared to other trace elements .Use of different substrates for fruit body production of G. lucidum revealed that agricultural residues (Wheat and paddy straw as well as soybean waste) were found to be more suitable as compared to forestry wastes by-products (sawdust of different trees) irrespective of supplementation with various additives in the experimentation .


111

Prof. M.J. Narasimhan Academic Merit Award Contest

001 Foliar blights of wheat and their management

NIDHI MITTAL and JASPAL KAUR Department of Plant Pathology, Punjab Agricultural University, Ludhiana-141004. Email: [email protected]

The foliar blight disease of wheat was caused by Bipolaris sorokiniana and Alternaria triticina. The disease produced oval to elliptical dark brown spots on wheat leaves with definite chlorotic margin. The disease was prevalent in all the surveyed districts of Punjab. The disease incidence and severity varied from 17.5-30.7 and 12.6-22.5 per cent, respectively. Five isolates of B. sorokiniana and four of A. triticina were found pathogenic with colony colour of grey to black or with white sectors and produced oval-elliptical lesions 3-4 days after inoculation. Isolate B3 of B. sorokiniana and A2 of A. triticina were more aggressive. Colony growth and spore germination was completely inhibited by Tilt 25EC, Folicur 25EC, Score 25EC and Amistar Top 25SC fungicides at 100 ppm whereas Indofil M-45 at 500 ppm and Nativo 75WG at 200 ppm concentration. Tilt inhibited more than 95 per cent mycelial growth and spore germination even at lower concentration of 50 ppm and was found most effective fungicide. Under field conditions, Tilt 25EC @ 0.1 per cent significantly controlled foliar blight disease of wheat by giving maximum disease control of 78.8 and 81.0 per cent in cultivars HD 2329 and PBW621, respectively. Nativo 75WG @ 0.1 per cent was found least effective. Detached leaf method and spray inoculation method can be successfully used for preliminary screening to identify foliar blight resistance. Screening of 50 lines of T. durum - Ae. speltoides inter-specific derivatives against foliar blight of wheat showed that none of the line was resistant. All the lines were moderately susceptible to susceptible to foliar blight of wheat.

002 Persistence of mancozeb and metalaxyl on tomato (Solanum lycopersicum L.)

RITU RANI and VINEET K. SHARMA Department of Plant Pathology, Punjab Agricultural University, Ludhiana-141004.


The persistence of Indofil M-45 (mancozeb) and Ridomil MZ (metalaxyl + mancozeb) on tomato was determined. The incubation period of Phytophthora infestans varied from 4 to 6 days on unsprayed leaves. However, disease did not appear on leaves up to 4 days when plants were inoculated 4 days after the spray of Indofil M-45 or Ridomil MZ each @ 0.25 per cent and 0.5 per cent. The effectivity of Indofil M-45 at 0.25% and 0.5% concentration was lost on the 6th and 7th days, respectively. Similarly, in case of Ridomil MZ @ 0.25% and 0.5%, the effectivity was lost on 7th and 8th day, respectively. Rainfall applied immediately after fungicidal spray removed fungicides from the leaf surface resulting in higher disease severity. As rain amount increased from 5 to 15 mm, disease also increased. In case of Ridomil MZ disease severity was less as compared to the Indofil M-45. The delaying of rainfall by 2 days after fungicidal spray resulted in significant reduction in disease severity in case of Ridomil MZ sprayed tomato plants. However, this was not true in case of Indofil M-45 sprayed tomato plants. The mean initial deposits of mancozeb and metalaxyl in tomato fruits were found to be 3.96, 6.98 and 0.05, 0.15 mg kg -1 after application of Ridomil MZ at 0.25 and 0.50 per cent, respectively. The mancozeb residues at 0.25% and 0.5% concentrations were found to be below detectable level (BDL) on 10th and 15th day after spray, respectively. Similarly, in metalaxyl applied at 0.25% and 0.5% concentrations residues were found to be BDL on 3rd and 5th day after spray, respectively. Since both mancozeb and metalaxyl are present in Ridomil MZ fungicide so, the safe waiting period (WP) of 3 days for Ridomil MZ in tomato was suggested.


112

003 Studies on bacterial spot of bell pepper (Capsicum annuum L.) caused by Xanthomonas campestris pv. vesicatoria (Doidge) Dye

DURGA PRASHAD and S.K. GUPTA Department of Plant Pathology, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan-173 230(HP).


Bell pepper (Capsicum annuum L.) popularly known as “Shimla Mirch” is an important Solanaceous vegetable crop grown in mid hills of Himachal Pradesh. In mid hills of the state, the crop is transplanted in the second fortnight of April and fruiting coincides with the advent of monsoon rains, which favours the development of various fungal and/ or bacterial diseases, of which bacterial spot (Xanthomonas campestris pv. vesicatoria) has been emerged to be predominant and most destructive disease causing severe damage to the crop and reducing potential yields. The disease has been responsible for causing a marked reduction in both quality and quantity of fruits. Present investigations were undertaken with an objective to study the occurrence of the disease, role of abiotic environmental factors in disease development and to devise suitable disease management strategies. The disease was found to occur in moderate to severe form in different bell pepper growing areas of Solan, Shimla and Sirmour districts of Himachal Pradesh. Based on morphological, cultural and biochemical characters, the identity of the pathogen was confirmed to be Xanthomonas

campestris pv. vesicatoria (Doidge) Dye. Optimum growth of the pathogen was obtained at 30o C and pH 7.0. Nutrient sodium chloride broth favoured maximum growth of the bacterium. Moderate temperatures (25 + 1o C) coupled with high relative humidity (80%) were found to favour the disease development. Out of 27 germplasm, two lines viz., Feroz and EC-57997 were found moderately resistant while eight lines viz., Selection 17-1-2, Kanauri, SP-628, Midway, EC-57996, Navgaon Collection, Nishant and KTCPH-7 exhibited moderately susceptible reaction under natural epiphytotic conditions. Among five biocontrol agents evaluated, only Pseudomonas fluorescens inhibited the growth of bacterium under in vitro conditions. Aqueous extracts of Allium sativum and Curcuma longa inhibited the growth of the bacterium under in vitro conditions. Foliar sprays of combination of streptomycin sulphate (0.01%) + copper oxychloride (0.25%) and streptomycin sulphate (0.01%) alone resulted in minimum disease severity and maximum fruit yield.

004 Studies on French bean rust in Himachal Pradesh

NEERAJ SHARMA, SAPNA CHAUHAN and SK GUPTA Department of Plant Pathology, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan (HP) 173230.

Rust is an important disease of French bean particularly of pencil types in mid hills of Himachal Pradesh. Present investigations were undertaken with an objective to study the occurrence of the disease, role of abiotic environmental factors in disease development and to devise suitable disease management strategies. The disease was found to occur in moderate to severe form in different French bean growing areas of Solan, Shimla and Sirmour districts of Himachal Pradesh. The samples collected from different locations were found infected with urediniospores. On the basis of morphological characters like shape, size, colour and echinulation of the urediniospores, the associated fungus was identified as Uromyces appendiculatus (Pers.) Unger). Among different substrates evaluated, KCl was observed to be the best substrate, whereas maximum germination and germ tube elongation was observed in water agar medium (1%). Temperatures of 20 oC and pH 7.0 were observed to be best for the germination and germ tube elongation of urediniospores, whereas when water agar medium was supplemented with methionine it recorded in maximum germination and germ tube elongation of urediniospores. Moderate temperature (20 ºC) and high humidity (>85%) were found to be most congenial factors for disease development, whereas high rainfall was deleterious to the disease. Among twenty one different germplasm/lines/cvs./local selections screened against pathogen Alapa Trey, Sing Tamey and Local Selection (hypersensitive reaction) were found to be highly resistant under natural epiphytotic and artificial inoculation conditions. Minimum rust severity and maximum green pod yield was recorded in May sowings as compared to June sowings. Under in vitro conditions zineb + hexaconazole was found to be the best fungicide followed by mancozeb, azoxystrobin and chlorothalonil. Foliar sprays of


113

azoxystrobin (0.1%) were most effective in reducing the rust severity and increasing the green pod yield followed by propiconazole and hexaconazole.

005 Studies on the role of arbuscular-mycorrhizal fungi in apple replant problem

PRAVEEN MEHTA and NARENDER K. BHARAT*

Directorate of Horticulture, Nau Bahar, Shimla (HP), *Department of Plant Pathology, Dr YS Parmar University of

Horticulture and Forestry, Nauni, Solan – 173 230 (HP). Email: [email protected]

Apple is the most important commercial fruit crop of Himachal Pradesh. The area under apple cultivation has increased in the state but the productivity has not increased. The reason for low productivity could be many but the most important is age of orchards. As most of the orchards in the state especially district Shimla have out lived there economic bearing life or declined due to adverse effect of insect pest and diseases. Hence, these orchards are needed to be replanted with new cultivars. Moreover, many growers are doing so, but due to limitation of land the growers are planting new varieties on the old apple site. Due to this practice the replant problem has emerged, the newly planted apple plants show poor growth and short life. This replant problem is known to be caused by various biotic and abiotic factors. Due to complex etiology it is difficult to be manged and only method adopted is soil fumigation. This fumigation has many drawbacks like inhibition of soil microflora including arbuscular mycorrhizal fungi (AMF). The AM fungi are known to improve plant growth, nutrient uptake and defense mechanisms in plants including apple. The present investigations were therefore, carried out to see the effect of indigenous arbuscular mycorrhizal fungi on the growth of apple seedlings grown in apple replant disease soil. During survey of apple orchards of district Shimla of H.P. AM fungi were invariably found associated with apple plantation in all the locations and the population of these fungi and other associated microflora was observed high in old bearing orchards than that in young and uprooted unproductive orchards. Twelve AM fungal species under four genera viz., Glomus, Acaulospora,

Gigaspora and Scutellospora were isolated and frequency of occurrence was high in case of Glomus spp. especially G. fasciculatum, G. mosseae and G. macrocarpum. Five cultures of these fungi were isolated from different locations and multiplied on Guinea grass (Panicum maximum) viz., AMFS-1, AMFS-2, AMFS-3, AMFS-4 and AMFS-5. Out of these five cultures two cultures (AMFS-2 and AMFS-3) resulted significantly better growth in inoculated apple seedlings. Mixed culture of these two selected AMF was used to study its effect on growth of apple seedlings grown in apple replant disease (ARD) soil collected from replant affected orchards at different locations along with other treatments. The AMF inoculation resulted significant increase in growth parameters like Plant height, stem diameter, internodal length, leaf area, shoot/ root fresh and dry weight of inoculated seedlings as compared to uninoculated seedlings grown in ARD soil. The positive effect of AMF inoculation on growth parameters further increased when the seedlings were grown in formaldehyde fumigated ARD soil. The phosphorus content of AMF inoculated seedlings were also significantly more than uninoculated seedlings grown in ARD and virgin soil. A significant reduction was observed in the population of fungi, bacteria and actinomycetes associated with roots of apple seedlings grown in ARD and virgin soil upon AMF inoculation. So it can be concluded from the present investigation that apple seedlings when inoculated with indigenous AM fungi showed better growth and nutrients status even when grown in apple replant disease soil and thus reduced the effect of replant disease.

006 Ethnomycology in Jammu and Kashmir

SANJEEV KUMAR and Y.P. SHARMA Department of Botany, University of Jammu, Jammu (J&K)-180006. E.mail. [email protected]

Mushrooms are among the most popular members of non-conventional food accepted world over. They are good source of delicious food with high nutritional and medicinal attributes and are referred to as low calorie nutraceuticals. The indigenous knowledge, folk taxonomy and valuation of fungi are referred to as ethnomycology. India, being a country of varied agro-climatic conditions, supports the existence of diversity of macrofungi (mushrooms) in wild. Numerous species of wild growing mushrooms are recognized and widely consumed as a delicacy across various regions of India. The state of Jammu and Kashmir has the


114

largest concentration of forest dwellers, comprising of about one-fourth of the population of the state. Several tribes and villagers subsist largely on non-traditional and wild food sources especially wild edible mushrooms. Limited information, however, is known about ethnomycology of macrofungi in India in general and Jammu and Kashmir in particular. Therefore, ethnomycological survey was carried out in various locations of Jammu and Kashmir State in order to develop a database on mushroom diversity and their traditional uses. In this study, seventy wild mushrooms which are distributed in 38 genera have been recorded to have various potentialities. These includes Agaricus spp., Amanita spp., Astreaus sp., Auricularia sp., Boletus spp., Bovista spp., Cantharellus spp., Calvatia spp., Clavaria sp., Clavulina spp., Coprinus spp., Fomes spp., Flammulina sp., Ganoderma spp., Geopora spp., Geastrum spp., Gymnopilus sp., Gyromitra spp., Helvella spp., Inocybe spp., Lactarius spp., Lepiota sp., Lentinus spp., Lycoperdon spp., Macrolepiota sp., Morchella spp., Peziza spp., Pleurotus spp., Ramaria spp., Russula spp., Rhizopogon spp., Sarcoscypha sp., Scleroderma spp., Sepultaria spp., Sparassis spp., Suillus sp., Termitomyces spp. and Verpa sp.. Brief macro and microscopic features, descriptive vocabulary and folk taxonomy, edibility status, traditional drying and preservation, culinary potential, common beliefs and traditions etc. have been highlighted in this paper. Overall, richness of ethnomycological information gathered indicates that the Himalayan state of Jammu and Kashmir represents a mycophilic region where edible mushrooms play an important role in the socio-economic activities of the local populace.

007 Studies on epidemiology and management of stem rot disease of carnation

SUSHMA SHARMA and SUNITA CHANDEL Department of Plant Pathology. Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan (HP)173230.

E.mail: [email protected]

During the survey of carnation growing areas, 11.2-31.5 per cent incidence of stem rot was recorded. Under epidemiological studies, high temperature 32.50°C and high soil moisture 23.13% favourable for the maximum disease incidence of stem rot i.e. 40.28 per cent. Among different fungicides tested in vitro thiram was found most effective with 84.63 per cent average inhibition in mycelial growth of pathogen Thiram was also effective in field condition in minimizing the disease incidence and increasing the growth and flower parameters. Among different soil amendments Melia azedarach was found to most effective with minimum disease incidence 13.62 per cent with increase in plant growth characteristics. Among different crucifer crop residues, cauliflower and cabbage were found best and most effective in minimizing disease incidence upto (22.28 and 24.25 %) with an increase of plant growth and flower parameters. Among five species of Trichoderma tested in vitro, T. viride was found most effective with 65.08 per cent inhibition in mycelial growth of the stem rot pathogen. Among bacterial antagonists, B. subtilis was found most effective with 55.05 per cent mycelial growth inhibition. Most potential antagonists further tested under field conditions which revealed that T. viride was most effective in field condition and resulted into minimum disease incidence 17.33 per cent with improved plant growth and flower parameters. Nine natural botanicals and two commercial formulations of neem were evaluated under in vitro against the stem rot pathogen and among these commercial formulation of Neemgold was most effective with 56.77 per cent average inhibition in mycelial growth and among natural botanicals Adhatoda vasica and Melia azedarach were found effective. Treatment combinations of Trichoderma viride and Melia azedarach were found most efficacious with minimum disease incidence (6.00 %) and also recorded maximum increase of 82.32, 76.64, 3.79, 7.20 per cent in plant height, stem length, number of flowers per plant, flower size and also recorded 131.0 less days to first flowering in comparison to control.


115

Late arrival

177 Prediction model for germination and germ tube elongation of urediniospores on

the basis of concentration of substrates NEERAJ SHARMA, R.K. GUPTA* and S.K. GUPTA Department of Plant Pathology, *Department of Basic Sciences, YS Parmar University of Horticulture & Forestry

Nauni Solan (HP) – 173 230.

Urediniospores of Uromyces appendiculatus were collected from infected bean plants from the field. Urediniospores germination percentage(Y) and germ tube length (Y) of Uromyces appendiculatus were recorded in two substrates viz. KCL and sucrose with different concentrations(X) after 96 hours of inoculation in water agar medium (1 %) . Different prediction models were used to estimate urediniospores germination (%) and germ tube length (µm) on the basis of their concentrations. Linear, quadratic and cubic models can be used for prediction of these two characters. High value of R2 was observed in quadratic model for urediniospores germination percentage which can be estimated by the model Y = 50.63 -0.531 X +0.016X2 in KCL , whereas in case of sucrose Y = 12.14 + 0.034 X +0.004X2 can be use for prediction. Germ tube length of Urediniospores can be predicted by using linear models for KCL (Y = 132.37 -1.177 X) and sucrose (Y = 62.113- 0.808X).

178 Efficacy of insecticides against shoot and fruit borer, Leucinodes orbonalis Guen.

on brinjal (Solanum melongena L.) ARCHANA KERKETTA, SUSHILA and NIVEDITA TANDI Department of Entomology, Indira Gandhi Krishi Vishwavidyalaya, Raypur (Chhattisgarh)

Brinjal (Solanum melongena L.) is an important vegetable crop in all over India. It is attacked by various pests like jassid, aphid, white fly, defoliators and shoot and fruit borer at different stages of crop. Out of these, shoot borer, Leucinodes orbonalis Guen. is serious pest and throughout the year attack the crop. Damage by this pest is the major constraint in successful cultivation of brinjal in Bilaspur district of Chattisgarh. In present the time, various insecticides with different mode of action has been found useful against the pest. Present investigation on efficacy of insecticides like, profenofos (50% EC), quinolphos (25% EC), carpat hydrochloride (50% SP), trizophos (40% EC), chlorpyriphos (20% EC) and cypermethrin (10% EC) against infestation of shoot and fruit borer and yield of brinjal were carried out. The results showed that trizophos @ 0.5 kg a.i. /ha. was the most effective and significantly superior over other treatments in controlling the pest (77.1%) and increasing the yield (163.09q/ha.). It was followed by cartap hydrochloride and quinalphos with 70.0 and 62.5 % control of pest and 151.15 and 146.47 q/ha yield, respectively.

souvenir ips-nz 2012.pdf · legume (pulse) diseases under a changing climate as a case-study. the...

Documents