involvement of th17 pathway in adverse drug reactions - t-space
TRANSCRIPT
Involvement of Th17 Pathway in Adverse Drug Reactions:
Mechanistic Investigation of Drug-Induced Autoimmunity and
Drug-induced Liver Injury
By
(Ervin) Xu Zhu
A thesis submitted in conformity with the requirements for the degree of DOCTOR OF PHILOSOPHY
Graduate Department of Pharmaceutical Sciences University of Toronto
©Copyright by (Ervin) Xu Zhu 2012
II
ABSTRACT Involvement of Th17 Pathway in Adverse Drug Reactions: Mechanistic Investigation of Drug-Induced Autoimmunity and Drug-induced Liver
Injury
By (Ervin) Xu Zhu
Faculty of Pharmacy, University of Toronto 2012
DOCTOR OF PHILOSOPHY
Clinical characteristics of idiosyncratic drug reactions (IDRs) suggest that they are
immune mediated. Penicillamine-induced autoimmunity in Brown Norway rats was used as a
tool for mechanistic studies of this type of IDR. It has been shown that T helper 17 (Th17)
cells play a central role in many types of autoimmune diseases. This study was designed to
test whether Th17 cells are involved in the pathogenesis of penicillamine-induced
autoimmunity. In sick animals, interleukin (IL) 6 and transforming growth factor-β1, known
to be driving forces of Th17 differentiation, were consistently increased following
penicillamine treatment. IL-17 and IL-22, characteristic cytokines produced by Th17 cells,
were increased in sick animals. Furthermore, the percentage of IL-17-producing CD4 T cells
was significantly increased, but only in sick animals. Retinoic acid, which has been reported
to inhibit Th17 cell development, made the autoimmunity worse, increased IL-6 production,
and did not decrease the number of Th17 cells. An infiltration of CD8 cytotoxic T cells in the
liver suggests that they may be the key player in causing liver toxicity induced by D-
penicillamine.
Drug-induced liver injury (DILI) is one of the major causes of morbidity, mortality,
and drug candidate failure. Recently, it has been suggested that Th17 cells may play an active
role in inflammatory human liver diseases. In a study of patients being treated with isoniazid,
III
some patients developed mild liver injury. The percentage of Th17 cells in the blood of these
patients significantly increased when the ALT increased, and this suggests that they play a
role in the mechanism of this liver injury. Furthermore, IL-10-producing T cells also
increased and this may have prevented the development of severe liver injury. In another
study, two hours after treatment of mice with acetaminophen there was a significant increase
in Th17 cells in the liver. This rapid response suggests that Th17 cells can be part of the
innate immune response to liver injury.
Our data provided evidence that Th17 cells are involved in both “toxic” and
idiosyncratic liver toxicity. This pathway could be a new target for the therapeutic
interventions to treat DILI.
IV
ACKNOWLEDGEMENT
First of all, I would like to thank and express my deepest gratitude to my supervisor,
Dr. Jack Uetrecht for his great mentorship and continuous support throughout my Ph.D
training in his lab. When I think how much I have learned and gained in the past five years, I
become very emotional. I realized that I have progressed from an insecure student to a fairly
confident one under his supervision. It is a complete privilege and a great honor for me to be
a member of his research group. He is a role model in my life.
I would like to extend my thanks to my advisory committee, Dr. Carolyn Cummins,
Dr. Jack Hay, Dr. Peter J. O’Brien, the internal examiner, Dr. Denis Grant , and the external
examiner of my thesis, Dr. Lance Pohl from NIH. I appreciate very much for their
suggestions and support for my research and the preparation of this thesis.
I would also like to thank my lab mates Jie, Tharsika, Julia, Baskar, Robert, Ping,
Xiao Chu, Maria, Xin, Feng, Winnie, Imir, Amy, and Alex who have always been
encouraging and supportive. They are not only colleagues, but also loyal friends. They made
the life more enjoyable.
Finally, I would like to specially thank my parents, Mr. Ningguo Zhu and Ms.
Songling Yu. Without your selfless support, I would never go this far. I would also like to
dedicate this work to my wife, Ms. Runhua Yang, for her constant care, encouragement and
support from every aspect. I appreciate in deed all she has done for me.
V
TABLE OF CONTENTS
ABSTRACT ................................................................................................................................ II
ACKNOWLEDGEMENT ....................................................................................................... IV
TABLE OF CONTENTS ........................................................................................................... V
LIST OF THESIS PUBLICATIONS .................................................................................. VIII
LIST OF ABBREVIATIONS ................................................................................................. IX
LIST OF FIGURES ................................................................................................................. XII
LIST OF TABLES ................................................................................................................. XIV
CHAPTER 1 ................................................................................................................................ 1
GENERAL INTRODUCTION .................................................................................................. 1
1.1. ADVERSE DRUG REACTIONS ....................................................................................... 2
1.2. IDIOSYNCRATIC DRUG REACTIONS .......................................................................... 5
1.3. PROPOSED HYPOTHESIS OF MECHANISMS OF IDRS ......................................... 11
1.3.1. THE HAPTEN HYPOTHESIS .................................................................................. 11
1.3.2. THE DANGER HYPOTHESIS ................................................................................ 12
1.3.3. THE PHARMACOLOGICAL INTERACTION HYPOTHESIS .............................. 13
1.4. D-PENICILLAMINE-INDUCED IDR ANIMAL MODEL ........................................... 14
1.5. IL-17 AND TH17 CELLS .................................................................................................. 17
1.5.1. IL-17 AND TH17 CELLS IN HOST DEFENSE ...................................................... 18
1.5.2. IL-17 AND TH17 CELLS IN AUTOIMMUNITY ................................................... 19
1.5.3. IL-17 AND TH17 CELLS IN LIVER DISEASES .................................................... 20
CHAPTER 2 .............................................................................................................................. 24
INVOLVEMENT OF T HELPER 17 (TH17) CELLS IN D-PENICILLAMINE-INDUCED
AUTOIMMUNE DISEASE IN BROWN NORWAY RATS ................................................ 24
2.1. INTRODUCTION .............................................................................................................. 25
VI
2.2. MATERIALS AND METHODS ....................................................................................... 28
2.3. RESULTS ............................................................................................................................ 32
2.4. DISCUSSION ...................................................................................................................... 40
CHAPTER 3 ............................................................................................................................. 43
MODULATION OF D-PENICILLAMINE-INDUCED AUTOIMMUNITY IN THE BROWN
NORWAY RATS WITH PHARMACOLOGICAL AGENTS THAT INTERFERE WITH THE
TH17 PATHWAY: THE EFFECTS OF RETINOIC ACID ................................................. 43
3.1. INTRODUCTION ............................................................................................................. 45
3.2. MATERIALS AND METHODS ....................................................................................... 47
3.3. RESULTS ............................................................................................................................ 49
3.4. DISCUSSION ...................................................................................................................... 52
CHAPTER 4 ............................................................................................................................. 54
CHARACTERIZATION OF THE ROLE OF THE IMMUNE SYSTEM IN D-
PENICILLAMINE-INDUCED LIVER INJURY. ................................................................. 54
4.1. INTRODUCTION .............................................................................................................. 55
4.2. MATERIALS AND METHODS ....................................................................................... 57
4.3. RESULTS ............................................................................................................................ 59
4.4. DISCUSSION ...................................................................................................................... 67
CHAPTER 5 ............................................................................................................................. 70
INVESTIGATION OF THE ROLE OF TH17 CELLS IN ISONIAZID-INDUCED LIVER
INJURY ...................................................................................................................................... 71
5.1. INTRODUCTION .............................................................................................................. 72
5.2. MATERIALS AND METHODS ....................................................................................... 74
5.3. RESULTS ............................................................................................................................ 76
5.4. DISCUSSION ...................................................................................................................... 83
VII
CHAPTER 6 ............................................................................................................................. 86
TH17 CELLS ARE INCREASED IN THE LIVER FOLLOWING ACETAMINOPHEN
TREATMENT OF MICE: TH17 CELLS AND THE INNATE IMMUNE SYSTEM ....... 86
6.1. INTRODUCTION .............................................................................................................. 88
6.2. MATERIALS AND METHODS ....................................................................................... 90
6.3. RESULTS AND DISCUSSION ......................................................................................... 93
CHAPTER 7 ............................................................................................................................. 98
OVERALL CONCLUSIONS AND FUTURE DIRECTIONS ............................................. 98
7.1. INTRODUCTION .............................................................................................................. 99
7.2. SUMMARY AND CONCLUSIONS ............................................................................... 100
7.3. IMPLICATIONS AND FUTURE DIRECTIONS ........................................................ 101
REFERENCES ........................................................................................................................ 105
VIII
LIST OF THESIS PUBLICATIONS Zhu X, Li J, Liu F, Uetrecht JP. Involvement of T helper 17 cells in D-penicillamine-
induced autoimmune disease in Brown Norway rats. Toxicol Sci. 2011 Apr; 120(2):331-8.
Jinze Li, Xu Zhu, Feng Liu, Ping Cai, Carron Sanders, William M. Lee, and Jack Uetrecht. Cytokine and autoantibody patterns in acute liver failure. J Immunotoxicol. 2010 Jul-Sep; 7(3):157-64.
Metushi IG, Cai P, Zhu X, Nakagawa T, Uetrecht JP. A fresh look at the mechanism of isoniazid-induced hepatotoxicity. Clin Pharmacol Ther. 2011 Jun; 89(6):911-4.
Zhang X, Liu F, Chen X, Zhu X, Uetrecht J. Involvement of the immune system in idiosyncratic drug reactions. Drug Metab Pharmacokinet. 2011; 26(1):47-59. Review
Dugoua JJ, Machado M, Zhu X, Chen X, Koren G, Einarson TR. Probiotic safety in pregnancy: a systematic review and meta-analysis of randomized controlled trials of Lactobacillus, Bifidobacterium, and Saccharomyces spp J Obstet Gynaecol Can. 2009 Jun;31(6):542-52. Review.
Zhu X, Li J, and Uetrecht JP. Th17 cells are increased in the liver following acetaminophen treatment of mice: Th17 cells and the innate immune system (Submitted) J Immunotoxicol.
Zhu X, Li J, and Uetrecht JP. Modulation of D-penicillamine-induced autoimmunity in the Brown Norway rats with pharmacological agents that interfere with the Th17 pathway: The effects of retinoic acid. (Submitted) J Immunotoxicol.
IX
LIST OF ABBREVIATIONS Chapter 1 ADR, Adverse drug reaction ALT, Alanine aminotransferase APC, Antigen presenting cell AST, Aspartate aminotransferase BN, Brown Norway CD, Cluster of differentiation ConA, Concanavalin A DILI, Drug induced liver injury DNA, Deoxyribonucleic acid EAE, Experimental autoimmune encephalomyelitis FOXP3, Forkhead box P3 HBV, Hepatitis B HCV, Hepatitis C HLA, Histocompatibility leukocyte antigen HMGB, High mobility group protein HSP, Heat shock proteins IDILI, Idiosyncratic drug induced liver injury IDR, Idiosyncratic drug reaction IFN, Interferon IgE, Immunoglobulin E IL, Interleukin
IL-17R, IL-17 receptor G-CSF, Granulocyte colony stimulating factor GI, Gastrointestinal LPS, Lipopolysaccharide MHC, Major histocompatibility mRNA, Messenger ribonucleic acid MS, Multiple sclerosis NK, Natural Killer NKT, Natural killer T PI, Pharmacological interaction Poly I:C, Polyinosinic-Polycytidylic acid RAGE, Receptors for advanced glycation end products ROR, Retinoic acid receptor-related orphan receptor SJS, Steven-Johnson syndrome
X
STAT, Signal transducer and activator of transcription TCR, T cell receptor TEN, toxic epidermal necrolysis TGF, Transforming growth factor Th, T helper cell TNF, Tumor necrosis factor Treg, Regulatory T cells
Chapter 2 BCIP, 5-bromo-4-chloro-3-indolyl-phosphate CCL, Chemokine (C-C motif) ligand cDNA, Complementary DNA IgG, Immunoglobulin G ELISA, Enzyme-linked immunosorbent assay ELISPOT, Enzyme-linked immunosorbent spot GAPDH, Glyceraldehyde 3-phosphate dehydrogenase GM-CSF, Granulocyte macrophage colony-stimulating factor MACS, Magnetic cell separation technology MCP, Monocyte chemotactic protein MIP, Macrophage inflammatory protein NBT, Nitro blue tetrazolium GRO/KC, Growth-related oncogene PBMC, Peripheral blood mononuclear cells PCR, Polymerase chain reaction qRT-PCR, Quantitative real-time PCR RANTES, Regulated upon Activation, Normal T-cell Expressed, and Secreted VEGH, Vascular endothelial growth factor Chapter 3 PMA, Phorbol myristate acetate RA, Retinoic acid Chapter 4 ANOVA, Analysis of variance APAP, Acetaminophen D-PBS, Dulbecco's Phosphate-Buffered Saline H&E, Hematoxylin and eosin RPMI, Roswell Park Memorial Institute SDH, Sorbitol dehydrogenase Chapter 5 INH, Isoniazid
XI
PBS, Phosphate-buffered saline Chapter 6 ALF, Acute liver failure CYP, Cytochrome P450 I.P., Intraperitoneal NAPQI, N-acetyl-p-benzoquinone imine
XII
LIST OF FIGURES FIGURE 01. SERUM CONCENTRATION OF IL-6 .......................................................... 32 FIGURE 02. CHANGES IN BODY WEIGHT (A) AND CUMULATIVE INCIDENCE OF
AUTOIMMUNITY ........................................................................................ 33 FIGURE 03. SERUM CYTOKINE/CHEMOKINE PROFILES ......................................... 34 FIGURE 04. SERUM IL-22 DURING THE DEVELOPMENT OF PENICILLAMINE-
INDUCED AUTOIMMUNITY. .................................................................... 35 FIGURE 05. IL-6 & IL-22 SERUM LEVELS IN THE FIRST WEEK OF PENICILLAMINE
TREATMENT ................................................................................................ 36 FIGURE 06. IL-6, IL-7, AND IL-17 PRODUCTION AT THE END OF PENICILLAMINE
TREATMENT ................................................................................................ 38 FIGURE 07. FLOW CYTOMETRY ANALYSIS FOR INTRACELLULAR IL-17A IN
CD4+ LYMPHOCYTES FROM CONTROL, TREATED NON-SICK, AND SICK ANIMALS ............................................................................................ 39
FIGURE 08. CHANGES IN CUMULATIVE INCIDENCE OF AUTOIMMUNITY ....... 49 FIGURE 09. FLOW CYTOMETRY ANALYSIS OF INTRACELLULAR IL-17A IN CD4+
LYMPHOCYTES .......................................................................................... 50 FIGURE 10. SERUM CONCENTRATION OF IL-6 IN RA-TREATED VS. CONTROL
ANIMALS. ..................................................................................................... 51 FIGURE 11. RA APPEARS TO ACTIVATE MACROPHAGES LEADING TO AN
INCREASE IN SERUM IL-6 AND FACILITATING THE DIFFERENTIATION OF TH17 CELLS. ...................................................... 51
FIGURE 12. SERUM CONCENTRATIONS OF IL-10 OVER SEVEN WEEKS IN D-PENICILLAMINE-TREATED ANIMALS AND IN THE CONTROL GROUP ........................................................................................................................ 59
FIGURE 13. SERUM CONCENTRATIONS OF ALT AND SDH IN THE CONTROL GROUP AND THE D-PENICILLAMINE-TREATMENT GROUP ............ 60
FIGURE 14. SERUM CONCENTRATIONS OF IL-10 AND SDH OF INDIVIDUAL ANIMALS IN THE D-PENICILLAMINE-TREATMENT GROUP............ 61
FIGURE 15. FLOW CYTOMETRIC ANALYSIS OF CD3+CD8+ T CELL SUBSETS IN THE LIVER FROM CONTROL, NON-SICK, AND SICK ANIMAL GROUPS. ....................................................................................................... 63
FIGURE 16. FLOW CYTOMETRIC ANALYSIS OF CD8+, CD161+ SUBSETS IN THE LIVER T CELLS FROM CONTROL, NON-SICK, AND SICK ANIMAL GROUPS. ....................................................................................................... 64
XIII
FIGURE 17. FLOW CYTOMETRIC ANALYSIS OF CD3+CD4+ T CELL SUBSETS IN THE LIVER FROM CONTROL, NON-SICK, AND SICK ANIMAL GROUPS. ....................................................................................................... 65
FIGURE 18. MORPHOLOGICAL CHANGES (H&E STAIN) IN THE LIVER OF MALE BN RATS THAT DEVELOPED D-PENICILLAMINE-INDUCED AUTOIMMUNITY. ....................................................................................... 66
FIGURE 19. THE PERCENTAGE OF TH17 CELLS IN THE PERIPHERAL BLOOD IN PATIENTS RECEIVING INH ...................................................................... 78
FIGURE 20. EXAMPLES OF INCREASES IN THE PERCENTAGE OF TH17 CELLS BEFORE AND AFTER INH TREATMENT IN SOME PATIENTS WHO HAD AN INCREASE IN ALT ...................................................................... 79
FIGURE 21. THE PERCENTAGE OF TREG CELLS IN THE PERIPHERAL BLOOD IN PATIENTS RECEIVING INH ...................................................................... 81
FIGURE 22. THE RATIO OF TH17 CELLS/TREG CELLS COMPARED BETWEEN PATIENTS WITH A NORMAL OR AN ELEVATED ALT LEVEL. ......... 82
FIGURE 23. INCREASED PERCENTAGE OF CELLS THAT PRODUCE IL-10 IN THE PERIPHERAL BLOOD FROM TWO PATIENTS THAT DEVELOPED INH-INDUCED LIVER INJURY. ......................................................................... 85
FIGURE 24. LIVER INJURY DURING APAP-INDUCED LIVER TOXICITY .............. 93 FIGURE 25. SERUM IL-17 LEVELS AFTER APAP (300�MG/KG) TREATMENT. .... 93 FIGURE 26. APAP TREATMENT INCREASED THE LEVELS OF IL-17-PRODUCING
CD4+ T CELLS IN THE LIVER .................................................................. 94 FIGURE 27. COMPARISON OF STAINING FOR CD1D TETRAMER (NKT CELL
MARKER) IN TOTAL HEPATIC LYMPHOCYTES AND HEPATIC LYMPHOCYTES THAT STAIN POSITIVE FOR CD3/CD4/IL-17 FROM FIGURE 26..................................................................................................... 95
XIV
LIST OF TABLES TABLE 1. EXAMPLES OF DRUGS THAT HAVE BEEN WITHDRAWN BECAUSE OF
ADVERSE REACTIONS .................................................................................... 3 TABLE 2. CLASSIFICATION OF ADVERSE DRUG REACTIONS ................................ 4 TABLE 3. PRIMER SEQUENCES FOR QRT-PCR .......................................................... 42 TABLE 4. SERUM CONCENTRATIONS OF SDH IN THE CONTROL GROUP AND
TREATMENT GROUP .................................................................................... 62 TABLE 5. ALT LEVELS AND THE FREQUENCY OF TH17 CELLS AT VARIOUS
TIME POINTS IN PATIENTS TREATED WITH INH .................................. 77 TABLE 6. ALT LEVELS AND THE PERCENTAGE OF TREG CELLS IN THE
PERIPHERAL BLOOD AT VARIOUS TIME POINTS IN PATIENTS TREATED WITH INH ...................................................................................... 80
2
1.1. ADVERSE DRUG REACTIONS
An adverse drug reaction (ADR) is “an appreciably harmful or unpleasant reaction,
resulting from an intervention related to the use of a medicinal product, which predicts
hazard from future administration and warrants prevention or specific treatment, or alteration
of the dosage regimen, or withdrawal of the product” (Edwards and Aronson 2000). ADRs
can lead to significant morbidity and mortality and they are a serious public health problem.
For example, in the United Kingdom, it has been reported that ADRs are responsible for
more than 6% of hospital admissions and the mortality rate was approximately 2%
(Pirmohamed, James et al. 2004). Another report suggests that the number of ADR-related
hospital admissions increased at a greater rate than the increase in total hospital admissions
between 1999 and 2009, and mortality due to ADR admissions also increased during the
same period (Wu, Jen et al. 2010). In the US, according to a meta-analysis, ADRs rank
among the six leading causes of death after heart diseases, cancer, stroke, pulmonary disease,
and accidents (Lazarou, Pomeranz et al. 1998). ADRs are also a major issue for drug
candidate failure considering the fact that it usually takes about 12-14 years to bring a new
drug to market at a cost of up to $800 million, but due to various ADRs many drugs acquire a
black box warning or are withdrawn from the market (Table 1.1).
3
Table 1 Examples of drugs that have been withdrawn because of adverse reactions (Adapted from Stephens' Detection and Evaluation of Adverse Drug Reactions)
Drug Year Adverse Reaction Outcome Diododiethyl tin 1954 Cerebral Oedema Withdrawn Thalidomide 1961 Congenital Malformation Withdrawn Clioquinol 1975 Neuropathy Withdrawn Benoxaprofen 1982 Liver injury, photosensitivity Withdrawn Zimelidine 1983 Hypersensitivity Withdrawn Zomepirac 1983 Anaphylaxis Withdrawn Fenclofenac 1984 Toxic epidermal necrolysis Withdrawn Indoprofen 1984 GI bleeding Withdrawn Osmosin 1984 GI ulceration Withdrawn Nomifensine 1986 Haemolytic anaemia Withdrawn Suprofen 1987 Renal impairment Withdrawn L-tryptophan 1990 Eosinophilic myalgia syndrome Withdrawn Metipranolol 1990 Anterior uveitis Withdrawn Noscapine 1991 Gene toxicity Withdrawn Terodiline 1991 Cardiac arrhythmias Withdrawn Triazolam 1991 Psychiatric disorders Withdrawn Temafloxacin 1992 Serious adverse reactions Withdrawn Centoxin 1993 Increased mortality Withdrawn Flosequinan 1993 Increased mortality Withdrawn Remoxipride 1994 Aplastic anaemia Withdrawn Naftidrofuryl 1995 Cardiac/neurological toxicity Withdrawn Troglitazone 1997 Liver failure Withdrawn Terfenadine 1997 Torsade de pointe Withdrawn Dexfenfluramine 1997 Cardiac valve abnormalities Withdrawn Mibefradil 1998 P450 inhibition/drug interactions Withdrawn Tolcapone 1998 Liver failure Withdrawn Astemizole 1998 Torsade de pointe Withdrawn Sertindole 1998 Torsade de pointe Withdrawn Cisapride 2000 QT interval prolongation Withdrawn Cerivastation 2001 Rhabdomyolysis Withdrawn Kava extracts 2002 Liver damage Withdrawn TGN1412 2005 Cytokine release syndrome Withdrawn Rofecoxib 2004 Cardiovascular disease Withdrawn Benfluorex 2009 Pulmonary hypertension Withdrawn Rosiglitazone 2010 Cardiovascular disease Withdrawn
4
ADRs were first classified as type A (pharmacological, dose-related, or augmented)
and type B (idiosyncratic, non-dose-related, or bizarre) (Rawlins, Thompson 1977). Later, as
the mechanism of ADRs were further studied, the first proposed types A and B were
inadequate to classify all ADRs and four more types of reactions were added: C (chronic,
dose-related and time-related), D (delayed, time-related), E (withdrawal, end-of-use effects),
and F (unexpected failure of therapy) (Grahame-Smith, Aronson 1984; Royer, 1997). This
classification is summarized in Table 1.2.
Table 2 Classification of adverse drug reactions
Type Feature Example Management
A Dose dependent and predictable
Digoxin toxicity Reduce doses or withhold
B Unpredictable Penicillin hypersensitivity Withhold
C Chronic Corticosteroids Reduce doses or withhold
D Delayed Carcinogenesis Often intractable
E End-of-treatment Opiate withdrawal Reintroduce and withdraw slowly
F Failure of therapy Inadequate dosage of an oral contraceptive
Increase dosage
5
1.2. IDIOSYNCRATIC DRUG REACTIONS
Type B ADRs are also referred to idiosyncratic drug reactions (IDRs), which can be
defined as an ADR that does not occur in most patients within the normal therapeutic dose
range and does not involve the therapeutic effects of the drug (Uetrecht 2009a). IDRs are
unpredictable ADRs and are the most difficult type to prevent. Although the fundamental
mechanisms of IDRs remain largely unknown, most IDRs are thought to be immune-
mediated, which may result from dysregulation of the normal activity of the immune system.
This is supported by the fact that IDRs are often associated with a delay between starting the
drug and the onset of the adverse reaction, but on rechallenge, there is usually a rapid onset
of the adverse reaction, which is one of the characteristics of immunological memory
(Uetrecht 2009a). There are many types of IDRs, most of which involve skin rashes,
hematological reactions, autoimmunity, and liver injury.
Drug-induced skin rashes can range from the less severe maculopapular rashes and
urticaria to Steven-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN). The most
common IDRs are exanthematous or maculopapular drug eruptions, which comprise almost
95% of all drug-induced rashes. After starting the drug, it usually takes about 1 to 2 weeks to
develop a rash (Torres, Mayorga et al. 2009). However, rashes usually occur more rapidly on
rechallenge or in previously sensitized patients. Typical histology shows a cellular infiltration
of CD4+ T lymphocytes in the dermis, suggesting that maculopapular rashes are T cell-
mediated immune reactions (Fernandez, Canto et al. 2009). The second most common form
of skin eruption is drug-induced urticaria, which accounts for about 5% of all cutaneous drug
reactions (Nigen, Knowles et al. 2003). ß-lactam-induced allergic reactions are the most well
known example of drug-induced urticaria. β-lactam-related IgE antibodies are responsible for
these IDRs, clearly indicating that this is an immune-mediated reaction (Parker and Thiel
1963; Gomez, Torres et al. 2004). Drug-induced SJS and TEN are two forms of very severe
6
skin rashes, both characterized by fever and blister formation, and differing only in the
degree of severity (Mockenhaupt 2009). The histology of both of SJS and TEN is
characterized by extensive T cell infiltration and related keratinocyte apoptosis. Other
evidence suggesting an immune-mediated mechanism includes the association between HLA
and some drug-induced SJS/TEN (Chung, Hung et al. 2010).
The most common types of hematological IDRs are thrombocytopenia,
agranulocytosis, and aplastic anemia (Uetrecht, 2009a). Drugs are one of the major causes of
thrombocytopenia (Kenney and Stack 2009). The time to onset is usually more than a week.
It should be noted that drug-induced thrombocytopenia is immune-mediated, but it is not
associated with immune memory (Warkentin and Kelton 2001). For example, patients
rechallenged with heparin do not develop thrombocytopenia more rapidly even when they
have a history of heparin-induced thrombocytopenia (Warkentin and Kelton 2001). Drugs
including analgesics, antipsychotics, antithyroid medications, and anticonvulsants may
induce agranulocytosis (Andres, Zimmer et al. 2006). Several experiments demonstrated that
drug-dependent antibodies are responsible for agranulocytosis caused by several drugs
(Salama et al., 1989). However, in the case of clozapine, agranulocytosis does not recur
rapidly on rechallenge, and no drug-dependent antibodies have been reported in patients
(Guest, Sokoluk et al. 1998). An autoimmune component is possibly involved in this case.
Drug-induced aplastic anemia is less common, but more severe. Evidence suggests that
idiosyncratic drug-induced aplastic anemia is immune-mediated. Cytotoxic T lymphocytes
may play a very important role and cause bone marrow destruction (Young 2002).
The liver is the major site of metabolism for drugs and other xenobiotics. Given that
most IDRs appear to be caused by reactive metabolites (Uetrecht, 2009a), this is probably
why the liver is involved in many IDRs. The mechanisms of idiosyncratic drug-induced liver
injury (IDILI) are not well understood, and the involvement of the immune system is more
7
controversial than for other types of IDRs. As with other IDRs, there is generally a delay
between starting a drug and the onset of IDILI. The most typical delay is 1-3 months, but in
some cases the delay can be significantly longer, especially if the IDILI is clearly
autoimmune, where it usually requires more than a year of treatment before it becomes
symptomatic (Lawrenson, Seaman et al. 2000). There are some cases in which the serum
transaminases were normal when the drug was stopped and did not become elevated until a
month later (Kelsu and Andersson, 2010). In some cases there is a rapid onset of symptoms
when a patient is rechallenged with a drug, but this is not universal. In a few cases, IDILI is
associated with fever, rash, and eosinophilia, which are classic symptoms of an immune-
mediated allergic reaction, but with many drugs, more often than not, these symptoms are
absent (Zimmerman, 1999). In addition, antidrug antibodies or autoantibodies have been
detected in some cases of IDILI (Obermayer-Straub, Strassburg et al. 2000). Although it is
unclear what role they play in the pathogenesis of the injury, such antibodies provide strong
evidence that the drug has induced an immune response (Liu and Kaplowitz 2002). The
histology of hepatocellular IDILI can mimic almost any other type of liver injury, but it most
commonly resembles viral hepatitis with mild to moderate inflammation, and the infiltration
is mostly lymphocytes and sometimes eosinophils (Kleiner 2009). IDILI caused by drugs
such as isoniazid and ketoconazole has been classified as metabolic idiosyncrasy
(Zimmerman, 1999). However, there are clear cases of both isoniazid- and ketoconazole-
induced IDILI with a very rapid onset on rechallenge (Maddrey and Boitnott 1973; Chien,
Sheen et al. 2003). This provides strong evidence of an immune-mediated reaction. Although
it can be a risk factor, there are also no examples where polymorphism of a metabolic
pathway is sufficient to explain the idiosyncratic nature of IDILI.
Another proposed hypothesis is the inflammagen hypothesis, which proposes that
the idiosyncratic nature of IDILI is based on the chance superposition of drug treatment and
8
an inflammatory stimulus such as lipopolysaccaride from the intestine (Roth, Luyendyk et al.
2003). However, this model simply does not have the same characteristics as clinical IDILI
(Uetrecht 2008).
Another hypothesis for the mechanism of IDILI is that the drugs involved cause
mitochondrial damage, which leads to the death of hepatocytes. There are drugs such as
valproic acid and perhexiline that cause IDILI that is characterized by microvesicular
steatosis and/or lactic acidosis (Zimmerman, 1999). These are clear indications that the drug
has compromised lipid and energy metabolism, which occur in mitochondria. In addition,
mitochondria control cell death, which also makes this an attractive hypothesis. However, it
does not explain the delay in onset or the inability to readily produce animal models by
simply giving large doses of the drug. There is an animal model of IDILI that utilizes mice
that are partially deficient in mitochondrial superoxide dismutase (Ong, Latchoumycandane
et al. 2007). It was found that when these mice were treated with troglitazone and a few other
drugs they developed liver toxicity; however, the toxicity was relatively mild and other
groups have not been able to reproduce the results (Fujimoto, Kumagai et al. 2009). It is
possible that the difference in results was due to a difference in the solvent and route of
exposure used for administration of the troglitazone. The original study used a solvent that
contained polyglycol esters of 12-hydroxystearic acid, which may also have effects on the
metabolism of fatty acids, and the troglitazone was given by i.p. injection rather than orally.
There are examples in which drugs such as fialuridine and nucleoside reverse transcriptase
inhibitors that cause damage to mitochondrial DNA led to delayed and cumulative liver
damage in humans, but this toxicity is not idiosyncratic (McKenzie, Fried et al. 1995; Duong
Van Huyen, Landau et al. 2003). The delay and cumulative liver toxicity observed with
mitochondrial DNA damage is due to the fact that mitochondrial DNA does not have the
same repair mechanisms as nuclear DNA (Gredilla, 2011). This toxicity is also characterized
9
by microvesicular steatosis and/or lactic acidosis, which is not a common feature of IDILI. It
is quite possible that a drug could cause less severe mitochondrial damage that does not result
in steatosis or lactic acidosis, but this is unlikely to result in liver failure. If a drug caused
damage to mitochondrial proteins instead of DNA, it should not be delayed and cumulative
because of the relatively rapid turnover of proteins. Milder mitochondrial damage may not
directly lead to liver failure, but it could act as a danger signal which is a molecule or
molecular structure, released or produced by cells undergoing stress or abnormal cell death
(Rad et al., 2003), and in some patients, this might lead to an immune response that results in
liver failure. In fact, even IDILI such as that associated with valproic acid could involve an
immune mechanism, and this would explain its idiosyncratic nature. Therefore,
mitochondrial damage could be an important component to the mechanism of IDILI even if it
is not sufficient by itself to explain most cases of IDILI. In principle, screening for
mitochondrial damage might improve the safety of drug candidates (Xu, Henstock et al.
2008).
We are still left with cases of IDILI that do not have characteristics typical of an
immune-mediated reaction. In some cases there is no recurrence on rechallenge such as in the
case of isoniazid, or they occur very late as with some cases of troglitazone-induced
hepatotoxicity. However, as mentioned above, in the case of heparin-induced
thrombocytopenia, which is clearly immune-mediated, there is also no immune memory.
Furthermore, the delay in onset is actually longest for IDILI that is clearly immune-mediated,
i.e. for drug-induced autoimmune hepatitis. For example minocycline can cause two different
types of IDILI: one that is typical for IDILI and occurs after 1-3 months of treatment, and the
other that is autoimmune and occurs after more than a year of treatment (Lawrenson, Seaman
et al. 2000). Nitrofurantoin and α-methyldopa can also cause typical autoimmune hepatitis,
which is characterized by a long delay in onset (Liu and Kaplowitz 2002). As mentioned
10
earlier, most IDRs are immune-mediated (Uetrecht, 2008). Thus IDILI, which shares many of
the same characteristics as other IDRs, especially the delay in onset, can most easily be
explained by immune mechanisms. It is important to note that a large fraction of the drugs
that cause IDILI also cause other types of immune-mediated IDRs, in particular, autoimmune
IDRs (Uetrecht 2009). A likely explanation for these observations is that most reactive
metabolites bind to a variety of proteins, and the pattern is different for different drugs. If the
dominant immune response is to a liver protein, it can lead to liver toxicity, and if it is to a
skin protein, it can lead to a skin rash. The response can also be to different parts of the drug-
modified protein so that in some cases the major epitope will be the drug, and in other cases
the immune response will be to the native protein (Uetrecht, 2009a). The dominant response
will be different in each patient, at least in part, because the T cell receptor repertoire is
different for each individual, even different in identical twins. If the dominant response has a
major autoimmune component, even if it is not classic autoimmune hepatitis, it could lead to
a longer delay in onset and possibly lack of immune memory (Uetrecht, 2009b). An
autoimmune component could also explain why IDILI could begin a month after the drug had
been discontinued and the drug is no longer present or why it sometimes progresses after the
drug has been stopped. Even though drug-induced autoimmunity usually resolves rapidly
when the drug is discontinued, this is not always the case, and obviously the antigen is still
present in an autoimmune reaction.
The liver can be considered to be a lymphoid organ and an important part of the
reticuloendothelial system (Crispe 2009). The liver blood supply comes from both the
systemic circulation and the intestine. Each minute, almost one third of the total blood passes
through the liver (Sheth and Bankey 2001), and about 1010 peripheral blood lymphocytes can
be recruited by the liver in 24 hours (Wick, Leithauser et al. 2002). The liver itself contains
resident T cells, B cells, natural killer (NK), and natural killer T (NKT) cells. It also contains
11
a large number of macrophages (Kupffer cells), stellate cells, and dendritic cells. These cells
are continuously exposed to antigens derived from various sources, such as food, medications,
or endogenous toxins (Racanelli and Rehermann 2006). Thus the liver plays an important
role in determining how the immune system will respond to different antigens.
1.3. PROPOSED MECHANISMS FOR IMMUNE-MEDIATED IDRS
1.3.1 The Hapten Hypothesis
In 1935, Landsteiner reported that he was unable to induce an immune response to
small molecules such as 2,4-dinitrochlorobenzene and p-nitrosodimethylaniline in guinea
pigs unless the molecules were covalently bound to proteins (Landsteiner and Jacobs 1935).
The small molecule is referred to as a hapten. Thus, the hapten hypothesis is: small molecules
are non-immunogenic; after they bind irreversibly to protein, the modified protein can lead to
an immune response.
Later, it was proposed that several drugs cause ADRs by the formation of reactive
metabolites that bind to proteins (Brodie, Reid et al. 1971; Mitchell, Jollow et al. 1973). A
good example of covalent binding leading to a hypersensitivity reaction was penicillin-
induced allergic reactions. Penicillin is characterized by a β-lactam ring, which can react
irreversibly with free amino and sulfhydryl groups on proteins. In some patients, this leads to
an immune response against the penicillin-protein adduct. Furthermore, if sufficient IgE
antibodies were generated, a severe allergic reaction such as anaphylaxis can result. The
hapten hypothesis is true for penicillin-induced allergic reactions because the chemical
reactivity of the penicillin allows it to act as a hapten, and it is the anti-penicillin IgE
antibodies that mediate the IDR. Although no clear conclusion has been drawn why some
people develop a predominantly IgE response to penicillin while others do not, the
mechanistic understanding of penicillin-induced hypersensitivity and the hapten hypothesis
12
provided a framework for the examination of other IDRs. Even though some drugs are not
chemically reactive, reactive species can still be formed during metabolism, and these
reactive metabolites can serve as haptens. For example, halothane is metabolized to the
reactive trifluoroacetyl chloride, and antibodies were found against trifluoroacetyl chloride-
modified protein in most halothane-induced liver injury patients (Vergani, Mieli-Vergani et
al. 1980). Although these antibodies may not be pathogenic, they indicate that halothane has
induced an immune response, suggesting that halothane-induced hepatotoxicity is immune-
mediated. However it has to be noted that covalent binding is not a perfect predictor in terms
of the risk of liver toxicity (Nakayama, Atsumi et al. 2009). Drugs such as ximelagatran
appear to lead to immune-mediated liver toxicity without forming reactive metabolites
(Kindmark, Jawaid et al. 2008).
1.3.2 Danger Hypothesis
Polly Matzinger proposed that it is molecules released by damaged cells that
activate antigen presenting cells (APCs) and control immune responses; this is known as the
danger hypothesis (Matzinger 1994). It was discovered that activation of APCs leading to
expression of costimulatory molecules such as B7 was required for activation of T cells. The
interaction between MHC-antigen complex on APCs and T cell receptor (TCR) on T cells is
referred to as signal 1, while other interactions such as between B7 on APCs and CD28 on T
cells is referred to as signal 2. The immune response is initiated when both signal 1 and
signal 2 are present, and tolerance will be induced if only signal 1 is present (Uetrecht 1999).
According to danger hypothesis, the injured tissue produces danger signals that activate
APCs leading to upregulation of costimulatory molecules and inducing an immunological
response. Some proposed danger signals are high mobility group protein 1 (HMGB1),
interleukin (IL)-1a, cytosolic calcium binding proteins of the S100 family, heat shock
13
proteins (HSPs), uric acid, etc (Harris and Raucci 2006). HMGB1 is a non-histone nuclear
protein of which the identified receptors are receptors for advanced glycation end products
(RAGE) and toll-like receptors 2, 4, and 9 (Kokkola, Andersson et al. 2005; Lotze and
Tracey 2005). High serum levels of HMGB1 have been found in acetaminophen-induced
liver toxicity, which may act as a proinflammatory factor to initiate an immune response
(Antoine, Williams et al. 2009). It has been shown that S100 proteins may be involved in the
development of autoimmunity as danger signals (Ehrchen, Sunderkotter et al. 2009). S100
A7/A15 (psoriasin) present in the epidermis was found to be pathogenic in psoriasis (Wolf,
Lewerenz et al. 2007). HSPs have also been referred to as danger signals. However, unlike
the above danger signals, not every member of HSPs is a danger signal. For example, HSP27
can serve as an anti-inflammatory protein (Miller-Graziano, De et al. 2008). In addition, it
has to be pointed out that the hapten and danger hypotheses are not mutually exclusive, and it
is likely that both can play a role in IDRs. However, even in the presence of both signals the
immune response may still be immune tolerance rather than an IDR.
1.3.3 Pharmacological Interaction (PI) Hypothesis
Another hypothesis is the pharmacological interaction (p-i) hypothesis as proposed
by Pichler. He found that clones of lymphocytes from patients with a history of an IDR to
sulfamethoxazole proliferated in response to sulfamethoxazole in the absence of metabolism.
In this hypothesis the parent drug acts as a superantigen to bind reversibly to the complex
formed by the complex of MHC II on APCs and the T cell receptor on T cells to initiate an
immune response. This hypothesis was based on the observation that T cell clones were
activated when incubated with sulfamethoxazole in the absence of drug metabolism (Pichler
2002). A key assumption of the p-i hypothesis is that what lymphocytes respond to is what
initiated the immune response. In an immune-mediated skin rash induced by nevirapine in
14
rats, we found that lymphocytes from these animals respond to nevirapine better than the 12-
hydroxy metabolite even though we had shown that oxidation to the 12-hydroxy metabolite is
required to induce a rash. Furthermore, T cells from animals in which the rash was induced
by treatment with the 12-hydroxy metabolite and the animals had never been exposed to
nevirapine still responded better to nevirapine (Chen, Tharmanathan et al. 2009). Therefore,
the response of T cells is not an accurate indication of what induced an immune response. In
a more recent study of human T cells from 3 patients with hypersensitivity to
sulfamethoxazole, lymphocyte proliferation was stimulated by sulfamethoxazole and both the
hydroxylamine and nitroso metabolites; however, more antigen-specific T-cell clones were
generated with the two reactive metabolites than with the parent drug sulfamethoxazole
(Castrejon, Berry et al. 2010). An IDR that may involve the p-i mechanism is ximelagatran-
induced hepatotoxicity. Ximelagatran is structurally similar to a small peptide and does not
appear to form reactive metabolites. It may be able to initiate an immune response through a
p-i type of interaction, and there is evidence that it binds reversibly to MHC (Kindmark,
Jawaid et al. 2008).
1.4. D-PENICILLAMINE-INDUCED IDR ANIMAL MODEL
D-penicillamine has been used in the treatment of rheumatoid arthritis and Wilson’s disease.
However, its use is limited because of a relatively high incidence of a variety of adverse
autoimmune reactions (Stein, Patterson et al. 1980). In animals, similar adverse effects have
been observed; in Brown Norway (BN) rats D-penicillamine can induce a disease that is
characterized by dermatitis, vasculitis, production of anti-nuclear antibodies, formation of
circulating immune complexes, deposits of IgG along the glomerular basement membrane,
hepatic necrosis, arthritis, and weight loss (Donker, Venuto et al. 1984; Tournade, Pelletier et
al. 1990). D-penicillamine-induced autoimmunity is idiosyncratic as it only occurs in BN rats,
15
and the incidence is only 50%–80% in this highly inbred strain of rat. In addition, there is a
delay of about three weeks between starting treatment and the onset of the autoimmune
syndrome, which is typical of an idiosyncratic reaction. The dose-response curve in the BN
rat model is unusual; a dose of 20 mg/day is required to induce the syndrome and an increase
to 50 mg/day does not significantly increase the incidence, but at a dose of 10 mg/day the
incidence is zero. In fact, this low dose leads to immune tolerance, and subsequent treatment
with 20 mg/day does not lead to autoimmunity. Even though it is an immune-mediated
reaction, the time to onset is not shortened on rechallenge.
Penicillamine is chemically reactive without metabolism; it can react with protein thiols to
form mixed disulfides, and it reacts with aldehydes to form a thiazolidine ring (Howard-Lock,
Lock et al. 1986). One of the signaling pathways between macrophages and T cells involves
reaction of an aldehyde on macrophages with an amine on T cells, forming a reversible imine
linkage (Rhodes 1989). When spleen cells isolated from BN rats were incubated with D-
penicillamine, it was found that penicillamine preferentially binds to macrophages (Li,
Mannargudi et al. 2009). Furthermore, a microarray study showed that after a 6 h incubation
with D-penicillamine, several known macrophage activation markers were up-regulated (Li
and Uetrecht 2009). All of the above data suggest that the irreversible reaction of
penicillamine with the aldehyde groups on macrophages leads to activation of macrophages,
and in some cases this can lead to a generalized autoimmune syndrome.
The incidence of D-penicillamine-induced autoimmunity can be influenced by manipulation
of the immune system. The incidence and severity of autoimmunity in the BN rat can be
increased by a single dose of poly (I:C), which mimics viral RNA and stimulates
macrophages through toll-like receptor 3 (Sayeh and Uetrecht 2001). Lipopolysaccharide, a
toll-like receptor 4 agonist, has a similar, but smaller effect than poly (I:C) (Masson and
Uetrecht 2004). As mentioned above, two weeks of D-penicillamine low-dose treatment (5-
16
10 mg/day) prior to a dose of 20 mg/day leads to tolerance in 100% of BN rats (Masson and
Uetrecht 2004). Adoptive transfer of spleen cells from a tolerant animal led to tolerance in
naïve animals, thus indicating that it is immune tolerance. CD4+ T cells appear to be the
major cell responsible for this tolerance; when tolerized animals are treated with 20 mg/day,
their CD4+ T cells express increased levels of IL-10 and transforming growth factor-ß mRNA
(Masson and Uetrecht 2004). One dose of misoprostol (a prostaglandin E analog) prevents
penicillamine-induced autoimmunity. Treatment of tolerized animals with a combination of
poly (I:C) and penicillamine partially overcomes tolerance, and it also appears that depletion
of macrophages during tolerance induction partially prevents the induction of tolerance.
This animal model appears to be a valid representation of the autoimmune reactions induced
by penicillamine in humans. The basic mechanism appears to involve direct activation of
macrophages with the production of IL-6, but it is not clear in this highly inbred strain of
animals why only some of the animals produce an early spike in IL-6, which appears to be
essential for the later development of autoimmunity. The activation of macrophages may be
an essential step in the initiation of IDRs in general.
Treatment with D-penicillamine is associated with a high incidence of a wide variety of
adverse effects. The most common adverse effects are various autoimmune syndromes,
kidney injury, and skin rash; isolated liver toxicity is uncommon. However, there are reports
of liver toxicity including cholestatic hepatitis (Kumar, Bhat et al. 1985). In another case, a
patient developed aplastic anemia and apparent liver failure even though the aspartate
aminotransferase was only two times the upper limit of normal (Fishel, Tishler et al. 1989). It
is important to understand that penicillamine reacts with aldehydes including pyridoxal
phosphate, which is the cofactor in both the aspartate aminotransferase and ALT assays.
Some drugs such as isoniazid have been shown to interfere with these assays by reacting with
pyridoxal phosphate (O'Brien, Slaughter et al. 2002). It is interesting that penicillamine has
17
been found to decrease ALT in patients being treated with the drug and this was ascribed to a
hepatoprotective effect (Iorio, D’Ambrosi et al. 2004; Gong, Klingenberg et al. 2006);
however, it is likely that much of the effect actually involved interference with the ALT assay.
In animal studies, it was found that the liver is involved in penicillamine-induced
autoimmunity (Donker, Venuto et al. 1984). Granulomatous and necrotic lesions were
observed in the rats that developed D-penicillamine-induced autoimmunity. A more recent
study was carried out to further characterize the effects of D-penicillamine on
the liver (Sayeh and Uetrecht 2001). In sick animals, histology of the liver showed portal and
sinusoidal infiltration of plasma cells, lymphocytes, eosinophils, neutrophils, and
macrophages. Also, large aggregates associated with necrosis of the hepatocytes and
granulomatous lesions in the liver were demonstrated in these animals. These effects were
not observed in the penicillamine-treated non-sick animals indicating that these lesions are
part of the penicillamine-induced autoimmune syndrome.
1.5. IL-17 AND TH17 CELLS
CD4+ T helper cells play a central role in adaptive immunity. They provide critical help to
induce adaptive immune responses for the elimination of many invading pathogens. On the
other hand, the differentiation and activation of CD4+ T helper cells has to be tightly
controlled in order to prevent inadvertent responsiveness to self antigens, which could lead to
autoimmune diseases. According to their characteristic profiles of transcription factors and
cytokines, CD4+ T helper cells are classified into four major subsets: Th1, Th2, Th17, and
regulatory T cells (Treg). Th1 cells are capable of producing a proinflammatory cytokine
interferon (IFN)-γ, which promotes macrophage activation and is involved in combating
intracellular pathogens (Glimcher and Murphy 2000; Murphy and Reiner 2002). Th1 cells
have been associated with cell-mediated autoimmune diseases. Characteristic cytokines of
18
Th2 cells are IL-4, IL-5, and IL-13. Th2 cells play a major role in allergy and fighting against
various extracellular pathogens and parasites (Glimcher and Murphy 2000; Murphy and
Reiner 2002).
Th17 cells were identified more recently; they are characterized by the secretion of
their signature cytokine IL-17. Th17 cell differentiation is under the combined influences of
TGF-β and IL-6 (Bettelli, Carrier et al. 2006; Veldhoen, Hocking et al. 2006). At the
transcription factor level, RORγt (or RORc) and STAT3 are activated and they are
responsible for the development of Th17 cells (Ivanov, McKenzie et al. 2006). Interestingly,
in the absence of IL-6, TGF-β induces FoxP3+ Treg, suggesting a close relationship between
Th17 and Treg (Bettelli, Carrier et al. 2006; Yang, Panopoulos et al. 2007). IL-23 is required
for maintenance and survival of developed Th17 cells (Langrish, Chen et al. 2005). Th17
cells produce IL-17A, IL-17F, IL-21, IL-22, and TNFα, which may play an active role in host
defense, inflammatory tissue injury, autoimmunity, and various types of liver diseases (Korn,
Bettelli et al. 2009).
1.5.1 IL-17 and Th17 Cells in Host Defense
Studies by Kolls first showed that IL-17 is involved in host defense against
microbial pathogens. In their experiment, IL-17 receptor (IL-17R)-deficient and wild-type
mice were infected with Klebsiella pneumoniae. It was found that IL-17R-deficient mice had
increased numbers of bacteria in the lung and reduced overall survival (Ye, Garvey et al.
2001). Inadequate neutrophil recruitment and granulocyte colony stimulating factor (G-CSF)
and chemokine expression were observed in the lung, suggesting that IL-17 plays an
important role in recruitment of neutrophils to provide protective immunity against infection
(Ye, Rodriguez et al. 2001). Since then, the involvement of IL-17 in host defense against
many other pathogens has been studied. IL-17 and IL-17-expressing CD4+ T cells have been
19
shown to be actively induced in response to gram-negative bacteria (Chung, Kasper et al.
2003), parasitic infections (Kelly, Kolls et al. 2005), and fungal infections (Huang, Na et al.
2004). In addition to extracellular bacterial pathogens, there is evidence that IL-17 can also
enhance responses to intracellular pathogens (Hamada, Umemura et al. 2008). Overall, these
studies imply that IL-17 and IL-17-producing CD4+ T cells are critical for maintaining host
immune responses to infection.
1.5.2 IL-17 and Th17 Cells in Autoimmunity
Prior to the discovery of Th17 cells, it was generally believed that autoimmunity was
driven by type 1 T helper cells (Th1). Th1 cells and IL-12 were required for induction of
organ-specific autoimmunity. However, this concept was later challenged. Specifically, IFN-
γ- and IFN-γ receptor-deficient mice, as well as IL-12p35-deficient mice, were not protected
from experimental autoimmune encephalomyelitis (EAE), and in fact, they developed more
severe disease (Krakowski and Owens 1996). This study suggested that another subset of T
cells might be involved in the induction of EAE and other autoimmune diseases. In 2003,
Cua and colleagues demonstrated that IL-23 rather than IL-12 was crucial for the
development of EAE (Cua, Sherlock et al. 2003). Furthermore, IL-23 was found to be
responsible for the expansion of an IL-17-producing T helper cell population, which could
induce EAE when adoptively transferred into naïve mice (Langrish, Chen et al. 2005).
The role of Th17 cells in the pathogenesis of organ-specific autoimmunity has now
been well established. It has been shown that IL-17 plays a critical role in cartilage and bone
erosion as observed in an animal model of autoimmune arthritis (Sato, Suematsu et al. 2006).
IL-17A-deficient mice also developed less severe EAE (Komiyama, Nakae et al. 2006) and
collagen-induced arthritis (Nakae, Nambu et al. 2003) with delayed onset. In addition, it has
20
been reported that IL-17 is involved in the formation of germinal centers and the production
of autoantibody in autoimmune mice (Hsu, Yang et al. 2008).
Studies from patients with various human autoimmune conditions have also
suggested the importance of IL-17 and the Th17 pathway in autoimmune disorders. In
patients with multiple sclerosis (MS), IL-17A is upregulated in lesions of the central nervous
system (Lock, Hermans et al. 2002). IL-17 positive lymphocytes have been observed in brain
lesions of active MS patients, while these cells were decreased in patients with quiescent MS
(Tzartos, Friese et al. 2008). In psoriatic skin, Th17 cells were observed, and IL-17 has been
shown to induce intracellular adhesion molecule-1 and IL-6 in human keratinocytes
(Teunissen, Koomen et al. 1998). Th17 cells are also involved in chronic inflammatory
diseases. Compared to corresponding samples from normal controls, increased levels of IL-
17 mRNA were observed in the patients with the inflammatory bowel diseases: ulcerative
colitis and Crohn’s disease (Fujino, Andoh et al. 2003). Blocking IL-23 is sufficient to
prevent the onset of colitis in IL-10-deficient mice by a mechanism involving inhibition of
IL-17. As the above data indicate, the IL-17/Th17 pathway plays an essential pathological
role in various types of autoimmune diseases.
1.5.3 IL-17 and Th17 Cells in Liver Diseases
The liver is a major metabolic organ. It can also be considered as a lymphoid organ
(Crispe 2009). Generally, immune cells that reside in or infiltrate into the liver remain
tolerant to harmless antigens (Tacke, Luedde et al. 2009). However, in some cases, either
innate or adaptive immune responses can be induced by substances such as
lipopolysaccharide (LPS) or bacterial antigens. Innate immune cells are relatively enriched in
the liver, including macrophages (Kupffer cells), NK, and NKT cells (Tacke, Luedde et al.
21
2009). It is believed that they initiate the immunological responses at the early stages of
hepatic inflammation.
Cells from the adaptive immune, such as CD8+ and CD4+ T cells, also play
important roles in the pathogenesis of liver injuries (Racanelli and Rehermann 2006). Since
the discovery of Th17 cells, its potential role in liver diseases has received a lot of attention.
The involvement of Th17 cell and its related cytokines has been investigated in different liver
disorders in both mice models and human studies.
Halothane-induced liver injury has been used as an animal model for studying the
mechanism of DILI. Serum levels of ALT in mice are increased after i.p. injection of
halothane. Histological samples from animals with mild liver injury show infiltration of
immune cells into the liver (You, Cheng et al. 2006). After halothane treatment, it was found
that the levels of IL-17 are elevated. Serum AST and ALT levels were decreased by the
administration of a anti-mouse IL-17 neutralizing antibody while recombinant IL-17
treatment aggravated hepatic injury (Kobayashi, Kobayashi et al. 2009), implying that IL-17
and the Th17 pathway play an important role in halothane-induced liver injury.
Concanavalin A (ConA)-induced hepatitis is a widely used murine model for
hepatitis (Tiegs, Hentschel et al. 1992). Liver inflammation and necrosis are induced shortly
after intravenous administration of ConA. Depletion of CD4+ T cells has been shown to
ameliorate hepatic toxicity, suggesting that it is mediated by CD4+ T cells (Nagata,
McKinley et al. 2008). Recently, it was found that the level of IL-17 was greatly increased in
the liver during Con A-induced hepatitis. Blockage of IL-17 significantly attenuated the
severity of hepatitis. In addition, IL-17-positive CD4+ T and natural killer T cells were
greatly increased in Con A-injected mice compared with that in controls (Yan, Wang et al.
2011). All these data imply that the Th17 pathway is critical in the pathogenesis of Con A-
induced hepatitis.
22
It has been observed that IL-2Rα (CD25) knockout mice spontaneously produce
autoantibodies and develop biliary damage. They have been utilized as an animal model for
studying the pathology of the autoimmune liver disease, primary biliary cirrhosis
(Wakabayashi, Lian et al. 2006). In IL-2Rα KO mice, there was an elevated level of IL-17
and more Th17 cells were recruited to the liver (Laurence, Tato et al. 2007). This could be
due to a loss of Treg cells because IL-2Rα is required for Treg cell function. Thus, it suggests
that the Th17 pathway may be involved in the induction of primary biliary cirrhosis; however,
further investigation is needed.
Emerging evidence suggests that Th17 cells are also involved in human liver disease.
In alcohol-induced liver disease, it has been shown that leukocytes infiltrate into inflamed
liver tissue following injury, and large numbers of neutrophils were recruited into the liver
(Jaeschke 2002). Recently, Lemmers et al. found a significant increase in both IL-17 levels
and the frequency of IL-17-positive T cells in patients with alcohol-induced liver disease, and
neutrophil recruitment appears to correlate with the presence of IL-17-producing T helper
cells within the liver (Lemmers, Moreno et al. 2009). Recently, infiltration and activation of
Th17 cells has been found in both chronic hepatitis B (HBV) and hepatitis C (HCV)
infections (Rowan, Fletcher et al. 2008; Lemmers, Moreno et al. 2009). The severity of liver
damage seems to be correlated with the number of circulating Th17 cells in chronic hepatitis
patients. It has been reported that Th17 responses were decreased after antiviral therapy with
pegylated interferon and ribavirin in HCV-infected patients (Jimenez-Sousa, Almansa et al.
2010). In primary biliary cirrhosis, a number of studies have indicated a close correlation
between Th17 responses and primary biliary cirrhosis (Rong, Zhou et al. 2009). Infiltration
of IL-17 positive cells into damaged bile ducts was observed (Lan, Salunga et al. 2009). In
addition, IL-17 serum levels were also increased in patients with autoimmune hepatitis
23
(Yasumi, Takikawa et al. 2007) and acute liver rejection after transplantation (Fabrega,
Lopez-Hoyos et al. 2009).
As reviewed above, it has been shown that Th17 cells are involved in a number of
autoimmune diseases and liver disorders. The present studies aims to test the hypotheses that
IL-17 and Th17 cells may also play an important role in ADRs, such as drug-induced
autoimmunity and drug-induced liver toxicity. Experiments will be carried out in both animal
models and clinical samples.
24
CHAPTER 2
INVOLVEMENT OF T HELPER 17 (TH17) CELLS IN D-
PENICILLAMINE-INDUCED AUTOIMMUNE DISEASE IN
BROWN NORWAY RATS
Xu Zhu*, Jinze Li†, Feng Liu*, and Jack P. Uetrecht*, ‡
*Department of Pharmaceutical Sciences, Faculty of Pharmacy and ‡Faculty of Medicine, University of Toronto, Ontario M5S 3M2, Canada
†Department of Immunotoxicology, R&D, Drug Safety Evaluation, Bristol-Myers Squibb Company, New Brunswick, New Jersey 08903, USA
Toxicological Sciences 2011 Apr; 120(2):331-8.
25
2.1. INTRODUCTION
Idiosyncratic drug reactions (IDRs) refer to a group of adverse drug reactions that do
not occur in most patients within their therapeutic dose range and cannot be explained by the
known pharmacological properties of the drug (Uetrecht, 2009a). IDRs can be very severe,
even life-threatening, thus representing a significant clinical problem. They also present a
challenge to the pharmaceutical industry by adding an additional level of uncertainty to new
drug development. At present it is impossible to predict IDRs largely because the
mechanisms involved are unknown. Nevertheless, the delay between starting the drug and
the onset of the adverse reactions suggests that most are immune-mediated (Uetrecht, 2007).
Animal models are essential tools for mechanistic studies; unfortunately,
idiosyncratic drug reactions are also idiosyncratic in animals and so there are very few
practical models with characteristics similar to idiosyncratic reactions that occur in humans
(Shenton et al., 2004). Penicillamine-induced autoimmunity in Brown Norway (BN) rats
represents an important model for the mechanistic study of one type of IDR, drug-induced
autoimmunity, because it mirrors the variety of autoimmune reactions that it can cause in
humans (Jaffe, 1981): both can involve the presence of antinuclear antibodies, a skin rash,
deposits of IgG along the glomerular basement membrane, arthritis, hepatic necrosis, and
weight loss (Tournade et al., 1990, Sayeh and Uetrecht, 2001). By definition, drug-induced
autoimmunity is an immune-mediated IDR. Penicillamine-induced autoimmunity in rats is
also idiosyncratic: it is strain specific – treatment of Lewis and Sprague-Dawley rats does not
induce autoimmunity. Moreover, even though BN rats are highly inbred and syngeneic,
autoimmunity only occurs in a little over 50% of male BN rats.
Ever since it was proposed in 1986, the Th1-Th2 hypothesis has been a significant
aspect of mechanistic theories of T cell-mediated diseases (Mosmann, 1992). Based on an
elevation of IL-4 and IgE, which are associated with Th2-type responses, it was proposed that
26
penicillamine-induced autoimmunity as well as autoimmunity induced by gold salts and graft
vs host disease were Th2-driven immune reactions (Goldman et al., 1991). We tested this
hypothesis by using a series of agents such as misoprostol that were expected to tip the
Th1/Th2 balance; however, the effects were the opposite of those predicted by the Th2
hypothesis (Sayeh and Uetrecht, 2001). In contrast, it was proposed that organ-specific
autoimmune diseases were mediated by Th1 cells, which are driven by IL-12 and produce
IFN-γ (Singh et al., 1999). However, the Th1 theory of organ specific autoimmunity was
challenged because Th1 cytokines were often found to be protective. For example, INF-�
knockout mice had a higher mortality in an experimental autoimmune encephalomyelitis
model than the wild type animals (Ferber et al., 1996). In an animal model of arthritis, it was
found that it was IL-23, which shares a p40 subunit with IL-12, and not IL-12 that was
required for the development of arthritis (Murphy et al., 2003). Additional studies of the
involvement of IL-23 in autoimmune diseases led to the discovery of a new helper T cell
subset characterized by the production of a proinflammatory cytokine, IL-17, which were
therefore named Th17 cells (Langrish et al., 2005, McKenzie et al., 2006). Since its
discovery, the signature cytokine pattern of Th17 cells has been expanded with addition of
several other key inflammatory cytokines such as IL-21 and IL-22. In spite of many
unknowns in the function of Th17 cells, significant progress has been made in characterizing
this new T cell population. A large number of studies have found that a combination of TGF-
β and IL-6 are required for the initial commitment of naïve T cells to become Th17 cells
(Mangan et al., 2006, Zhou et al., 2007); exposure to TGF-β in the absence of IL-6 leads to T
regulatory cells believed to play an important role in immune tolerance (Zhou et al., 2008).
In contrast, IL-23 was found to play a very important role in maintaining the growth and
expansion of Th17 cells. Numerous studies in both humans and mice strongly suggest that
the Th17 cell is a major determinant of the development of many kinds of autoimmune
27
diseases (Ouyang et al., 2008). Although the exact role of Th17 cells is controversial, there is
compelling evidence that Th17 cells are involved in many inflammatory and autoimmune
reactions (Tesmer et al., 2008). This study was designed to examine the involvement of
Th17 cells in penicillamine-induced autoimmunity as a model of a drug-induced autoimmune
IDR.
28
2.2. MATERIALS AND METHODS
Animals. Male BN rats (175-200 g) were purchased from Charles River (Montreal,
Quebec, Canada) and doubly housed in standard cages in a 12:12 h light:dark cycle at 22 °C.
The rats were given free access to standard rat chow (Agribrands, Purina Canada, Strathroy,
Ontario, Canada) and tap water for a weeklong acclimatization period before starting an
experiment. All of the animal protocols were approved by the University of Toronto Animal
Care Committee.
Chemicals, kits, and solutions. D-Penicillamine was purchased from Richman
Chemical Inc. (Lower Gwynedd, PA). MACS anti-rat CD4 magnetic microbeads and
magnetic columns were purchased from Miltenyi Biotec (Auburn, CA). ELISA and
ELISPOT kits were purchase from R&D Systems (Minneapolis, MN). Luminex kits were
purchased from Millipore (St. Charles MO). RNeasy Mini kits and OmniScript reverse
transcriptase 285 kits were purchased from Qiagen (Mississauga, Ontario, Canada). Oligo
(dT15) primers, RNAse inhibitor, and LightCycler SYBR Green I kits for quantitative real-
time PCR (qRT-PCR) were all purchased from Roche (Montreal, Quebec, Canada). HPLC-
purified primers for qRT-PCR were designed and obtained from Integrated DNA
Technologies (Coralville, IA). Phorbol 12-myristate-13-acetate and calcium ionomycin were
purchased from Sigma (Oakville, ON, Canada). Fixation/permeabilization solution was
purchased from eBioscience (San Diego, CA). Monensin was purchased from BD
Biosciences (San Jose, CA). Conjugated monoclonal antibodies for CD4 (clone W3/25) were
purchased from Cedarlane (Burlington, Ontario, Canada), and IL-17 (clone eBio17B7) was
purchased from eBioscience (San Diego, CA).
D-penicillamine treatment. Rats were given D-penicillamine dissolved in tap
water at a concentration of 1.5 mg/mL with an average water intake of 25 mL per day. The
D-penicillamine solution was prepared fresh every two days because of the slow formation of
29
inactive penicillamine disulfide. Unless otherwise indicated or unless signs of a severe
autoimmune syndrome led to sacrifice of the animal, the duration of D-penicillamine
treatment was 8 weeks. Red ears were the primary sign used as a surrogate to determine
which animals had developed autoimmunity.
Determination of serum IL-6. Blood samples were drawn via tail vein on day 0
and at the end of each week of penicillamine treatment. Blood samples were allowed to clot
for 2 h at room temperature before centrifuging for 20 min at approximately 2000×g. Sera
were aliquoted and stored at -80 ºC. Serum IL-6 levels were determined by ELISA.
Phenotyping splenic CD4+ T cells by qRT-PCR. At the end of penicillamine
treatment, splenic CD4+ T cells were isolated using rat CD4 magnetic microbeads according
to the manufacturer’s instructions. RNA was isolated from CD4+ T cells using RNeasy mini
kits as described by the manufacturer. RNA concentration and purity were determined
spectrophotometrically. RNA (0.5 μg) from each sample was reverse transcribed to cDNA.
The expression level of Th17-related cytokine mRNAs was determined using qRT-PCR
carried out with a LightCycler instrument (Roche). The basic PCR program for all samples
was as follows: 95 ◦C for 10 min; 45 cycles of 95 ◦C for 5 sec, annealing temperature (primer-
specific, 295 range 55-62 ◦C) for 5 sec, elongation at 72 ◦C for various times (due to
difference in PCR product length, range 5-16 sec). Melting curve analysis was performed
after amplification and carried out at a temperature transition rate of 0.2 ◦C/sec up to 95 ◦C.
Data were normalized by calculating the absolute concentration of the cDNA of interest
relative to absolute GAPDH concentration in each cDNA sample.
Profiling cytokines/chemokines. Male BN rats (n=20) were treated with
penicillamine and blood samples were drawn via tail vein on day 0 and at end of each week
of treatment. Serum was isolated as described above. A Luminex assay of 24
30
cytokines/chemokines (Eotaxin, GM-CSF, G-CSF, MCP-1, Leptin, MIP-1α, IFN-γ, IL-1α,
IL-1β, IL-2, IL-4, IL-5, IL-6, IL-9, IL-10, IL-12p70, IL-13, IL-17, IL-18, IP-10, GRO/KC,
RANTES, TNF-α, VEGF) was performed to determine the overall pattern of serum
cytokines/chemokines over the course of penicillamine treatment using the protocol provided
by the manufacturer. Serum concentration of IL-22 was determined separately by ELISA
during penicillamine treatment of male BN rats (n=8) at days 0, 7, 14, 16, 18, 20, 22, 24, and
28.
In another study (n=8), IL-6 and IL-22 were measured by ELISA at days 1, 3, 5, and
7 of penicillamine treatment to determine if an early change predicted which animals would
develop autoimmunity. In addition, at the end of treatment, serum IL-6 and IL-7 were
determined by ELISA, and IL-17 production in blood, lymph nodes, and the spleens was
determined by ELISPOT according to the protocol provided by manufacturer as below.
Determination of IL-17 production by ELISPOT. The frequency of IL-17-
producing cells from different organs was evaluated by ELISPOT using an IL-17A ELISPOT
kit. Briefly, single cell suspensions free of red blood cells were prepared from the spleens,
cervical lymph nodes, and peripheral blood mononuclear cells (PBMC). An aliquot of
2.0x105 lymphocytes was added to each well and stimulated with 50 ng/mL of phorbol 12-
myristate-13-acetate and 0.5 µg/mL calcium ionomycin for 16 h at 37 °C in an incubator with
an atmosphere containing 5% CO2, which was followed by streptavidin conjugation and
BCIP/NBT chromogen staining according to the manufacturer’s instructions. The spots were
counted using an ImmnunoSpot Reader®.
Intracellular cytokine staining and flow cytometry. The presence of CD4+IL-17+
cells was evaluated by flow cytometry. Lymphocytes were isolated from the cervical lymph
nodes, and after cell surface staining, the cells were washed and resuspended in
31
fixation/permeabilization solution and intracellular staining was performed following the
manufacturer's instructions. For the detection of IL-17, cells were incubated for 4 h with 50
ng/mL phorbol myristate acetate and 1 μg/mL ionomycin in the presence of monensin in
tissue culture incubator at 37 °C. Stained cells were analyzed by a BD FACSAria flow
cytometer, and data were analyzed by FlowJo software.
Statistical analysis. Statistical analyses were performed using GraphPad Prism
(GraphPad Software, San Diego, CA, USA). T-test with Welch's correction was conducted to
examine the ELISA results. One-way analysis of variance was carried out for flow cytometry
analysis. Two-tailed analysis was carried out with significance defined as P < 0.05 with 95%
confidence.
2.3. RESULTS
Serum levels of IL-6 during penicillamine treatment. In a preliminary
experiment, 2 out of 3 penicillamine-treated rats developed an autoimmune syndrome (rat #2
(P2): day 18; rat #3 (P3): day 20). Serum IL-6 was significantly increased at about the time
that the animals developed clinical signs of autoimmunity while the serum IL-6 level of the
nonsick and control animals remained at non-detectable levels throughout the treatment
(Figure 1).
At the end of the experiment described in the previous paragraph the rats were
sacrificed and total RNA was isolated from purified splenic CD4+ T cells. IL-21 and IL-4
mRNA was increased in all three treated animals (4 fold and 2 fold, respectively). In contrast,
a two-fold increase of IL-17 mRNA was only observed in the two sick animals, and there
was no significant change in IFN-γ or IL-10 mRNA. Given that this was a preliminary
experiment with limited numbers of animals, the results could only be used to direct further
experiments.
Figure. 1. Serum concentration of IL-6: penicillamine (n=3) vs. control (n=3). Out of three penicillamine-treated rats, two developed autoimmunity (P2 and P3). Significant serum IL-6 levels were only detected in the two sick animals, not in non-sick (P1) and control animals (C1, C2, and C3). (P = penicillamine-treated; C= Control)
32
Serum cytokine/chemokine pattern during penicillamine treatment. During 5
weeks of penicillamine treatment, 15 out of 20 rats developed autoimmunity, and in most
cases the time to onset was between 14 and 21 days. The body weight and cumulative
incidence are shown in Figure 2. The total splenocytes in sick animals was more than double
those in nonstick animals indicating significant splenomegaly. Of the 24
cytokines/chemokines, serum levels of IL-6, TGF-β1, IL-17, IL-2, IL-4, IL-5, IL-9, IL-10,
IL-13, IL-18, GRO/KC, MCP-1, leptin, and RANTES were found to be significantly
different between sick and non-sick animals at different time points (Figure 3), while other
analytes were either non-detectable in all treated animals (i.e. IL-1α), or there was no
difference between sick and non-sick rats throughout the penicillamine treatment (i.e. IFN-γ).
Figure. 2. Changes in body weight (A) and cumulative incidence of autoimmunity (B) in 20 animals that were treated with penicillamine for 5 weeks; 15 developed autoimmunity and 5 did not.
33
Serum IL-22 during penicillamine treatment. Serum concentrations of IL-22
during penicillamine treatment were monitored and compared between sick and non-sick
animals. As shown in Figure 4, there was an elevation of serum IL-22 about 4 days before
the onset of autoimmunity in sick rats, while no elevation of IL-22 was detected in non-sick
rats.
Figure. 4. Serum IL-22 during the development of penicillamine-induced autoimmunity. The onset of autoimmunity for 4 sick animals were: day 15 for rat 5, day 20 for rat 4, day 22 for rat 6, and day 27 for rat 1.
Serum cytokines at early time points of penicillamine treatment. If IL-6 drives
the formation of Th17 cells we would expect to see an increase in IL-6 at early time points,
but in Figure 3 there is no increase in IL-6 until day 21. It is possible that we missed an early
spike in IL-6 and so another experiment was done to look at IL-6 and IL-22 levels during the
first week. Out of 8 treated rats, 4 eventually developed autoimmunity. Concentrations of
35
serum IL-6 (day 1) and IL-22 (day 3) were elevated more in animals that developed
autoimmunity as shown in Figure 5.
Figure. 5. IL-6 & IL-22 serum levels in the first week of penicillamine treatment (n=8: 4 developed autoimmunity and 4 did not by the end of treatment).
Th17 cell phenotyping. Marked IL-17 production by cells from lymph nodes, the
spleen, and PBMC is clearly shown by ELISPOT with few IL-17-producing cells in the wells
containing cells from control and non-sick animals (Figure 6). Consistent with previous
findings, a dramatically elevated level of IL-6 was detected in sick animals at the end of
treatment. In contrast, the serum concentration of IL-7 was lower in sick animals than in
non-sick animals. More definitive evidence of Th17 cell involvement in penicillamine-36
37
induced autoimmunity is the marked increase in CD4+IL-17+ cells in sick animals compared
to control and non-sick animals (Figure 7).
Figure. 6. IL-6, IL-7, and IL-17 production at the end of penicillamine treatment. The top of the figure shows the serum IL-6 and IL-7 levels. The bottom of the figure shows the number of cells from cervical lymph nodes (ALN), the spleen, and peripheral blood mononuclear cells (PBMC) that produce IL-17 as determined by ELISPOT. The number in bold next to each spot is the number of cells producing IL-17.
38
Figure. 7. Flow cytometry analysis for intracellular IL-17A in CD4+ lymphocytes from control, treated non-sick, and sick animals, A shows a representative plot from one animal from each group and B shows the average % of CD4+/IL-17+ cells (n = 4 in each group).
39
40
2.4. DISCUSSION
Th17 cells have been implicated in many types of immune-mediated pathology, but
there is currently little evidence for their involvement in IDRs. This study provides a very
complete cytokine/chemokine profile as a function of time during the development of an
autoimmune idiosyncratic drug reaction. An increase in IL-17-producing cells as determined
by ELISPOT was observed in sick animals, but that does not prove the involvement of Th17
cells. For example, in a previous study we found an increase in serum IL-17 levels in some
patients with idiosyncratic drug-induced liver failure (Li et al., 2010), which suggested that
Th17 cells were also involved in this idiosyncratic drug reaction. However, some of the
patients with acetaminophen-induced liver failure also had increased serum levels of IL-17,
and acute acetaminophen-induced liver injury is very unlikely to be mediated by Th17 cells.
It is now known that several other cell types, especially innate immune cells (i.e. γδT cells,
invariant NKT cells, NK cells) can produce IL-17 (Cua and Tato, 2010). These innate
immune cell populations are probably the major cellular sources of IL-17 in response to early
cell stress or damage. Thus the first peak of serum IL-17 around 1 week of penicillamine
treatment is likely released from innate cells that can be directly activated by penicillamine.
In contrast, later in the course of treatment, animals with evidence of penicillamine-induced
autoimmunity had a marked increase in CD4+/IL-17+ cells, which defines Th17 cells, and this
provides strong evidence for their involvement in penicillamine-induced autoimmunity. In
addition, the pattern of cytokines is exactly what would be expected for a Th17 response;
specifically, an early spike of IL-6 (Figure 5) and the presence of increased TGF-ß (Figure 3),
which are required for the development of Th17 cells as discussed in the introduction. It
appears that many other types of IDRs may have an autoimmune component (Uetrecht,
2009a); therefore, Th17 cells may be involved in other types of IDRs.
41
In addition to the Th17-associated cytokines, i.e. IL-17 and IL-22, there is also a
marked increase in IL-2, IL-5, IL-6, IL-9, IL-10, IL-18, and MCP-1, and a marked decrease
in RANTES and leptin when the animals develop clinical evidence of autoimmunity (Figure
3). IL-9 can be produced by Th17 cells, but it also appears to be produced by Th2 and Th9
cells and is associated with autoimmunity (Nowak and Noelle, 2010). The major source of
IL-6, IL-18, and MCP-1 (monocyte chemotactic protein also known as CCL2) is
macrophages, and these cytokines/chemokines are associated with inflammation and
generally increased in autoimmune reactions. In particular, IL-18 appears to be a good
indicator of disease activity in lupus (Favilli et al., 2009). Therefore, although these results
are consistent with the hypothesis that penicillamine-induced autoimmunity is mediated by
Th17 cells, it is also to be expected that any immune response involves a symphony of
different cells interacting over time, and this is demonstrated by these data.
The very early spike in IL-6 predicted which animals would develop autoimmunity.
Therefore it is clear that a very early “decision” is made by the immune system that
determines how it will evolve even though the manifestations of autoimmunity occur weeks
later. It is possible that such a pattern could be used to predict which patients will develop an
IDR; however, there is no evidence at present that most IDRs are mediated by Th17 cells.
Although the spike in IL-6 clearly predicted which animals would ultimately develop
autoimmunity, it is not clear what factor(s) determine which animals will develop
autoimmunity, especially when these animals are syngeneic, thus virtually genetically
identical, and they were housed together which should minimize environmental factors. A
better understanding of cellular sources of cytokines (i.e. IL-6, IL-13, IL-17 etc.) that
significantly changed during early drug treatment might be able to explain the response
difference and would shed light on the pathogenesis of drug-induced idiosyncratic
autoimmunity.
42
In summary this study provides a very nice picture of cytokine changes that occur
during the development of an IDR. It remains to be determined whether this is a common
profile for most IDRs, is specific for autoimmune reactions, or is unique to penicillin-induced
autoimmunity. IL-17 intracellular staining determined by flow cytometry represents an
efficient way to define the Th17 cell population. However, it would be a challenge to obtain
fresh peripheral blood cells from patients early in the course of an IDR for the assessment of
Th17-mediated pathology.
Acknowledgement. J.U. holds a Canada Research Chair in Adverse Drug
Reactions. This research work was supported by grants from the Canadian Institutes of
Health Research.
Table 3. Primer sequences for qRT-PCR
Gene Forward Primer (5’-3’) Reverse Primer (5’-3’)
IFN-γ ATATCTGGAGGAACTGGCAAAA TAGATTCTGGTGACAGCTGGTG
Interleukin 4 TCAACACTTTGAACCAGGTCAC GCAGCTTCTCAGTGAGTTCAGA
Interleukin 10 AGGACCAGCTGGACAACATACT TCATTCATGGCCTTGTAGACAC
Interleukin 13 ACAGGACCCAGAGGATATTGAA AACTGAGGTCCACAGCTGAGAT
Interleukin 17 TGGACTCTGAGCCGCATTGA GACGCATGGCGGACAATAGA
Interleukin 21 CGAAGCTTTTGCCTGTTTTC GAAGGGCATTTAGCCATGTG
43
CHAPTER 3
MODULATION OF D-PENICILLAMINE-INDUCED
AUTOIMMUNITY IN THE BROWN NORWAY RATS WITH
PHARMACOLOGICAL AGENTS THAT INTERFERE WITH
THE TH17 PATHWAY: THE EFFECTS OF RETINOIC ACID
Xu Zhu*, Jinze Li†, and Jack P. Uetrecht*, ‡
*Department of Pharmaceutical Sciences, Faculty of Pharmacy and ‡Faculty of Medicine, University of Toronto, Ontario M5S 3M2, Canada
†Department of Immunotoxicology, R&D, Drug Safety Evaluation, Bristol-Myers Squibb Company, New Brunswick, New Jersey 08903, USA
Journal of Immunotoxicology (Submitted)
44
ABSTRACT
D-Penicillamine induces an autoimmune syndrome in Brown Norway (BN) rats. D-
Penicillamine also causes a variety of autoimmune adverse reactions in humans; therefore,
this represents an animal model for the study of immune-mediated adverse drug reactions.
Helper T-cells-17 (TH17) cells are involved in many autoimmune reactions, and we had
previously shown that TH17 cells are required for penicillamine-induced autoimmunity in
BN rats. Therefore, agents that could modify the development of TH17 cells could be
important for controlling autoimmune reactions. Retinoic acid (RA) has been reported to
block the development of TH17 cells in vitro. However, when BN rats were co-treated with
RA, it not only did not prevent the development of D-penicillamine-induced autoimmunity, it
increased the incidence and severity of the autoimmunity. We found that RA did not decrease
the number of TH17 cells in lymph nodes. Furthermore, RA alone increased interleukin (IL)-
6 serum levels, a cytokine that is required for TH17 cell development. Therefore, this
represents an example where the results of in vitro experiments cannot be extrapolated to a
complete immune system.
45
3.1. INTRODUCTION
Evidence suggests that most idiosyncratic drug reactions (IDR) are immune-
mediated. Penicillamine causes a variety of autoimmune syndromes in humans, and treatment
of Brown Norway (BN) rats with penicillamine also causes autoimmunity. D-Penicillamine-
induced auto-immunity in BN rats has been utilized as an animal model for mechanistic
studies of this type of IDR. Some time ago it was believed that D-penicillamine-induced
autoimmunity was a Th2-driven immune response, but when we tried to test this hypothesis
the results were the opposite from what this hypothesis would predict (Sayeh and Uetrecht,
2001). More recently, we demonstrated that TH17 cells are involved in D-penicillamine-
induced autoimmunity (Zhu et al., 2011). Specifically, its characteristic cytokines, i.e.,
interleukin (IL)-17 and IL-22, were found to be elevated in animals that developed
autoimmunity, and there was an significant increase in CD4+IL-17+ cells in sick animals
compared to control and treated animals that did not develop autoimmunity. This provides
important clues to the mechanism of this drug-induced autoimmune syndrome. However,
these studies did not demonstrate that Th17 cells were essential for the induction of
autoimmunity by D-penicillamine.
In addition to the cytokine and flow cytometric data, experiments in which the TH17
pathway was manipulated using pharmacological agents would also help to reveal the role of
TH17 cells in this animal model and possibly be useful clinically. A number of agents have
been reported to modulate the TH17 pathway, and extensive studies have been carried out
with retinoic acid (RA), a vitamin A derivative. It has been implied that RA is protective in
animal models of autoimmune disease, possibly by promotion of forkhead box P3 (FoxP3)
expression in the anti-inflammatory FoxP3+ T regulatory (Treg) cells leading to inhibition of
the formation of TH17 cells (Mucida et al., 2007). The aim of present study was to gain
46
further insights into the role of TH17 cells by studying the effects of RA in D-penicillamine-
induced autoimmunity in BN rats.
47
3.2. MATERIALS AND METHODS
Animals. Male BN rats (175-200 g, 7-9-wk-old) were purchased from Charles River
(Montreal, Quebec, Canada) and kept 2/cage in a pathogen-free facility maintained at 22°C
and with a 12:12 hr light:dark cycle. The rats were given ad libitum access to standard rat
chow (Agribrands, Purina Canada, Strathroy, Ontario, Canada) and tap water for a weeklong
acclimatization period before starting an experiment. The University of Toronto’s Animal
Care Committee approved all experimental protocols.
Chemicals, kits, and solutions. D-Penicillamine was purchased from Richman
Chemical Inc. (Lower Gwynedd, PA). All ELISA kits were purchased from R&D Systems
(Minneapolis, MN). A conjugated monoclonal antibody (mAb) against CD4 was purchased
from Cedarlane (Burlington, Ontario) Conjugated mAb against CD3 and IL-17 were
purchased from eBioscience (San Diego, CA).
Co-treatment with RA. BN rats (n = 20) were subdivided into four groups: 4 rats
were used as controls and 8 rats were given D-penicillamine (dissolved in tap water) at 1.0
mg/ml with an average water intake of 20 ml per day. Four rats were given D-penicillamine
and RA (20 mg/kg) by oral gavage on 10 consecutive days. Another 4 rats were gavaged
daily with RA (20 mg/kg) only. Red ears were the primary sign used as a surrogate to
determine which animals had developed autoimmunity.
Determination of serum IL-6. Blood samples were drawn via tail vein on Day 0 and
at the end of each week of D-penicillamine treatment. After being allowed to clot at room
temperature for 30 min, sera were isolated, and then aliquoted and stored at -80ºC. Serum IL-
6 levels were ultimately determined using a commercial ELISA kit (R6000B, R&D,
Minneapolis, MN) and following manufacturer instructions. The sensitivity of the kit was 15
pg/ml.
48
Intracellular cytokine staining and flow cytometry. The presence of CD4+IL-17+
cells was evaluated by flow cytometry. Lymphocytes from the cervical lymph nodes were
isolated by gently mincing the lymph nodes through a 40-μm cell strainer (BD Falcon,
Franklin Lakes, NJ). Thereafter, 106 cells underwent cell surface staining of CD4; briefly, all
cells were washed in phosphate-buffered saline (PBS, pH 7.4) and then pre-incubated with 2
µl of affinity-purified FcγR-binding inhibitor/106 cells for 20 min on ice prior to staining.
The recommended quantity of primary antibody was added to an appropriate volume of Flow
Cytometry Staining Buffer (eBioscience Inc., San Diego, CA) and then applied to the cells.
All samples were then incubated for 30 min in the dark on ice at 4°C. Thereafter, the cells
were washed with Flow Cytometry Staining Buffer (eBioscience) and intra-cellular staining
of IL-17 was performed. For this step, the 106 cells were incubated for 4 hr with 50 ng
phorbol myristate acetate/ml (PMA; Sigma, St Louis, MO) and 1 μg ionomycin/ml (Sigma)
in the presence of monensin (Sigma). Thereafter, the cells were permeabilized using
Permeabilization Reagent (eBioscience) and then stained with anti-IL-17 antibody. Stained
cells were then analyzed by a FACSCanto flow cytometer (BD Bioscience, San Jose, CA),
and data were analyzed by FlowJo software (TreeStar, Ashland, OR). A minimum of 100,000
events per sample was acquired.
Statistical analysis. Statistical analyses were performed using GraphPad Prism
(GraphPad Software, San Diego, CA). T-test with Welch's correction was conducted to
examine the ELISA results. One-way analysis of variance was carried out for flow cytometry
analysis. Two-tailed analysis was carried out with significance defined as p < 0.05 with 95%
confidence.
3.3. RESULTS
Changes in Th17 cells following treatments. Surprisingly, all rats co-treated with
RA and D-penicillamine developed autoimmunity within 2 weeks (Figure 8). Consistent with
previous findings, a dramatic increase in the number of Th17 cells was observed in the
animals that developed autoimmunity. RA itself or co-treatment with D-penicillamine did not
inhibit the development of Th17 cells (Figure 9). The levels of TH17 cells in controls, RA-
only-treated, and D-penicillamine-treated (but not suffering autoimmunity) was ≈ 0.3%.
These levels increased to ≈ 1.5% in D-penicillamine-treated autoimmunity-suffering hosts
and those that received both drugs.
IL-6 serum levels. It was found that IL-6, known to be a driving force for Th17
differentiation, was significantly increased after RA treatment (Figure 10). This increase
occurred at relatively early times after the administration of RA. In hosts with RA, IL-6
levels reached a maximum of 130 pg/ml at Week 2 and decreased thereafter to near-control
levels (which never exceeded 35 pg/ml over the 3-wk period).
Figure 8. Cumulative incidence of autoimmunity. Incidence in rats (n = 8) treated for 8 wk with D-penicillamine and rats (n = 4) treated for 8 wk with D-penicillamine and RA. Out of 8 treated animals, 5 developed autoimmunity.
49
Figure 9. Percent TH17 cells in lymph nodes after D-penicillamine treatment (A) representative dot plots of intracellular IL-17A staining of CD4+ lymphocytes from non-sick and sick groups. (B) Average % of CD4+/IL-17+ cells in each group (mean [± SD], n = 4). Cells were collected at the end of the treatment - either at the end of Week 8 or when rats had to be euthanized due to morbidity. 5 out of 8 animals developed autoimmunity after D-penicillamine single treatment. ***: p< 0.001
50
Figure 10. Serum concentration of IL-6. IL-6 levels in RA-treated and control animals. None of the RA only-treated rats developed autoimmunity. A significant increase in serum IL-6 level was only detected in the RA-treated group (mean [± SD], n = 4). *: p< 0.05
51
52
3.4. DISCUSSION
We previously demonstrated that cytokines associated with TH17 cells, such as IL-6,
IL-17, and IL-22, were increased in animals that developed D-penicillamine-induced
autoimmunity, but not in treated animals that did not develop autoimmunity. In addition,
TH17 cells were significantly increased only in sick animals, suggesting that the TH17
pathway plays an important role in D-penicillamine-induced autoimmunity in the BN rat
model. This led to an attempt to inhibit TH17 cell development with RA, a vitamin A
metabolite, which has been reported to inhibit TH17 cell differentiation and development.
However, to our surprise, our results showed that RA did not block the development of TH17
cells and actually increased the incidence and severity of D-penicillamine-induced
autoimmunity.
Previous studies had studied the role of RA in TH17 cell differentiation, and early in
vitro studies showed that RA is able to inhibit the development of TH17 cells in the absence
of antigen presenting cells (APC) and also promote anti-inflammatory Treg cell differentiation
(Mucida et al., 2007). However, more recent studies, especially several in vivo experiments,
reported conflicting results. In mice on a Vitamin A-deficient diet, it was found that this diet
led to low expression of IL-17 mRNA and resulted in significant inhibition of TH17 cell
differentiation in the small intestine (Cha et al., 2008). In another study, it was found that the
ability of APC to secrete IL-6, which is a key factor for TH17 cell polarization, is reduced in
Vitamin A-deficient mice (Hall et al., 2011). Such data suggest that RA might be required for
the differentiation of TH17 cells. Furthermore, Wang et al. (2010) found that RA appeared to
be required for the development of TH17 cells with specific tropisms in the gut. Overall, it
appears that the effects of RA on TH17 cell differentiation are under the combined influences
of APC and T-cells.
53
IL-6 is known to be a critical factor for the development of TH17 cells. In particular,
we previously found that a spike in IL-6 24 hours after starting penicillamine predicted which
animals would develop autoimmunity with an increase in Th17 cytokines weeks later (Zhu et
al., 2011). Macrophages are a major source of IL-6, and we have previously shown that
macrophages are activated by D-penicillamine (Li and Uetrecht, 2009). The present
experiments showed that RA did not inhibit TH17 cell differentiation; there was no difference
in the percentage of TH17 cells in the RA co-treatment group at the end of treatment (Figure
9), but RA actually promoted the development of D-penicillamine-induced autoimmunity
with decrease in time to onset and an increase in the incidence and severity. We found that
RA alone significantly increased serum IL-6 in BN rats (Figure 10), and given the previous
data that an early spike in IL-6 predicted which animals would develop D-penicillamine-
induced autoimmunity, it is likely that the increase in IL-6 induced by RA played an
important role in the mechanism by which RA increased the incidence and severity of D-
penicillamine-induced autoimmunity. Although there was no difference in the number of
TH17 cells at the end of the experiment, the much earlier time to onset of autoimmunity in
the RA-co-treated animals is also consistent with an early increase in IL-6 induced by RA.
54
CHAPTER 4
CHARACTERIZATION OF THE ROLE OF THE IMMUNE
SYSTEM IN D-PENICILLAMINE-INDUCED LIVER INJURY
Xu Zhu*, Imir Metushi‡ and Jack P. Uetrecht*, ‡
*Department of Pharmaceutical Sciences, Faculty of Pharmacy and ‡Faculty of Medicine,
University of Toronto, Ontario M5S 3M2, Canada
55
4.1. INTRODUCTION
Drug-induced lupus is an autoimmune condition that occurs rarely, so it is extremely
difficult to study in humans. D-penicillamine-induced autoimmunity in the male Brown
Norway (BN) rat has been utilized to investigate the mechanisms of drug-induced lupus. The
resulting disease in this model bears a number of similarities to drug-induced lupus in
humans, including anti-DNA antibodies, increases in serum IgE, IgG deposits along the
glomerular basement membrane in the kidneys, proteinuria, rash, and weight loss (Donker,
Venuto et al. 1984; Seguin, Teranishi et al. 2003). In addition to these common
manifestations, liver toxicity has also been found in clinical studies (Kumar, Bhat et al. 1985)
and in animals (Donker, Venuto et al. 1984). For example, after a ten-day course of D-
penicillamine therapy, a patient with rheumatoid arthritis showed manifestations including
cholestatic hepatitis (Kumar, Bhat et al. 1985). In animals with D-penicillamine-induced
autoimmunity, granulomatous and necrotic lesions have been observed in the liver (Donker,
Venuto et al. 1984). A more recent study was carried out to further characterize the effects of
D-penicillamine on the liver (Sayeh and Uetrecht 2001). In sick animals, histology of
the liver showed a portal and sinusoidal infiltration of plasma cells, lymphocytes, eosinophils,
neutrophils, and macrophages. Also, large aggregates associated with necrosis of hepatocytes
and granulomatous lesions in the liver were observed in these animals. These effects were not
observed in the D-penicillamine-treated non-sick animals indicating that these lesions are
part of the D-penicillamine-induced autoimmune syndrome. However, a detailed mechanism
of this liver injury such as what types of immune cells are involved is not clear.
It has been reported that the liver may contain up to 1010 local lymphocytes in
humans (Racanelli and Rehermann 2006). These lymphocytes are comprised of T cells, B
cells, natural killer (NK), and natural killer T (NKT) cells. In addition, the liver receives a
dual blood supply from the hepatic artery and the portal vein, which can contain a large
56
number of lymphocytes from the gut, especially during infection and inflammation (Adams
and Eksteen 2006). Growing evidence suggests that immune cells play a critical role in drug-
induced liver toxicity because DILI is usually accompanied with an infiltration of
lymphocytes. It is likely that effector lymphocytes are responsible for hepatocyte destruction
and liver injury. Thus, characterization of the lymphocytes in the liver is critical for
understanding the pathogenesis of DILI. In the current study, cytokine analysis and
lymphocyte phenotyping were performed to study the role of the immune system in the liver
toxicity caused by D-penicillamine.
57
4.2. MATERIALS AND METHODS
Animals. Male BN rats (175-200 g) were purchased from Charles River (Montreal,
Quebec, Canada) and kept 2 in a cage in a 12:12 h light:dark cycle at 22 °C. The rats were
given free access to standard rat chow (Agribrands, Purina Canada, Strathroy, Ontario,
Canada) and tap water for a weeklong acclimatization period before starting an experiment.
Chemicals, kits, and solutions. D-Penicillamine was purchased from Richman
Chemical Inc. (Lower Gwynedd, PA). All ELISA kits were purchased from R&D Systems
(Minneapolis, MN). Sorbitol dehydrogenase (SDH) diagnostic kits were purchased from
Catachem, Inc. (Oxford, Connecticut, USA). Conjugated monoclonal antibodies for CD4
(clone W3/25) and CD161 (clone 10-78) were purchased from Cedarlane (Burlington,
Ontario, Canada). Conjugated monoclonal antibodies for CD3 (clone eBioG4.18) and CD8
(clone OX8) were purchased from eBioscience.
D-Penicillamine treatment. Male BN rats were given water (vehicle, n = 4) or D-
penicillamine dissolved in tap water at a concentration of 0.75 or 1.0 mg/mL with an average
water intake of 20 mL per day (n = 4 or 8) resulting in a D-penicillamine dose of 15 - 20
mg/day. The D-penicillamine solution was prepared fresh every third day because of the slow
formation of inactive penicillamine disulfide, which may potentially affect the incidence of
autoimmunity. All animal procedures were performed according to the University of Toronto
guidelines for the care and use of laboratory animals.
Determination of serum IL-10 and SDH. IL-10 and SDH levels were determined
by ELISA and a SDH assay kit. Blood samples were drawn via tail vein on day 0 and at the
end of each week of D-penicillamine treatment. Blood samples were allowed to clot for one h
at room temperature before centrifuging for 5 min at approximately 5000×g. Sera were
aliquoted and stored at -80 ºC until further processing.
58
Preparation of liver cells and flow cytometry. Animals were sacrificed by carbon
dioxide asphyxiation. The livers were isolated and perfused with Dulbecco's Phosphate-
Buffered Saline (D-PBS, Sigma–Aldrich, USA). The liver was then carefully mashed on a
BD Falcon 70 µm cell strainer using a syringe piston and centrifuged at 350 x g in 40-50 mL
complete RPMI (Sigma–Aldrich, USA). The samples were resuspended in 10 mL D-PBS and
split into two 15 mL tubes. After centrifuging again, the samples were resuspended in 9-10
mL of a 33% Percoll solution and then spun at 1150 x g for 20 min at room temperature. The
cake on top of the Percoll was carefully removed, and the cell pellet at the bottom was
resuspended in 1 mL of complete RPMI. Following red blood cell lysis, lymphocytes were
isolated and the final cell concentration was adjusted to 2x107/mL. One million cells were
added to each well of a 96-well plate and prepared for flow cytometry staining. All cells were
pre-incubated with 2 µL affinity-purified FcγR-binding inhibitor (eBioscience Inc., San
Diego, CA, USA) per million cells for 20 min on ice prior to staining. The recommended
quantity of each primary antibody was combined in an appropriate volume of Flow
Cytometry Staining Buffer (eBioscience Inc., San Diego, CA, USA) and added to the cells.
All samples were incubated for at least 30 min in the dark on ice at 4 °C and then washed
with Flow Cytometry Staining Buffer. Stained cells were analyzed by a FACSCanto
cytometer (BD bioscience, USA) and data were analyzed by FlowJo software (TreeStar,
USA).
Statistical analysis. Statistical analyses were performed using GraphPad Prism
(GraphPad Software, San Diego, CA). T-test with Welch's correction was conducted to
evaluate the ELISA results. One-way ANOVA was carried out for flow cytometry analysis.
Two-tailed analysis was carried out with significance defined as p <0.05. Data were
expressed as the mean ± SD.
4.3. RESULTS
Serum levels of IL-10 and SDH after low-dose D-penicillamine treatment. None
of the rats receiving low-dose (15 mg/day) D-penicillamine developed autoimmunity. D-
Penicillamine-induced liver injury appeared to be mild and idiosyncratic. Significantly
increased levels of IL-10 were only observed in the treatment group and were undetectable in
the control group (Figure 12). The concentration of IL-10 in D-penicillamine-treated
animals peaked at one week and then started to decline although it varied between animals as
shown in Figure 14. After four weeks, IL-10 was no longer detectable in any of the animals.
Figure 12 shows ALT and SDH levels of animals in control and treated animals. The SDH
levels (Figure 13B) were elevated in the treatment group suggesting that mild liver injury was
induced by D-penicillamine. It should be noted that the ALT level (Figure 13A) as measured
by the assay actually decreased, which can be explained by the reaction of D-penicillamine
with pyridoxal phosphate, which is the cofactor for the reaction. Individual differences in IL-
10 and SDH changes in the treatment group are shown in Figure 14. The animal (D1) with
the highest IL-10 level (at an early time point following the treatment) showed the lowest
SDH level (Figure 14 A, B).
Figure 12. Serum concentrations of IL-10 over seven weeks in low dose D-penicillamine-treated animals (D1-D4) and in the control group (C1-C4; D-penicillamine dose, 15 mg/day; the data represent the mean ± S.D from 4 animals).
59
A
B
Figure 13. Serum concentrations of ALT (A) and SDH (B) in the control group (C1-C4) and the D-penicillamine-treatment group (D1-D4, D-penicillamine dose, 15 mg/day; n=8; Mean ± S.D. *p < 0.05.)
60
A
B
Figure 14. Serum concentrations of IL-10 (A) and SDH (B) of individual animals in the low dose D-penicillamine-treatment group (D1-D4, D-penicillamine dose, 15 mg/day; n=4.)
61
62
Serum levels of SDH after high-dose (20 mg/day) D-penicillamine treatment. When
animals were given with D-penicillamine at a dose of approximately 20 mg/day, five out of eight
(D1-D5 in Table 4) rats developed autoimmunity at various time points after treatment.
Significantly increased levels of SDH were only observed in the sick animals (D1-D5 in Table 4).
Once the animal developed liver toxicity, blood SDH levels remained elevated or decreased, but
they did not return to pretreatment levels (D6-D8 in Table 4).
Week 0 Week 1 Week 2 Week 3 Week 4 Week 5 Week 6 C1 4.3 3.9 6.9 5.6 N/A N/A N/A C2 5.6 4.9 4 5.7 6.4 N/A N/A C3 4.2 3.8 3.8 2.9 3.4 5.8 3.2 C4 5.9 3.5 5.4 2.5 5.2 6.1 6 D1 4.6 4.3 3.8 3.5 4.9 5.3 14 D2 6.3 4.2 11.5 11 N/A N/A N/A D3 5.7 4.1 4 14.5 9.6 13.5 17 D4 4.6 2 5 2.6 2.8 3.1 22 D5 4.1 4.7 45.2 25.6 12.2 N/A N/A D6 4.8 2.4 2.5 3.9 5.8 5.9 4.6 D7 6.4 3.8 3.8 2.7 2.7 3.1 4.6 D8 3.8 5.1 6.3 4.4 5.1 4.2 6.5
Table 4. Serum concentrations of SDH in the control group (C1-C4, n=4) and treatment group (D1-D8, D-penicillamine: 20 mg/day; n=8.). Values in red represent increased SDH levels. N/A indicates the data were not available at that specific time point since the animals was sacrificed according to the animal protocol because of the development of autoimmunity.
Phenotyping liver cells after high-dose (20 mg/day) D-penicillamine
treatment. Liver cells (control group n=4; treatment group n=8) were analyzed by
immunofluorescent staining and multicolor flow cytometric analysis to study changes in
CD161 expression on CD4 and CD8 T cells. As shown in Figure 15, the % CD8 T cells
increased in animals that developed autoimmunity: 8.0 ± 0.7% in the control group, 7.9 ± 0.9%
in the non-sick group, and 17.3 ± 4.5% in the sick group. Staining for CD161 also defined a
subset of activated CD8 cells (Figure 16): 6.4 ± 0.7% in the control group, 6.2 ± 0.8% in the
non-sick group, and 18.6 ± 5.6% in the sick group. The mean percentages of CD4+ T cells
among the three groups were 37.5 ± 6.8%, 43.8 ± 5.6%, and 25.2 ± 4.2%, respectively
(Figure 17). Histological changes among different groups were compared in Figure 18.
A
B
Figure 15 Flow cytometric analysis of CD3+CD8+ T cell subsets in the liver from control (n=4), non-sick (n=3), and sick (n=5) animal groups. The top panel shows an example from a sick animal. A one way ANOVA test was performed, p<0.03; Mean ± S.D.
63
A
B
Figure 16 Flow cytometric analysis of CD8+, CD161+ subsets in the liver T cells from control (n=4), non-sick (n=3), and sick (n=5) animal groups. The top panel shows an example from a sick animal. A one way ANOVA test was performed, p<0.03; mean ± S.D
64
A
B
Figure 17. Flow cytometric analysis of CD3+CD4+ T cell subsets in the liver from control (n=4), non-sick (n=3), and sick (n=5) animal groups. Top panel shows an example from the sick animal group. A one way ANOVA test was performed, p<0.03; Mean ± S.D.
65
A:
B:
C:
Figure 18. Morphological changes (H&E stain) in the liver of male BN rats that developed D-penicillamine-induced autoimmunity. A. Control; B. Sick (D4). There is a central area containing numerous intact neutrophils surrounded by many macrophages, some of which are fused as multi-nucleated giant cells. C. Sick (D4): Granulocytes have infiltrated around the macrophages.
66
67
4.4. DISCUSSION
It has been reported that the liver is one of the organs affected in D-
penicillamine-induced autoimmunity (Donker, Venuto et al. 1984). Early histology
studies from our own group indicated that D-penicillamine treatment could lead to
hepatocyte necrosis (Sayeh and Uetrecht 2001). The present experiments provided
additional data on D-penicillamine-induced liver injury. Following low-dose
treatment in which none of the animals develop obvious autoimmunity, SDH levels
only increased in the treatment group at a very early time point (Figure 13B and 14B)
and then returned to normal, while ALT values were depressed at the same time point.
In contrast, at a higher dose of D-penicillamine, the increase in SDH was delayed and
only occurred in animals that developed autoimmunity (Table 4). Because not all of
the rats treated with D-penicillamine develop liver toxicity (Table 4), this type of
DILI is idiosyncratic. Since it is extremely difficult to study idiosyncratic DILI in
humans, this model may serve as unique tool for mechanistic studies of idiosyncratic
DILI.
It has been reported before that some chemicals or drugs can react with
aldehydes including pyridoxal phosphate, which is the cofactor in both the AST and
ALT assays. Thus, these reactions would potentially interfere with these assays
(O'Brien, Slaughter et al. 2002). In earlier studies we found histological evidence of
hepatic necrosis in the D-penicillamine model but no increase in ALT. In the current
studies, it was found that D-penicillamine can affect the ALT assay presumably by
depleting pyridoxal phosphate which is a cofactor for the assay. It is known that D-
penicillamine reacts with aldehyde groups, and as was shown in Figure 2, D-
penicillamine treatment significantly increased the SDH level, but only at week 1
(Figure 13A), while serum levels of ALT (Figure 14B) significantly decreased in the
68
same samples. Therefore, the hepatoprotective effects of D-penicillamine that have
been reported in some clinical studies (Iorio, D’Ambrosi et al. 2004; Gong,
Klingenberg et al. 2006) may be largely due to interference with the ALT assay.
However, the changes observed in this study were only significant at week 1. It is
unclear why the ALT did not remain depressed but there may be some compensatory
mechanism to increase pyridoxal phosphate production.
It has been hypothesized by our group that most IDILI is mediated by the
immune system and occurs when immune tolerance fails (Metushi, Cai et al. 2011).
IL-10, a classic anti-inflammatory cytokine, has been generally accepted as one
mediator of immune tolerance. A number of studies have shown that IL-10 plays a
protective role during liver inflammation, possibly by direct inhibition of the
production of proinflammatory cytokines, such as IFN-γ, IL-6, IL-12, and TNF-α. For
example, it was found that IL-10 levels are increased in the liver and serum shortly
after the administration of ConA in mice (Louis, Le Moine et al. 1997). In addition,
pretreatment of anti-IL-10 antibody before administration of ConA resulted in more
severe hepatitis with increased levels of IL-12, TNF-α, and IFN-γ in the blood (Louis,
Le Moine et al. 1997). In IL-10-deficient mice (Di Marco, Xiang et al. 1999),
treatment with recombinant IL-10 suppresses the production of proinflammatory
cytokines and protects the liver from ConA-induced injury. It was also found that IL-
10 exerts a critical effect by preventing IL-6 increase and other potential hepatotoxic
factors in liver injury induced by acetaminophen (APAP) (Bourdi et al., 2007). In the
current study, IL-10 was significantly increased in the serum of some animals one
week after low dose D-penicillamine treatment (Figure 12 and 14), indicating that
immune tolerance may begin at a very early time point after the administration of the
drug. Interestingly, the IL-10 levels appear to be inversely correlated with the severity
69
of the liver injury. For example, Rat D1, which had a much higher serum IL-10 level,
did not develop significant liver injury (Figure 14). These data suggest that IL-10
plays a protective role in D-penicillamine-induced liver injury. In earlier studies we
found that serum IL-10 was increased late in the course of high dose D-penicillamine
treatment in animals that developed autoimmunity (see Chapter 2).
In earlier studies, infiltration of plasma cells, lymphocytes, eosinophils,
neutrophils, and macrophages was observed following D-penicillamine treatment
(Sayeh and Uetrecht 2001). Histological changes in the liver were also observed
(Figure 18). In sick animals, H&E staining showed that there is a central area
containing numerous intact neutrophils surrounded by many macrophages, some of
which are fused as multi-nucleated giant cells, which is clearly different from control
animals. All of this data suggests that this DILI is at least partially mediated by the
immune system. However, what types of immune cells are involved in and are
responsible for the liver injury has not been previously investigated. Thus
phenotyping of liver cells with flow cytometry was carried out to reveal the changes
of lymphocytes after D-penicillamine treatment. The current study focused on two
major types of T cells: cytotoxic T cells and helper T cells. As was shown in Figures
15 and 17, compared with the control group and non-sick animal group, the
percentage of cytotoxic T cells increased significantly in the sick animal group while
the percentage of T helper cells was decreased after these animals developed
autoimmunity following D-penicillamine treatment. Furthermore, among the
cytotoxic T cells, it was found that the percentage of cells that expressed CD161
molecule was significantly increased (Figure 16). CD161 has been reported to be
expressed on a minority of CD8+ T cells in the normal state (Lanier, Chang et al.
1994). A more recent study showed that these CD8+CD161+ cells produce
70
significantly higher levels of IFN-γ and TNF-α than the CD8+CD161- subset
(Takahashi, Dejbakhsh-Jones et al. 2006), suggesting that this subset of cytotoxic T
cells bear proinflammatory characteristics and may be responsible for the liver injury.
Flow cytometric data from the current study suggest that D-penicillamine-induced
liver injury is mediated by these CD8+CD161+ cytotoxic T cells.
71
CHAPTER 5
INVESTIGATION OF THE ROLE OF TH17 CELLS IN
ISONIAZID-INDUCED LIVER INJURY
Xu Zhu*, Imir Metushi, Xin Chen, and Jack P. Uetrecht*, ‡
*Department of Pharmaceutical Sciences, Faculty of Pharmacy and ‡Faculty of
Medicine, University of Toronto, Ontario M5S 3M2, Canada
72
5.1. INTRODUCTION Drugs are one of the most common causes of liver injury. It has been
reported that more than 900 drugs or toxins can cause liver toxicity (Friedman, 2003).
Drug-induced liver injury (DILI) is a significant source of morbidity and mortality.
For example, DILI accounts for about 5% of all hospital admissions and 50% of
all acute liver failure (Ostapowicz et al., 2002, Sgro et al., 2002). In addition, drug-
induced hepatic injury is also the leading reason cited for discontinuation of
previously approved drugs. Thus liver toxicity caused by medications has become an
important public health problem. The overall incidence of DILI is believed to be very
low for most drugs that can cause DILI. This low incidence of DILI has made it
difficult to perform mechanistic studies, especially for the idiosyncratic type (IDILI),
which is unpredictable. Although the mechanisms of most IDILI remain largely
unknown, evidence from clinical studies suggests that the immune system plays a
very important role. Evidence for an immune mechanism includes fever, rash, and
eosinophilia, and a typical latency period from several weeks to several months,
which is consistent with the development of an adaptive immune response.
Isoniazid (INH) is a first-line drug used to treat tuberculosis. Mild hepatic
injury, evidenced by a transient elevation of serum ALT, occurs in about 20% of
patients taking INH, and up to 1% of patients develop severe liver injury if they
continue with the treatment (Black et al., 1975, Maddrey and Boitnott, 1973). This
elevation in ALT usually appears from 1 week to 6 months after initiation of INH
treatment. In most instances, the increase in enzyme levels returns to normal with no
need to withdraw the drug. Only in rare cases does the injury progress to liver failure.
It has been proposed that direct cytotoxicity rather than an immune-mediated drug
reaction is responsible for INH-induced hepatotoxicity, and this is referred to as
metabolic idiosyncrasy (Zimmerman, 1999). However, some evidence suggests that
73
INH-induced liver injury may involve an immune reaction. For example, it has been
found that 10% of INH-treated patients develop eosinophilia (Black et al., 1975). In
other cases, rechallenge of a patient with INH led to fever and liver injury within
hours of rechallenge (Maddrey and Boitnott, 1973). Such evidence implies that the
adaptive immune mechanism plays a role in at least some cases of INH-induced
hepatotoxicity.
CD4 helper T cells are central regulators in adaptive immunity, and they can
develop into pro-inflammatory cells such as Th17 cells or anti-inflammatory
sublineages such as regulatory T cells (Treg). Th17 cells have been shown to play
critical roles in the development of autoimmunity and allergic reactions (Ouyang et al.,
2008, Korn et al., 2009). Recently, it has been suggested that Th17 cells may also
play a role in inflammatory liver diseases. We found that IL-17 was elevated in ~ 60%
of acetaminophen (APAP)-induced liver injury and idiosyncratic DILI, while a much
lower fraction of patients with viral hepatitis had elevated IL-17 levels (Li et al.,
2010). In addition, it has been shown that the balance between Treg and Th17 cells is
a key factor that regulates helper T-cell function in autoimmune disease (Afzali et al.,
2007). However, there is no information on the balance between Treg and Th17 cells
in IDILI patients. In the present study, we investigated the numbers of Th17 cells and
Treg cells in blood from patients treated with INH to determine if the balance in these
cells might help to explain the mechanism of IDILI.
74
5.2. MATERIALS AND METHODS
Patients. Patients who had been diagnosed as having latent tuberculosis and
were being started on a course of INH were enrolled in the current study. Fresh blood
samples were collected at various time points, and the serum ALT was determined by
the Toronto Western Hospital. This study was approved by the Toronto Academic
Health Sciences Network and University of Toronto ethics committees. Written
informed consent was obtained from all individuals.
Cell preparation. Approximately 13 mL of venous blood was drawn from
INH-treated patients. A portion of the blood was drawn into a 9 mL heparinized tube
for the isolation of peripheral blood mononuclear cells (PBMC), while the remaining
4 mL was used for the preparation of serum. PBMC were isolated using a Ficoll-
Paque Plus density gradient solution (GE Health, USA). Centrifugation was
performed at 400xg for 30 min at 15 °C. The serum was separated and stored at -80°C
until it was analyzed for cytokine levels.
Flow cytometric analysis of Th17 cells and Treg cells. To investigate Th17
cells, IL-17-producing CD4 lymphocytes were quantified by flow cytometry. PBMC
were suspended at a density of 1x106 cells/mL in culture medium (RPMI 1,640
supplemented with 100 U/mL penicillin and 100 g/mL streptomycin, 2 mM glutamine
and 10% heat-inactivated fetal calf serum, Gibco BRL). Cultures were stimulated for
5 h using 50 ng/mL of phorbol myristate acetate (PMA, Sigma–Aldrich, USA) and
750 ng/mL ionomycin (Sigma–Aldrich, USA) in the presence of monensin (2 mM,
BD GolgiStop™, USA), at 37 °C and a 5% CO2 atmosphere. Cells were then washed
with phosphate-buffered saline (PBS) and surface-labeled with CD3-APC/Cy7
(Biolegend, USA), CD4-eFluor® 450 and CD8-PerCP (eBioscience, USA).
Following surface staining, cells were fixed and permeabilized using Permeabilization
Reagent (eBioscience, USA) and then stained with IL-17A-FITC (eBioscience, USA).
75
For analysis of Treg cells, PBMC were aliquoted into wells without PMA and
ionomycin stimulation, and they were surface-labeled with CD4-eFluor® 450 and
CD25-FITC (eBioscience, USA) followed by fixation and permeabilization and
intracellular staining with FoxP3-PE (eBioscience, USA). Labeled cells were washed
and analyzed with FACSCanto cytometer using FACSDiva software (BD biosciences,
USA).
Statistical analysis. Data analysis was performed with Prism software
(GraphPad Software, San Diego, CA, USA). Data are presented as the mean ± SD.
The non-paired Student’s t-test was used to examine differences between groups.
Findings were considered significant when P-values were <0.05.
76
5.3. RESULTS
Frequencies of Th17 cells in the peripheral blood of INH-treated
patients. The frequencies of Th17 cells in peripheral blood were determined by
intracellular staining and flow cytometry. Table 5 summarizes ALT levels (A) and the
frequency of Th17 cells (B) at various time points following INH treatment. As
shown in Fig. 19A, there was no significant difference in the percentage of Th17 cells
(CD4+ IL-17A+) between patients that developed INH-induced liver injury and those
that did not (0.47 ± 0.12 vs 0.42 ± 0.11%). In contrast, the percentage of Th17 cells
increased in many patients coincident with an increase in ALT (Fig. 19B and 20), and
the mean number of Th17 cells was significantly higher in patients with an increase in
ALT relative to those who did not have an increase in ALT (1.05 ± 0.18 vs 0.42 ±
0.04%; p < 0.01).
77
A Revisit # 0 1 2 3 4 5 6Patient 01 34 44 144 Patient 02 14 15 30 32 46 57 73Patient 03 23 15 39 58 59 49 Patient 04 15 18 25 47 39 36 Patient 05 22 23 52 34 Patient 06 15 27 22 19 26 Patient 07 12 17 16 14 15 Patient 08 18 20 20 20 24 Patient 09 19 28 29 22 25 22 23Patient 10 14 12 11 10 B Revisit # 0 1 2 3 4 5 6Patient 01 0.72 1.68 1.34 Patient 02 0.61 0.96 0.98 0.91 0.81 1.74 1.9 Patient 03 0.18 0.38 0.3 0.3 0.36 0.72 Patient 04 0.36 0.35 0.23 0.86 0.38 0.20 Patient 05 0.23 0.36 0.74 0.64 Patient 06 0.18 0.26 0.17 0.21 0.33 Patient 07 0.57 0.67 0.28 0.37 0.51 Patient 08 0.67 0.28 0.44 0.43 0.58 Patient 09 0.18 0.18 0.11 0.26 0.25 0.26 0.14 Patient 10 0.74 0.65 0.32 0.47
Table 5. ALT levels (A) and the frequency of Th17 cells (B) at various time points in patients treated with INH. Mild liver injury was observed in patients 1-5. ALT levels above 40 U/L were considered to be abnormal (bold numbers).
A
B
Figure 19. The percentage of Th17 cells in the peripheral blood at baseline (before receiving INH) was compared between patients who later developed an increase in ALT vs patients who did not have an increase in ALT (A) and then later the % Th17 cells when patients had an increase in ALT vs those who did not have an increase in ALT (B). NS: no significant difference. T test with Welch‘s correction; Mean ± SD; p <0.01.
78
Figure 20. Examples of increases in the percentage of Th17 cells before and after INH treatment in some patients who had an increase in ALT.
Frequencies of Treg cells in the peripheral blood of INH-treated patients.
The frequencies of Treg cells in peripheral blood were determined by flow cytometry
with intracellular staining. ALT levels are summarized in Table 6 (A) and the
frequency of Treg cells in 6 (B) at various time points following INH treatment. As
shown in Fig. 21A, there was no significant difference in the basal levels of Treg cells
between patients who developed INH-induced mild injury and those who did not
(1.12 ± 0.22 vs 1.11 ± 0.23%). This indicates that the basal levels of Treg cells did
not determine which patients would develop liver injury. When the percentage of Treg
cells was compared between patients who developed an increase in ALT and those
79
80
who did not (Fig. 21B), there was no significant difference (1.14 ± 0.08 vs 1.32 ±
0.09%).
A
Revisit # 0 1 2 3 4 5 6Patient 01 34 44 144 Patient 02 14 15 30 32 46 57 73Patient 03 23 15 39 58 59 49 Patient 04 15 18 25 47 39 36 Patient 05 22 23 52 34 Patient 06 15 27 22 19 26 Patient 07 12 17 16 14 15 Patient 08 18 20 20 20 24 Patient 09 19 28 29 22 25 22 23Patient 10 14 12 11 10 B Revisit # 1 2 3 4 5 6Patient 01 1.39 1.46 1.47 Patient 02 1 1.34 1.31 1.59 1.35 1.23 0.72Patient 03 0.66 0.94 0.99 0.85 1.18 1.16 Patient 04 1.86 2.29 1.38 1.05 0.86 0.44 Patient 05 0.63 2.16 0.93 0.96 Patient 06 0.35 1.13 1.18 1.09 0.73 Patient 07 0.98 0.86 0.59 0.63 0.79 Patient 08 1.46 1.33 1.27 0.75 1.85 Patient 09 1.57 1.86 1.95 1.89 2.19 1.21 2.66Patient 10 1.28 2.49 0.83 1.57
Table 6. ALT levels (A) and the percentage of Treg cells (B) in the peripheral blood at various time points in patients treated with INH. Mild liver injury was observed in patients 1-5. ALT levels above 40 U/L were considered to be abnormal (bold numbers).
Figure 21. The percentages of Treg cells at baseline (before receiving INH) were compared between patients who developed an increase in ALT vs patients who did not (A), and then later the % of Treg cells were compared in patients with an increase in ALT during INH treatment (B). NS: no significant difference. T test with Welch‘s correction; Mean ± SD.
81
82
Figure 22. The ratio of Th17 cells/Treg cells compared between patients with a normal or an elevated ALT level. T test with Welch‘s correction; Mean ± SD; p <0.05
83
5.4. DISCUSSION
As mentioned in the later part of the Introduction, we believe that many IDRs
are immune-mediated while many hepatologists accept the concept that drug-induced
idiosyncratic liver toxicity without fever, rash, and anti-drug antibodies represents
metabolic idiosyncrasy (Zimmerman, 1999). However, there are no examples in
which a polymorphism in a metabolic pathway is sufficient to explain the
idiosyncratic nature of IDILI. In our previous studies, we observed a clear increase in
IL-17 serum levels in patients with INH-treated patients who had drug-induced liver
failure (Li et al., 2010). At the same time, the plasma levels of IL-6 were found to be
much higher in IL-17-positive patients. Some features, including the delay between
starting the drug and onset of the injury, suggest the involvement of the adaptive
immune system. Furthermore, INH treatment can induce a lupus-like syndrome.
These data suggest that some, if not most, cases of INH-induced liver injury are
immune-mediated.
In the present study, we investigated the frequencies of Th17 and Treg cells
in the peripheral blood of patients taking INH. Our study found that there was a clear
difference in the percentage of peripheral Th17 cells between patients who had an
abnormal ALT level and those with a normal ALT level. As shown in Figure 19B, a
significant increase in Th17 cells was observed in many patients when ALT levels
reached an abnormal level. In contrast, no difference in basal levels of Th17 cells was
detected between patients who developed mild liver injury and those who did not
(Figure 19A). In addition, it has been demonstrated that the peripheral Th17
frequency in patients with latent TB infections is not different than from that in
healthy donors (Chen et al., 2010). There were no significant differences in Treg cells
between patients with normal ALT levels and those with increased ALT levels
84
(Figure 21). These data suggest that Th17 cells may play an important role in INH-
induced liver injury.
It has been shown that there is a reciprocal relationship between Th17 and
Treg cells. Data suggest that a Th17/Treg imbalance may be a characteristic of some
chronic inflammatory diseases. An imbalance between Th17 and Treg cells has been
reported in a number of inflammatory disorders such as arthritis, primary biliary
cirrhosis, and inflammatory bowel disease (Nistala et al., 2008, Rong et al., 2009,
Eastaff-Leung et al., 2010). In the present study, the Th17/Treg ratio for each time
point was calculated. Patients with normal ALT levels exhibited a low Th17/Treg
ratio, while patients with increased ALT levels had a higher Th17/Treg ratio (Figure
22). However, this difference is controlled completely by the change in Th17 cells.
This suggests that there may be some cell other than the Treg that is responsible for
the tolerance that usually develops in INH-induced liver injury, although it is possible
that the Tregs are in the liver, not in the peripheral blood.
Very recently, 2 patients who developed INH-induced mild liver injury were
found to have an increase in IL-10-secreting T cells (Figure 23). Considering that IL-
10 plays a critical role in immunosuppression, these results suggest that after the
development of liver injury in some patients, immune tolerance may have occurred
and prevented the development of severe liver injury. Considering the fact that the
percentage of Tregs did not increase with an increase in ALT, it is very likely these
IL-10-producing cells are not classic Tregs. Thus, it will be very interesting to
determine the exact phenotype of these IL-10 producing cells. Additional research
work carried out in humans and animal models will be required to further define the
mechanism of INH-induced hepatotoxicity; however, this study suggests that INH-
induced liver injury is mediated by the adaptive immune system, and in most cases the
injury is kept in check by cells that produce IL-10 but are not classic Tregs.
Figure 23. Increased percentage of cells that produce IL-10 in the peripheral blood from two patients that developed INH-induced liver injury. The PBMCs were stimulated with PMA and ionomycin for 5 h. Representative FACS staining for IL-10 and CD3+ T cells before INH treatment and at the time of increased ALT is shown.
85
86
CHAPTER 6
TH17 CELLS ARE INCREASED IN THE LIVER
FOLLOWING ACETAMINOPHEN TREATMENT OF
MICE: TH17 CELLS AND THE INNATE IMMUNE
SYSTEM
Xu Zhu* and Jack P. Uetrecht*, ‡
*Department of Pharmaceutical Sciences, Faculty of Pharmacy and ‡Faculty of
Medicine, University of Toronto, Ontario M5S 3M2, Canada
Journal of Immunotoxicology (Submitted)
87
ABSTRACT
Helper T (TH) cells are an important part of the adaptive immune system. We
hypothesized that one type of helper T-cell, TH17 cells, play an important role in
idiosyncratic drug-induced liver failure, and we found that interleukin (IL)-17, the
signature cytokine of TH17 cells, was elevated in most patients with idiosyncratic
drug-induced liver failure. However, we also found that IL-17 was elevated in some
patients with acetaminophen (APAP)-induced liver failure. It is unlikely that APAP-
induced liver failure is mediated by the adaptive immune system, but there are other
cells such as macrophages and natural killer (NK) cells that also produce IL-17.
Therefore, we studied the phenotype of cells that produce IL-17 in a mouse model of
APAP-induced liver toxicity. To our surprise we found that most of the IL-17
producing cells in the liver were TH17 cells, and they were increased within hours of
APAP treatment. This is too fast for a response of the adaptive immune system. These
data suggest that TH17 cells can be part of the innate immune response; however, it is
unclear what role they play in the pathogenesis of APAP-induced hepatotoxicity.
88
6.1. INTRODUCTION
Acetaminophen (paracetamol, APAP)-induced liver injury is not
idiosyncratic, but the dose required to cause liver failure can vary significantly from
one individual to another. For example, low-dose APAP treatment is believed to be
safe and is usually not associated with liver damage; however, when used at the
maximum recommended daily dose, it has been shown that APAP can result in the
elevation of serum alanine aminotransferase (ALT) levels more than three times the
upper limit of normal in over 40% of people (Watkins et al., 2006). APAP overdose
can lead to severe liver damage, and in the United States it has been reported that
more than 50% of cases of acute liver failure (ALF) are due to APAP (Ostapowicz et
al., 2002).
The mechanisms of APAP-induced hepatotoxicity have been extensively
studied. APAP is mainly metabolized in the liver by Phase II pathways of sulfation
and glucuronidation. The Phase I reaction that involves cytochromes P450 is only
responsible for a very limited proportion of the metabolism of APAP; however,
oxidation generates a highly reactive metabolite: N-acetyl-p-benzoquinone imine
(NAPQI). NAPQI is detoxified by conjugation with glutathione. Although this
conjugation prevents significant toxicity at low doses, with an overdose, the increased
amount of NAPQI depletes glutathione (Nelson, 1990). Covalent binding of NAPQI
to proteins leading to mitochondrial injury appears to be the ultimate mechanism
leading to cell death (Kon et al., 2004; Reid et al., 2005).
Although it is generally accepted that APAP-induced hepatotoxicity is
largely due to events occurring within the hepatocytes, recent studies have begin to
focus on cells of the innate immune system and imply that these cells may also play
an important role in the pathogenesis of this liver damage (Liu and Kaplowitz, 2006).
89
However, a careful look at the current data suggests that these cells, i.e. Kupffer cells,
neutrophils, and monocytes, likely play a protective role and are responsible for
repairing tissue damage (Jaeschke et al., 2011). For example, it has been shown that
complete depletion of Kupffer cells with the intravenous injection of
liposome/clodronate caused a significant decrease in the hepatic expression of
mRNAs of modulatory cytokines and significantly increased susceptibility to APAP-
induced liver injury (Ju et al., 2002), suggesting that Kupffer cells have protective
function in APAP-induced liver injury.
Our laboratory has postulated that most idiosyncratic drug-induced liver
injury is mediated by the adaptive immune system. In order to test this hypothesis we
studied the cytokine profile in patients with idiosyncratic drug-induced liver failure
with an emphasis on cytokines related to TH17 cells. TH17 cells and their associated
cytokines have been implicated in a number of human liver diseases, including
autoimmune, viral, alcoholic, and ischemia/reperfusion injury (Hammerich et al.,
2010). We found that most of the patients with idiosyncratic drug-induced liver failure
had elevated levels of interleukin (IL)-17, the signature TH17 cytokine; however,
many of the patients with APAP-induced liver failure also had increased levels of IL-
17 (Li et al., 2010). Although several other cells such as macrophages and NK cells
can produce IL-17, IL-21, another cytokine related to TH17 cells, was also elevated in
patients with APAP-induced liver injury. In the present study, the involvement of IL-
17/TH17 pathway in APAP-induced liver injury in a mouse model where the IL-17-
producing cells in the liver could be phenotyped was investigated.
90
6.2. MATERIALS AND METHODS
Animals. Male Balb/c mice (15-20 g, 4-6-wk-old) were purchased from
Charles River (Montreal, Quebec, Canada) and kept 2/cage in a pathogen-free facility
maintained at 22°C and with a 12:12 hr light:dark cycle. The mice were given ad
libitum access to standard mouse chow (Agribrands, Purina Canada, Strathroy,
Ontario, Canada) and tap water for a weeklong acclimatization period before starting
an experiment. All animal procedures were performed according to the University of
Toronto guidelines for the care and use of laboratory animals.
Chemicals, kits, and solutions. APAP, phorbol myristate acetate, ionomycin,
Percoll solution, and RPMI 1640 medium were purchased from Sigma-Aldrich (St.
Louis, MO). Fetal bovine serum (FBS) and penicillin-streptomycin solution were
purchased from Gibco, Invitrogen (Carlsbad, CA). All ELISA kits were purchased
from R&D Systems (Minneapolis, MN). The ALT assay reagents were purchased
from Thermo Fisher Scientific Inc. (Middletown, VA). Conjugated monoclonal
antibodies against CD3 (phycoerythrin-Cy7 cyanine dye), CD4 (fluorescein
isothiocyanate), and IL-17 (allophycocyanin) were purchased from eBioscience Inc.
(San Diego, CA). CD1d tetramer (phycoerythrin) reagents were provided by the NIH
tetramer Core Facility (Atlanta, GA).
APAP treatment and cell preparation. Animals were fasted for 15 hr
before experiments. The male mice were then given saline (vehicle, n = 4) or APAP
dissolved in saline at a concentration of 300 mg/kg body weight (BW)
(intraperitoneally [IP], n = 4). Two hr after the APAP (or vehicle) injection, all mice
were euthanized by carbon dioxide asphyxiation. At necropsy, the liver was then
perfused with phosphate-buffered saline (PBS, pH 7.4) and isolated, followed by
immediate gall bladder removal. The liver was then carefully mashed on a BD Falcon
91
70 µm cell strainer using a syringe piston and centrifuged at 350 x g in 40-50 ml
complete RPMI (RPMI containing 10% FBS and 1% penicillin/streptomycin). The
cell pellets were re-suspended in 10 ml PBS and split into two 15 ml tubes. After
centrifuging again, the samples were re-suspended in 9-10 ml of a 33% Percoll
solution and then spun at 1150 x g for 20 min at room temperature. The cake on top of
the Percoll was carefully removed, and the cell pellet at the bottom was re-suspended
in 1 ml of complete RPMI. Following red blood cell lysis, lymphocytes were isolated,
and the final cell concentration was adjusted to 2 x 107/ml.
Flow cytometric analysis of Th17 cells. IL-17-producing CD4+
lymphocytes were examined. Liver cells were suspended at a density of 1 x 106
cells/ml in complete culture medium. Cultures were stimulated for 5 hr using 50 ng
phorbol myristate acetate/ml and 750 ng ionomycin/ml in the presence of monensin,
at 37°C and 5% CO2. All cells were then washed in PBS and pre-incubated with 2 µl
of affinity-purified FcγR-binding inhibitor/106 cells for 20 min on ice prior to staining.
The recommended quantity of each primary antibody was combined in an appropriate
volume of Flow Cytometry Staining Buffer (eBioscience Inc., San Diego, CA) and
added to the cells. All samples were then incubated for at least 30 min in the dark on
ice at 4°C and then washed with Flow Cytometry Staining Buffer (eBioscience).
Following surface staining, cells were fixed and permeabilized using Permeabilization
Reagent (eBioscience) and then stained with anti-IL-17 antibody. Stained cells were
analyzed with a FACSCanto cytometer (BD Bioscience, San Jose, CA) and data were
analyzed by FlowJo software (TreeStar, Ashland, OR). A minimum of 200,000 events
per sample was routinely acquired.
Statistical analysis. Statistical analyses were performed using GraphPad
Prism (GraphPad Software, San Diego). The statistical test used for the ELISA results
92
and flow cytometry analysis was a one-way analysis of variance (ANOVA). A two-
tailed analysis was carried out with significance defined as a p-value < 0.05. All data
were expressed as the mean ± SEM.
6.3. RESULTS AND DISCUSSION
Figure 24. Liver injury during APAP-induced liver toxicity. Balb/c mice were given
saline or APAP (300 mg/kg) once by IP injection. At 0, 2, 6, and 24h post-injection,
mice were euthanized, blood was collected, and serum levels of ALT then measured.
Results shown are the mean (±SE) of four mice.
Figure 25. Serum IL-17 levels after APAP (300�mg/kg) treatment. Results are the mean ± SE of four mice (**P<0.01).
93
A
B
C
Figure 26. APAP treatment increased levels of IL-17-producing CD4+ T-cells in the liver after 2 hr. (A) CD3 and CD4 double-positive cells were gated for further analysis. (B) Example of IL-17 expression compared between control and treatment animals. (C) Percentage of CD4+IL-17+ T-cells in the liver 2 hr after APAP treatment compared with controls. Results shown are the mean (±SE) from three mice. Similar results were obtained in three independent experiments (p < 0.03).
94
Figure 27. Comparison of staining for CD1d tetramer (NKT cell marker) in total hepatic lymphocytes (left panel) and hepatic lymphocytes that stain positive for CD3/CD4/IL-17 from Figure 3 (right panel).
High-dose APAP treatment (300 mg/kg) resulted in an increase in ALT
(Figure 1) and this was associated with an increase in serum IL-17 levels (Figure 2).
The phenotype of IL-17-producing cells in APAP-induced acute liver injury was
determined by flow cytometry. APAP-treated animals had significantly higher
percentages of CD3+CD4+IL-17+ cells (0.64 ± 0.06%) as compared to the controls
(0.15 ± 0.03%) (Figure 3). Very few CD3+CD4+ IL-17+ cells expressed measureable
levels CD1d molecules (Figure 4). Such data strongly suggest that these cells are
TH17 cells rather than NKT cells which can also be the source of IL-17.
IL-17 and TH17 cells have been shown to play critical roles in various
inflammatory and autoimmune diseases (Korn et al., 2009). Moreover, increasing
evidence suggests that the TH17 pathway is also involved in different liver diseases,
including acute liver failure, viral hepatitis, alcoholic liver disease, autoimmune
hepatitis, and primary biliary cirrhosis (Hammerich et al., 2010). Recently, it has been
95
96
reported that IL-17/IL-17R signalling is involved in the pathogene-sis of
Concanavalin A (ConA)-induced acute liver toxicity (Yan et al., 2011). The increased
levels of IL-17 were found to parallel the severity of liver injury, and blockade of IL-
17 or IL-17R significantly ameliorated ConA-induced acute liver injury.
APAP-induced hepatotoxicity is (generally) not believed mediated by the
adaptive immune system; however, an increase in pro-inflammatory TH17-related
cytokines such as IL-17 and IL-21 was found in samples from patients treated with
APAP (Li et al., 2010). It was plausible that the source of this IL-17 was cells of the
innate immune system such as NK cells (Lo et al., 2008). To test this hypothesis we
treated mice with APAP and phenotyped the cells that produced IL-17. Serum IL-17
was observed to increase as early as 2 hr after APAP treat-ment (Figure 2). In liver, it
is known that a fraction of NKT cells also co-express CD3 and CD4 (Godfrey et al.,
2000). However, in the current study, it was found that almost all of the
CD3+CD4+IL-17+ cells (Figure 4) did not bind to CD1d tetramer, an NKT cell-
specific marker. Such data indicate that these CD3+CD4+IL-17+ cells are TH17 cells
rather than NKT cells.
Considering the fact that both IL-17 and IL-6 were increased at early time
points, the adaptive immune system is unlikely to be the source of these cytokines.
This suggested that the source of IL-17 is the innate immune system. However, the
data in this study (Figures 3 and 4) strongly suggest that TH17 cells are the major
source of IL-17 induced by the administration of APAP. It has been reported that IL-
1ß signalling is activated by APAP (Williams et al., 2010), and it has been shown that
IL-1ß can promote the expression of the chemokine CCL20 and recruit TH17 cells by
interaction with its receptor, CCR6 (Hirata et al., 2010). Such a mechanism may
explain the significant increase in TH17 cells observed in the current study. Very
97
recently, TH17 cells have also been shown to be responsible for the innate IL-17-
associated responses to bacteria (Geddes et al., 2011). IL-6 is required for induction
of such an early TH17 response. APAP-induced liver injury appears to be another
example in which TH17 cells are part of the innate response, but it is not clear what
role they play since the innate immune system appears to play a protective role in
APAP-induced liver injury.
99
7.1. INTRODUCTION
Adverse drug reactions (ADRs) are responsible for a significant amount of
morbidity and mortality in patients, and they sometimes lead to withdrawal of a drug
from the market. Thus ADRs remain a serious problem for patients, the
pharmaceutical industry, and the health care system. However, the mechanisms of
most ADRs, especially the idiosyncratic type of ADRs (IDRs) are still not clear. Little
progress has been made in mechanistic understanding probably because it is not
feasible to study most IDRs in humans prospectively and there are a very limited
number of valid animal models available for mechanistic studies.
Although the mechanisms of most IDRs are largely unknown, accumulated
evidence from both animal and clinical studies suggest that most IDRs are mediated
by the immune system. To investigate the role of the immune system in IDRs, our lab
has been working on an animal model that mimics one idiosyncratic drug reaction that
occurs in humans: penicillamine-induced autoimmunity in Brown Norway (BN) rats.
The results from previous studies on this model have suggest that interactions
between penicillamine and macrophages are the initial event leading to the immune
response (Li and Uetrecht, 2009). Macrophages can be directly activated by
penicillamine, and it is conceivable that they serve as antigen presenting cells. In
addition, it has also been shown that immune tolerance to penicillamine-induced
autoimmunity requires the involvement of T cells (Seguin et al., 2004), which are
well-known to play a central role in both innate immunity and adaptive immunity.
Naturally the next question to answer is which types of T cells are involved in the
penicillamine-induced autoimmunity. The experiments included in the first part of the
thesis (Chapters 2 and 3) are designed to answer this question with a focus on Th17
cells/pathway, which have been tightly linked with several autoimmune diseases since
100
they were first discovered and identified as a new subtype of T helper cells.
The next part of this thesis set out to examine the involvement of immune
system in drug-induced liver injury (DILI) because it has been reported that quite a
number of drugs can cause both hepatotoxicity and autoimmune diseases (Uetrecht,
2009b). Other evidence such as a delay between starting the drug and the onset of
the injury also suggests that most DILI is mediated by the immune system. Special
attention was also given to Th17 and regulatory T cells (Tregs), which are generally
considered to play key pathogenic and protective roles, respectively, in immune-
mediated reactions.
7.2. SUMMARY AND CONCLUSIONS
The results obtained from the above studies can be summarized as follows:
1) It was found that animals that developed penicillamine-induced autoimmunity
had marked increases in interleukin 6 (IL-6) and transforming growth factor-β1,
which are known to be driving forces of Th17 differentiation. This increase
occurred well before the onset of autoimmunity and there was a second peak of
IL-6 when the animals appeared ill. However, no significant changes in these
cytokines were observed in animals that did not develop autoimmunity. IL-17, a
characteristic cytokine produced by Th17 cells, was increased in sick animals at
both the messenger RNA and serum protein level. In addition, serum
concentrations of IL-22, another characteristic cytokine produced by Th17 cells,
were found to be elevated. Furthermore, the percentage of IL-17–producing CD4
T cells was significantly increased, but only in sick animals.
2) The results showed that retinoic acid (RA) did not block the development of Th17
cells and actually increased the incidence and severity of D-penicillamine-
101
induced autoimmunity. RA itself led to a significant increase in serum IL-6
levels in BN rats.
3) It is possible that D-penicillamine-induced liver injury is partially due to failure
of immune tolerance. Although IL-10 increased with the development of
autoimmunity, IL-4, IL-13, and TGF-ß decreased. An infiltration of CD8
cytotoxic T cells in the liver suggests that they may be the key player in causing
liver toxicity induced by D-penicillamine.
4) The present study found that there was a clear difference in the percentage of
peripheral Th17 cells between patients treated with isoniazid with an abnormal
ALT level and those with a normal ALT level. The immunological balance
between Th17 and Treg cells may be broken with INH-induced liver injury. Two
patients who developed INH-induced mild liver injury were found to have an
increase in IL-10-secreting T cells.
5) IL-17 was observed to increase as early as two hours after acetaminophen
treatment. The percentage of Th17 cells in the liver is increased very rapidly
following acetaminophen treatment in mice, suggesting that innate Th17
responses have been induced. Th17 and other CD4- T cells appear to the major
source of IL-17 in the liver after injury.
7.3. IMPLICATIONS AND FUTURE DIRECTIONS
The study in Chapter 2 provides a very complete cytokine/chemokine profile
as a function of time during the development of an autoimmune idiosyncratic drug
reaction. The finding that an early spike in IL-6 predicted which animals would
develop autoimmunity following penicillamine treatment has important implications.
Not only may IL-6 represent a biomarker to predict certain types of IDRs, but it also
102
suggests that the immune system makes a very early “decision” even though it took
two or three weeks for the manifestations of autoimmunity to develop. However,
although an early peak in IL-6 predicted which animals would ultimately develop
autoimmunity, it is still not clear what factor(s) actually cause such an IL-6 spike, or
why only about half of the animals develop autoimmunity, especially because this is a
highly inbred rat strain. A better understanding of the cellular sources of cytokines (i.e.
IL-6 and IL-17 etc.) that significantly changed during early drug treatment might be
able to explain the response difference and would shed light on the pathogenesis of
drug-induced idiosyncratic autoimmunity.
Th17 cells have been suggested to play a pathogenic role in many types of
autoimmune diseases, but there is currently little evidence for their involvement in
IDRs. Animals with D-penicillamine-induced autoimmunity had a significant increase
in CD4+/IL-17+ cells, which defines Th17 cells, and this provides strong evidence for
their involvement in penicillamine-induced autoimmunity. In addition, the pattern of
cytokines is exactly what would be expected for a Th17 response; specifically, an
early spike of IL-6 and the presence of increased TGF-ß, which are required for the
development of Th17 cells. It appears that many other types of IDRs may have an
autoimmune component (Uetrecht, 2009b); therefore, the current study implies that
Th17 cells may be involved in other types of IDRs.
It was quite surprising that our results showed that retinoic acid did not block
the development of Th17 cells and actually increased the incidence and severity of D-
penicillamine-induced autoimmunity. Such data provide additional evidence that in
vivo RA treatment does not inhibit the differentiation and development of Th17 cells,
which conflicts with the results of early in vitro studies. The observation that RA itself
can lead to a marked increase in IL-6 levels at a relatively early time point seems to
103
have been overlooked by others and may explain the discrepancy between in vivo and
in vitro data given that IL-6 is such a critical factor in the differentiation of Th17 cells.
In addition, this finding further highlights the critical role of an early increase IL-6
level in D-penicillamine-induced autoimmunity.
It has been reported that the liver is one of the organs affected in D-
penicillamine-induced autoimmunity (Donker, Venuto et al. 1984). Phenotyping of
liver cells with flow cytometry in the present studies showed that the percentage of
cytotoxic T cells (CD8+CD161+) increased significantly when animals developed D-
penicillamine-induced autoimmunity. It has been reported that these CD8+CD161+
cells are capable of producing increased levels of IFN-γ and TNF-α (Takahashi,
Dejbakhsh-Jones et al. 2006), suggesting that this subset of cytotoxic T cells bear
proinflammatory characteristics and may be responsible for the liver injury. However,
it should be noted that this data was collected at the endpoint of the treatment and
therefore it is not clear whether these cytotoxic T cells are the “cause” or “result” of
the liver injury. A study carried out at an earlier time points would help to further
characterize the role such cytotoxic T cells in penicillamine-induced liver injury.
In the present project, I found that Th17 cells were increased in patients who
took isoniazid (INH) and developed very mild liver injury. Considering the fact that
Th17 cells appear to play a role in various types of autoimmune disease and liver
disorders, it is possible that Th17 cells could mediate this type of INH-induced mild
liver injury. But special caution is required because some patients with
acetaminophen-induced liver failure also had increased serum levels of IL-17, and
acute acetaminophen-induced liver injury is very unlikely to be mediated by Th17
cells. Thus another possibility is that they may only contribute to an inflammatory
environment that may facilitate the induction and development of such injury. The
104
finding that IL-10-producing T cells were also increased in patients with an increase
in ALT suggests that this mild injury is immune-mediated and the adaptation is
immune tolerance. This is in contrast to the generally accepted hypothesis that INH-
induced liver injury represents “metabolic idiosyncrasy”. A further mechanistic
understanding of this type of IDILI requires the development of valid animal models
in which the sequence of events leading to IDILI can be studied and controlled
experiment could be carried out. However, great difficulties have been encountered in
developing such animal models in our lab. And it seems that failure to break immune
tolerance is responsible for the unsuccessful development of animal models, which is
a major obstacle faced by many oncologists who are trying to treat cancer.
Further detailed clinical studies can also be carried out with other drugs that
may cause a high incidence of IDRs. Such studies may help to characterize various
aspects of the mechanisms in humans and find out to what degree the mechanisms
may vary with different drugs and in different individuals. On the other hand,
although a patient may not develop a clinically significant IDR, it may lead to a
change in cytokines and leukocytes that ends in immune tolerance. Such changes
could certainly provide clues to the mechanism by which an IDR occurs when
immune tolerance fails.
105
REFERENCES Adams, D. H. and B. Eksteen (2006). "Aberrant homing of mucosal T cells and extra-
intestinal manifestations of inflammatory bowel disease." Nat Rev Immunol 6(3): 244-51.
Afzali, B., G. Lombardi, et al. (2007). "The role of T helper 17 (Th17) and regulatory T cells (Treg) in human organ transplantation and autoimmune disease." Clin Exp Immunol 148(1): 32-46.
Andres, E., J. Zimmer, et al. (2006). "Idiosyncratic drug-induced agranulocytosis: Update of an old disorder." Eur J Intern Med 17(8): 529-35.
Antoine, D. J., D. P. Williams, et al. (2009). "High-mobility group box-1 protein and keratin-18, circulating serum proteins informative of acetaminophen-induced necrosis and apoptosis in vivo." Toxicol Sci 112(2): 521-31.
Bettelli, E., Y. Carrier, et al. (2006). "Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells." Nature 441(7090): 235-8.
Black, M., J. R. Mitchell, et al. (1975). "Isoniazid-associated hepatitis in 114 patients." Gastroenterology 69(2): 289-302.
Bourdi, M., D. P. Eiras, et al. (2007). "Role of IL-6 in an IL-10 and IL-4 double knockout mouse model uniquely susceptible to acetaminophen-induced liver injury." Chem Res Toxicol 20(2): 208-16.
Brodie, B. B., W. D. Reid, et al. (1971). "Possible mechanism of liver necrosis caused by aromatic organic compounds." Proc Natl Acad Sci U S A 68(1): 160-4.
Castrejon, J. L., N. Berry, et al. (2010). "Stimulation of human T cells with sulfonamides and sulfonamide metabolites." J Allergy Clin Immunol 125(2): 411-418 e4.
Cha, H. R., S. Y. Chang, et al. (2010). "Downregulation of Th17 cells in the small intestine by disruption of gut flora in the absence of retinoic acid." J Immunol 184(12): 6799-806.
Chen, X., T. Tharmanathan, et al. (2009). "A study of the specificity of lymphocytes in nevirapine-induced skin rash." J Pharmacol Exp Ther 331(3): 836-41.
Chen, X., M. Zhang, et al. (2010). "Reduced Th17 response in patients with tuberculosis correlates with IL-6R expression on CD4+ T Cells." Am J Respir Crit Care Med 181(7): 734-42.
106
Chien, R. N., I. S. Sheen, et al. (2003). "Unintentional rechallenge resulting in a causative relationship between ketoconazole and acute liver injury." Int J Clin Pract 57(9): 829-30.
Chung, D. R., D. L. Kasper, et al. (2003). "CD4+ T cells mediate abscess formation in intra-abdominal sepsis by an IL-17-dependent mechanism." J Immunol 170(4): 1958-63.
Chung, W. H., S. I. Hung, et al. (2010). "Genetic predisposition of life-threatening antiepileptic-induced skin reactions." Expert Opin Drug Saf 9(1): 15-21.
Crispe, I. N. (2009). "The liver as a lymphoid organ." Annu Rev Immunol 27: 147-63.
Cua, D. J., J. Sherlock, et al. (2003). "Interleukin-23 rather than interleukin-12 is the critical cytokine for autoimmune inflammation of the brain." Nature 421(6924): 744-8.
Cua, D. J. and C. M. Tato (2010). "Innate IL-17-producing cells: the sentinels of the immune system." Nat Rev Immunol 10(7): 479-89.
Di Marco, R., M. Xiang, et al. (1999). "Concanavalin A-induced hepatitis in mice is prevented by interleukin (IL)-10 and exacerbated by endogenous IL-10 deficiency." Autoimmunity 31(2): 75-83.
Donker, A. J., R. C. Venuto, et al. (1984). "Effects of prolonged administration of D-penicillamine or captopril in various strains of rats. Brown Norway rats treated with D-penicillamine develop autoantibodies, circulating immune complexes, and disseminated intravascular coagulation." Clin Immunol Immunopathol 30(1): 142-55.
Duong Van Huyen, J. P., A. Landau, et al. (2003). "Toxic effects of nucleoside reverse transcriptase inhibitors on the liver. Value of electron microscopy analysis for the diagnosis of mitochondrial cytopathy." Am J Clin Pathol 119(4): 546-55.
Eastaff-Leung, N., N. Mabarrack, et al. (2010). "Foxp3+ regulatory T cells, Th17 effector cells, and cytokine environment in inflammatory bowel disease." J Clin Immunol 30(1): 80-9.
Edwards, I. R. and J. K. Aronson (2000). "Adverse drug reactions: definitions, diagnosis, and management." Lancet 356(9237): 1255-9.
Ehrchen, J. M., C. Sunderkotter, et al. (2009). "The endogenous Toll-like receptor 4 agonist S100A8/S100A9 (calprotectin) as innate amplifier of infection, autoimmunity, and cancer." J Leukoc Biol 86(3): 557-66.
107
Fabrega, E., M. Lopez-Hoyos, et al. (2009). "Changes in the serum levels of interleukin-17/interleukin-23 during acute rejection in liver transplantation." Liver Transpl 15(6): 629-33.
Favilli, F., C. Anzilotti, et al. (2009). "IL-18 activity in systemic lupus erythematosus." Ann N Y Acad Sci 1173: 301-9.
Ferber, I. A., S. Brocke, et al. (1996). "Mice with a disrupted IFN-gamma gene are susceptible to the induction of experimental autoimmune encephalomyelitis (EAE)." J Immunol 156(1): 5-7.
Fernandez, T. D., G. Canto, et al. (2009). "Molecular mechanisms of maculopapular exanthema." Curr Opin Infect Dis 22(3): 272-8.
Friedman, S. E. G., James H.; McQuaid, Kenneth R. (2003). "Current diagnosis & treatment in gastroenterology." pp. 664–679.
Fujimoto, K., K. Kumagai, et al. (2009). "Sensitivity of liver injury in heterozygous Sod2 knockout mice treated with troglitazone or acetaminophen." Toxicol Pathol 37(2): 193-200.
Fujino, S., A. Andoh, et al. (2003). "Increased expression of interleukin 17 in inflammatory bowel disease." Gut 52(1): 65-70.
Geddes, K., S. J. Rubino, et al. (2011). "Identification of an innate T helper type 17 response to intestinal bacterial pathogens." Nat Med 17(7): 837-44.
Glimcher, L. H. and K. M. Murphy (2000). "Lineage commitment in the immune system: the T helper lymphocyte grows up." Genes Dev 14(14): 1693-711.
Godfrey, D. I., K. J. Hammond, et al. (2000). "NKT cells: facts, functions and fallacies." Immunol Today 21(11): 573-83.
Goldman, M., P. Druet, et al. (1991). "TH2 cells in systemic autoimmunity: insights from allogeneic diseases and chemically-induced autoimmunity." Immunol Today 12(7): 223-7.
Gomez, M. B., M. J. Torres, et al. (2004). "Immediate allergic reactions to betalactams: facts and controversies." Curr Opin Allergy Clin Immunol 4(4): 261-6.
Guest, I., B. Sokoluk, et al. (1998). "Examination of possible toxic and immune mechanisms of clozapine-induced agranulocytosis." Toxicology 131(1): 53-65.
108
Hall, J. A., J. L. Cannons, et al. (2011). "Essential role for retinoic acid in the promotion of CD4(+) T cell effector responses via retinoic acid receptor alpha." Immunity 34(3): 435-47.
Hamada, S., M. Umemura, et al. (2008). "IL-17A produced by gammadelta T cells plays a critical role in innate immunity against listeria monocytogenes infection in the liver." J Immunol 181(5): 3456-63.
Hammerich, L., F. Heymann, et al. (2010). "Role of IL-17 and Th17 cells in liver diseases." Clin Dev Immunol 2011: 345803.
Harris, H. E. and A. Raucci (2006). "Alarmin(g) news about danger: workshop on innate danger signals and HMGB1." EMBO Rep 7(8): 774-8.
Hirata, T., Y. Osuga, et al. (2010). "Recruitment of CCR6-expressing Th17 cells by CCL 20 secreted from IL-1 beta-, TNF-alpha-, and IL-17A-stimulated endometriotic stromal cells." Endocrinology 151(11): 5468-76.
Hsu, H. C., P. Yang, et al. (2008). "Interleukin 17-producing T helper cells and interleukin 17 orchestrate autoreactive germinal center development in autoimmune BXD2 mice." Nat Immunol 9(2): 166-75.
Huang, W., L. Na, et al. (2004). "Requirement of interleukin-17A for systemic anti-Candida albicans host defense in mice." J Infect Dis 190(3): 624-31.
Ivanov, II, B. S. McKenzie, et al. (2006). "The orphan nuclear receptor RORgammat directs the differentiation program of proinflammatory IL-17+ T helper cells." Cell 126(6): 1121-33.
Jaeschke, H. (2002). "Neutrophil-mediated tissue injury in alcoholic hepatitis." Alcohol 27(1): 23-7.
Jaeschke, H., C. D. Williams, et al. (2011). "Acetaminophen hepatotoxicity and repair: the role of sterile inflammation and innate immunity." Liver Int 32(1): 8-20.
Jaffe, I. A. (1981). "Induction of auto-immune syndromes by penicillamine therapy in rheumatoid arthritis and other diseases." Springer Semin Immunopathol 4(2): 193-207.
Jimenez-Sousa, M. A., R. Almansa, et al. (2010). "Increased Th1, Th17 and pro-fibrotic responses in hepatitis C-infected patients are down-regulated after 12 weeks of treatment with pegylated interferon plus ribavirin." Eur Cytokine Netw 21(2): 84-91.
Ju, C., T. P. Reilly, et al. (2002). "Protective role of Kupffer cells in acetaminophen-induced hepatic injury in mice." Chem Res Toxicol 15(12): 1504-13.
109
Kelly, M. N., J. K. Kolls, et al. (2005). "Interleukin-17/interleukin-17 receptor-mediated signaling is important for generation of an optimal polymorphonuclear response against Toxoplasma gondii infection." Infect Immun 73(1): 617-21.
Kenney, B. and G. Stack (2009). "Drug-induced thrombocytopenia." Arch Pathol Lab Med 133(2): 309-14.
Kindmark, A., A. Jawaid, et al. (2008). "Genome-wide pharmacogenetic investigation of a hepatic adverse event without clinical signs of immunopathology suggests an underlying immune pathogenesis." Pharmacogenomics J 8(3): 186-95.
Kleiner, D. E. (2009). "The pathology of drug-induced liver injury." Semin Liver Dis 29(4): 364-72.
Kobayashi, E., M. Kobayashi, et al. (2009). "Halothane-induced liver injury is mediated by interleukin-17 in mice." Toxicol Sci 111(2): 302-10.
Kokkola, R., A. Andersson, et al. (2005). "RAGE is the major receptor for the proinflammatory activity of HMGB1 in rodent macrophages." Scand J Immunol 61(1): 1-9.
Komiyama, Y., S. Nakae, et al. (2006). "IL-17 plays an important role in the development of experimental autoimmune encephalomyelitis." J Immunol 177(1): 566-73.
Korn, T., E. Bettelli, et al. (2009). "IL-17 and Th17 Cells." Annu Rev Immunol 27: 485-517.
Krakowski, M. and T. Owens (1996). "Interferon-gamma confers resistance to experimental allergic encephalomyelitis." Eur J Immunol 26(7): 1641-6.
Kumar, A., A. Bhat, et al. (1985). "D-penicillamine-induced acute hypersensitivity pneumonitis and cholestatic hepatitis in a patient with rheumatoid arthritis." Clin Exp Rheumatol 3(4): 337-9.
Lan, R. Y., T. L. Salunga, et al. (2009). "Hepatic IL-17 responses in human and murine primary biliary cirrhosis." J Autoimmun 32(1): 43-51.
Landsteiner, K. and J. Jacobs (1935). "Studies On The Sensitization Of Animals With Simple Chemical Compounds." J Exp Med 61(5): 643-56.
Langrish, C. L., Y. Chen, et al. (2005). "IL-23 drives a pathogenic T cell population that induces autoimmune inflammation." J Exp Med 201(2): 233-40.
110
Lanier, L. L., C. Chang, et al. (1994). "Human NKR-P1A. A disulfide-linked homodimer of the C-type lectin superfamily expressed by a subset of NK and T lymphocytes." J Immunol 153(6): 2417-28.
Larson, A. M., J. Polson, et al. (2005). "Acetaminophen-induced acute liver failure: results of a United States multicenter, prospective study." Hepatology 42(6): 1364-72.
Laurence, A., C. M. Tato, et al. (2007). "Interleukin-2 signaling via STAT5 constrains T helper 17 cell generation." Immunity 26(3): 371-81.
Lawrenson, R. A., H. E. Seaman, et al. (2000). "Liver damage associated with minocycline use in acne: a systematic review of the published literature and pharmacovigilance data." Drug Saf 23(4): 333-49.
Lazarou, J., B. H. Pomeranz, et al. (1998). "Incidence of adverse drug reactions in hospitalized patients: a meta-analysis of prospective studies." Jama 279(15): 1200-5.
Lemmers, A., C. Moreno, et al. (2009). "The interleukin-17 pathway is involved in human alcoholic liver disease." Hepatology 49(2): 646-57.
Li, J. and J. P. Uetrecht (2009). "D-penicillamine-induced autoimmunity: relationship to macrophage activation." Chem Res Toxicol 22(9): 1526-33.
Li, J., X. Zhu, et al. (2010). "Cytokine and autoantibody patterns in acute liver failure." J Immunotoxicol 7(3): 157-64.
Liang, S. C., X. Y. Tan, et al. (2006). "Interleukin (IL)-22 and IL-17 are coexpressed by Th17 cells and cooperatively enhance expression of antimicrobial peptides." J Exp Med 203(10): 2271-9.
Liu, Z. X. and N. Kaplowitz (2002). "Immune-mediated drug-induced liver disease." Clin Liver Dis 6(3): 755-74.
Liu, Z. X. and N. Kaplowitz (2006). "Role of innate immunity in acetaminophen-induced hepatotoxicity." Expert Opin Drug Metab Toxicol 2(4): 493-503.
Lo, C. K., Q. L. Lam, et al. (2008). "Natural killer cell degeneration exacerbates experimental arthritis in mice via enhanced interleukin-17 production." Arthritis Rheum 58(9): 2700-11.
Lock, C., G. Hermans, et al. (2002). "Gene-microarray analysis of multiple sclerosis lesions yields new targets validated in autoimmune encephalomyelitis." Nat Med 8(5): 500-8.
111
Lotze, M. T. and K. J. Tracey (2005). "High-mobility group box 1 protein (HMGB1): nuclear weapon in the immune arsenal." Nat Rev Immunol 5(4): 331-42.
Louis, H., O. Le Moine, et al. (1997). "Production and role of interleukin-10 in concanavalin A-induced hepatitis in mice." Hepatology 25(6): 1382-9.
Maddrey, W. C. and J. K. Boitnott (1973). "Isoniazid hepatitis." Ann Intern Med 79(1): 1-12.
Makin, A. J., J. Wendon, et al. (1995). "A 7-year experience of severe acetaminophen-induced hepatotoxicity (1987-1993)." Gastroenterology 109(6): 1907-16.
Mangan, P. R., L. E. Harrington, et al. (2006). "Transforming growth factor-beta induces development of the T(H)17 lineage." Nature 441(7090): 231-4.
Matzinger, P. (1994). "Tolerance, danger, and the extended family." Annu Rev Immunol 12: 991-1045.
McKenzie, B. S., R. A. Kastelein, et al. (2006). "Understanding the IL-23-IL-17 immune pathway." Trends Immunol 27(1): 17-23.
McKenzie, R., M. W. Fried, et al. (1995). "Hepatic failure and lactic acidosis due to fialuridine (FIAU), an investigational nucleoside analogue for chronic hepatitis B." N Engl J Med 333(17): 1099-105.
Metushi, I. G., P. Cai, et al. (2011). "A fresh look at the mechanism of isoniazid-induced hepatotoxicity." Clin Pharmacol Ther 89(6): 911-4.
Miller-Graziano, C. L., A. De, et al. (2008). "HSP27: an anti-inflammatory and immunomodulatory stress protein acting to dampen immune function." Novartis Found Symp 291: 196-208; discussion 208-11, 221-4.
Mitchell, J. R., D. J. Jollow, et al. (1973). "Drug metabolism as a cause of drug toxicity." Drug Metab Dispos 1(1): 418-23.
Mockenhaupt, M. (2009). "Severe drug-induced skin reactions: clinical pattern, diagnostics and therapy." J Dtsch Dermatol Ges 7(2): 142-60; quiz 161-2.
Mosmann, T. R. (1992). "T lymphocyte subsets, cytokines, and effector functions." Ann N Y Acad Sci 664: 89-92.
Mucida, D., Y. Park, et al. (2007). "Reciprocal TH17 and regulatory T cell differentiation mediated by retinoic acid." Science 317(5835): 256-60.
112
Murphy, C. A., C. L. Langrish, et al. (2003). "Divergent pro- and antiinflammatory roles for IL-23 and IL-12 in joint autoimmune inflammation." J Exp Med 198(12): 1951-7.
Murphy, K. M. and S. L. Reiner (2002). "The lineage decisions of helper T cells." Nat Rev Immunol 2(12): 933-44.
Nagata, T., L. McKinley, et al. (2008). "Requirement of IL-17RA in Con A induced hepatitis and negative regulation of IL-17 production in mouse T cells." J Immunol 181(11): 7473-9.
Nakae, S., A. Nambu, et al. (2003). "Suppression of immune induction of collagen-induced arthritis in IL-17-deficient mice." J Immunol 171(11): 6173-7.
Nakayama, S., R. Atsumi, et al. (2009). "A zone classification system for risk assessment of idiosyncratic drug toxicity using daily dose and covalent binding." Drug Metab Dispos 37(9): 1970-7.
Nelson, S. D. (1990). "Molecular mechanisms of the hepatotoxicity caused by acetaminophen." Semin Liver Dis 10(4): 267-78.
Nigen, S., S. R. Knowles, et al. (2003). "Drug eruptions: approaching the diagnosis of drug-induced skin diseases." J Drugs Dermatol 2(3): 278-99.
Nistala, K., H. Moncrieffe, et al. (2008). "Interleukin-17-producing T cells are enriched in the joints of children with arthritis, but have a reciprocal relationship to regulatory T cell numbers." Arthritis Rheum 58(3): 875-87.
Nowak, E. C. and R. J. Noelle (2010). "Interleukin-9 as a T helper type 17 cytokine." Immunology 131(2): 169-73.
Obermayer-Straub, P., C. P. Strassburg, et al. (2000). "Target proteins in human autoimmunity: cytochromes P450 and UDP- glucuronosyltransferases." Can J Gastroenterol 14(5): 429-39.
Ong, M. M., C. Latchoumycandane, et al. (2007). "Troglitazone-induced hepatic necrosis in an animal model of silent genetic mitochondrial abnormalities." Toxicol Sci 97(1): 205-13.
Ostapowicz, G., R. J. Fontana, et al. (2002). "Results of a prospective study of acute liver failure at 17 tertiary care centers in the United States." Ann Intern Med 137(12): 947-54.
Ouyang, W., J. K. Kolls, et al. (2008). "The biological functions of T helper 17 cell effector cytokines in inflammation." Immunity 28(4): 454-67.
113
Parker, C. W. and J. A. Thiel (1963). "Studies In Human Penicillin Allergy: A Comparison Of Various Penicilloyl-Polylysines." J Lab Clin Med 62: 482-91.
Pichler, W. J. (2002). "Pharmacological interaction of drugs with antigen-specific immune receptors: the p-i concept." Curr Opin Allergy Clin Immunol 2(4): 301-5.
Pirmohamed, M., S. James, et al. (2004). "Adverse drug reactions as cause of admission to hospital: prospective analysis of 18 820 patients." Bmj 329(7456): 15-9.
Racanelli, V. and B. Rehermann (2006). "The liver as an immunological organ." Hepatology 43(2 Suppl 1): S54-62.
Rong, G., Y. Zhou, et al. (2009). "Imbalance between T helper type 17 and T regulatory cells in patients with primary biliary cirrhosis: the serum cytokine profile and peripheral cell population." Clin Exp Immunol 156(2): 217-25.
Roth, R. A., J. P. Luyendyk, et al. (2003). "Inflammation and drug idiosyncrasy--is there a connection?" J Pharmacol Exp Ther 307(1): 1-8.
Rowan, A. G., J. M. Fletcher, et al. (2008). "Hepatitis C virus-specific Th17 cells are suppressed by virus-induced TGF-beta." J Immunol 181(7): 4485-94.
Sato, K., A. Suematsu, et al. (2006). "Th17 functions as an osteoclastogenic helper T cell subset that links T cell activation and bone destruction." J Exp Med 203(12): 2673-82.
Sayeh, E. and J. P. Uetrecht (2001). "Factors that modify penicillamine-induced autoimmunity in Brown Norway rats: failure of the Th1/Th2 paradigm." Toxicology 163(2-3): 195-211.
Seguin, B., M. J. Masson, et al. (2004). "D-penicillamine-induced autoimmunity in the Brown Norway rat: role for both T and non-T splenocytes in adoptive transfer of tolerance." Chem Res Toxicol 17(10): 1299-302.
Seguin, B., M. Teranishi, et al. (2003). "Modulation of D-penicillamine-induced autoimmunity in the Brown Norway rat using pharmacological agents that interfere with arachidonic acid metabolism or synthesis of inducible nitric oxide synthase." Toxicology 190(3): 267-78.
Sgro, C., F. Clinard, et al. (2002). "Incidence of drug-induced hepatic injuries: a French population-based study." Hepatology 36(2): 451-5.
Shenton, J. M., J. Chen, et al. (2004). "Animal models of idiosyncratic drug reactions." Chem Biol Interact 150(1): 53-70.
114
Sheth, K. and P. Bankey (2001). "The liver as an immune organ." Curr Opin Crit Care 7(2): 99-104.
Singh, V. K., S. Mehrotra, et al. (1999). "The paradigm of Th1 and Th2 cytokines: its relevance to autoimmunity and allergy." Immunol Res 20(2): 147-61.
Tacke, F., T. Luedde, et al. (2009). "Inflammatory pathways in liver homeostasis and liver injury." Clin Rev Allergy Immunol 36(1): 4-12.
Takahashi, T., S. Dejbakhsh-Jones, et al. (2006). "Expression of CD161 (NKR-P1A) defines subsets of human CD4 and CD8 T cells with different functional activities." J Immunol 176(1): 211-6.
Tesmer, L. A., S. K. Lundy, et al. (2008). "Th17 cells in human disease." Immunol Rev 223: 87-113.
Teunissen, M. B., C. W. Koomen, et al. (1998). "Interleukin-17 and interferon-gamma synergize in the enhancement of proinflammatory cytokine production by human keratinocytes." J Invest Dermatol 111(4): 645-9.
Tiegs, G., J. Hentschel, et al. (1992). "A T cell-dependent experimental liver injury in mice inducible by concanavalin A." J Clin Invest 90(1): 196-203.
Tournade, H., L. Pelletier, et al. (1990). "D-penicillamine-induced autoimmunity in Brown-Norway rats. Similarities with HgCl2-induced autoimmunity." J Immunol 144(8): 2985-91.
Tzartos, J. S., M. A. Friese, et al. (2008). "Interleukin-17 production in central nervous system-infiltrating T cells and glial cells is associated with active disease in multiple sclerosis." Am J Pathol 172(1): 146-55.
Uetrecht, J. (2007). "Idiosyncratic drug reactions: current understanding." Annu Rev Pharmacol Toxicol 47: 513-39.
Uetrecht, J. (2008). "Idiosyncratic drug reactions: past, present, and future." Chem Res Toxicol 21(1): 84-92.
Uetrecht, J. (2009). "Immune-mediated adverse drug reactions." Chem Res Toxicol 22(1): 24-34.
Uetrecht, J. (2009). "Immunoallergic drug-induced liver injury in humans." Semin Liver Dis 29(4): 383-92.
Uetrecht, J. P. (1999). "New concepts in immunology relevant to idiosyncratic drug reactions: the "danger hypothesis" and innate immune system." Chem Res Toxicol 12(5): 387-95.
115
Veldhoen, M., R. J. Hocking, et al. (2006). "TGFbeta in the context of an inflammatory cytokine milieu supports de novo differentiation of IL-17-producing T cells." Immunity 24(2): 179-89.
Vergani, D., G. Mieli-Vergani, et al. (1980). "Antibodies to the surface of halothane-altered rabbit hepatocytes in patients with severe halothane-associated hepatitis." N Engl J Med 303(2): 66-71.
Wakabayashi, K., Z. X. Lian, et al. (2006). "IL-2 receptor alpha(-/-) mice and the development of primary biliary cirrhosis." Hepatology 44(5): 1240-9.
Wang, C., S. G. Kang, et al. (2010). "Retinoic acid determines the precise tissue tropism of inflammatory Th17 cells in the intestine." J Immunol 184(10): 5519-26.
Watkins, P. B., N. Kaplowitz, et al. (2006). "Aminotransferase elevations in healthy adults receiving 4 grams of acetaminophen daily: a randomized controlled trial." Jama 296(1): 87-93.
Wick, M. J., F. Leithauser, et al. (2002). "The hepatic immune system." Crit Rev Immunol 22(1): 47-103.
Williams, C. D., A. Farhood, et al. (2010). "Role of caspase-1 and interleukin-1beta in acetaminophen-induced hepatic inflammation and liver injury." Toxicol Appl Pharmacol 247(3): 169-78.
Wolf, R., V. Lewerenz, et al. (2007). "Human S100A15 splice variants are differentially expressed in inflammatory skin diseases and regulated through Th1 cytokines and calcium." Exp Dermatol 16(8): 685-91.
Wu, T. Y., M. H. Jen, et al. (2010). "Ten-year trends in hospital admissions for adverse drug reactions in England 1999-2009." J R Soc Med 103(6): 239-50.
Xu, J. J., P. V. Henstock, et al. (2008). "Cellular imaging predictions of clinical drug-induced liver injury." Toxicol Sci 105(1): 97-105.
Yan, S., L. Wang, et al. (2011). "Critical role of interleukin-17/interleukin-17 receptor axis in mediating Con A-induced hepatitis." Immunol Cell Biol.
Yang, X. O., A. D. Panopoulos, et al. (2007). "STAT3 regulates cytokine-mediated generation of inflammatory helper T cells." J Biol Chem 282(13): 9358-63.
Yasumi, Y., Y. Takikawa, et al. (2007). "Interleukin-17 as a new marker of severity of acute hepatic injury." Hepatol Res 37(4): 248-54.
116
Ye, P., P. B. Garvey, et al. (2001). "Interleukin-17 and lung host defense against Klebsiella pneumoniae infection." Am J Respir Cell Mol Biol 25(3): 335-40.
Ye, P., F. H. Rodriguez, et al. (2001). "Requirement of interleukin 17 receptor signaling for lung CXC chemokine and granulocyte colony-stimulating factor expression, neutrophil recruitment, and host defense." J Exp Med 194(4): 519-27.
You, Q., L. Cheng, et al. (2006). "Role of neutrophils in a mouse model of halothane-induced liver injury." Hepatology 44(6): 1421-31.
Young, N. S. (2002). "Acquired aplastic anemia." Ann Intern Med 136(7): 534-46.
Zhou, L., Ivanov, II, et al. (2007). "IL-6 programs T(H)-17 cell differentiation by promoting sequential engagement of the IL-21 and IL-23 pathways." Nat Immunol 8(9): 967-74.
Zhu, X., J. Li, et al. (2011). "Involvement of T helper 17 cells in D-penicillamine-induced autoimmune disease in Brown Norway rats." Toxicol Sci 120(2): 331-8.
Zimmerman, H.J. Hepatotoxicity: The Adverse Effects of Drugs and Other Chemicals on the Liver 2nd edn. (Lippincott Williams & Wilkins, Philadelphia, PA, 1999).