JOURNAL OF BACTERIOLOGY, July 1993, p. 4145-4153 Vol. 175, No. 130021-9193/93/134145-09$02.00/0Copyright X 1993, American Society for Microbiology

Involvement of the Alginate algT Gene and Integration Host Factorin the Regulation of the Pseudomonas aeruginosa algB Gene

DANIEL J. WOZNIAKt* AND DENNIS E. OHMANDepartment of Microbiology and Immunology, University of Tennessee,

and VA Medical Center, Memphis, Tennessee 38163

Received 22 January 1993/Accepted 22 April 1993

Strains of Pseudomonas aeruginosa causing pulmonary infection in cystic fibrosis patients are often mucoidbecause of the synthesis of a capsular polysaccharide called alginate. Regulation of alginate biosynthesisincludes the algB gene product (AlgB), which belongs to a class of proteins that control gene transcription inresponse to environmental stimuli. In this study, a homolog of the DNA-binding-and-bending proteinintegration host factor (IHF) and the positive regulatory gene algT were shown to be involved in algBexpression. An algB-cat gene fusion was constructed on a low-copy-number, broad-host-range plasmid. Inalginate-producing (Alg') P. aeruginosa, levels of chloramphenicol acetyltransferase from algB-cat weretwofold higher than in spontaneous Alg- or aIgT::TnSOl mutant strains, indicating that the mucoid status ofthe cell influences aIgB transcription. An aIgB transcription initiation site was identified 286 nucleotidesupstream of translation initiation and revealed an Escherichia coli sigma 70-like promoter. Sequences in thealgB promoter region were highly similar to the consensus E. coli IHF binding site. In DNA gel band mobilityshift assays, a protein present in extracts from IHF+ E. coli strains and IHF purified from E. coli boundspecifically to these algB DNA fragments, while extracts prepared from isogenic IHF- E. coli strains failed toalter the mobility of algB DNA fragments containing the consensus IHF binding site. A protein in cell extractsprepared from P. aeruginosa strains also demonstrated binding to algB fragments containing the IHF bindingsite, and the position of the complex formed with these extracts was identical to that of the complex formed withpurified IHF. Moreover, this binding could be inhibited by anti-IHF antibodies. To test the role of the IHF sitein aIgB regulation, site-specific mutations in the algB IHF site, based on changes which severely affect IHFbinding in E. coli, were generated. When either purified E. coli IHF or extracts from P. aeruginosa were usedin DNA binding studies, the algB mutant DNAs were severely reduced in IHF binding. Mutations affecting IHFbinding at the aIgB promoter were introduced into the algB-cat plasmid, and all resulted in severely impairedtranscriptional activity in Alg- and algT mutant strains of P. aeruginosa. However, these mutations resultedin similar or slightly reduced algB-cat transcription in Alg+ and algB::TnSOI mutant strains. Thus, the aIgTproduct plays a positive role in the high-level expression of aIgB in mucoid cells, whereas a protein present inP. aeruginosa extracts which is likely an IHF homolog plays a positive role in maintaining a basal level ofalgBexpression in nonmucoid strains.

Pulmonary infection by Pseudomonas aeruginosa in cys-tic fibrosis (CF) patients remains a serious complication ofthe disease, despite aggressive antibiotic therapy. Onceacquired, this bacterium is rarely eradicated, and the major-ity of CF patients succumb to respiratory failure, which iscomplicated by this bacterial infection (17). CF patients areoften initially colonized with typical, nonmucoid P. aerugi-nosa, but as the disease progresses, mucoid variants arise(33). Lower respiratory colonization with mucoid P. aerugi-nosa is associated with both acute exacerbation and chronicprogression of CF. These strains are mucoid because of theoverproduction of an exopolysaccharide called alginate,which is a high-molecular-weight, acetylated polymer com-posed of 0-1,4-linked D-mannuronic and L-guluronic acids(37). This highly viscous polysaccharide plays a role in thepathogenesis of P. aeruginosa by imparting antiphagocyticproperties (3), an adherence mechanism (39), and protectionfrom opsonization (3). Furthermore, the polyanionic natureof alginate has been proposed to provide protection from

* Corresponding author.t Present address: Department of Microbiology and Immunology,

Bowman Gray School of Medicine, Wake Forest University, Win-ston-Salem, NC 27157-1064.

antibiotics by preventing their incorporation into the bacte-rial cell (10).The genetics and regulation of alginate biosynthesis in P.

aeruginosa have been a focus of much study in recent years.There are three known regions of the P. aeruginosa chro-mosome that contain genes involved in alginate production.At the 34-min region of the P. aeruginosa chromosome is alarge cluster of genes which encode most of the enzymesrequired for alginate biosynthesis (12). This alginate genecluster was recently shown to form an operon (8). The firstgene in this operon (algD) encodes GDP mannose dehydrog-enase (14). No transcription of algD is apparent in nonmu-coid cells, but the gene undergoes strong transcriptionalactivation in mucoid cells (14, 15). Thus, many studies of theregulation of alginate biosynthesis include measurements ofrelative algD expression.

Alginate genes located near hisI at 68 min include thealgSTN cluster (19, 20, 27) and four muc loci (23, 24). Thesegenes are involved in the conversion between the nonmucoidand mucoid phenotypes of P. aeruginosa. A transposoninsertion in the chromosomal algT gene, which appears toencode a positive regulator, results in a nonmucoid pheno-type (19). Spontaneous genetic changes, linked to algT andcalled algS, commonly cause mucoid strains to revert to the

4145

on Decem

ber 19, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

4146 WOZNIAK AND OHMAN

nonmucoid form and affect algT expression (19, 20). Thealginate-producing (Alg') phenotype is genotypically re-

ferred to as algS(On), and strains which spontaneouslyconvert to Alg- in the laboratory are referred to as

algS(Off). A plasmid containing an algS(On)TN cluster froma mucoid strain will confer the Alg+ phenotype in trans ifalgN on the plasmid is inactivated or deleted, suggesting thatalgN encodes a negative regulator (27).

Several genes located near the 9- to 13-min region of thechromosome are positive transcriptional regulators of algDexpression. Two of these gene products, AlgR(AlgR1) (13)and AlgB (26, 51), are called response regulators becausetheir sequences indicate that they belong to the family oftwo-component regulatory proteins which are typically re-sponsive to environmental stimuli (46). These are found in a

wide variety of bacteria (46), including pathogens (40), andrespond to environmental signals by transcriptionally regu-lating genes which ultimately allow the bacterium to adapt tothat environmental signal. AlgB is clearly distinct fromAlgR, since AlgB contains sequences that are highly con-served with those of the NtrC subfamily of transcriptionalactivators (51). Previous studies have indicated that algB isrequired for the high level of alginate produced by mucoid P.aeruginosa (29) and that algB acts at the level of algDtranscription (51). AlgR(AlgR1) has been purified and shownto bind to at least two 14-mer sequences located unusuallyfar upstream from the start of algD transcription (31). Twoother genes in this region, designated algP(algR3) and algQ(algR2), are required for the full expression of algD (16, 32).AlgP(AlgR3) is a highly basic, histone-like protein, whileAlgQ(AlgR2) is a small (18-kDa) acidic polypeptide. Alsolocated in this region of the chromosome (44) is algC, an

apparently unlinked alginate biosynthetic gene which en-

codes phosphomannomutase (53).We have been studying the regulation and function of

algB, one of two known response regulators involved inalginate gene expression. A genetic analysis of algB was

performed to identify the promoter and other sequencesinvolved in its expression. During this analysis, we discov-ered that a protein which may be a P. aeruginosa homolog ofintegration host factor (IHF) is also involved in algB expres-sion. IHF of Escherichia coli is a heterodimer (Mr, 21,800)composed of two subunits encoded by the unlinked hip(himD) and himA genes. This histone-like protein was orig-inally described as a host factor required for integration ofphage lambda DNA into the E. coli chromosome. However,recent studies indicate that IHF plays a role in several otherimportant processes in E. coli. These include plasmid repli-cation, regulation of the type 1 fimbria phase variation,transposition of ISJ, -yb, Tn5, and ISIO, and the partitioningand transfer of plasmids (for reviews, see references 21 and22). In addition, IHF has been shown to be involved in theexpression of phage and E. coli chromosomal genes (21, 22).Depending on the system, IHF may act as a positive or

negative effector of gene expression. IHF has also beenimplicated in the regulation of genes or processes in bacteriaother than E. coli (25, 30, 47), including P. aeruginosa (2). Inthe present study, data which suggest that P. aeruginosacontains an IHF homolog are presented. We also show that,depending upon the mucoid status of the cell, algB transcrip-tion is positively regulated by IHF or AlgT.

MATERIALS AND METHODS

Bacterial strains and plasmids. The bacterial strains andplasmids utilized in this study are shown in Table 1. All P.

aeruginosa strains were derived from FRD1, an Alg' clini-cal isolate of CF origin (41). All plasmids containing algBand its derivatives were subcloned from pDJW15, which is a3.9-kb HindIII-XhoI algB+ fragment derived from pJG194(29) cloned into pKS- (Fig. 1A).Media, chemicals, and enzyme assays. L broth (10.0 g of

tryptone, 5.0 g of yeast extract, 5.0 g of NaCl per liter [pH7.5]) was used for culturing P. aeruginosa and E. coli formost manipulations. Antibiotics were used at the concentra-tions described elsewhere (51). The medium used for selec-tion of P. aeruginosa following triparental mating was APmedium (41) or VB minimal salts medium (49). Extracts forchloramphenicol acetyltransferase (CAT) assays were per-formed essentially as we described previously (51), exceptthat cells were sonicated (two 20-s bursts) instead of beingdisrupted by French press. CAT levels were determined asindicated by the manufacturer (5 Prime--3 Prime, Inc.) andnormalized for protein concentration, which was determinedby the method of Bradford (7) with bovine serum albumin(Sigma) as a standard.

Nucleic acid manipulations. Most routine genetic manipu-lations were performed as described elsewhere (1, 38, 51).Plasmid DNA was isolated from E. coli by using Qiagencolumns and procedures (Qiagen Corp.). Triparental matingswere used to mobilize plasmids from E. coli to P. aeruginosaas previously described (28). DNA sequences were deter-mined from plasmid DNA by the chain termination tech-nique with adaptations published elsewhere (51). Oligonu-cleotides used for sequencing and primer extensions weresynthesized on an Applied Biosystems 380B DNA synthe-sizer. RNA was isolated from logarithmic-phase P. aerugi-nosa cells cultured in L broth to 5 x 108 cells per ml andpurified as described elsewhere (1, 14), with the followingmodifications. Cells from a 100-ml culture were placed incentrifuge tubes and rapidly frozen in dry ice-ethanol forapproximately 20 min. Following centrifugation (12,000 x gfor 30 min), the cells were suspended in 5 ml of 50 mMTris-HCl (pH 8.0). Sodium dodecyl sulfate and diethylpyro-carbonate (DEPC) were added to final concentrations of 4and 0.2%, respectively, and the suspension was incubated at56'C for 5 min. To the mixture, 4 g of CsCl and 5 ml of 50mM Tris-HCl (pH 8.0) were added. Following centrifugationas described above, the supernatant was carefully layeredover a 2.5-ml cushion of 5.7 M CsCl-100 mM EDTAcontained in a 5.1-ml polyallomer centrifuge tube. Themixture was then subjected to ultracentrifugation in anSW50.1 rotor (35,000 x g at 15'C for 14 h), the liquid wascarefully removed, and the RNA pellet was allowed to dry.The pellet was resuspended in 0.3 ml of 0.2% DEPC andextracted twice with chloroform, and then the amount ofRNA was estimated byA260 analysis. For primer extensions,50 ,ug of total RNA was precipitated with ethanol and driedunder a vacuum. The RNA pellet was suspended in 10 ,ul of0.2% DEPC and mixed with 5 x 104 cpm of an algB-specificend-labeled oligonucleotide (5'-GCGCCGATCGTGCAAAACGC-3'), labeled as described elsewhere (1) with [-y-32P]ATPby polynucleotide kinase. The suspension was heated for 5min at 85'C, and the primer was allowed to anneal to theRNA for 3 h at 42°C. Following this annealing step, themixture was adjusted to 50 mM Tris-HCl (pH 8.3), 75 mMKCl, 3 mM MgCl2, and 1 mM dithiothreitol. Deoxynucleo-side triphosphates (0.2 mM) and 200 U of Superscriptreverse transcriptase (Bethesda Research Laboratories,Inc.) were added, the suspension was incubated for 30 min at42'C, and the nucleic acids were recovered by phenolextraction and ethanol precipitation. The DNA pellet was

J. BACTERIOL.

on Decem

ber 19, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

IHF AND AlgT CONTROL algB TRANSCRIPTION 4147

TABLE 1. Bacterial strains and plasmids used in this study

Strain or plasmid Characteristic(s)a Source or reference

P. aeruginosaFRD1 Prototroph; Alg+; CF isolate 41FRD2 Spontaneous Alg- derivative of FRD1 42FRD444 algB::TnSO1-2 29FRD440 his-1 algT::TnSOl-33 20

E. coliHB101 proA2 leuB6 thi-1 lacYl hsdR hsdM recA13 supE44 rpsL20 6TB1 F- ara A(lac-proAB) rpsL F80 lacZAM15 hsdR 4JM109 endAl recAl gyrA96 thi hsdR17 (rK MK+) relU1 supE44 A(lac-proAB) Promega

(F' traD36proAB lacIqZAM15)BMH71-18 mutS thi supE lac-proAB mutS::TnlO (F' proAB lacIqZAM15) PromegaMH10900 (RBB63) F- X- galK2 rpsL200 IN (rmD-rrnE)1 M. Howe (5)MH10906 (RBB184) F- X- galK2 rpsL200 IN(rrnD-rrnE)1 himA ASmaI himDA3::cat M. Howe (5)

pLAFR3 IncP1 oriT Xcos Tcr 45pKS- Apr StratagenepCM4 pBR325 + 0.8-kb BamHI cat gene cartridge; Apr 9pACYC177 Apr Knr New England BiolabspSelect-1 Aps Tcr PromegapCP13 IncP1 Tcr Knr rix Xcos 11pRK2013 ColE1-Tra(RK2)+ Knr 18pJG194 pCP13 + 3.9-kb HindIII-XhoI fragment; algB+ Tcr 29pDJW15 pKS- + 3.9-kb HindIII-XhoI fragment; algB+ Apr This studypDJW150 pJG194 + fQ gene cartridge cloned in IpnI site; Tcr Smr Spcr This studypDJW149 pACYC177 + 3.9-kb HindIII-XhoI fragment; algB+ Apr This studypDJW160 pDJW149 + 800-bp cat cartridge cloned in EcoRI site; Apr This studypDJW161 HindIII-XhoI of pDJW160 cloned in pCP13; Tcr This studypDJW162 4.7-kb HindIII-XhoI fragment from pDJW160 cloned in pSelect-1; Tcr This studypDJW200 algB5 in pSelect-1; Apr Tcr This studypDJW201 algB6 in pSelect-1; Apr Tcr This studypDJW202 algB7 in pSelect-1; Apr Tcr This studypDJW207 4.7-kb HindIII-BamHI fragment from pDJW200 cloned in pLAFR3; algB5 Tcr This studypDJW208 4.7-kb HindIII-BamHI fragment from pDJW201 cloned in pLAFR3; algB6 Tcr This studypDJW209 4.7-kb HindIII-BamHI fragment from pDJW202 cloned in pLAFR3; algB7 Tcr This study

a Abbreviations: Apr, Knr, Tcr, Smr, and Spcr, resistant to ampicillin, kanamycin, tetracycline, streptomycin, and spectinomycin, respectively; Alg+ and Alg-,producing or not producing alginate, respectively.

suspended in formamide sequencing stop mix and heated at850C for 3 min, and then an aliquot was applied to a 6%sequencing gel. This was electrophoresed in 1x TBE buffer(89 mM Tris base, 89 mM boric acid, 2 mM EDTA) with aDNA sequencing ladder of DNA primed with the oligonu-cleotide used for primer extension.DNA binding assays. DNA binding assays were performed

by using 1 to 50 nM purified IHF (a generous gift of H. Nash)or 100 to 750 ng of extract from P. aeruginosa or E. colistrains. These extracts were prepared as described above forCAT analysis. All of the algB DNA probes used in this studyfor binding were generated by digesting plasmid DNA (con-taining wild-type or mutated IHF binding sites) with EcoRIand KpnI. Cleavage with these enzymes yields a 420-bpfragment containing the algB IHF binding site (Fig. 1B). The5' overhang generated by EcoRI cleavage was filled in withKlenow enzyme (2.5 U) in a reaction mixture containingrestriction enzyme buffer, heat (650C)-inactivated restrictionenzyme, 50 p.Ci of [a-32P]dATP, and 0.2 mM each dGTP,dCTP, and dTTP. The reaction was carried out for 30 min at30'C. The probes were separated on agarose gels and recov-ered and purified by GeneClean as recommended by themanufacturer (Bio 101). Binding assays were performed at250C for 10 min in a total volume of 10 RI. The binding bufferincluded 25 mM Tris-HCl (pH 8.0), 6 mM MgCl2, 0.5 mMEDTA (pH 8.0), 0.5 mM dithiothreitol, 20 mM KCl, 5%glycerol, 2.5 ,g of poly(dI-dC), and approximately 0.1 pmol

of DNA. Following incubation, the samples were applied toprerun (2 h at 200 V) 4% polyacrylamide gels and electro-phoresed in lx TBE buffer for 2 h at 200 V. The gels weredisassembled, dried under a vacuum, and subjected toautoradiography. Under the conditions described above, thethermodynamic binding constant (Kb) for binding of purifiedE. coli IHF to algB sequences was estimated by the formuladescribed by Prentki et al. (43). These estimates rely on therelative ratios of bound to unbound probe at the threeconcentrations of IHF used for Fig. 4 and assume that IHFis 100% active.

Construction of algB-cat transcription fusions and mutagen-esis of the algB 1HF binding site. To construct a system formonitoring transcription of algB alleles containing wild-typeand mutated IHF binding sites, an algB-cat transcriptionalgene fusion was generated (Fig. 1A). For this, pDJW149 waslinearized with EcoRI, the ends were blunted with Klenowfragments, and the DNA was ligated to an 800-bp promoter-less cat gene cartridge, derived from BamHI-digested pCM4with ends blunted with Klenow fragments. The presence andorientation of this gene cartridge in the resulting plasmid(pDJW160) were verified by DNA sequence analysis. Site-specific mutagenesis of the algB IHF binding site was

performed by the Altered Sites Mutagenesis System(Promega, Inc.) as outlined by the manufacturer. The nucle-otides within the algB IHF binding site were mutated byusing as a guide mutations which dramatically affect binding

VOL. 175, 1993

on Decem

ber 19, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

4148 WOZNIAK AND OHMAN

A.HIndill

pJG194 6-

HindillpDJWl 50 -

HIndIIIpDJW1 61 -

KpnI EcoRI algB

Omeg a.____. .B

catKpnI ' algB

I= _

B.1 KpnIGGTACCGCCTCGGGGCCAGGCCCATCGGGGTAGCGAACCGGCCTGTGTCC

51ATTTTTPTCTTCAGGGAGACCGTGACTACCTCATTGCACGCCGCAATGCC101 -35 -10AGCCTTPCTGAAAAATAAACACTTTTA&TTCAATAAGTTATAAAACAA151 7CCCAGGTAGTCTGCGCAGTTCATCCTGCACGACGCGACAAATTATTCCGG

201 PvuIGCGTTTPGCACGATCGGCGCGGTACGCTGTCACATGCAACAGGGAAGCGA251CCCGGCACCTGCTACCCGGAGCCATCCGTGGAGCCGCCACGGCTIUCCGA301AAACCCAAGAACAGACATCGGCGGGTTGCACGCCGCCCTGGCCGCCCGGA

351TGGGCGGCGGGGCGCTCTGCAACTTGCATGGGCTTTCCGGGGACTAACCC

401 ZcORI RBSAGAAGCCGAATGGCAGTGAATTCCCTAGAGGATAAAAAGCAACGATGGAA

3MtGlu2

FIG. 1. (A) Restriction maps of parental plasmids used through-out the study. (B) DNA sequence of the 5' region of algB. The arrowindicates the start of algB transcription. The algB ATG initiationcodon and ribosome binding site (RBS) are indicated. The IHFbinding sequence present in algB (underline), the complementarysequence where the oligonucleotide for primer extension analysiswas generated (hatched line), and sequences with similarity toconsensus cr70 promoters of E. coli (overbar) are indicated.

of the E. coli IHF to a consensus IHF binding site (35, 36).DNA for this mutagenesis procedure was the -4.7-kbHindIII-XhoI fragment containing algB-cat, derived frompDJW160, and cloned in HindIII-Sall-restricted pSelect-1(Promega), resulting in pDJW162. The following three algBalleles with mutations in the IHF binding site were generatedby using the indicated mutagenic oligomers: algBS, 5'-TAACTTATllAATrAAAAGTG-3'; algB6, 5'-TAACTlATTCAA1TAAAAGTG-3'; and algB7, 5'-TTGTEEJTATAACOTA-jTCAATTAAAAGTG-3' (altered sites underlined). Themutagenic oligomers and a P-lactamase gene repair oligonu-cleotide (Promega) were annealed to single-stranded DNAderived from infection of JM1O9(pDJW162) with the helperphage MK404, and the plasmids with mutations were ob-tained by selection for ampicillin resistance. All algB IHFbinding site alleles were verified by DNA sequence analysis.For analysis of algB-cat expression from these mutant algBIHF alleles, pDJW200 (algB5), pDJW201 (algB6), andpDJW202 (algB7) were digested with HindIII-BamHI, andfrom each of these plasmids, the -4.7-kb fragment contain-ing algB-cat was subcloned into HindIII-BamHI-restrictedpLAFR3, which is a low-copy-number plasmid capable of

FIG. 2. Primer extension analysis of the algB gene. The oligo-nucleotide used for these experiments (5'-GCGCCGATCGTGCAAAACGC-3') was end labeled and used in a primer extensionexperiment to map the 5' end of the algB transcript. RNA from thefollowing strains was analyzed: FRD1 (Alg') (lane 1), FRD2 (Alg-)(lane 2), FRD440 (algT::TnSO1) (lane 3), and FRD444 (algB::TnSO1)(lane 4). The arrow identifies the start of algB transcription. ThealgB sequencing ladder (GATC) was produced with the sameoligonucleotide used for synthesis of the probe in the primerextension experiment.

replicating in P. aeruginosa. The derivatives from thiscloning, pDJW207, pDJW208, and pDJW209, respectively(Table 1), were mobilized into P. aeruginosa strains, andCAT assays were performed as described above.

RESULTS

Identification of an algB promoter. To begin characterizingthe regulation of algB expression, we performed a primerextension analysis to determine the start of transcriptioninitiation upstream of the algB protein coding sequence.RNA was isolated from logarithmic-phase P. aeruginosaFRD1 (Alg+), FRD2 (a spontaneous Alg- derivative of FRD1[i.e., algS(Off)], FRD444 (algB::TnSO1-2), and FRD440(algT: :TnSO1-33). The products formed by reverse tran-scriptase extension of the primer (hybridizing to 224 to 244nucleotides upstream of the translational AUG start site[Fig. 1B]) were examined next to a sequencing ladder formedby the same primer (Fig. 2). The results showed thattranscription of algB initiated at a G residue located 286nucleotides upstream relative to translational initiation (Fig.1B). In addition, a primer hybridized to sequences locatedbetween positions 33 and 52 (relative to the algB AUGtranslational start) gave an identical result (data not shown).There was no significant open reading frame located in thisrather long 5' leader RNA until the algB open reading frame.The levels of algB transcription from this promoter, asdetermined by the relative amounts of the primer extensionproduct observed, were similar with RNA from the Alg+strain (Fig. 2, lane 1) and the spontaneous Alg- (lane 2) andalgT::TnSOJ Alg- (lane 3) strains. This indicated that tran-scription from this promoter was not dependent on oractivated by the mucoid status of the cell, unlike transcrip-tion from the promoters of algD (14, 15) and algR (16).However, the signal from the algB promoter was generallyweak compared with those of other alginate gene promotersexamined simultaneously (data not shown), and thus it wasdifficult to quantitate levels of expression by this method. A

Xhol

3.9 kb

Xhol

Xhol

J. BACT1ERIOL.

on Decem

ber 19, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

IHF AND AlgT CONTROL algB TRANSCRIPTION 4149

a8gB 35 -10 +1promoter AAAAATAAAAACACTTTTAATTCAATA&GTTATAAAACAACCCAGGTAG

IHF-bindina ARNWNNTT Rconsensus

allelesaIgB5aIgB6aIgB7

A

G TG C

FIG. 3. Alignment of the algB IHF binding site with the consen-

sus IHF binding site proposed by Kur et al. (34). Colons representidentical bases, W denotes dA or dT, N is any deoxynucleotide, andR represents a purine residue. Mutagenesis of the algB IHF bindingsite was performed, generating the three algB alleles shown (bot-tom): algBS, C(-26)-+A; algB6, C(-26)---G; and algB7, C(-26)--*Gand A(-24)--C. The putative -10 and -35 sequences of algB are

indicated by an overbar.

primer extension product was also observed when RNAfrom the algB::TnSOJ mutant (Fig. 2, lane 4) was used,suggesting that algB transcription is not autoregulated.

Several primers were tested in the 420-bp Kjpnl-EcoRIregion upstream of the algB coding sequence (Fig. 1A), butno other start of transcription was observed. The 2.2-kbKpnI-XhoI fragment (Fig. 1A) has previously been shown tocomplement the algBSO(Ts) mutation (29, 52). When an

omega gene cartridge containing transcriptional terminatorswas inserted in the KpnI site of pJG194 (pDJW150) (Fig. 1A)to block transcription from any promoters that might beupstream, the plasmid still complemented the algB::TnSOJmutation in FRD444 (data not shown). Taken together, theseresults suggest that there is no other promoter upstream ofthe KpnI site necessary for algB complementation.Examination of sequences located immediately upstream

from this transcription start site revealed a promoter withsimilarity to the consensus c0-utilized promoters of E. coliwith a match in 5 of 6 nucleotides at the -10 region and in 3of 6 nucleotides at the -35 region, with a 17-bp spacer (Fig.1B). These sequences were actually located at positions -13and -36 relative to the start of algB transcription (Fig. 1Band 3).Measurements of algB transcription in P. aeruginosa by

using gene fusions. To more accurately measure the effect ofthe mucoid status of the cell on the transcription of algB, a

transcriptional reporter gene was cloned downstream of thepromoter identified above. An algB-cat transcriptional fu-sion was constructed by placing a promoterless cat gene

cartridge at +259 bp 3' of the start of algB transcription (i.e.,a blunt-ended EcoRI site [Fig. 1A]). This algB-cat fusionwas subcloned in a low-copy-number, broad-host-range vec-tor to form pDJW161 and transferred to FRD1 (Alg+), FRD2(spontaneous Alg-), FRD440 (algT::TnSOJ), and FRD444(algB::TnSOl). Compared with those in the Alg+ strain,specific CAT levels from algB-cat were consistently reducedby at least half in the spontaneous Alg- strain (Table 2). Ithas been shown that spontaneous Alg- variants have geneticalterations (called aigS) in the algT region that affect theexpression or activity of algT-containing clones (20). Ourresults were consistent with these studies, since the samelevels of CAT from algB-cat were observed in thealgT::TnSOl mutant as in the spontaneous [algS(Off)] Alg-variant (Table 2), suggesting that algB transcription wasunder algT control. No difference in the levels of CAT fromalgB-cat in the algB::TnSOl mutant compared with thewild-type Alg+ strain was evident (Table 2), again indicatingthat algB is not autoregulated.

Identification of an IHF binding site at the algB promoter.

TABLE 2. Specific CAT levels of algB-cat as a measure of algBtranscriptional activity in strains of P. aeruginosa

Phenotype and algB-cat (ng ofStrain' genotype proTein ofSE

FRD1 Alg+ algS(On) 402 + 40FRD2 Alg- algS(Off) 169 ± 17FRD440 Alg- algT::TnS01 174 ± 17FRD444 Alg- algB::TnS5O 413 + 41

a All strains carried pDJW161, which is pLAFR3 with a HindIII-XhoIfragment containing algB and a promoterless cat cartridge at +259 bp from thestart of algB transcription. Strains were grown under identical conditions in Lbroth. The results shown above represent the average of three comparableexperiments.

P. aeruginosa genomic DNA is 67% G+C on average, butsequences located in the 50 nucleotides upstream of the algBtranscription start site were unusually A+T rich (20% G+C)(Fig. 1B), suggesting that this region may be involved in algBregulation. Upon further examination of the algB promotersequence, a potential binding site was observed for theDNA-binding-and-bending protein (DNA-binding/bendingprotein), IHF (Fig. 1B). This sequence (5'-TAAAAACAC'T'l'l'l'AATTCAATAAGTTA-3') was located at positions-17 to -43, relative to the start of algB transcription, andoverlapped the -35 sequence and 2 nucleotides of theputative -10 sequence. This sequence was identical to theconsensus IHF binding site proposed by Kur et al. (34) (Fig.3) and highly similar to that proposed by Friedman (22)(WATCAANNNNTTR).

Since IHF has been shown to regulate the transcription ofgenes controlled by the response regulator NifA (30) andsince algB contained a consensus IHF binding site, we choseto examine whether IHF could interact with the algB pro-moter-IHF binding site. A gel band mobility shift assay wasutilized to study the binding of proteins to an end-labeledalgB fragment containing these sequences. A protein presentin extracts of E. coli MH10900 (IHF+) bound to a 420-bpKpnI-EcoRI fragment containing the algB promoter-IHFbinding site, causing a mobility shift (Fig. 4, lane 2). Thisbinding was eliminated by the addition of anti-IHF antibod-ies (Fig. 4, lane 3). No binding was observed when extractsfrom E. coli MH10906, which has deletions in himA andhimD, which encode the subunits of IHF (Fig. 4, lane 4),were used. In addition, purified IHF at concentrations of 50,25, and 5 nM bound to this fragment (Fig. 4, lanes 5, 7, and9, respectively). Moreover, the binding of purified IHF tothese sequences was eliminated when anti-IHF antibodieswere included in the binding reaction mixtures (Fig. 4, lanes6, 8, and 10). We have observed IHF binding to this fragmentwith as little as 50 pmol of IHF (52). This binding of IHF tothe algB promoter was apparently specific because DNAfragments from upstream or downstream of the algB pro-moter-IHF binding site failed to form such complexes (52).On the basis of these observations, the thermodynamicbinding constant for IHF binding to the algB promoter wasestimated to be -8 x 107 M-1.A protein present in cell extracts of Alg+ and Alg- P.

aeruginosa was also shown to bind to the 420-bp fragment ofDNA containing the algB promoter-IHF site (Fig. 4, lanes 11and 13, respectively). The mobility of the DNA-proteincomplex formed with extracts of P. aeruginosa was identicalto that observed with extracts of E. coli or purified IHF (Fig.4; compare lanes 11 and 13 with lanes 2, 5, 7, and 9).

VOL. 175, 1993

on Decem

ber 19, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

4150 WOZNIAK AND OHMAN

| ~~~~~~~~~~~~~~a/gB4HF~~~~~~~~~~~~~~ComplexFree algBProbe

FIG. 4. Analysis of IHF binding by gel band mobility shift assay.Approximately 0.1 pmol of an end-labeled EcoRI-KpnI fragment(Fig. 1B) was incubated with the following concentrations of purifiedIHF, cell extracts, or combinations of each with anti-IHF (0.5 jil):lane 1, no addition; lane 2, 250 ng of extract from IHF+ E. coliMH10900; lane 3, 250 ng of extract from IHF+ E. coli MH10900 plusanti-IHF; lane 4, 250 ng of extract from IHF- E. coli MH10906; lane5, 50 nM IHF; lane 6, 50 nM IHF plus anti-IHF; lane 7, 25 nM IHF;lane 8, 25 nM IHF plus anti-IlF; lane 9, 5 nM IHF; lane 10, 5 nMIHF plus anti-IHF; lane 11, 750 ng of extract from Alg+ P.aeruginosa FRD1; lane 12, 750 ng of extract from Alg+ P. aerugi-nosa FRD1 plus anti-IHF; lane 13, 750 ng of extract from Alg- P.aeruginosa FRD2; lane 14, 750 ng of extract from Alg- P. aerugi-nosa FRD2 plus anti-IHF.

Although only one concentration of P. aeruginosa extractswas used in this experiment, we utilized a range of concen-trations (50 ng to 10 pug) of other extracts. In these assays,only the ratios of free to bound probe varied and the mobilityof the complexes was identical to that of complexes formedwith purified IHF (52). Significantly, these complexesformed by P. aeruginosa extracts were not present whenantibodies to E. coli IHF were present in the bindingreaction mixture (Fig. 4, lanes 12 and 14).

Mutational analysis of the algB IHF binding site. A muta-tional analysis was performed to determine whether IHFbinding to the algB promoter had a role (positive or negative)in its expression. Oligonucleotide-directed mutations weregenerated in the 420-bp EcoRI-KpnI fragment containing thealgB promoter. These mutations changed the IHF bindingsite at critical residues but did not alter the -10 or -35sequences or the spacing between these regions. The choiceof these mutations was based upon those previously shownto severely affect IHF binding and expression of genes whichare subject to IHF control in E. coli (35, 36). Three algBalleles with mutations in the consensus IHF binding sitewere generated: in algBS, C at -26 was changed to A; inalgB6, C at -26 was changed to G; and in algB7, a doublemutation in which CAA at -24 to -26 was changed to GACwas made (Fig. 3). These mutations were verified by DNAsequence analysis, and the sequences located 5' and 3' of themutations were identical to wild-type sequences (52).DNA fragments of the wild-type and mutant alleles de-

scribed above were end labeled and tested for DNA-proteinbinding in a gel shift mobility assay using both purified IHFand extracts from P. aeruginosa (Fig. 5). As previouslydemonstrated, wild-type algB promoter sequences bind topurified IHF (Fig. 5, lane 2) and to a protein present inextracts from P. aeruginosa (lane 3). However, binding ofpurified IHF to algBS DNA was reduced by approximately30% (Fig. 5, lane 4), and this binding was completely absentwhen extracts from P. aeruginosa were used (lane 5). Theeffect of the algB6 and algB7 mutations on binding purifiedIHF were even more dramatic than those observed withalgB5, and the reductions in binding were approximately 90

algB-IHFM.! ~ Complex

Free algBProbe

FIG. 5. Effects of the algB mutations on IHF binding. Approxi-mately 0.1 pmol of an end-labeled EcoRI-KpnI fragment (Fig. 1B)from the wild type or the algB mutants was incubated with 50 nMpurified IHF or 750 ng of extracts from P. aeruginosa Alg- FRD2.Lane 1, wild-type algB; lane 2, wild-type algB plus IHF; lane 3,wild-type algB plus P. aeruginosa extract; lane 4, algBS plus IHF;lane 5, algBS plus P. aeruginosa extract; lane 6, algB6 plus IHF;lane 7, algB6 plus P. aeruginosa extract; lane 8, algB7 plus IHF;lane 9, algB7 plus P. aeruginosa extract.

and 100%, respectively (Fig. 5, lanes 6 and 8). Similar toobservations for algB5, no binding of proteins in extracts ofP. aeruginosa was observed when algB6 and algB7 DNAfragments were used in the assay (Fig. 5, lanes 7 and 9,respectively).

Effects of 11F binding site mutations on expression of thealgB-cat gene fusion. The mutations described above whichseverely affected the binding of IHF to the algB promoterwere also introduced into a 4.7-kb HindIII-XhoI fragmentcontaining algB-cat (Fig. 1A). This permitted an examina-tion of the effect of IHF binding on algB promoter activity bythe measurement of algB-cat-directed CAT synthesis in P.aeruginosa strains. Low-copy-number, broad-host-rangealgB-cat derivatives were constructed in pLAFR3, and thesecontained algBS (pDJW207), algB6 (pDJW208), and algB7(pDJW209) alleles in addition to wild-type algB sequences(pDJW161). These plasmids were transferred to P. aerugi-nosa FRD1, FRD444, FRD2, and FRD440. Extracts of cellswere taken during the logarithmic phase of growth in L brothand assayed for specific CAT levels. In the Alg+ strainFRD1, levels of CAT from the algBS-cat, algB6-cat, andalgB7-cat fusions were similar or slightly reduced comparedwith the levels of CAT synthesis from FRD1 containing thewild-type algB-cat allele (Fig. 6). Similar results were ob-served in the algB::TnSOl mutant FRD444. The levels ofCAT from all algB-cat constructions were comparable inFRD1 and FRD444, again suggesting that algB was notsubject to autoregulation. In Alg- FRD2, wild-type algB-catsynthesis was reduced -50% compared with its expressionin FRD1 (as described above), but fusions containing muta-tions in the IHF binding site demonstrated greatly reducedalgB expression (Fig. 6). The algB6-cat and algB7-cat genefusions in this spontaneous Alg- (FRD2) strain producedonly -20 and 15%, respectively, of the CAT produced in theAlg+ (FRD1) parental strain. The effects of the IlF bindingsite mutations were even more dramatic in the algT::TnSOlmutant FRD440, in which the algBS-cat, algB6-cat, and

J. BACTERIOL.

on Decem

ber 19, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

IHF AND AlgT CONTROL algB TRANSCRIPTION 4151

Strain FRDI FRD444 FRD2Genotype ag9S(On) aigBa::Tn5Ol aIgS(OMt

FRD440aIgT::Tn5Ol

c

I-C)

0)

CL

0

%-O

a

EWA:=0........

Wild-type + + + +aIgB5 + + + +algB6 + + + +

aIgB7 + + + +

FIG. 6. Effects of the IHF binding site mutations on algB ex-

pression. P. aeruginosa strains containing plasmid pDJW161 (wild-type algB), pDJW207 (algB5), pDJW208 (algB6), or pDJW209(algB7) were cultured to the same cell density in logarithmic phase.The cell extracts were prepared and assayed for CAT by a sandwichenzyme-linked immunosorbent assay. These data represent theaverages of three independent experiments.

algB7-cat gene fusions produced only -30, 10, and 0%,respectively, of the CAT observed in the Alg' FRD1 strain.Moreover, the magnitude of this decrease in algB expressioncorrelates with the loss of IHF binding observed with algB5,algB6, and algB7 (Fig. 5). Thus, in the absence of algTproduct (FRD440), the result of a severe defect introducedinto the IHF binding site (algB7) was the total loss of algBtranscription.

DISCUSSION

The combined data from this laboratory and other labora-tories have revealed a complex multigenic regulatory systemfor the biosynthesis of alginate in P. aeruginosa. Oneelement of this system is AlgB, which has homology to theNtrC-like family of two-component response regulators (51).We are currently examining the environmental signal(s) towhich AlgB responds and its specific target site in the P.aeruginosa genome.

In this study, the regulation of algB transcription was

examined by primer extension and gene fusion analysis. Weidentified a promoter located 286 nucleotides upstream of thealgB translation initiation codon. The sequences located inthe -13 to -18 region of algB contained a match of 5 of 6nucleotides with the -10 consensus (r70-utilized) Pribnowbox of E. coli, and a similarity with the -35 consensus

sequence was also apparent in the -36 to -41 region (amatch of 3 of 6 nucleotides). However, this promoter was

not expressed well in E. coli (52). On the basis of our gene

fusion studies (Table 2), transcription from this promoterwas indeed regulated by the product of the algT gene, sinceexpression of algB-cat was reduced at least 50% in a

spontaneous Alg- strain and an algT: :TnSOJ mutant, both ofwhich have reduced or no algT expression (20). These

results appear to be in general agreement with those recentlyobserved (26) in a study in which algB transcript accumula-tion was monitored in Alg' and Alg- strains by RNA-DNAdot blot analysis. In addition, transcription from this pro-moter was not dependent upon the algB gene product, sincetranscription was identical in algB::TnSOl strains and wild-type Alg' P. aeruginosa strains. Therefore, algB does notappear to be autoregulated.The algB-cat gene fusions described above showed that

transcription of algB in Alg' P. aeruginosa was increased atleast twofold over that in Alg- strains, and this was relatedto algT expression. Despite these gene fusion data, theprimer extension experiments clearly demonstrated an algBtranscription product in all Alg- as well as Alg' strains.Apparently, our primer extension experiments were notsufficiently sensitive to distinguish a twofold difference inalgB expression. Although these data cannot totally rule outthe possibility of another alginate-regulated promoter up-stream of the cat reporter gene (Fig. 1A), our extensivesearch for all algB transcription start sites upstream of theinitiation codon revealed only one. Previous complementa-tion studies (29), as well as the observation that insertion oftranscriptional terminators (i.e., an omega gene cartridge) atthe KpnI site located =160 bp upstream of the transcriptionstart site did not affect the ability of the algB clone(pDJW150) to complement an algB::TnSOl chromosomalmutation, suggest that the sequences required for algBexpression are contained entirely within the 420-bp K:pnI-EcoRI fragment. Therefore, these data suggest that low-leveltranscription and translation of algB in the nonmucoid cellmay have a purpose, even though it is not promoting alginateproduction. Considering that AlgB is apparently part of anenvironmental sensory system which modulates alginateproduction levels, it may be advantageous for the cell tohave a basal level of AlgB to maintain the sensory apparatusbefore the switch to the Alg+ phenotype occurs.

In this study, we also identified another level of algBregulation involving the DNA-binding/bending protein, IHF.Sequences located upstream of the start of algB transcrip-tion were unusually AT rich, and overlapping the algBpromoter was a consensus IHF binding site. This sequencecontained one mismatch with the consensus IHF binding siteproposed by Friedman (22) and was identical to the consen-sus IHF site described by Kur et al. (34). The latter consen-sus site takes into account the presence of poly(dA) andpoly(dT) sequences located immediately upstream of thecentral WATCAANNNNTTR core. These dA and dT se-quences were present in the algB IHF site. Additionally, gelband mobility shift assays were utilized to demonstrate thatthese sequences actually bind purified IHF with a relativelyhigh affinity (-8 x 107 M- ), and this is in the rangeobserved for binding of IHF to sequences present in the IS1element (43) and for IHF sites in the oriT region of F plasmid(48). Further evidence for the binding of IHF to thesesequences was provided by cell extracts from P. aeruginosaand E. coli. In these experiments, binding of IHF present inthese extracts was inhibited by anti-IHF antibodies. Inaddition, mutations in the algB IHF binding site which affectbinding of purified E. coli IHF also dramatically affect thebinding of IHF from P. aeruginosa. Taken together, theseresults suggest that IHF from P. aeruginosa is similar inbinding specificity to E. coli IHF and that it shares anantigenic epitope which reacts with E. coli IHF antibodiesand neutralizes its DNA binding activity. Further evidencefor this hypothesis was obtained in an immunoblot analysisusing antibodies raised against E. coli IHF. The major

VOL. 175, 1993

on Decem

ber 19, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

4152 WOZNIAK AND OHMAN

reacting species in cell extracts of P. aeruginosa were twopolypeptides having the same mobility as the IHF subunitsin E. coli (52). However, we cannot absolutely conclude thatthe inhibition of binding with the anti-E. coli IHF antibodies(Fig. 4, lanes 12 and 14) is due to inhibition of IHF becausethe antiserum also showed minor cross-reactivity with otherproteins in the P. aeruginosa extracts. We are aware of onlyone report suggesting the existence of IHF in P. aeruginosa;in that report, E. coli IHF was shown to bind to a site locatednear the left end of the D3112 transposable phage (2).Verification of IHF in P. aeruginosa by cloning and sequenc-ing of the genes which encode this protein is under way inour laboratory.IHF from E. coli is considered to be a member of the

histone-like family of proteins, since it can compact DNAand the subunits share amino acid sequence homology withHU protein (21). However, there exists an important distinc-tion between these proteins in that IHF binding to DNA issequence specific. Once bound, IHF often induces severebends in the DNA, allowing novel interactions to occurbetween other DNA-binding proteins and/or regions of theDNA molecule. For example, during X integration, IHFbinds to attP and bends the DNA, allowing the topo-isomerase Int to catalyze reactions necessary for integrationof X. In this system, IHF is not directly involved in therecombination process but is essential for maintaining thecritical DNA topology necessary for Int activity. IHF maybe acting in a similar fashion in the expression of algB. Bybinding at the algB promoter region, IHF may provide thecorrect DNA architecture to allow basal expression of algBin nonmucoid strains and in the absence of the algT product.The fact that IHF binding to the algB promoter plays amuch-reduced role in mucoid strains suggests that the algTproduct may play a role similar to that played by IHF (eitherdirectly or indirectly) in algB expression.IHF is also involved in Klebsiella pneumoniae nifH tran-

scription (30). In this system, IHF binds upstream of theRpoN (or' ) promoter and is believed to induce a bend in theDNA to facilitate interactions between the upstream-boundtranscriptional activator NifA and the promoter-bound RNApolymerase, leading to open complex formation and nifHtranscription. Located near the or4-like promoter ofalgD arepotential IHF binding sites, and we have recently demon-strated that IHF binds specifically to these sequences (50).We are currently testing the possibility that IHF may also beacting as a positive effector of algD transcription by facili-tating interactions between transcriptional activators such asAlgR or AlgB bound unusually far upstream of the algDpromoter and RNA polymerase.The regulation of alginate biosynthesis is clearly a com-

plex process involving numerous genes. Determining themolecular mechanisms of control of one of the essentialalginate regulators (algB) is fundamental to our understand-ing of alginate gene control and its role in disease caused bythe remarkable opportunistic pathogen P. aeruginosa. Inthis study, we have shown that the maximal level of algBtranscription is dependent on two proteins, AlgT and anas-yet-unidentified factor. This new factor binds to a se-quence that is identical to the binding site for E. coli IHF,and the factor most likely is a P. aeruginosa IHF homolog.

ACKNOWLEDGMENTS

We thank the members of the Howard Nash laboratory for thegenerous gifts of purified 1HF and anti-IHF antibodies and MarthaHowe for providing E. coli strains. We acknowledge the Molecular

Resources Center of the University of Tennessee, Memphis, forproviding oligonucleotides for sequencing and mutagenesis.

This work was supported by Public Health Service grant AI-19146from the National Institute of Allergy and Infectious Diseases(D.E.O.) and in part by Veterans Administration medical researchfunds (D.E.O.). D.J.W. was the recipient of a Cystic FibrosisFoundation postdoctoral research fellowship.

REFERENCES

1. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G.Seidman, J. A. Smith, and K. Struhl. 1989. Short protocols inmolecular biology. John Wiley & Sons, New York.

2. Autexier, C., S. Wragg-LUgari, and M. S. DuBow. 1991. Char-acterization of the Pseudomonas aeruginosa transposablephage D3132 left-end regulatory region. Biochim. Biophys. Acta1088:147-150.

3. Baltimore, R. S., and M. Mitchell. 1982. Immunologic investi-gations of mucoid strains ofPseudomonas aeruginosa: compar-ison of susceptibility to opsonic antibody in mucoid and non-mucoid strains. J. Infect. Dis. 141:238-247.

4. Bethesda, R. L. 1984. E. coli TB1 host for pUC plasmids. Focus6:7.

5. Bourret, R. B., and M. S. Fox. 1988. Lysogenization of Esche-richia coli him', himA, and himD hosts by bacteriophage Mu. J.Bacteriol. 170:1672-1682.

6. Boyer, H. W., and D. Roullard-Dussoix. 1969. A complementa-tion analysis of the restriction and modification of DNA inEscherichia coli. J. Mol. Biol. 41:459-472.

7. Bradford, M. M. 1976. A rapid and sensitive method for thequantitation of microgram quantities of protein utilizing theprinciple of protein-dye binding. Anal. Biochem. 72:248-254.

8. Chitnis, C. E., and D. E. Ohman. Genetic analysis of thealginate biosynthetic gene cluster of Pseudomonas aeruginosashows evidence for an operonic structure. Mol. Microbiol., inpress.

9. Close, T. J., and R. L. Rodriguez. 1982. Construction andcharacterization of the chloramphenicol-resistance gene car-tridge: a new approach to the transcriptional mapping of extra-chromosomal elements. Gene 20:305-316.

10. Costerton, J. W., K. J. Cheng, G. G. Geesey, T. Ladd, J. C.Nickel, M. Dasgupta, and T. Marrie. 1987. Bacterial biofilms innature and disease. Annu. Rev. Microbiol. 41:435-464.

11. Darzins, A., and A. M. Chakrabarty. 1984. Cloning of genescontrolling alginate biosynthesis from a mucoid cystic fibrosisisolate of Pseudomonas aenrginosa. J. Bacteriol. 159:9-18.

12. Darzins, A., S.-K. Wang, R. I. Vanags, and A. M. Chakrabarty.1985. Clustering of mutations affecting alginic acid biosynthesisin mucoid Pseudomonas aeruginosa. J. Bacteriol. 164:516-524.

13. Deretic, V., R. Dikshit, W. M. Konyecsni, A. M. Chakrabarty,and T. K. Misra. 1989. The algR gene, which regulates mucoidyin Pseudomonas aeruginosa, belongs to a class of environmen-tally responsive genes. J. Bacteriol. 171:1278-1283.

14. Deretic, V., J. F. Gill, and A. M. Chakrabarty. 1987. Gene algDcoding for GDPmannose dehydrogenase is transcriptionallyactivated in mucoid Pseudomonas aeruginosa. J. Bacteriol.169:351-358.

15. Deretic, V., J. F. Gill, and A. M. Chakrabarty. 1987. Pseudo-monas aeruginosa infection in cystic fibrosis: nucleotide se-quence and transcriptional regulation of the algD gene. NucleicAcids Res. 11:4567-4581.

16. Deretic, V., and W. M. Konyecsni. 1989. Control of mucoidy inPseudomonas aeruginosa: transcriptional regulation of algRand identification of the second regulatory gene, algQ. J.Bacteriol. 171:3680-3688.

17. Fick, R. 1981. Pseudomonas in cystic fibrosis. Clin. Chest Med.2:91-102.

18. Figurski, D., and D. R. Helinski. 1979. Replication of anorigin-containing derivative of plasmid RK2 dependent on aplasmid function provided in trans. Proc. Natl. Acad. Sci. USA76:1648-1652.

19. Flynn, J. L., and D. E. Ohman. 1988. Cloning of genes frommucoid Pseudomonas aeruginosa which control spontaneous

J. BACTERIOL.

on Decem

ber 19, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

IHF AND AlgT CONTROL algB TRANSCRIPTION 4153

conversion to the alginate production phenotype. J. Bacteriol.170:1452-1460.

20. Flynn, J. L., and D. E. Ohman. 1988. Use of a gene replacementcosmid vector for cloning alginate conversion genes from mu-

coid and nonmucoid Pseudomonas aeruginosa strains: aigScontrols expression of algT. J. Bacteriol. 170:3228-3236.

21. Freundlich, M., N. Ramani, E. Mathew, A. Sirko, and P. Tsui.1992. The role of integration host factor in gene expression inEscherichia coli. Mol. Microbiol. 6:2557-2563.

22. Friedman, D. I. 1988. Integration host factor: a protein for allreasons. Cell 55:545-554.

23. Fyfe, J. A. M., and J. R. W. Govan. 1980. Alginate synthesis inmucoid Pseudomonas aeruginosa: a chromosomal locus in-volved in control. J. Gen. Microbiol. 119:443-450.

24. Fyfe, J. A. M., and J. R. W. Govan. 1981. A revised chromo-somal location for muc: a locus involved in the control ofalginate production by mucoid Pseudomonas aeruginosa. Soc.Gen. Microbiol. Q. 8:250-251.

25. Gober, J. W., and L. Shapiro. 1990. Integration host factor isrequired for the activation of developmentally regulated genes

in Caulobacter. Genes Dev. 4:1494-1504.26. Goldberg, J. B., and T. Dahnke. 1992. Pseudomonas aeruginosa

AlgB, which modulates the expression of alginate, is a memberof the NtrC subclass of prokaryotic regulators. Mol. Microbiol.6:59-66.

27. Goldberg, J. B., W. L. Gorman, J. L. Flynn, and D. E. Ohman.1993. A mutation in algN permits trans activation of alginateproduction by algT in Pseudomonas species. J. Bacteriol.175:1303-1308.

28. Goldberg, J. B., and D. E. Ohman. 1984. Cloning and expressionin Pseudomonas aeruginosa of a gene involved in the produc-tion of alginate. J. Bacteriol. 158:1115-1121.

29. Goldberg, J. B., and D. E. Ohman. 1987. Construction andcharacterization of Pseudomonas aeruginosa algB mutants:role of algB in high-level production of alginate. J. Bacteriol.169:1593-1602.

30. Hoover, T. R., E. Santero, S. Porter, and S. Kustu. 1990. Theintegration host factor stimulates interaction of RNA poly-merase with NifA, the transcriptional activator for nitrogenfixation operons. Cell 63:11-22.

31. Kato, J., and A. M. Chakrabarty. 1991. Purification of theregulatory protein AlgR1 and its binding in the far upstreamregion of the algD promoter in Pseudomonas aeruginosa. Proc.Natl. Acad. Sci. USA 88:1760-1764.

32. Kato, J., T. K. Misra, and A. M. Chakrabarty. 1990. AlgR3, a

protein resembling eukaryotic histone H1, regulates alginatesynthesis in Pseudomonas aeruginosa. Proc. Natl. Acad. Sci.USA 87:2887-2891.

33. Kulczycki, L. L., T. M. Murphy, and J. A. Bellanti. 1978.Pseudomonas colonization in cystic fibrosis: a study of 160patients. JAMA 240:30-34.

34. Kur, J., N. Hasan, and W. Szybalski. 1989. Physical andbiological consequences of interactions between integrationhost factor (IHF) and coliphage lambda P'R promoter and itsmutants. Gene 81:1-15.

35. Lee, E. C., L. M. Hales, R. I. Gumport, and J. F. Gardner. 1992.The isolation and characterization of mutants of the integrationhost factor (IHF) of Escherichia coli with altered, expandedDNA-binding specificities. EMBO J. 11:305-313.

36. Lee, E. C., M. P. MacWilliams, R. I. Gumport, and J. F.Gardner. 1991. Genetic analysis of Escherichia coli integration

host factor interactions with its bacteriophage X H' recognitionsite. J. Bacteriol. 173:609-617.

37. Linker, A., and R. S. Jones. 1966. A new polysaccharideresembling alginic acid isolated from pseudomonads. J. Biol.Chem. 241:3845-3851.

38. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecularcloning: a laboratory manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, N.Y.

39. Marcus, H., and N. R. Baker. 1985. Quantitation of adherence ofmucoid and nonmucoid Pseudomonas aeruginosa to hamstertracheal epithelium. Infect. Immun. 47:723-729.

40. Miller, J. F., J. J. Mekalanos, and S. Falkow. 1989. Coordinateregulation and sensory transduction in the control of bacterialvirulence. Science 243:916-922.

41. Ohman, D. E., and A. M. Chakrabarty. 1981. Genetic mappingof chromosomal determinants for the production of the ex-opolysaccharide alginate in a Pseudomonas aeruginosa cysticfibrosis isolate. Infect. Immun. 33:142-148.

42. Ohman, D. E., and A. M. Chakrabarty. 1982. Utilization ofhuman respiratory secretions by mucoid Pseudomonas aerugi-nosa of cystic fibrosis origin. Infect. Immun. 37:662-669.

43. Prentki, P., M. Chandler, and D. J. Galas. 1987. Escherichia coliintegration host factor bends DNA at the ends of ISJ and in aninsertion hotspot with multiple binding sites. EMBO J. 6:2479-2487.

44. Shortridge, V. D., M. L. Pato, A. I. Vasil, and M. L. Vasil. 1991.Physical mapping of virulence-associated genes in Pseudo-monas aeruginosa by transverse alternating-field electrophore-sis. Infect. Immun. 59:3596-3603.

45. Staskawicz, B., D. Dahlbeck, N. Keen, and C. Napoli. 1987.Molecular characterization of cloned avirulence genes from race0 and race 1 of Pseudomonas syringae pv. glycinea. J. Bacte-riol. 169:5789-5794.

46. Stock, J. B., A. J. Ninfa, and A. M. Stock. 1989. Proteinphosphorylation and regulation of adaptive responses in bacte-ria. Microbiol. Rev. 53:450-490.

47. Toussaint, B., C. Bosc, P. Richaud, A. Colbeau, and P. M.Vignais. 1991. A mutation in a Rhodobacter capsulatus geneencoding an integration host factor-like protein impairs in vivohydrogenase expression. Proc. Natl. Acad. Sci. USA 88:10749-10753.

48. Tsai, M.-M., Y.-H. F. Fu, and R. C. Deonier. 1990. Intrinsicbends and integration host factor binding at F plasmid oriT. J.Bacteriol. 172:4603-4609.

49. Vogel, H. J., and D. M. Bonner. 1956. Acetylornithinase inEscherichia coli: partial purification and some properties. J.Biol. Chem. 218:97-106.

50. Wozniak, D. J. 1992. Involvement of integration host factor inthe regulation of Pseudomonas aeruginosa alginate genes, algBand algD, abstr. D-232, p. 134. Abstr. 92nd Gen. Meet. Am.Soc. Microbiol. 1992.

51. Wozniak, D. J., and D. E. Ohman. 1991. Pseudomonas aerugi-nosa AlgB, a two-component response regulator of the NtrCfamily, is required for algD transcription. J. Bacteriol. 173:1406-1413.

52. Wozniak, D. J., and D. E. Ohman. Unpublished data.53. Zielinski, N. A., A. M. Chakrabarty, and A. Berry. 1991.

Characterization and regulation of the Pseudomonas aerugi-nosa algC gene encoding phosphomannomutase. J. Biol. Chem.266:9754-9763.

VOL. 175, 1993

on Decem

ber 19, 2020 by guesthttp://jb.asm

.org/D

ownloaded from