INVESTIGATION OF ACTIVATED PHOSPHATIDYLINOSITOL 3’ KINASE SIGNALING IN STEM CELL SELF-RENEWAL AND TUMORIGENESIS

By

Ling Sunny Ling

A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy

Department of Medical Biophysics University of Toronto

© Copyright by Ling Sunny Ling (2012)

ii

Investigation of activated phosphatidylinositol 3' kinase signaling in stem cell self-renewal and tumorigenesis Doctor of Philosophy, 2012 Ling Sunny Ling Department of Medical Biophysics University of Toronto

Abstract

The phosphatidylinositol 3' kinase (PI3K) pathway is involved in many cellular processes

including cell proliferation, survival, and glucose transport, and is implicated in various disease

states such as cancer and diabetes. Though there have been numerous studies dissecting the

role of PI3K signaling in different cell types and disease models, the mechanism by which PI3K

signaling regulates embryonic stem (ES) cell fate remains unclear. It is believed that in addition

to proliferation and tumorigenicity, PI3K activity might also be important for self-renewal of ES

cells. Paling et al. (2004) reported that the inhibition of PI3K led to a reduction in the ability of

leukemia inhibitory factor (LIF) to maintain self-renewal causing cells to differentiate. Studies in

our lab have revealed that ES cells completely lacking GSK-3 remain undifferentiated compared

to wildtype ES cells. GSK-3 is negatively regulated by PI3K suggesting that PI3K may play a vital

role in maintaining pluripotency in ES cells through GSK-3.

By using a modified Flp recombinase system, we expressed activated alleles of PDK-1

and PKB to create stable, isogenic ES cell lines to further study the role of the PI3K signaling

pathway in stem cell fate determination. In vitro characterization of the transgenic cell lines

revealed a strong tendency towards maintenance of pluripotency, and this phenotype was

found to be independent of canonical Wnt signal transduction. To assess growth and

iii

differentiation capacity in vivo, the ES cell lines were grown as subcutaneous teratomas. The

constitutively active PDK-1 and PKB ES cell lines were able to form all three germ layers when

grown in this manner – in contrast to ES cells engineered to lack GSK-3. The resulting PI3K

pathway activated cells exhibited a higher growth rate which resulted in large teratomas.

In summary, PI3K signaling is sufficient to maintain self-renewal and survival of stem

cells. Since this pathway is frequently mutationally activated in cancers, its effect on

suppressing differentiation may contribute to its oncogenicity.

iv

Acknowledgements

First and foremost, I would like to thank my supervisor, Jim Woodgett, for his patience,

guidance, and continuous support. Not only is he a wealth of knowledge and a role model for

aspiring scientists, but his unwavering compassion and strong integrity is what makes him a

great person. The time spent in his lab has taught me to be an independent scientist, but

perhaps more importantly, I have learned valuable lessons on how to navigate life. I am very

appreciative of my committee members: Vuk Stambolic and Chi-chung Hui, for making my

work better with their insightful comments and helpful suggestions. They truly care about their

students and are passionate about teaching. I would also like to thank all past and current

members of the Woodgett lab, especially Eric Ho and Satish Patel for the fond memories. Their

friendship and moral support is the reason I look forward to going to the lab everyday and on

weekends. Thanks to Brad Doble for his solid guidance and advice over the years. I could not

have succeeded without his impeccable protocols and frequent troubleshooting. Thanks to Liz

Rubie for creating order and maintaining operational efficiency in the lab, to Mike Parsons for

helping me inject mice, and to Diane Di Cesare for her administrative assistance. I am grateful

for the technical support and training from the Nagy Lab, SLRI microscopy, UHN microarray,

AOMF, and the staff of CMHD. A special thanks to Malgosia Kownacka, the ES cell facility

manager, for consistently running a top-rate facility, and making it possible to do such long-

term ES cell work. Most of all, I would like to thank my family for their unconditional love and

support, and especially my husband and colleague, Dan. One of the greatest gifts I received

from my PhD was meeting you. Thank you for achieving this milestone with me, and I look

forward to starting a new chapter in our lives.

v

Dedicated to my husband, Dan, and M&M

vi

Table of contents Page

Abstract ii

Acknowledgements iv

Table of contents vi

Table of figures viii

List of abbreviations and symbols x

Chapter 1 1 Introduction 1.1 Overview of stem cells 2

History of ES cell research 2 Pluripotency and differentiation 3 Role of LIF/Jak/STAT in maintaining stem cell self-renewal 7 Essential transcription factors in pluripotency 9 Epigenetics and microRNAs in pluripotency 11 iPS cells 13 Cancer stem cells 15

1.2 Overview of PI3K signaling 16

Major signaling pathways in development and cancer 16 PI3K signaling pathway 17 Role of PI3K signaling in ES cell maintenance 24 Role of PI3K signaling in cancer 26 1.3 Other signaling pathways in stem cell regulation 27 Canonical Wnt signaling pathway 27 Ras/MAPK signaling pathway 30 TGF-β signaling pathway 32 Notch signaling pathway 32 Hedgehog signaling pathway 36

vii

1.4 GSK-3 signaling in stem cells 39 Role of GSK-3 in ES cell maintenance 39 Multiple roles of GSK-3 41 1.5 Rationale and hypothesis 44

Chapter 2 45 Activation of PDK-1 maintains mouse embryonic stem cell self-renewal in a PKB-dependent manner 2.1 Introduction 46 2.2 Results 50 2.3 Discussion 65 2.4 Materials and methods 70 Chapter 3 77 Analysis of activated PI3K signaling on teratoma formation

3.1 Introduction 78 3.2 Results 81 3.3 Discussion 90 3.4 Materials and methods 95 Chapter 4 99 Discussion and future directions

4.1 PI3K signaling crosstalk 100 4.2 Stem cell heterogeneity 105 4.3 Clinical implications 107 Bibliography 110

viii

Table of figures Page

Chapter 1 1 Introduction 1-1 Pluripotent embryonic stem cells 5

1-2 Stem cell division and differentiation 6 1-3 Jak/STAT signaling pathway 8 1-4 PI3K signaling pathway 19 1-5 Canonical Wnt signaling pathway 29 1-6 Ras/MAPK signaling pathway 31 1-7 TGF-β signaling pathway 33 1-8 Notch signaling pathway 35 1-9 Hedgehog signaling pathway 37 Chapter 2 45 Activation of PDK-1 maintains mouse embryonic stem cell self-renewal in a PKB-dependent manner 2-1 Phosphorylation of PtdIns 47

2-2 Modified Flp-In system 51 2-3 PCR screen of GSK-3β+/- host ES cell lines 52 2-4 Characterization of myr-PDK1 cell lines 53 2-5 Analysis of pluripotent markers on myr-PDK1 cells 55 2-6 Analysis of pluripotent markers on PKB-DD cells 56 2-7 Treatment of myr-PDK1 ES cells with PKB inhibitor 58 2-8 Long-term treatment of myr-PDK1 embryoid bodies with PKB inhibitor 59 2-9 Treatment of myr-PDK1 ES cells with rapamycin 60 2-10 Analysis of β-catenin expression in myr-PDK1 and PKB-DD cells 62

2-11 Examination of crosstalk between PI3K and Wnt signaling via GSK-3 63, 64 2-12 Examination of potential myr-PDK1 targets 66 2-13 Separate PI3K and Wnt signaling pathways 69

Chapter 3 77 Analysis of activated PI3K signaling on teratoma formation 3-1 Gross morphology of teratomas after 3 weeks of growth 82

3-2 Histology of teratomas after 3 weeks of growth 83

ix

3-3 myr-PDK1 and PKB-DD expression in teratomas 84 3-4 Analysis of CD31 expression in teratomas 87 3-5 Analysis of cell numbers and survival 88 3-6 In vitro endothelial differentiation assay 91 3-7 Teratoma formation in Tie2-GFP/Rag1-/- mice 92

x

List of abbreviations and symbols

4E-BP1 eukaryotic translation initiation factor 4E-binding protein 1

Akt thymoma viral oncogene homolog

AMH anti-müllerian hormone

ANK ankyrin

AP alkaline phosphatase

APC adenomatous polyposis coli

β-cat β-catenin

β-cat p.m. β-catenin phosphorylation mutant

BIO 6-bromo-indirubin-3’-oxime

BLAST basic local alignment search tool

BMP bone morphogenic protein

bp base pair(s)

BSA bovine serum albumin

CBF1 C promoter binding factor 1

CD cluster of differentiation

Cdk cyclin-dependent protein kinase

cDNA complementary deoxyribonucleic acid

CK casein kinase

COS derived from Cercopithecus aethiops

Cos2 Costal 2

CpG cytosine-phosphate-guanine

xi

CRD-BP coding region determinant-binding protein

Cre causes recombination

C-terminal carboxy-terminal

Ctrl control

D aspartic acid

Da daltons(s)

DAG diacylglycerol

DEPC diethyl pyrocarbonate

Dll delta-like

DMEM Dulbecco’s modified Eagle medium

DMSO dimethylsulfoxide

DNA deoxyribonucleic acid

DNase deoxyribonuclease

dNTP deoxy-nucleotide triphosphate

DTA diphtheria toxin gene

EB embryoid body

ECL enhanced chemiluminescence

EDTA ethylenediamine tetraacetic acid

EF-1α polypeptide chain elongation factor-1α

EGF epidermal growth factor

EGFR epidermal growth factor receptor

EGFP enhanced green fluorescent protein

xii

eIF2B eukaryotic translation initiation factor 2B

ERas embryonic stem cell-expressed Ras

ERK extracellular signal-regulated kinase

ES cell embryonic stem cell

Esrrb estrogen related receptor beta

et al. et alia (L. and others)

FBS fetal bovine serum

FCS fetal calf serum

FGF fibroblast growth factor

Flp flippase

FoxD3 forkhead box D3

FRT flippase recognition target

Fz-1 frizzled-1

G418 Geneticin®

GAPDH glyceraldehyde 3-phosphate dehydrogenase

GDF growth and differentiation factor

GDP guanosine diphosphate

GEF guanine nucleotide exchange factor

GF growth factor

GFP green fluorescent protein

Gli glioma-associated oncogene family member

gp130 glycoprotein 130

xiii

GSK-3 glycogen synthase kinase-3

Grb2 growth factor receptor binding protein 2

GTP guanosine-5'-triphosphate

H&E haematoxylin and eosin

HA hemagglutinin

HEK cell human embryonic kidney cell

HER2 human epidermal growth factor receptor 2

Hes hairy and enhancer of split

hES cell human embryonic stem cell

Hh hedgehog

HIF hypoxia-inducible factor

HM hydrophobic motif

HMG high mobility group

hygro hygromycin

ICM inner cell mass

Ig immunoglobulin

IGF insulin-like growth factor

IL-6 interleukin-6

iPS cell induced pluripotent stem cell

IRS1 insulin receptor substrate 1

Jak Janus kinase

kb kilobase(s)

xiv

kDa kiloDalton

Kif kinesin family member

Klf Krüppel-like factor

KO knockout

LAG Lin-12 and Glp-1

LB Luria-Bertani medium

LEF lymphoid enhancer-binding factor

Let-7 lethal-7

LIF leukemia inhibitory factor

LIFR leukemia inhibitory factor receptor

Lin-28 abnormal cell lineage-28

loxP locus of X-over P1

LRP lipoprotein-related protein

MAML mastermind-like

MAP3K mitogen-activated protein kinase-kinase-kinase

MAPK mitogen-activated protein kinase

MCS multiple cloning site

MEF mouse embryonic fibroblast

MEK mitogen-activated protein/extracellular signal-regulated kinase

mES cell mouse embryonic stem cell

miR micro ribonucleic acid

miRNA micro ribonucleic acid

xv

MMTV mouse mammary tumor virus

mRNA messenger ribonucleic acid

mTOR mammalian target of rapamycin

mTORC-1 mTOR complex-1

mTORC-2 mTOR complex-2

Myc myelocytomatosis oncogene

myr-PDK1 myristoylated-PDK1

neg. negative

NaCl sodium chloride

Nanog novel homeodomain protein named after the Tir nan Og legend

NCBI National Center for Biotechnology Information

NICD Notch intracellular domain

N-terminal amino-terminal

Oct-4 octamer-4

O.D. optical density

PAK-1 p21-activated kinase-1

PBS phosphate-buffered saline

PCR polymerase chain reaction

PDK1 phosphoinositide-dependent kinase 1

PDPK1 phosphoinositide-dependent protein kinase 1

PGC7 primordial germ cell 7

PGK phosphoglycerate kinase

xvi

PH pleckstrin homology

PIF PDK1-interacting fragment

PI3K phosphatidylinositol 3' kinase or phosphoinositide 3-kinase

PI3KCA catalytic subunit of PI3K

PIP phosphatidylinositol (3)-phosphate

PIP2 phosphatidylinositol (3,4)-bisphosphate

PIP3 phosphatidylinositol (3,4,5)-trisphosphate

PKB protein kinase B

PKC protein kinase C

pos. positive

PPI phosphorylated Ptdlns

PRK1/2 PKC-related kinases 1 and 2

PtdIns phosphatidylinositol

PTEN phosphatase and tensin homolog deleted on chromosome ten

Ptch patched

puro puromycin

PVDF polyvinyl difluoride

RAM RBP-Jκ-associated module

Ras rat sarcoma virus oncogene

RBP-Jκ recombination signal binding protein of the Jκ Ig gene

RCF relative centrifugal force

Rex-1 reduced expression gene-1

xvii

RFP red fluorescent protein

Rheb Ras homolog enriched in brain

RIPA radioimmunoprecipitation

RNA ribonucleic acid

RNase ribonuclease

RPC retinal progenitor cell

rpm rotations per minute

RSK p90 ribosomal protein S6 kinase

RTK receptor tyrosine kinase

RT-PCR reverse transcription-polymerase chain reaction

rtTA reverse tetracycline transcriptional activator

S6K p70 ribosomal protein S6 kinase

SCID severe combined immune deficiency

SDS sodium dodecyl sulfate

SDS-PAGE sodium dodecyl sulfate-polyacrylamide gel electrophoresis

SGK serum and glucocorticoid-inducible kinase

Ser serine

SH2 src homology 2

SHH sonic hedgehog

SLRI Samuel Lunenfeld Research Institute

SMAD Sma- and mothers against decapentaplegic-related protein

Smo smoothened

xviii

SOC salt-optimized + carbon

SOS son of sevenless

Sox-2 SRY-related HMG-box gene-2

Src rous sarcoma oncogene

SRY sex determining region Y

SSEA-1 stage-specific embryonic antigen-1

STAT signal transducer and activator of transcription

Sufu suppressor of fused

Su(H) suppressor of hairless

TBE tris borate ethylenediaminetetraacetic acid

TBST tris-buffered solution (plus Tween-20)

Tbx-3 T-box protein-3

TCF T cell factor

Tcl-1 T cell lymphoma-1

Tet tetracycline

TetO tetracycline-inducible promoter

TGF-β transforming growth factor-β

Tie-2 tyrosine kinase with immunoglobulin-like and epidermal growth

factor-like domains-2

Thr threonine

Tyr tyrosine

TM transmembrane

xix

TOPO topoisomerase I

TSC tuberous sclerosis protein

TUNEL terminal deoxynucleotidyl transferase dUTP nick end labeling

μF micro farad (coulomb per volt)

U units

UTR untranslated region

UV ultraviolet

V volt(s)

Vps34 vacuolar protein-sorting defective 34

Wnt Wg (wingless) + INT genes

WT wildtype

CHAPTER 1

Introduction

1

1.1 Overview of stem cells

History of ES cell research

Fifty years ago two Toronto scientists working at the Ontario Cancer Institute, Drs.

James E. Till, a biophysicist, and Ernest A. McCulloch, a haematologist, published findings in

Radiation Research and Nature that proved the existence of a population of cells that can self-

renew repeatedly, and in so doing laid the foundation for the field of stem cell research (Till and

McCulloch, 1961 and Becker et al., 1963). Since then, research on embryonic stem (ES) cells,

teratocarcinomas, and embryonal carcinoma cells has gone through varying phases influenced

by available technologies, scientific fads, and public interest and funding priorities (Solter,

2006). The increased interest in mammalian developmental biology and cell differentiation in

the 1970s saw a surge of interest in ES cells, teratomas (benign), and teratocarcinomas

(malignant). In the 1980s, mouse ES cells were isolated for the first time (Evans and Kaufman,

1981; Martin, 1981), and became a valuable tool to introduce targeted genetic modifications

into the germ line by homologous recombination, and generate transgenic mouse models for

the study of development and disease. This was a huge advancement in cell and molecular

biology, because it allowed scientists to isolate and study gene function. Generally speaking,

advances in human ES cell research lagged behind its mouse counterpart by roughly a decade,

and in 1998, the first human ES cell line was derived (Shamblott et al., 1998). The promise of

new and potentially more effective cell and tissue therapies on one hand and the ethical and

political dilemmas surrounding the use of human embryonic material on the other put stem cell

research in the spotlight, and became a hotly debated topic gaining interest from the general

public. Perhaps the moral issues surrounding human ES cells renewed interest in the

2

manipulation of mouse and other non-human mammalian stem cells. In 2006, a ground-

breaking study introduced induced pluripotent stem (iPS) cells—reprogrammed adult cells that

resembled pluripotent ES cells in the expression of certain stem cell markers, chromatin

methylation patterns, doubling time, embryoid body (EB) formation, teratoma formation, viable

chimera formation, and potency and differentiability (Takahashi and Yamanaka, 2006). This

remarkable study showed that somatic cells could be reprogrammed to a state closely

resembling embryonic stem cells through the introduction of only four genes (see “iPS cells”

section below). The first human iPS cells were generated within a year, and this important

breakthrough made it possible for researchers to obtain and study pluripotent stem cells

without the controversial use of human embryos.

Pluripotency and differentiation

During development, the process of determination occurs in which non-specialized

cells become committed and differentiate into specialized cell types. These non-specialized

cells can be broadly categorized into embryonic and adult or somatic stem cells, which

possess two defining properties: the ability to continuously self-renew through symmetric cell

division and the ability to asymmetrically differentiate into an array of specialized, terminally

differentiated cell types. Thus, a cell that has the ability to renew itself and differentiate into

at least one other cell type is called a stem cell. The range of different cell types that a stem

cell can potentially differentiate into is termed potency and can range from totipotent

(fertilized egg) to nullipotent (terminally differentiated cell). The zygote and blastomere

(morula) are totipotent and can develop into all cell types of the organism including the

3

embryonic membranes. Pluripotent ES cells are derived from the epiblast layer of the inner

cell mast of the blastocyst (Fig. 1-1), and are able to differentiate into cells from all three

germ layers: endoderm which gives rise to the gastrointestinal tract, mesoderm which gives

rise to blood, connective tissue, bone, and muscle, and ectoderm which gives rise to the

epidermis and nervous system; however, they cannot specialize into extraembryonic tissues.

Stem cells play major roles in development, tissue repair, and cancer. During

development, the zygote undergoes cleavage immediately following fertilization where the

zygotic cytoplasm is rapidly divided into numerous blastomeres that form a sphere called the

blastula. The rate of mitotic cell division then slows down as the embryo enters the gastrula

stage where extensive and highly coordinated cell rearrangements result in the formation of

the three germ layers which later give rise to progenitor or precursor cells. The cells then

further interact and rearrange to form organs and tissues in the process of organogenesis.

Certain cell types undergo long migrations from their places of origin to their final location

during organogenesis including gametes, blood precursor cells, lymph cells, and pigment cells

(Gilbert, 2000). As the embryo develops and ages, there is a loss of potential and a gain of

specialization in a phenomenon known as determination (Fig. 1-2).

Due to the process of determination, there are far fewer stem cells in the adult as

many of the cells have already become committed and reached the stage of terminal

differentiation. However, though they are scarce, adult stem cells do exist and play a key role

in the process of tissue regeneration and wound healing by providing a continuous supply of

4

Figure 1-1. Pluripotent embryonic stem cells can be isolated from the inner cell mast of the blastocyst and cultured in vitro. Adapted from Jones, 2006.

5

Figure 1-2. Stem cell division and differentiation. (A) A pluripotent stem cell can undergo symmetric division to form pluripotent daughter stem cells. (B) A stem cell can also undergo asymmetric division to produce a pluripotent stem cell and a more specialized progenitor cell. (C) Progenitor cells can undergo cell division. (D) Progenitor cells can produce terminally differentiated cells.

6

newly differentiated cells to their tissue compartments. These cells are more frequently

found in adult tissues which undergo a high cell turnover rate such as in the blood and

epithelium. Signaling by cytokines and growth factors can activate quiescent stem cells to

migrate to the site of injury where they proliferate and differentiate to repair the damage.

Somatic stem cells can be isolated from adult tissue, umbilical cord blood, and other non-

embryonic sources, and possess the capacity to transform into a variety of cell types with the

proper pathophysiological stimuli (Pessina and Gribaldo, 2006). For example, such plasticity

has been observed in hematopoietic stem cells which can give rise to blood (Abkowitz and

Chen, 2007), liver (Liu et al., 2006a and 2006b) and kidney (Kale et al., 2003) cells.

Role of LIF/Jak/STAT in maintaining stem cell self-renewal

The presence of pluripotent stem cells in vivo is transient, and these cells only exist in

the mouse embryo until the early post-implantation stage. In vitro, daughter cells of ES cells

can be made to self renew and remain pluripotent by symmetric division under appropriate

tissue culture conditions. Mouse ES cells are routinely grown in vitro by co-culturing with a

layer of fibroblasts that secrete leukemia inhibitory factor (LIF), and/or with the addition of

LIF supplementation to the culture medium. LIF is a member of the IL-6 family of cytokines.

Binding of LIF to its receptor, LIFR, recruits the transmembrane co-receptor, gp130 and leads

to the phosphorylation and nuclear translocation of STAT-3 (Signal transduction and

activation of transcription-3), thereby activating the canonical Jak/STAT pathway (Chamber

and Smith, 2004) (Fig. 1-3). In the absence of LIF, stem cells in culture differentiate

haphazardly into an assortment of cell types representing the three germ layers. However,

7

GF

Jak Jak Jak Jak

STAT P P

STAT P P

STAT

STAT

P P STAT

STAT P

P STAT

STAT

Figure 1-3. Jak/STAT signaling pathway. Cells can communicate with each other through the secretion of cytokines, small (8–30 kDa) soluble proteins. Upon binding of cytokines and growth factors to their cognate receptors, receptor-associated Jaks phosphorylate tyrosine residues of STATs. Phosphorylated STATs form homodimers, shuttle to the nucleus and participate in transcriptional regulation of a variety of genes.

8

although LIF is the major endogenous regulatory cytokine in ES cell cultures, activation of

STAT-3 alone is insufficient to maintain pluripotency (Sumi et al., 2004). The ability of LIF-/- ES

cells to self-renew in the presence of neutralizing gp130 antibody provided evidence that ES

cell pluripotency can be sustained via a LIFR/gp130-independent, STAT-3 independent,

signaling pathway (Dani et al., 1998). Interestingly, in pluripotent human ES cells, STAT-1, 3,

and 5 are not phosphorylated, and LIF does not support human ES cell pluripotency when

grown in the absence of a feeder layer (Noggle et al., 2005). Identifying the various factors

that sustain self-renewal and preserve multilineage differentiation is currently an active field

of stem cell research. Several signaling pathways have been shown to play important roles in

stem cell and cancer stem cell development including: phosphatidylinositol 3’ kinase (PI3K)

(Welham et al., 2007), Wnt (Sato et al., 2004), fibroblast growth factor (FGF) (Dvorak et al.,

2006), bone morphgenic protein (BMP) (Ying et al., 2003), transforming growth factor (TGF)-β

(James et al., 2005), Notch (Carlson and Conboy, 2007), and Hedgehog (Peacock et al., 2007).

Several of these pathways are described in section 1.3.

Essential transcription factors in pluripotency

To date, several intrinsic determinants have been found to be essential to ES cell

identity: Oct-4, Sox-2, and Nanog. These transcription factors regulate ES cell pluripotency

through a proposed self-sustaining gene-regulatory network (Niwa, 2007). Oct-4 is a

mammalian POU domain homeobox transcription factor associated with the establishment of

the inner cell mass (ICM). Expression of Oct-4 is maintained in the epiblast of the pre- and

post-implantation embryos, and is later restricted to the migratory primordial germ cells

9

where it persists through the formation of the genital ridges (Chambers and Smith, 2004).

Precise Oct-4 levels are required for pluripotency, since over-expression leads to

differentiation into primitive endoderm and mesoderm (Niwa et al., 2000), and loss-of-

function results in differentiation into trophoectoderm (Nichols et al., 1998). Oct-4 can

interact with Sox-2, an HMG-box transcription factor, in the nucleus to regulate pluripotency

and lineage specification. Sox-2 is expressed in oocytes, ICM, epiblast, germ cells,

multipotent cells of extraembryonic ectoderm, cells of neural lineage, brachial arches and gut

endoderm (Boyer et al., 2006). Matsui et al., (2007) observed that forced expression of Oct-4

rescues the pluripotency of Sox-2-null ES cells, which indicates that the function of Sox-2 is to

stabilize ES cells in a pluripotent state by maintaining the requisite level of Oct-4 expression.

Nanog is a homeodomain transcription factor that plays a crucial role in maintaining the

pluripotent epiblast and preventing differentiation to primitive endoderm (Pan and Thomson,

2007). It can serve as a marker of pluripotency since Nanog mRNA is not expressed in

differentiated cells. Chambers et al. (2003) showed that endogenous Nanog acts in parallel

with cytokine stimulation of STAT-3 to drive ES cell self-renewal, and constitutive expression

of Nanog is sufficient for clonal expansion of ES cells, bypassing STAT-3 and maintaining Oct-4

levels, enabling self-renewal of ES cells. However, recent studies have found that Nanog

expression fluctuates and is dynamic within populations of ES cells (Chambers et al., 2007),

and in fact, ES cell populations themselves are heterogeneous (Canham et al., 2010).

Interestingly, Chambers and colleagues (2007) found that although the cells are prone to

differentiate, mouse ES cells can self-renew indefinitely in the permanent absence of Nanog.

10

Thus, of the three master regulators comprising the core pluripotent transcriptional network,

Oct-4 is the most robust marker of pluripotency.

Epigenetics and microRNAs in pluripotency

Though general epigenetic regulatory mechanisms are outside the scope of this thesis,

it is worth noting that epigenetic factors such as post-translational histone modifications

(Jenuwein and Allis, 2001; Torres-Padilla, 2007), DNA methylation of cytosine in the context

of CpG nucleotides (Bird and Wolffe, 1999 and Wu; Sun, 2006), and microRNAs (miRNAs)

(Park et al., 2007) also play critical roles in determining stem cell fate. Indeed, genome-wide

demethylation is requisite for reprogramming of iPS cells. “Stemness” refers to cell

populations that can possess the unlimited potential to self-renew over long periods of time,

while generating all differentiated somatic cell types in vitro and in vivo. Interestingly, the

constitution of the genomic sequences generally remains unchanged during the process of

differentiation, yet a phenotypically and functionally heterogeneous organism can arise from

genetically homogeneous cells even in the context of similar environmental cues. It is the

epigenetic codes, defined as heritable code other than the genomic sequence (Gan et al.,

2007) that play important roles in determining cellular differentiation in ES cells and

governing tumor initiation in “cancer stem cells” during carcinogenesis (Yamada and

Watanabe, 2010).

DNA is highly structured through a series of packaging states. At the basic level, DNA is

organized into nucleosomes which consist of two copies each of four core histones: H2A, H2B,

11

H3, and H4 wrapped by 146 bp of DNA and linked together by variable lengths of histone H1

and linker DNA (Luger et al., 1997). This organization helps to tightly package eukaryotic

genomic DNA into chromatin in the cell nucleus. The promoter loci of active pluripotent

marker genes in ES cells, such as Oct-4 and Nanog are modified by specific acetylation of H3

and H4; this chromatin signature marks them for active gene transcription (Hattori et al.,

2004; Kimura et al., 2004). In similar fashion, histone modification mechanisms are present

in ES cells that also silence critical transcription factors for cell lineage determination, and

may rapidly exchange to prime these lineage-control genes for later activation by the

appropriate environmental signals (Azura et al., 2006; Gan et al., 2007).

miRNAs were discovered in the early 1990s, and have been shown to be key regulators

of vital cellular processes. They comprise small 21- to 23- nucleotide non-coding RNAs that

change mRNA expression by base pairing with mRNAs, mostly in the 3’ untranslated regions

(UTRs) (Tiscornia and Belmonte, 2010). Each miRNA can impact hundreds of distinct target

mammalian mRNAs (Friedman et al., 2009). Recent studies have begun to elucidate their

specific roles in regulating stemness in pluripotent cell populations by acting as on-off

switches to regulate cell fate decisions. Loss-of-function and gain-of-function studies have

shown that miR-134, miR-296, and miR-470 are up-regulated during differentiation in mouse

ES cells, which in turn down-regulates Oct-4, Sox-2, and Nanog (Tay et al., 2008). In human ES

cells, miR-145 represses Oct-4, Sox-2, and Krüppel-like factor-4 (Klf-4) (Xu et al., 2009). The

fact that DGCR8- and Dicer-null ES cells that lack miRNAs remain trapped in a state of

12

constant symmetric cell division and cannot be induced to differentiate highlights the crucial

role miRNAs play in controlling stemness (Tiscornia and Belmonte, 2010).

iPS cells

During the course of this thesis work, our understanding of stem cell development and

pluripotency has increased significantly due in part to the discovery of induced pluripotent

stem (iPS) cells, and sparked a newfound public interest and hope of using stem cell

approaches in potential regenerative therapies. The iPS cell era was spearheaded by

Takahashi and Yamanaka’s (2006) study that showed that Nanog was actually dispensable for

inducing pluripotency in somatic cells. They concluded that only four factors: Oct-4, Sox-2, c-

Myc, and Klf-4 are necessary to reprogram and confer pluripotency to mouse fibroblasts. A

second quartet of factors: Oct-4, Sox-2, Nanog, and Lin-28 were also used to reprogram

human fibroblasts to iPS cells (Yu et al., 2007). The ability to reprogram lineage-restricted

cells to a pluripotent state through overexpression of defined transcription factors resulting

in iPS cells that have normal karyotypes, that are transcriptionally and epigenetically similar

to natural ES cells, and that maintain the developmental potential to differentiate into all

three germ layers is considered a phenomenal breakthrough in regenerative medicine

(Amabile and Meissner, 2009).

Oct-4, Sox-2, and Nanog were discussed previously as essential transcription factors in

the stemness regulatory circuitry. Lin-28 is expressed during early embryogenesis, and acts as

a translational enhancer by increasing the stability of specific mRNAs, and aids in establishing

13

the identity of the tissue in which it is expressed (Polesskaya et al., 2007). In addition, it may

play a role in controlling miRNA-mediated differentiation in stem cells by selectively blocking

let7 miRNA processing (Viswanathan et al., 2008). Klf-4 is a transcription factor that can act

as both an oncogene (Yu et al., 2011) and a tumor suppressor (Zhao et al., 2004). Over-

expression of Klf-4 in ES cells inhibits differentiation of mouse erythroid progenitors (Li et al.,

2005). Within the context of reprogramming, Klf-4 can be replaced with Klf-2 and Klf-5

(Nakagawa et al., 2008) or with unrelated factors, Lin-28 and Nanog (Yu et al., 2007).

c-Myc is a pleiotropic transcription factor that was first identified as a retrovirally

transduced oncogene that is highly expressed in rapidly proliferating cells, and functions in

cell-cycle regulation, growth, differentiation, and metabolism (Schmidt, 1999 and Murphy et

al., 2008). The specific role that c-Myc plays in the establishment and maintenance of

pluripotency remains unclear. c-Myc can be replaced by other Myc family members, such as

n-Myc and l-Myc in somatic cell reprogramming, and it is dispensable in the generation of

both mouse and human iPS cells, but the reprogramming efficiency drastically decreases

without it (Nakagawa et al., 2008; Wernig et al., 2008; Huangfu et al., 2008; Kim et al., 2008),

which indicates that though Myc may not be essential, it nonetheless provides an important

functions in stem cell reprogramming. One of Myc’s main roles is to repress the activity of

differentiation-inducing genes, such as the endoderm master regulator, GATA-6 (Smith et al.,

2011). Evidence suggests that c-Myc plays a critical role in the modulation of stem cell

behavior through its ability to directly regulate a large numbers of target genes through

chromatin remodeling and indirect regulation of miRNAs (Smith and Dalton, 2010).

14

Cancer stem cells

Perhaps the first demonstration of a cancer promoting cell was in 1964, when

Kleinsmith and Pierce showed the multipotentiality of single embryonal carcinoma cells. A

defining characteristic of all cancers is the capacity for unlimited self-renewal/proliferation,

which is also a hallmark of normal stem cells (Passegué et al., 2003). Research on stem cell

biology in the past two decades has yielded results that support the cancer stem cell

hypothesis, which postulates that tumors arise from cells with stem cell properties or directly

from tissue-specific adult stem cells (Tan et al., 2006). These biologically unusual cell

populations are termed cancer stem cells, which were first discovered mainly through studies in

leukemia (Lapidot et al., 1994) and hematopoiesis (Spangrude et al., 1988; Bonnet and Dick,

1997), and more recently have also been identified in solid tumors in the breast (Al-Hajj et al.,

2003) and brain (Uchida et al., 2000; Hematti et al., 2003; Singh et al., 2003 and 2004; Singh

and Dirks, 2007). Interestingly, studies by Shackleton et al. (2006) showed that a single

mammary stem cell was able to reconstitute the entire mammary gland in vivo. The

transplanted cell contributed to both the luminal and myoepithelial lineages and generated

functional lobuloalveolar units during pregnancy. A cancer stem cell shares similar

characteristics with an adult stem cell in that they both have the ability to self-renew and

produce progenitors that are multipotent. However, what distinguishes a cancerous tissue

from a normal one is the loss of proliferative control, whereas homeostatic balance is normally

present at the stem cell level. If neoplastic clones are indeed maintained exclusively by a rare

fraction of cells with stem cell properties, this would have implications for therapies to

specifically target these cancer stem cells in order to be effective. It should be noted that

15

though cancer stem cells have been well characterized in hematologic cancers, the general

applicability of the cancer stem cell model and even the very existence of cancer stem cells in

other organ systems, especially in solid tumors, remains controversial. It is unclear whether

cancer stem cells can actually give rise to multiple differentiated cell types. There is also debate

on the cell of origin of cancer stem cells – whether they originate from bona fide stem cells that

have lost the ability to regulate proliferation, or from more differentiated population of cells

that have acquired abilities to self-renew due to signals in the tumor microenvironment that

influence plasticity, allowing for the interconversion between the cancer stem cell and non-

cancer stem cell compartments (reviewed in Gupta et al., 2009).

1.2 Overview of PI3K signaling

Major signaling pathways in development and cancer

Due to the unique property of ES cells to be able to differentiate into cell lineages from

the three germ layers, ES cells are a useful tool to study early embryonic development in vitro.

Indeed, embryoid body differentiation closely resembles early embryogenesis and cell

specification. The human body consists of approximately 210 different somatic cell types, the

majority of which have limited proliferative capacity. However, both stem cells and cancer cells

can bypass this replicative barrier and undergo symmetric division indefinitely when cultured

under defined conditions (Dreesen and Brivanlou, 2007). Several signaling pathways have been

shown to play important roles in regulating stem cell development, and interestingly, the over-

expression of key molecules of these pathways are linked to cancerous phenotypes. The crucial

role of the LIF/Jak/STAT pathway in maintaining stem cell self-renewal was previously

16

discussed. Additionally, the pathway plays a role in tumorigenesis; for example, increased

STAT-3 is observed in 50% of lung and 95% of head and neck cancers (Darnell, 2005). Likewise,

the PI3K/PKB pathway plays an important role in both stem cell maintenance and tumor

development. The pathway is frequently mutated in human cancers; with mutational

activation of the catalytic subunit of PI3K occurring in 80% of carcinomas of the breast,

prostate, colon and endometrium (Zhao and Vogt, 2008). Loss of the PI3K antagonist, PTEN, is

frequently seen in glioblastomas, melanoma, and lung carcinoma (reviewed in Vivanco and

Sawyers 2002). The focus of this thesis is on the PI3K signal transduction pathway, and in the

following sections, the PI3K pathway will be discussed in more detail with particular emphasis

on its role in stem cell maintenance and cancer. To acknowledge that other signaling pathways

also play important roles in regulating stem cell development and cancer, some of the key

components of the canonical Wnt, Ras/MAPK, TGF-β, Notch, and Hedgehog signaling pathways

will also be briefly overviewed.

PI3K signaling pathway

Mammalian cells have relatively high amounts of phosphatidylinositol (Ptdlns) and low

amounts of phosphorylated Ptdlns derivatives (PPI) within their plasma membranes.

Phosphoinositide kinases synthesize PPI by adding phosphate groups to inositol

glycerophospho-lipids. The individual phosphoinositide 3-kinase (PI3K) subfamilies

phosphorylate different phosphoinositides, and the most well studied is the class PI3K-1A,

which is activated by insulin and growth factor receptor-mediated stimulation to phosphorylate

phosphatidyloinositol-4,5-bisphosphate (PIP2) at the D3 position of the inositol ring to generate

17

phosphatidylionositol-3,4-5-trisphosphate (PIP3). Activated receptor tyrosine kinases (RTKs)

activate class 1 PI3K through either direct binding or through phosphorylation of the tyrosine

residue of scaffolding proteins such as Insulin Receptor Substrate 1 (IRS1), which then bind and

activate PI3K to generate PIP3 (Manning and Cantley, 2007). PIP3 is an important bona fide lipid

second messenger that transmits signals from receptor tyrosine kinases, and targets and

recruits substrates to the plasma membrane through a highly selective pleckstrin homology

(PH) domain, resulting in the initiation of downstream protein kinase signaling cascades (Fig. 1-

4). The PH domain was first identified as a 100-120 amino acid sequence that occurs twice in

the platelet protein pleckstrin, and binds with high affinity and high specificity to

phosphoinositide (Haslam et al., 1993 and Mayer et al., 1993). Interestingly, only 15 or

approximately 10% of PH domains bind with high affinity to the head group of

phosphoinositides, whereas the others have been shown to bind phosphoinositides and inositol

phosphates weakly and without specificity (Lemmon and Ferguson, 2000).

The serine/threonine kinase 3’-phosphoinositide-dependent protein kinase 1 (known as

PDK1 in the literature but officially as PDPK1 according to the National Center for Biotechnology

Information (NCBI)) and protein kinase B (PKB), also known as Akt, bind to PIP3 at the plasma

membrane via their cognate PH domains. PDK1 is a single copy gene (Manning et al., 2002) and

a member of the AGC family of protein kinases first reported by Cohen and colleagues (1997) as

a critical mediator of PKB activation loop (T-loop) phosphorylation and activation. Termed a

“master kinase” (Mora et al., 2004), PDK1 activates a number of downstream kinases including:

protein kinase B (PKB/Akt), serum- and glucocorticoidinducible kinase (SGK), p70 ribosomal

18

GF

PI3K

PIP2 PIP3

IRS1

PTEN

RTK

PDK1 PKB/Akt GSK-3

SGK3

P P

S6K

S6

mTOR Raptor

Rheb TSC2 TSC1

mTOR Rictor

4E-BP1

Figure 1-4. PI3K signaling pathway. Activated RTKs activate class I PI3K through direct binding or through tyrosine phosphorylation of scaffolding adaptors, such as IRS1, which then bind and activate PI3K. PI3K phosphorylates PIP2 to generate PIP3 in a reaction that can be reversed by PTEN. PDK1 and PKB bind to PIP3 at the plasma membrane, and signal to multiple downstream targets such as SGK3 and S6K and GSK-3, respectively. RTK signaling also activates mTORC-2 which phosphorylates PKB. PKB activates mTORC-1 through phosphorylation of TSC2 within the TSC1-TSC2 complex, which blocks the ability of TSC2 to act as a GTP-ase-activating protein for Rheb. Accumulated Rheb-GTP activates mTORC-1 which phosphorylates downstream targets such as 4E-BP1.

mTORC-1

mTORC-2

GDP GTP

19

protein S6 kinase (S6K), p90 ribosomal protein S6 kinase (RSK), p21-activated kinase-1 (PAK-1),

PKC-related kinases-1 and 2 (PRK1/2), and diacylglycerol (DAG)-dependent PKCs, resulting in

increased glucose uptake, protein synthesis, and inhibition of pro-apoptotic proteins (Kikani et

al., 2005). PDK1 is a 556 amino acid protein kinase that consists of an N-terminal kinase

domain (residues 70-359) and a C-terminal PH domain (residues 459-550) that binds PIP2 and

PIP3 and which targets PDK1 to the plasma membrane. PDK1 also contains a small phosphate

binding groove in its catalytic domain called the PDK1-interacting fragment (PIF)-pocket, which

is not necessary for PKB activation, but is required to activate its other substrates, such as S6K

and SGK (Bayascas, 2008). PDK1 knockout mice are embryonic lethal and die at E9.5 due to lack

of somites, forebrain, and neural crest derived tissues, whereas PDK1 hypomorphs are viable

but 40-50% smaller due to decreased cell volume (Lawlor et al., 2002). Recently, it was

reported that a basal population of PDK1 homodimers exists in cells that is increased in

response to PI3K signaling, and that the formation of homodimers is strictly dependent on the

PH domain of PDK1 (Masters et al., 2010). Monomeric PDK1 is the active form, and the authors

suggest that the enhanced homodimerization of PDK1 translocating to the plasma membrane

may act as a negative feedback loop after stimulation to inactivate PDK1-mediated PI3K

signaling, since PDK1 homodimers force an autoinhibitory conformation.

PKB signaling has become increasingly complex and important in development and

disease since it was first identified as a weak oncogene two decades ago (Bellacosa et al., 1991).

PKB phosphorylates many downstream substrates that play essential roles in the regulation of

survival, glucose uptake, metabolism, growth, proliferation and angiogenesis. Like PDK1, PKB is

20

also a member of the AGC family of protein kinases. There are three mammalian PKB isoforms

(PKBα/Akt1, PKBβ/Akt2, and PKBγ/Akt3), which have extensive amino acid sequence identity

and contain three functional domains: an N-terminal PH domain, a kinase domain and a C-

terminal hydrophobic motif (HM) (Scheid and Woodgett, 2003). PKB has two activating

phosphorylation sites, Thr308 and Ser473. PDK1 is responsible for PIP3-dependent

phosphorylation of PKB; binding to PIP3 alone does not activate PKB, but it does recruit PKB to

the plasma membrane and induces a conformational change which allows for it to be

phosphorylated and activated by PDK1 at Thr308. Additional phosphorylation at Ser473 in the

HM is required for full activation, and it is somewhat controversial as to exactly how Ser473

phosphorylation is mediated in vivo (Woodgett, 2005); scientists have termed the hypothetical

protein kinase that phosphorylates Ser473 as PDK2.

Mammalian target for rapamycin (mTOR) is a component of the mTOR complex-1

(mTORC-1) and mTOR complex-2 (mTORC-2). mTOR activity depends on intracellular nutrients

and extracellular growth factors. The major effect of mTOR cellular activity is to regulate the

initiation step of mRNA translation in protein synthesis (Gingras et al., 2001). mTOR

phosphorylates p70S6K and creates a docking site for PDK1, which then phosphorylates Thr229

resulting in its activation. Then p70S6K phosphorylates a component of the 40S ribosome, S6,

which has been suggested to increase translation (Tominaga et al., 2005). PKB activates

mTORC-1 by phosphorylating tuberous sclerosis protein 2 (TSC2) in the TSC1-TSC2 complex. As

a result, Rheb-GTP accumulates because the function of TSC2 to act as a GTPase-activating

protein for Rheb is blocked. The accumulated Rheb-GTP activates mTORC-1, which

21

phosphorylates downstream effectors 4E-BP1 and the S6 kinases (Manning and Cantley, 2007).

The mTOR-rictor (rapamycin insensitive companion to mTOR) complex (mTORC-2) appears to

possess the activity of the elusive PDK2 under most circumstances; mTORC-2 phosphorylates

PKB at Ser473, which then stimulates PKB phosphorylation at Thr308 by PDK1 leading to full

activation of PKB (Sarbassov et al., 2005).

SGKs comprise a further serine/threonine protein kinase family with three members

that act downstream of PDK1 in the PI3K signaling pathway. The SGKs are structurally related

to the family of PKBs except they lack a PH domain at the amino-terminus. SGK3 contains a PX

domain which preferentially binds to PI(3)P and targets the proteins to endosomes (Tessier and

Woodgett, 2006a). SGK3 can be phosphorylated at two regulatory sites: Thr320 (activation

loop) and Ser486 (hydrophobic motif). Interestingly, in contrast to PKB, phosphorylation of

SGK3 by PDK1 is inhibited at the plasma membrane. Instead, targeting SGK3 to endosomes via

the PX domain is required for activation of the protein. However, once the hydrophobic motif

of SGK3 is phosphorylated, the PX domain is no longer required for activation. Thus, a

constitutively active form of SGK3 can be generated by replacing the hydrophobic motif of SGK3

with the phosphomimetic hydrophobic motif of PRK2 (Tessier & Woodgett, 2006b).

Glycogen synthase kinase-3 (GSK-3) was the first discovered direct target of PKB (Cross

et al., 1995). There are two isoforms encoded by separate genes, GSK-3α and GSK-3β, which

are highly conserved, ubiquitously expressed, and activated in resting, unstimulated cells. GSK-

3 is a promiscuous kinase with many substrates, and a tendency to phosphorylate and

22

inactivate its downstream substrate proteins (Woodgett, 2005). Upon PKB activation, PKB

inhibits GSK-3 by phosphorylating Ser21 in GSK-3α and Ser9 in GSK-3β, inducing the

dephosphorylation and resulting activation of certain substrates of GSK-3 (Doble and

Woodgett, 2003), including glycogen synthase and eIF2B, two well characterized substrates of

GSK-3 that regulate the rates of glycogen metabolism and protein synthesis, respectively (Patel

et al., 2004).

Phosphatase and tensin homolog deleted on chromosome ten (PTEN) is a

phosphatidylinositol 3’ phosphatase that negatively regulates the PI3K pathway and PKB

activation by specifically catalyzing the dephosphorylation of the 3’ phosphate of the inositol

ring in PIP3, resulting in the bisphosphate product PIP2 (Stambolic et al., 1998). The PTEN gene

was first identified in 1997 as a tumor suppressor that is mutated in a large number of cancers

at high frequency (Li et al., 1997). In that study, mutations of PTEN were detected in 17% of

primary glioblastomas, 31% of glioblastoma cell lines and xenografts, 100% of prostate cancer

cell lines, and 6% of breast cancer cell lines and xenografts (Li et al., 1997). It contains a tensin-

like domain and a catalytic domain, and possesses dual protein and phospholipid phosphatase

activity. Its tumor suppressor activity is dependent on its lipid phosphatase activity, and

requires both the phosphatase (catalytic) domain and the C2 (lipid membrane-binding) domain.

Targeted disruption of PTEN exons 3-5 in mice results in PTEN null embryos that die by E9.5

with abnormal patterning and extensive overgrowth of the cephalic and caudal regions

(Stambolic et al., 1998 and Suzuki et al., 1998). The early embryonic lethality precluded the

functional analysis of PTEN in adult tissues and organs. However, several groups generated

23

viable tissue-specific PTEN knockout mice using the Cre-loxP system (Knobbe et al., 2008).

Conditional PTEN-deficient mice develop teratomas, cholangiocellular carcinomas,

leiomyosarcomas, prostate, pancreas, breast, and thyroid cancers (Suzuki et al., 2008). Non-

cancerous phenotypes include increased cell proliferation, resistance to apoptosis, stem cell

renewal, centromeric instability, DNA double-strand breaks, increased angiogenesis and

autoiummune disease (Suzuki et al., 2008).

Role of PI3K signaling in ES cell maintenance

Evidence that PI3K signaling is necessary for the maintenance of mouse ES cell self-

renewal was obtained by using LY294002, an inhibitor of PI3K signaling (Paling et al. 2004) and

forced expression of a dominant-negative mutant which both reduced the ability of mouse ES

cells to maintain an undifferentiated state (Welham et al., 2011). Overexpression of Nanog

alone was shown to be sufficient to maintain ES cell self-renewal without LIF (Chambers et al.,

2003), and gene expression profiling performed by Welham’s group on mouse ES cells treated

with LY294002 resulted in the down-regulation of Nanog and other known regulators of ES cell

pluripotency (Storm et al., 2009). Interestingly, during retinoic acid (RA)-induced differentiation

of F9 embryonic carcinoma cells, LY294002 decreased Nanog expression in the early stages, but

had no effect in the late stages despite inhibiting PKB phosphorylation, suggesting that Nanog

expression seems to be differentially regulated by the PI3K/PKB pathway depending on

differentiation state (Kim et al., 2010).

24

Prior to the work by Welham’s group, the PI3K signaling pathway was implicated in ES

cell development when PTEN-/- mouse ES cells displayed increased cell cycle progression and

cell survival due to accelerated G1/S transition accompanied by down-regulation of p27KIP1, a

major inhibitor for G1 cyclin-dependent kinases and PKB activation leading to increased Bad

phosphorylation in PTEN-null cells, respectively (Sun et al., 1999). A role for PI3K in controlling

ES cell proliferation was further supported by Takahashi et al. (2003), who showed that

overexpression of an active membrane-bound form of PI3K p110α was able to rescue the

proliferative defects of mouse ES cells lacking ERas (embryonic stem cell-expressed Ras), which

is localized to the plasma membrane via a CAAX motif, and promotes the formation and

proliferation of teratomas by mouse ES cells (Takahashi et al., 2005). Moreover, treatment with

LY294002 markedly increased the G0/G1 phase in ES cells demonstrating the role of PI3K

signaling in cell-cycle control of ES cells (Jirmanova et al., 2002).

Though PDK1-/- ES cells grow normally, IGF1 cannot activate PKBα, S6K, and SGK1

without PDK1 (Williams et al., 2002 and Collins et al., 2003). PTEN-/- cells exhibit accelerated

growth, but the fact that PTEN and PKBα double knockout cells ES cells grow much more slowly

than wildtype ES cells indicates that PKB functions as a downstream effector of PI3K in ES cell

survival and cell proliferation (Stiles et al., 2002; Takahashi et al., 2005). Watanabe et al. (2006)

provided strong evidence that PI3K/PKB signaling regulates stemness by demonstrating that the

activation of PKB signaling is sufficient to maintain pluripotency in mouse and monkey ES cells.

myr-PKB cell lines maintained the stem cell markers: Nanog, Oct-3/4, PGC7/Stella, and Rex-1

eight days after LIF withdrawal, further implicating a crucial role for PI3K/PKB in stem cell

25

pluripotency in addition to its more well established role in regulating cell proliferation and

tumorigenicity (Watanabe et al., 2006).

Role of PI3K signaling in cancer

PTEN is one of the most commonly lost tumor suppressors in human cancers. Frequent

genetic inactivation of PTEN occurs in glioblastoma, melanoma, endometrial, bladder, kidney,

colon and prostate cancer; and reduced expression is found in many other tumor types such as

leukemia, thyroid, lung, liver and breast cancer (Hollander et al., 2011). There is a 50%

mortality rate in PTEN heterozygous mice in the first year and these animals develop mammary,

thyroid, endometrial, and prostate cancers, as well as T-cell lymphomas—a spectrum that

closely resembles the neoplasias in humans with PTEN mutations (Suzuki et al., 2008).

Inactivation of PTEN results in unrestrained signaling of the PI3K/PKB signaling cascade, which

plays a critical role in cancer by giving tumor cells a survival and growth advantage. Indeed, it

was the discovery of PTEN as a tumor suppressor that directly linked PI3K to human cancer and

since then, mutations activating the PI3K signaling pathway were found to be one of the most

frequently occurring in some of the most common human tumors (reviewed in Liu et al., 2009).

Oncogenic mutations in the catalytic subunit of PI3K (PI3KCA) have been found in

various types of solid tumors (Samuels and Velculescu, 2004), frequently occurring in the helical

domain (E545K and E542K), in exon 9 and the kinase domain (H1047R) in exon 20 (Wong et al.,

2010). These somatic missense mutations have been reported to increase PIP3 levels, activate

PKB signaling, and promote cellular transformation in vitro and in vivo (Isakoff et al., 2005;

26

Samuels et al., 2005; Bader et al., 2006). Generally, mutations in PDK1 are rarely detected in

human cancer (Hunter et al., 2006), but 20% of breast cancers show amplification or

overexpression of PDK1 (Brugge et al., 2007).

The PKB/Akt isoforms play critical roles in tumorigenesis including tumor initiation,

progression, and metastasis (Stambolic and Woodgett, 2006). Amplification of PKBα and PKBβ

has been identified in a variety of cancers including breast, colon, ovarian, lung, gastric,

pancreas, and head and neck (Liu et al., 2009). In 2007, Carpten and colleagues reported a rare

transforming mutation in the PH domain of PKBα (E17K) detected in melanoma, breast,

colorectal, and ovarian cancers, which increased PKB phosphorylation via growth factor-

independent constitutive association with the plasma membrane (Yuan and Cantley, 2008).

Interestingly, a year later, the equivalent mutation was also found in PKBγ in human melanoma

tumors and melanoma cell lines (Davies et al., 2008). The ubiquitous nature of PI3K pathway

activation in cancer suggests that components of the signaling cascade may be promising

targets for cancer therapy; in fact, several PI3K, PKB, and mTOR inhibitors have undergone

clinical trials, and at least three mTOR inhibitors: Rapamune, Temsirolimus, and Everolimus

have been approved (Liu et al., 2009).

1.3 Other signaling pathways in stem cell regulation

Canonical Wnt signaling pathway

The Wnt pathway is highly conserved throughout evolution in multicellular organisms

and is mutationally activated in 90% of colon cancers through loss of adenomatous polyposis

27

coli (APC) or mutation of negatively acting phosphorylation sites in β-catenin (Saunders and

Wallace, 2007). Likewise, activating mutations in β-catenin are also found in 48% of small

intestinal adenocarcinomas and 64% of gastric polyps (Giles et al., 2003). The Wnt signaling

pathway is classified as canonical, which signals through β-catenin, and non-canonical, which

does not require β-catenin (Davis and Zur Nieden, 2008). Canonical signaling by the Wnt family

of secreted glycolipoproteins to stabilize β-catenin, a transcriptional activator, plays a central

role in embryonic development and adult diseases such as cancer (Huang and He, 2008). Wnts

1, 3a, and 8 bind to two receptors: Frizzled-1 (Fz-1), a 7 transmembrane (7TM) receptor, and

low-density lipoprotein-related protein (LRP)5 or 6. The binding of Wnt promotes

phosphorylation of residues in the cytoplasmic portion of the LRP6 receptor by Casein Kinase-1

(CK-1) and GSK-3, allowing it to act as a high affinity docking site for Axin, a scaffolding protein

which is normally associated with APC, Casein Kinase-1 (CK-1), and GSK-3 as a part of the β-

catenin destruction complex. As a result of Wnt-induced Axin reorganization, the destruction

complex is destabilized, and newly synthesized β-catenin escapes phosphorylation and

degradation: hence its cytosolic concentration gradually increases. The free β-catenin enters

the cell nucleus to activate the T cell factor/lymphoid enhancer-binding factor (TCF/LEF) family

of transcription factors and triggers expression of genes including axin-2 which acts to switch

off the pathway (reviewed in Huang and He, 2008; Wu et al., 2009; MacDonald et al., 2009)

(Fig. 1-5).

28

Axin-1

CK-1

APC

β-catenin P P P

β-catenin

Frizzled LRP

Dishevelled

GSK-3

P

P P P P

P P P P

Figure 1-5. Canonical Wnt signaling pathway. (a) Upon Wnt stimulation, Dishevelled is engaged, the destruction complex is disrupted, and CK-1 and GSK-3 activities are diverted to LRP at the cell membrane. Unphosphorylated β-catenin may accumulate and enter the nucleus to regulate gene expression upon binding to TCF/LEF DNA-binding proteins. (b) In the absence of Wnt signalling, the destruction complex comprised of APC, Axin-1, CK-1, and GSK-3 promotes the phosphorylation and subsequent ubiquitin-mediated degradation of β-catenin.

APC

Axin-1

Dishevelled

Wnt

β-catenin

β-catenin

β-catenin β-catenin

β-catenin

GSK-3

CK-1 P P

LRP Frizzled

TCF/LEF β-catenin

A B

29

Ras/MAPK signaling pathway

In the mitogen-activated protein kinase/extracellular signal-regulated kinase

(MAPK/ERK) signaling pathway (Fig. 1-6), activating mutations of K-Ras are seen in 45% of colon

and 90% of pancreatic cancers, and Raf mutations have been observed in approximately 66% of

melanomas (Sebolt-Leopold et al., 2004). The Ras/MAPK pathway is activated by growth factor

receptor tyrosine kinases (RTKs). Upon growth factor stimulation, the adaptor protein, Growth

factor receptor binding protein 2 (Grb2), binds to specific phospho-tyrosine residues on

activated receptors via its SH2 domain. Grb2 also binds to the guanine nucleotide exchange

factor (GEF) Son of sevenless (SOS) through its two SH3 domains. This recruits the Grb2/SOS

complex to the plasma membrane where it docks to the phosphorylated receptor and activates

SOS, which then catalyzes the removal of guanosine disphosphate (GDP) from the Ras subfamily

of small GTPases. Ras then rapidly binds guanosine triphosphate (GTP) and adopts an active

conformation. Activated Ras recruits the serine/threonine kinase c-Raf (also known as MAP-

kinase-kinase-kinase/MAP3K) to the membrane leading to Raf kinase activation and resulting in

phosphorylation and activation of Mitogen-activated protein/Extracellular signal-regulated

Kinase (MEK) on two serine residues in its activation segment (T-Loop). Activated MEK, in turn

phosphorylates ERK on a tyrosine and threonine residue within its T-Loop, so that it can

subsequently activate its nuclear and non-nuclear substrates (decribed in Gomperts et al.,

2009; Cakir and Grossman, 2009).

30

GF

RTK

Ras

Grb2 SOS

RasGTP

Raf

MEK P P

ERK P P

Figure 1-6. Ras/MAPK signaling pathway. Upon growth factor stimulation, the adaptor protein, Grb2, binds to specific phospho-tyrosine residues on activated receptors via its SH2 domain. Grb2 also binds to SOS and activates it at the plasma membrane, which then catalyzes the removal of GDP. Ras then rapidly binds GTP and adopts an active conformation. Activated Ras recruits Raf to the membrane leading to Raf kinase activation and resulting in phosphorylation and activation of MEK. Activated MEK, in turn phosphorylates ERK, so that it can subsequently activate its nuclear and non-nuclear substrates.

31

TGF-β signaling pathway

The TGF-β superfamily of ligands include: Bone morphogenetic proteins (BMPs), Growth

and differentiation factors (GDFs), Anti-müllerian hormone (AMH), Activin, Nodal and TGF-βs.

TGF-β signaling normally suppresses cell proliferation, and is inactivated through loss of the

effector protein, SMAD4, in over half of pancreatic carcinomas (Bardeesy et al., 2006). The

pathway is activated when a TGF-β superfamily ligand binds to a serine/threonine TGF-β type II

receptor dimer, which recruits and phosphorylates a type I receptor dimer forming a hetero-

tetrameric complex with the ligand (Wrana et al., 1992; Attisano et al., 1993). The type I

receptor goes on to phosphorylate receptor-regulated SMADs (R-SMADs). Each class of ligand

binds to a specific type II receptor and involves specific R-SMADs. BMPs, AMH and some GDFs

are mediated by SMAD1, SMAD5 and SMAD9, whereas TGF-β, Activins, Nodals and some GDFs

are mediated by SMAD2 and SMAD3. Phosphorylated R-SMADs have a high affinity for the

effector protein, coSMAD (SMAD4), and consequently forms a complex with coSMAD. R-

SMAD/coSMAD complexes accumulate and enter the nucleus where they activate transcription

(Attisano and Wrana, 1996) (Fig.1-7).

Notch signaling pathway

Notch signaling has been implicated in the regulation of adult stem cell self-renewal and

lineage determination, such as mesenchymal stem cell differentiation into osteoblasts (Lin and

Hankenson, 2011). Furthermore, its role in the control of stem cell survival and proliferation

has been demonstrated for several cell types including haematopoietic, neural and mammary

stem cells (Dontu et al., 2004). Mutations that truncate the extracellular domain of Notch

32

Figure 1-7. TGF-β signaling pathway. The pathway is activated when a TGF-β superfamily ligand binds to a TGF-β type II receptor dimer, which recruits and phosphorylates a type I receptor dimer forming a hetero-tetrameric complex with the ligand. The type I receptor goes on to phosphorylate R-SMADs. Phosphorylated R-SMADs have a high affinity for the effector protein, coSMAD, and consequently forms a complex with coSMAD. R-SMAD/coSMAD complexes accumulate and enter the nucleus where they activate transcription.

R-SMAD P P

R-SMAD P P

coSMAD

R-SMAD P P

coSMAD

coSMAD

R-SMAD

TGF-β

33

receptors can cause aberrant signaling and promote unregulated cell growth. Aberrant Notch

activation is present in over 50% of T-cell acute lymphoblastic leukemias (Weng et al., 2004).

The Notch signaling cascade consists of four Notch receptors (Notch1, Notch2, Notch3, Notch4)

and five ligands from the Jagged (Jagged-1 and Jagged-2) and Delta (Delta-like-1, Delta-like-3

and Delta-like-4) families. Notch proteins are single-pass transmembrane receptors with an

extracellular domain composed of multiple epidermal growth factor (EGF)-like repeats with

embedded ligand binding sites. Notch signaling generally involves binding between ligands and

receptors associated with adjacent cells. When Notch interacts with membrane-bound ligands

Delta or Jagged on the surface of neighboring cells, the Notch intracellular domain (NICD) is

proteolytically cleaved from the membrane by γ-secretase after several processing events, and

translocates to the nucleus to convert the transcription factor CSL (latency C promoter binding

factor 1 (CBF1) in humans, Suppressor of Hairless (Su(H)) in Drosophila, LAG (Lin-12 And Glp-1)

in Caenorhabditis elegans) from a gene repressor to a gene activator (Das et al., 2004). NICD

has two important functional domains required for Notch signaling and activity: the

recombination signal binding protein of the Jκ immunoglobulin gene (RBP-Jκ)/CBF1-associated

module (RAM) domain, which has high binding affinity for RFP-Jκ/CBF-1, and seven ankyrin

(ANK) repeats, which are required for the transactivation of RFP-Jκ/CBF-1-dependent genes

(Tani et al., 2001; Deregowski et al., 2006). CSL then recruits the co-activator Mastermind-like

(MAML) and initiates transcription of target genes such as hairy and enhancer of split (Hes)

(reviewed in Bolos et al., 2007; Watt et al., 2008) (Fig. 1-8).

34

Figure 1-8. Notch signaling pathway. Notch signaling generally involves binding between ligands and receptors associated with adjacent cells. When Notch interacts with membrane-bound ligands Jagged or Delta on the surface of neighboring cells, the Notch intracellular domain (NICD) is proteolytically cleaved from the membrane by γ-secretase after several processing events, and translocates to the nucleus to convert the transcription factor CSL from a gene repressor to a gene activator.

CSL

Jagged-1, Jagged-2 Dll-1, Dll-3, Dll-4

Notch

NICD γ-secretase

35

Hedgehog signaling pathway

Mammals express three related ligands that act in the Hedgehog (Hh) pathway, Sonic

hedgehog, Indian hedgehog and Desert hedgehog – of these, Sonic hedgehog (SHH) is the most

studied. Like the Wnt pathway, SHH signal transduction pathway is strongly implicated in

embryogenesis and regulation of stem cell development and cell fate (Beachy et al., 2004;

Briscoe, 2009). In addition, SHH signaling plays a central role in growth, patterning, and

morphogenesis of many organs, and is commonly hyperactivated in certain human cancers.

The pathway is mediated by the glioma-associated oncogene family members (Gli) zinc finger

transcription factors. A unique feature of vertebrate Hh pathway is that primary cilia are

essential for signal transduction, and the initial membrane events occur at the cilia (Goetz et al.,

2009). If cilia are inhibited from forming, the pathway is shut off. The binding of Hh to its

transmembrane receptor Patched (Ptch), which is located at the base of the primary cilium,

leads to activation and recruitment of a G-coupled transmembrane protein, Smoothened (Smo)

to the cilium (Corbit et al., 2005; Rohatgi et al., 2007; Tukachinsky et al., 2010). In the absence

of the Hh ligand, Ptch inhibits the activity of Smo, resulting in inactivation of Hh signaling.

Binding of the Hh ligand to Ptch abolishes the inhibitory effect of Ptch on Smo, thereby

activating the transcription factor Gli (Fig. 1-9). In vertebrates, three Gli genes have been

identified, with Gli1 being predominantly a transcriptional activator and Gli2 and Gli3, acting as

both activators and repressors. Activating mutations of Smo or suppressing mutations of Ptch

have been shown to constitutively activate the Hh signaling pathway (reviewed in Hui and

Angers, 2011). Suppressor of Fused (Sufu) and the kinesin family member (Kif) 7 are two

important intracellular regulators of Gli proteins. In the off-state, Sufu and Kif7 sequester the

36

Ptch Smo

Kif7

Sufu

Gli GliR GliA

Hh

Sufu Kif7 PKA CK-1

GSK-3

Figure 1-9. Hedgehog signaling pathway. Binding of the Hh ligand to Ptch abolishes the inhibitory effect of Ptch on Smo. Active Smo promotes the conversion of Gli to its active form by inhibiting the negative regulation of Kif7 and Sufu. In the absence of Hh, Sufu and Kif7 sequester the microtubule-bound pool of Gli in the primary cilium, leading to the repression of Hh target genes. Gli is converted to the transcriptional repressor form through the actions of PKA, CK-1, and GSK-3.

cilium

Hh target genes

37

microtubule-bound pool of Gli in the primary cilium, leading to the repression of Hh target

genes. Sufu antagonizes Hh signaling downstream of Smo, and its importance is highlighted by

the observation that targeted disruption of the Sufu gene in mice leads to embryonic lethality

with multiple patterning defects, resembling the phenotype of Ptch mutants (Cooper et al.,

2005). Recently, a study by Cwinn and colleagues (2011) reported a novel role for Sufu in the

maintenance of multipotency in retinal progenitor cells (RPCs). Conditional deletion of Sufu

resulted in downregulation of transcription factors required to specify or maintain RPC identity

and multipotency (Cwinn et al., 2011). An important study by Cheung et al. (2009) implicated

Kif7 as the functional mammalian homologue of the Drosophila molecular scaffolding protein,

Costal2 (Cos2), and showed that Kif7 plays a critical role in regulating mammalian Hh signaling

by physically interacting with Gli1, Gli2, and Gli3 to control their proteolysis and stability. Kif7

promotes physical sequestration of smoothened from patched, relieving the inhibitory activity

of Patched on Smoothened in the cilia. Kif7 knockout mice have a similar phenotype to Gli3

mutants (Hui and Joyner, 1993), including preaxial polydactyly, exencephaly, and

microphthalmia (Endoh-Yamagami et al., 2009).

Some crosstalk exists between the SHH and Wnt pathways, and several reports have

suggested that SHH signaling is controlled by Wnt signaling during embryogenesis (Borycki et

al., 2000; Iwatsuki et al., 2007). Noubissi et al. (2009) also described a mechanism by which the

Wnt signaling pathway stimulates the transcriptional output of Hedgehog signaling, whereby

Wnt/β-catenin signaling induces expression of an RNA-binding protein, coding region

determinant binding protein (CRD-BP), which in turn binds and stabilizes Gli1 mRNA, causing an

38

elevation of Gli1 expression and transcriptional activity. However, in some instances such as in

colon cancer, SHH signaling appears to antagonize Wnt. Akiyoshi et al., (2006) showed that

nuclear accumulation of β-catenin and Gli1 staining levels were inversely associated in the 40

human colorectal cancers that they examined. In fact, Wnt transcriptional activity was reduced

in Gli1 transfected cells, and the researchers concluded that Gli1 plays an inhibitory role in the

development of colorectal cancer involving Wnt signaling, even in cases with the stabilizing

mutation of beta-catenin. Thus, whether the SHH and Wnt pathways act in an analogous or

antagonistic manner appears to be context dependent.

1.4 GSK-3 signaling in stem cells

Role of GSK-3 in ES cell maintenance

As described above, GSK-3 is a constitutively active and ubiquitously expressed

serine/threonine kinase (Woodgett, 1990). Though it was first characterized as an important

downstream target of PKB in the PI3K signaling cascade, it also functions in several other

pathways. For example, GSK-3 acts to suppress the canonical Wnt/β-catenin signaling pathway

(van Amerongen and Nusse, 2009; MacDonald et al., 2009). In the absence of a Wnt signal,

GSK-3 phosphorylates cytosolic β-catenin within a destruction complex that comprises APC,

Axin-1, CK-1 and other proteins and targets the β-catenin for ubiquitin-mediated degradation.

Hence, very low levels of non-Cadherin-associated β-catenin are maintained in the cell under

resting conditions. Upon Wnt binding to Frizzled receptors and LRP co-receptors, and

subsequent engagement of the intracellular protein Dishevelled, the destruction complex is

disrupted (Wu et al., 2009; MacDonald et al., 2009). As a result, GSK-3 and CK-1 activities are

39

diverted to LRP co-receptors at the membrane, and cytoplasmic β-catenin avoids

phosphorylation, accumulates in the cytoplasm, and then enters the nucleus to regulate gene

expression via binding to the TCF/LEF DNA binding proteins (reviewed in Huang and He, 2008;

MacDonald et al., 2009; Voskas et al., 2010).

GSK-3 has many substrates and is involved in a smorgasbord of physiological processes.

Sato et al. (2004) recognized a role for GSK-3 in stem cell maintenance when the addition of 6-

bromo-indirubin-3’-oxime (BIO), a GSK-3 inhibitor, to mouse and human ES cells enhanced self-

renewal and pluripotency. Likewise, Bone et al., (2009) reported a robust enhancement of

mouse ES cell self-renewal with the treatment of highly selective bisindolylmaleimides that

specifically inhibit GSK-3 in the presence of LIF and serum. Interestingly, Austin Smith’s group

described the “ground state” of ES cell pluripotency by inhibiting fibroblast growth factor 4

(FGF4)-MAPK, ERK1/2, and GSK-3 signaling (Ying et al., 2008; Wray et al., 2010) and further

showed that the culture conditions of LIF plus two small molecule inhibitors (2i): PD0325901, a

MEK inhibitor eliminating differentiation-inducing signaling and CHIR99021, a GSK-3 inhibitor

enhancing cell growth capacity and viability, can efficiently induce and maintain up-regulation

of Oct-4 and Nanog in the generation of iPS cells (Silva et al., 2008). These studies all employed

chemical inhibition of GSK-3. Perhaps the most compelling evidence of the important role that

GSK-3 plays in stem cell development derives from ES cells in which all four alleles of GSK-3α

and GSK-3β have been genetically inactivated (Doble et al. 2007). These double knockout ES

cells failed to differentiate and exhibited hyperactivated Wnt/β-catenin signaling with massive

β-catenin accumulation. Knockdown of β-catenin rescues the differentiation defect of GSK-3-

40

null cells, but surprisingly, the effects of β-catenin on pluripotency do not appear to be

dependent on TCF-mediated signaling (Kelly et al., 2011). Rather, stabilization of β-catenin

induces the formation of β-catenin/Oct-4 complexes, which enhance Oct-4 activity and

reinforce pluripotency (Kelly et al., 2011). There is evidence that PI3K-mediated signaling of

GSK-3 promotes ES cell self-renewal by regulating the activity and localization of GSK-3

(Bechard and Dalton, 2009). These authors indicate that upon LIF withdrawal, PI3K/PKB

signaling declines and active GSK-3 accumulates in the nucleus, where it targets c-Myc through

phosphorylation on Thr58, earmarking it for degradation. However, when PI3K signaling is

active, nuclear GSK-3 is rapidly exported back into the cytoplasm in a PKB-dependent manner,

and thus c-Myc is maintained at the necessary levels to sustain self-renewal (Bechard and

Dalton, 2009).

Multiple roles of GSK-3

In addition to being a well-established downstream component of the PI3K signaling

pathway, GSK-3 is also a key enzyme in negatively regulating the canonical Wnt/β-catenin

signaling pathway and the Notch and Hedgehog pathways. Whether crosstalk actually exists

between these pathways has been a controversial subject. For example, the emergence of

several recent studies arguing that PKB-mediated inhibition of GSK-3 leads to β-catenin

accumulation has sparked the debate once again (Voskas et al., 2010). Physiological levels of

GSK-3 do not limit the capacity of the destruction complex to mediate β-catenin degradation;

only a small fraction (<10%) of the total GSK-3 in the cell is associated with Axin and actively

engaged in canonical Wnt signaling (Lee et al., 2003; . Benchabane et al., 2008). Other pools of

41

GSK-3 are additionally sequestered in several other pathways. For example, upon Insulin

stimulation and consequent PI3K activation, PKB phosphorylates GSK-3 and negatively regulates

its kinase activity (Cross et al., 1995). A similar mechanism of negative regulation of GSK-3 has

been demonstrated in other growth factor pathways, and though regulation of β-catenin has

also been demonstrated in many of these pathways (He et al., 2004; Ishibe et al., 2006; Gu et

al., 2007; Kobielak et al., 2007; Maes et al., 2010), the direct convergence of Wnt and growth

factor pathways on β-catenin regulation remains a subject of debate (Voskas et al., 2010).

Several human cancers tend to involve separate mutations of both pathways (Wu et al.,

2007). If PI3K activation alone was sufficient to activate Wnt signaling, then one would

question why additional mutations that lead to β-catenin stabilization would be required.

Several studies have also shown that growth factor stimulation which leads to GSK-3 inhibition

through PI3K signaling does not result in stabilization of β-catenin in the cell (Ding et al., 2002;

McManus et al., 2005; Ng et al., 2009). Furthermore, GSK-3 molecules with mutations in the

PKB phosphorylation sites, and thus insensitive to inhibition by PI3K signaling, are still inhibited

by Wnt signaling (McManus et al., 2005; Doble et al., 2007; Ng et al., 2009). Despite the fact

that PI3K and Wnt signaling pathways share GSK-3 as a core regulatory protein, it would appear

that the insulation of these pathways is sufficient to prevent cross-talk (McNeill and Woodgett,

2010). As demonstrated by Ng et al., (2009), Axin may shield the associated GSK-3 within the

destruction complex from protein kinases such as PKB that would otherwise phosphorylate and

inactivate GSK-3. Although GSK-3 that is not directly associated with the complex may still be

42

phosphorylated and inhibited, sufficient levels remain bound to the Axin complex to

phosphorylate and suppress the accumulation of β-catenin (Voskas et al., 2010).

43

1.5 Rationale and hypothesis

PI3K signaling has been shown to play important roles in regulating cell survival and

growth, and it is likely that components of the pathway are shared by stem cell populations. A

paper by Paling et al. (2004) reported that the use of a PI3K inhibitor resulted in ES cell

differentiation. Studies in our lab revealed that ES cells completely lacking GSK-3 remain

undifferentiated compared to wildtype ES cells. GSK-3 is negatively regulated by PI3K

suggesting that PI3K may play a vital role in maintaining self-renewal in ES cells through GSK-3.

We hypothesize that constitutively activating PI3K signaling by introducing activated alleles of

PDK1 and PKB would result in increased maintenance of stem cell pluripotency in the absence

of LIF. Instead of using drugs that potentially have off-target effects, the purpose of this study

is to employ the use of a genetic system to generate stable isogenic ES cell lines to further

characterize the role of key components of the PI3K pathway in modulating stem cell fate

determination. The elucidation of the molecular and cellular mechanisms responsible for

modulating stem cell development will ultimately provide further insight into the future

development of regenerative medicine or cancer therapies.

44

CHAPTER 2

Activation of PDK1 maintains mouse embryonic stem cell self-renewal in a PKB-dependent

manner

45

2.1 INTRODUCTION

The phosphatidylinositol 3’ kinases (PI3Ks) are a family of conserved intracellular lipid

kinases that phosphorylate the 3’-hydroxyl group of phosphatidylinositol (PtdIns) and

phosphoinositides, producing PtdIns(3)P (PIP), PtdIns(3,4)P2 (PIP2), and PtdIns(3,4,5)P3 (PIP3)

(Hawkins et al., 2006) (Fig. 2-1). The various isoforms of PI3Ks are divided into three main

classes based on substrate preference, mechanism of activation, and structural homology

(Bader et al., 2005). Class I PI3Ks are involved in many important physiological processes, and

are further subdivided into Class IA: those with a p110 catalytic subunit (α, β, or δ) and a p85

regulatory subunit (α, β, or γ) that are activated by growth factor receptor tyrosine kinases,

and Class IB: those with a p110γ catalytic subunit and a p101 or p84 regulatory subunit that

are activated by G-protein-coupled receptors. The three isoforms of class II PI3Ks share 40-

50% sequence homology with class I p110 subunits, but have additional PX and C2 domains at

the C-terminus and an extended divergent N-terminus; they preferentially phosphorylate

PtdIns and PtdIns-4-P in vitro, and may be important for membrane trafficking and receptor

internalization. The yeast protein, vacuolar protein-sorting defective 34 (Vps34), is the lone

member of class III PI3Ks and these only phosphorylate PtdIns to produce Ptdlns(3)P, a

phospholipid that may play a role in vesicle transport and cell growth (Engelman et al., 2006).

The PI3K signaling pathway is a complex pathway involved in the regulation of multiple

processes including proliferation, cell growth, survival, glucose transport, vesicle trafficking,

cell adhesion, cell motility and cytoskeletal organization. Insulin and other growth factors

simulate PI3K; the resulting lipid products act as second messengers and bind to pleckstrin

homology (PH) domains of proteins such as 3-phosphoinositide-dependent protein kinase 1

46

Figure 2-1. Phosphorylation of PtdIns. PI3K phosphorylates the 3’ -OH group of PtdIns. Ptdlns(3,4)P2 and Ptdlns(3,4,5)P3 (outlined in red) are important second messengers in the PI3K signaling cascade.

47

(PDK1) and protein kinase B (PKB) to allosterically modify their activity or translocate them to

the plasma membrane where they can bind to receptors and activate signal transduction

(Scheid and Woodgett, 2003). Modifications that alter subcellular targeting, such as adding a

Src myristoylation sequence to PDK1 (Scheid et al., 2005) or to PKB (Kohn et al., 1998), can

activate PI3K signaling by increasing their local densities at the plasma membrane, promoting

their interaction. In addition, PKB can be constitutively induced by mutating the Thr308 and

Ser473 phosphorylation sites to phosphomimetic aspartic acid residues (PKB-DD) (Alessi et

al., 1996; Scheid et al., 2002). The p110 catalytic subunit is regulated by the p85 adapter,

which targets p110 to the membrane for activation and substrate access, but also has

inhibitory effects on catalytic activity. Modifications such as adding a CAAX motif to p110

targets it to the membrane where it phosphorylates PIP2 to generate PIP3. It is, however, still

subject to negative regulation by p85. The PI3K pathway is one of the pathways most

frequently activated in human cancers and two point mutations of PI3K p110α in particular,

E545K and H1047R, lead to constitutive activation of the pathway (Zhao et al., 2005). Previous

studies have suggested that PI3K signaling may play a vital role in maintaining stem cell

pluripotency and giving ES cells their tumor-like proliferative properties. A large-scale

transcriptional study implicated components of the PI3K pathway in maintaining human ES

cell viability and pluripotency (Armstrong et al., 2006). Selective inhibition of class-IA PI3K

catalytic isoforms increased differentiation and reduced proliferation (Kingham and Welham,

2009). Phosphatase and tensin homolog deleted on chromosome ten (PTEN) inhibits PI3K

signaling by converting PIP3 back to PIP2, and negatively regulates ES cell proliferation and

teratoma formation (Takahashi et al., 2005). PTEN-null ES cells exhibit enhanced

48

tumorigenicity and PI3K signaling with increased PKB activation and Cyclin D1 levels (Sun et

al., 1999). It has been suggested that the activation of PKB via myristoylation is sufficient to

maintain the undifferentiated phenotype of ES cells without the addition of leukemia

inhibitory factor (LIF) (Watanabe et al., 2006). Glycogen synthase kinase-3 (GSK-3) is

negatively regulated by PI3K, and studies performed by Doble et al. , 2007 revealed that GSK-

3 double-knockout mouse ES cells remained undifferentiated, further implicating the

importance of the PI3K and Wnt pathways in regulating stem cell pluripotency.

Several studies have also employed the use of PI3K inhibitors. Paling et al. (2004)

reported that the inhibition of PI3K with the inhibitor LY294002 mitigated the ability of LIF to

maintain mES cell self-renewal and caused cells to differentiate. Transcriptome profiling

revealed several markers of pluripotency to be down-regulated, such as Nanog, Esrrb, Tbx-3,

and Tcl-1 (Storm et al., 2009). Cell proliferation was also inhibited with the addition of

LY294002, leading to the accumulation of mES cells in G1 phase followed by apoptotic cell

death (Lianguzova et al., 2007). Of note, LY294002 is a non-specific PI3K inhibitor and also

inhibits mTOR, which is crucial for ES cell proliferation (Murakami et al., 2004). Here, we have

analyzed the effects of expressing activated forms of components of the PI3K signaling

pathway in embryonic stem cells on pluripotency. To further dissect the molecular

mechanism of self-renewal under the control of PI3K signaling, we generated constitutively

active isogenic mouse ES cell lines of PDK1 and PKB, and characterized the pluripotentiality of

the cell lines. In accordance with previous literature, activation of the PI3K signaling pathway

49

was found to maintain stem cell self-renewal. We have tested for possible roles of PKB

affecting Wnt signaling in mediating this pluripotent phenotype.

2.2 RESULTS

Role of PI3K pathway in maintenance of pluripotency of ES cells

To generate isogenic ES cell lines expressing activated alleles of the genes of interest,

we employed a modified Flp-In system (Fig. 2-2). The activated mutants of genes were

inserted into the GSK-3β locus that had been targeted by an FRT-puromycin cassette. In the

generation of the host ctrl cell line, almost 700 individual colonies were picked and screened

following puromycin selection, and 4 positive colonies were identified (Fig. 2-3). PDK1 was

made constitutively active by the addition of a Src myristoylation signal on the N-terminus,

which localizes the protein to the cell membrane (Scheid et al., 2005). Three independent

activated PDK1 ES cell lines were generated with a myc-his tag on the N-terminus and a V5

tag at the C-terminus resulting in the increased protein size in the transgenic cell lines (Fig. 2-

4a). All three transgenic cell lines showed increased phosphorylation of PKB on threonine 308

and p70S6K on threonine 389 demonstrating activation of the pathway (Fig. 2-4a). In

addition, proper localization of myr-PDK1 at the cell membrane was visualized by confocal

microscopy following immunofluorescent staining for the V5 epitope (Fig. 2-4b).

To assess the pluripotency of the myr-PDK1 cells, we withdrew LIF from the media and

observed the morphological changes of the cells grown in culture. Interestingly, the myr-

PDK1 cells tended to remain as distinct, round colonies in monolayer culture, while the host

50

hygro

FRT

STOP myr-PDK-1 ATG P EF-1α

myr-PDK1 V5

puro

FRT

STOP myr-PDK-1 ATG P EF-1α

myr-PDK1 V5 PSV40

ATG hygro

FRT

(Chr. 16 B4)

P GSK-3β

1 2 11 3 4

ATG

(Chr. 16 B4)

P GSK-3β

1 2 11 3 4

ATG puro PSV40

FRT

ATG

+

Flp recombinase

Figure 2-2. Modified Flp-In system. A targeting vector is introduced to knockout a single allele of GSK-3β to create a host cell line with a FRT-puro cassette. Co-transfection of Flp recombinase and a gene of interest previously cloned into a vector containing a V5 epitope and FRT-hygro cassette results in homologous recombination at the FRT sites. Positive colonies are resistant to hygromycin and sensitive to puromycin.

51

Figure 2-3. PCR screen of GSK-3β+/- host ES cell lines. (a) Primers from the targeting vector endogenous GSK-3β locus were used to screen for proper homologous recombination. Four colonies: 6A5, 6B8, 6B10, and 7D11 are positive for the 1.5 kb product. (b) PCR of puromycin. Primers designed within the puromycin gene were used to screen the GSK-3β+/- host ES cell lines. Negative control: water was used in place of a DNA template for the PCR reaction. (c) PCR of FRT-puro cassette. Primers which flank the endogenous GSK-3β locus were used to screen for the replacement of exon 2 with a FRT-puro cassette. Positive control: a heterozygous conditional knockout mouse with floxed exon 2 showing wildtype and knockout bands (from Dr. Satish Patel). Negative control: water was used in place of a DNA template for the PCR reaction.

A

B C

52

Figure 2-4. Characterization of myr-PDK1 cell lines. (a) Western blot analysis of transgenic myr-PDK1 cell lines. (b) Membrane localization of myr-PDK1 by immunofluorescent staining of V5; confocal, 40X mag.

zoom in

B A

PDK1

β-actin

V5

β-actin

p-p70S6K T389

β-actin

p-PKB T308

53

control cell line, similar to R1 wildtype ES cells, showed evidence of morphological

differentiation and spread throughout the dish. The myr-PDK1 maintained positive staining

for alkaline phosphatase activity even in the absence of LIF for 5 days, a further indication

that these cells remained pluripotent (Fig. 2-5a). We proceeded to induce differentiation of

the cells by generating embyroid bodies using the hanging drop method. After 3 days as

hanging drops, the embryoid bodies were then each placed into the well of a 96-well tissue

culture plate and maintained for weeks. After a few days in the plate, contractile beating was

observed in both the myr-PDK1 and control embryoid bodies. However, interestingly the

myr-PDK1 cells retained a tightly compact morphology even at 33 days, while the host control

and R1 embyroid bodies grew in what appeared to be an uncontrolled manner and

differentiated (Fig. 2-5b). Immunofluorescent staining of the embyroid bodies for Oct-4, a

marker of pluripotency, revealed that the V5-epitope tagged myr-PDK1 cells were positive for

Oct-4 expression, whereas the control cells extinguished Oct-4 expression (Fig. 2-5c).

Previously, Watanabe et al. (2006) showed that myr-PKB expressing ES cells remain

undifferentiated. We therefore generated transgenic ES cell lines expressing a constitutively

activated PKB (PKB-DD in which the two activatory phosphorylation sites are mutated to

aspartic acid to partially mimic phosphorylation (Alessi et al., 1996), and detected a similar

phenotype to the myr-PDK1 cells in terms of alkaline phosphatase activity, overall embryoid

body morphology, and immunofluorescent staining for Oct-4 (Fig. 2-6). These data are

consistent with the notion that PDK1 acts through PKB/Akt to promote maintenance of

pluripotentiality. To gain insight into the mechanism underlying the maintenance of de-

54

Figure 2-5. Analysis of pluripotent markers on myr-PDK1 cells. (a) Alkaline phosphatase activity. Cells were grown in monolayer and stained for alkaline phosphatase activity on day 5; phase contrast, 10X mag. (b) Gross morphology of embryoid bodies; phase contrast, 5X mag. (c) Oct-4 immunofluorescent expression of myr-PDK1 transgenic embryoid bodies at day 10; confocal, 40X mag.

R1

Host ctrl

myr-PDK1

LIF + -

Oct-4 Topro-3 Merged V5

myr-PDK1 Host ctrl

15 days

22 days

33 days

myr-PDK1

Host ctrl

A B

C Oct-4 Topro-3 Merged V5

55

Figure 2-6. Analysis of pluripotent markers on PKB-DD cells. (a) Alkaline phosphatase activity. Cells were grown in monolayer and stained for alkaline phosphatase activity on day 5; phase contrast, 10X mag. (b) Gross morphology of embryoid bodies on day 15; phase contrast, 5X mag. (c) Oct-4 immunofluorescent expression of myr-PDK1 transgenic embryoid bodies at day 10; confocal, 40X mag.

Oct-4 Topro-3 Merged V5

B A

C

Host ctrl Host ctrl

PKB-DD PKB-DD

56

differentiation of the myr-PDK1 cell lines, we employed a downstream block and used a PKB

inhibitor that specifically inhibits its activity by targeting the PH domain (Logie et al., 2007).

Cells grown for several weeks in the presence of the PKB inhibitor (long-term treatment)

showed a marked decrease in PKB serine 473 phosphorylation and in PDK1 expression (Fig. 2-

7a). Interestingly, addition of the PKB inhibitor eliminated alkaline phosphatase activity

observed in untreated myr-PDK1 cells (Fig. 2-7b), and similarly ablated Oct-4 expression from

the myr-PDK1 and PKB-DD cells within 8 hours of inhibitor treatment (Fig. 2-7c), potentially

suggesting that the inhibition of PKB led to the loss of pluripotency. Long-term treatment

with the PKB inhibitor appeared to suppress translation of the transgenic PDK1, complicating

the interpretation of the data. In the experiment where cells were grown in monolayer in the

presence of PKB inhibitor for 2-3 weeks before forming embyroid bodies that were also

maintained in the presence of PKB inhibitor, control embryoid bodies appeared smaller

overall, and myr-PDK1 embryoid bodies consistently lost transgene expression (as judged by

loss of V5 epitope staining) (Fig. 2-8). Thus, we investigated the effects of rapamycin

treatment on myr-PDK1 and PKB-DD cells. Since the cells were unable to survive longer-term

exposure to rapamycin, we examined Oct-4 staining in the myr-PDK1 cells in the presence of

rapamycin for 8 hours, and rapamycin treatment did not affect Oct-4 expression levels as

assessed by immunfluorescent staining (Fig. 2-9a). We further examined the effects of the

rapamycin treatment by Western blot analysis, and saw that 8 hours of treatment resulted in

decreased mTOR activity evident by decreased phosphorylation of p70S6K on threonine 371,

and otherwise no effect on p70S6K phospho-T389, endogenous PKB, or transgenic PDK1

expression levels (Fig. 2-9b).

57

Figure 2-7. Treatment of myr-PDK1 ES cells with PKB inhibitor. (a) Western blot analysis of whole cell lysates after growing cells long-term in inhibitor. (b) Alkaline phosphatase activity on cells grown on monolayer at day 5; phase contrast, 10X mag. (c) Immunofluorescent staining of cells grown on monolayer after 8 hour treatment with PKBi; confocal, 40X mag.

LIF PKBi

+ - -

- - +

p-PKB S473

GAPDH

Host ctrl myr-PDK1 PKBi

V5

PDK1

+ + - -

GAPDH

Host ctrl PKB-DD myr-PDK1 Host ctrl PKB-DD myr-PDK1

no treatment + PKBi

V5

Oct-4

Topro-3

A B

C

Host ctrl

myr-PDK1

58

Figure 2-8. Long-term treatment of myr-PDK1 embryoid bodies with PKB inhibitor. V5 and Oct-4 immunofluorescent staining of myr-PDK1 embryoid bodies at day 10 after 3 week treatment with PKBi; confocal, 40X mag.

Oct-4 Topro-3 Merged V5

Oct-4 Topro-3 Merged V5

Oct-4 Topro-3 Merged V5

Oct-4 Topro-3 Merged V5

Host ctrl + DMSO

Host ctrl + PKBi

myr-PDK1 + PKBi

myr-PDK1 + DMSO

59

Host ctrl PKB-DD myr-PDK1

V5

Oct-4

Topro-3

GAPDH

V5

PKB

p-p70S6K T389

p-p70S6K T371

Figure 2-9. Treatment of myr-PDK1 ES cells with rapamycin. (a) Immunofluorescent staining of cells grown on monolayer after 8 hour stimulation with rapamycin; confocal, 40X mag. (b) Western blot analysis of whole cell lysates.

A

B

60

Does PI3K-dependent maintenance of pluripotency require stabilization of β-catenin?

GSK-3 plays a key role in promoting the phosphorylation and de-stabilization of β-

catenin in the Wnt pathway. Wnt leads to escape of β-catenin from GSK-3 phosphorylation

and allows the protein to accumulate and induce transcription through interaction with

TCF/LEF DNA binding proteins (reviewed in Huang and He, 2008; Wu et al., 2009; MacDonald

et al., 2009). Several studies have suggested that PI3K signaling may regulate β-catenin

through inactivation of GSK-3 (Desbois-Mouthon et al., 2001; Maes et al., 2010). We

therefore investigated the phosphorylation state of GSK-3 and expression levels of β-catenin

in myr-PDK1 and PKB-DD cells. Even though GSK-3α and β phosphorylation at Ser 21 and 9,

respectively were increased as expected in these transgenic ES cell lines, we observed no

apparent difference in localization (Fig. 2-10a) or in cytosolic protein accumulation of β-

catenin (Fig. 2-10b). To further test for PI3K pathway regulation of β-catenin, we used a GSK-

3β mutant S9A ES cell line, which expresses only a mutant of GSK-3β that is unresponsive to

PI3K signaling due to mutation of the PKB/Akt phosphorylation site, on a GSK-3 knockout

background. These cells were transiently transfected with PKB-DD-V5 and assessed for β-

catenin accumulation. We observed no difference in β-catenin localization (fig. 2-11a) or

cytosolic protein levels (fig. 2-11b) between GSK-3β S9A and GSK-3β-WT cells nor upon

expression of PKB-DD-V5. Axin2 transcript levels were similarly unaffected (Fig. 2-11c). Based

on these results, we conclude that in our myr-PDK1 and PKB-DD ES cells at least, activation of

the PI3K pathway does not affect canonical Wnt signaling. We further examined Oct-4

protein expression levels in whole cell lysates of GSK-3 S9A and GSK-3β-WT cells transiently

transfected with myr-PDK1-V5. Again, GSK-3 does not appear to affect the effects of myr-

61

Figure 2-10. Analysis of β-catenin expression in myr-PDK1 and PKB-DD cells. (a) Immunofluorescent staining of myr-PDK1 cells with β-catenin. (b) Western blot analysis of myr-PDK1 and PKB-DD cytosolic cell lysates for β-catenin protein expression and whole cell lysates for phospho-GSK-3 and pan-GSK-3 levels.

β-catenin

Topro-3

Merged

myr-PDK1 Host ctrl

A B

GAPDH

β-catenin

GSK-3

GAPDH

p-GSK-3 S21/9

62

Figure 2-11. Examination of crosstalk between PI3K and Wnt signaling via GSK-3. (a) Analysis of PKB-mediated regulation of β-catenin expression via GSK-3 by immunofluorescent staining following transient transfection with PKB-DD-V5.

GSK-3 S9A GSK-3β-WT DKO GSK-3β-WT + PKB-DD-V5

GSK-3 S9A + PKB-DD-V5

Topro-3

β-catenin

V5

Merged

A

63

GAPDH

β-catenin

V5

axin-2

β-actin

B C

p-GSK-3 S21/9

GSK-3

Figure 2-11. Examination of crosstalk between PI3K and Wnt signaling via GSK-3. (b) Western blot analysis of cytosolic cell lysates after transient transfection with PKB-DD-V5. (c) Semi-quantitative RT-PCR for axin-2 (1X and 10X template dilutions) after transient transfection with PKB-DD. (d) Western blot analysis of whole cell lysates of GSK-3 S9A and GSK-3β-WT cells transiently transfected with myr-PDK1-V5.

GAPDH

Oct-4

V5

D

- LIF + LIF

64

PDK1 on Oct-4 expression levels (Fig. 2-11d). Taken together, we conclude that the

maintenance of pluripotency by PI3K signaling is β-catenin independent in our system.

Our results indicate that activation of PDK1 maintains mouse embryonic stem cell self-

renewal in a PKB-dependent manner in the absence of LIF. We attempted to further

investigate the mechanism of action by examining potential downstream effectors. A report

showed that PI3K/PKB signaling promotes self-renewal by suppressing GSK-3β activity and

restricting its ability to phosphorylate c-Myc, thereby supporting LIF-independent self-renewal

(Bechard and Dalton, 2009). We investigate c-Myc expression in GSK-3β S9A and GSK-3β-WT

cells with and without transient PKB-DD-V5 expression and were not able to observe any

differences the levels of protein expression (Fig. 2-12a). When we examined mRNA levels in

host control versus myr-PDK1 stable cells by semi-quantitative RT-PCR, we also did not see any

discernable differences, although PKB mRNA expression is higher in myr-PDK1 cells as expected

(Fig. 2-12b). A recent study by Kobayashi and Kageyama (2011) reported that Hes1 regulates

the fate choice of ES cells by repressing Notch signaling. We assessed Hes1 transcript levels in

myr-PDK1 and PKB-DD cells by semi-quantitative RT-PCR, and did not observe any changes in

Hes1 expression in our experiments (Fig. 2-12c).

2.3 DISCUSSION

In this study, we generated stable isogenic myr-PDK1 embryonic stem (ES) cell lines to

examine the role that constitutively active mutants of the PI3K pathway (PDK1 and PKB/Akt)

play in maintenance of pluripotency. Several groups have previously demonstrated roles for

65

β-actin

c-Myc

PKB

Histone H3

c-Myc

β-actin

Hes1

A B

C

Figure 2-12. Examination of potential myr-PDK1 targets. (a) Western blot analysis of cytosolic cell lysates after transient transfection with PKB-DD-V5. (b) Semi-quantitative RT-PCR of myr-PDK1 cells for c-Myc and PKB mRNA expression (1X, 10X, 100X, and 1000X template dilutions). (c) Semi-quantitative RT-PCR of myr-PDK1 and PKB-DD cell lines for Hes1 mRNA expression (1X, 10X, and 100X template dilutions).

66

components of the PI3K signaling cascade in pluripotency, mostly based on loss-of-function

studies (Jirmanova et al., 2002; Paling et al., 2004; Armstrong, et al., 2006; Watanabe et al.,

2006). Consistent with stabilization of pluripotency, we demonstrate here that activated myr-

PDK1 ES cells retain alkaline phosphatase activity in the absence of LIF, and embryoid bodies

appear morphologically undifferentiated and display sustained Oct-4 staining compared to

controls.

Although PDK1 targets multiple downstream substrates, including PKB, S6K, RSK, SGK,

and atypical PKC isoforms (Mora et al., 2004), the effect of myr-PDK1 on pluripotency appears

to be mediated through its activation of PKB, since treatment of myr-PDK1 ES cells and

embryoid bodies with PKB inhibitors reversed the LIF-independent pluripotent phenotype.

Similar to studies demonstrating a role for an activated myristoylated form of PKB in

promoting LIF-independent self-renewal (Watanabe et al., 2006; Niwa et al., 2009), we also

showed that activated PKB-DD ES cells and embryoid bodies exhibit LIF-independent

pluripotency. To probe the molecular mechanism(s) by which myr-PDK1 and PKB-DD may

mediate LIF-independent pluripotency, roles for downstream targets of these protein kinases

were examined, including mTOR complex-1 (mTORC-1) and GSK-3. Both myr-PDK1 and PKB-

DD ES cells were treated with rapamycin, an inhibitor of mTOR. PDK1 and PKB activate

mTORC-1 signaling to promote protein synthesis and cell growth (Manning and Cantley,

2007). Upon treatment with an inhibitor of mTOR, no change was observed in Oct-4 staining

or pluripotency, indicating that another pathway(s) downstream of PDK1 and PKB is

responsible for the maintenance of Oct-4 expression and pluripotency in the absence of LIF.

67

It is well established that PKB/Akt phosphorylates and inhibits GSK-3 (Cross et al.,

1995). Furthermore, inhibition of GSK-3 has been linked to the maintenance of an

undifferentiated pluripotent stem cell state (Sato et al., 2004; Ying et al., 2008). Through its

association with the destruction complex, GSK-3 targets β-catenin for degradation. The ability

for PKB to stabilize β-catenin in the cytoplasm through its inhibition of GSK-3 has been tested

by a number of groups (He et al., 2004; Ishibe et al., 2006; Gu et al., 2007; Kobielak et al.,

2007; Maes et al., 2010). Here, we investigated whether this mechanism plays a role in the

maintenance of a PKB-mediated LIF-independent pluripotent stem cell state. Consistent with

several other studies (Ding et al., 2002; McManus et al., 2005; Ng et al., 2009), neither myr-

PDK1 nor PKB-DD ES cells enhanced β-catenin levels, either in the presence of a wildtype or

mutant version of GSK-3 that is unresponsive to PKB. Furthermore, no changes were

observed in Oct-4 levels, suggesting that the maintenance of PKB-mediated LIF-independent

pluripotency is also GSK-3 independent. This result supports the hypothesis that PI3K and

Wnt signaling pathways are insulated and do not cross-talk - at least in ES cells (Fig. 2-13).

In mediating ES cell pluripotency, PI3K signaling has previously been implicated

downstream of both cytokines and growth factors (Paling et al., 2004; Niwa et al., 2009). For

example, both LIF and insulin-like growth factor (IGF) have been shown to activate PKB in ES

cells (Storm et al., 2007; Niwa et al., 2009). More specifically, LIF-mediated PKB activation

positively regulates Tbx-3 and subsequently, Nanog and Oct-4 expression (Storm et al., 2007;

Niwa et al., 2009). It has been suggested that Jak-STAT and PI3K-PKB signal in parallel

pathways downstream of LIF to maintain pluripotency (Niwa et al., 2009). The ability to

68

Axin-1

CK-1

APC

β-catenin P P P

β-catenin

Frizzled LRP

Dishevelled

GF

PKB/Akt

PI3K

GSK-3

GSK-3

P

P P P P

P P P P

Figure 2-13. Separate PI3K and Wnt signaling pathways. GSK-3 is a key regulator in both the PI3K and Wnt signal transduction pathways. In the context of the myr-PDK1 and PKB-DD transgenic ES cell lines, the PI3K signaling pathway does not crosstalk with the canonical Wnt signaling pathway through GSK-3.

69

generate stable isogenic ES cell lines targeting additional components within the PI3K and

other pathways should allow further dissection of the functional hierarchy of signaling

proteins that control ES cell pluripotency and provide further insight into appropriate targets

for drug-mediated modulation of ES self renewal.

2.4 MATERIALS AND METHODS

Cell culture

ES cells were maintained on a MEF feeder layer in ES cell culture medium (ES-DMEM)

consisting of high glucose DMEM (Invitrogen) supplemented with 15% ES cell qualified FBS

(Hyclone), 50U penicillin/streptomycin (Invitrogen), 2mM GlutaMAX™ (Invitrogen), 0.1mM

MEM non-essential amino acids (Invitrogen), 1mM sodium pyruvate (Invitrogen), 0.1mM 2-

mercaptoethanol (Sigma), and 1000U/mL LIF (Millipore) at 37°C, 5% CO2. myr-PDK1 and PKB-

DD cell lines were maintained in the presence of selection to ensure transgene expression.

Before experiments, feeders were removed, and ES cells were grown on plates coated with

0.1% gelatin (Sigma).

Generation of GSK-3β+/- mouse ES cells as host cell line

R1 ES cells provided by the Samuel Lunenfeld Research Institute stem cell core facility

were used for the generation of the GSK-3β+/- host cell line. R1 ES cells were derived from

male blastocyst, hybrid of two 129 substrains (129X1/SvJ and 129S1/SV-+p+Tyr-cKitlSl-J/+),

and are heterozygous at the c and p loci (C/c,P/p) (Nagy et al., 2003). Pluripotency of the R1

line was tested by ES cell aggregation to form tetraploid embryos and germline transmission

70

to form diploid embryos, and the attempts were successful when cells were less than passage

14 (Wood et al., 1993; Nagy and Rossant, 1999).

The targeting vector, pTVB_deltaX2_NR_FRT/Pur_AgeIBclI (a gift of B. Doble) was

linearized with the NdeI restriction enzyme (NEB) and purified using QiaxII beads (Qiagen).

Purity of the extracted DNA was based on the 260nm/280nm O.D. ratio as calculated and

displayed by a NanoDrop ND-1000 spectrophotometer. 25μg of linearized and freshly

purified pTVB_deltaX2_NR_FRT/Pur_AgeIBclI was electroporated into approximately 1 X 106

passage 13 R1 ES cells that were grown for one passage on gelatin to remove feeder cells

using a BIO-RAD Gene Pulser® with a single pulse of 250V at 500μF. Following

electroporation, cells were distributed into 3 to 4 10cm gelatin-coated tissue culture dishes.

The medium was changed the next day and drug selection commenced 48 hours after

electroporation using 1.2μg/mL puromycin (Invitrogen). The selection media was changed

every day for the first few days then every other day until white colonies were large enough

to be visible by the naked eye. Well-spaced colonies with a defined border and compact

center with no distinguishable individual cells were picked into a V-bottom 96-well plate

containing 0.25% trypsin, 1mM EDTA (Invitrogen). The colonies were split into 2 replica flat-

bottom 96-plates: one was used for screening by PCR and the other was allowed to

propagate. Almost 500 colonies were picked in this manner and screened for homologous

recombination by pooled-PCR using primers that flank the short arm of homology following

crude extraction of total genomic DNA from the 96-well plate. The forward primer (5’-

CACAATGCGACTGACCCACTTCCCTTTC-3’) is found in pTVB_deltaX2_NR_FRT/Pur_AgeIBclI

71

upstream of the short arm and the reverse primer (5’-CTTAACTACCGGTGGATGTGGAATGTG-

3’) is in the endogenous GSK-3β locus resulting in a 1.5kb product upon a proper homologous

recombination event. These primers were previously designed by Brad Doble. Four colonies

were found to be positive for homologous recombination by pooled-PCR. These were

subsequently confirmed by single PCRs for the short arm, the puromycin gene, and the FRT-

puro cassette which replaces exon 2. The primer sequences used for puromycin were Puro

forward: 5’-ATCGAGCGGGTCACCGAGCT-3’ and Puro reverse: 5’-TTGCGGGTCATGCACCAGGT-

3’ (obtained from Eric Ho) and those used to flank GSK-3β exon 2 were forward: 5’-

GGGGCAACCTTAATTTCATT -3’, and reverse: 5’-TCTGGGCTATAGCTATCTAGTAACG-3’

(previously designed by Satish Patel).

Cloning of Flp-In constructs

In order to clone the genes of interest into the Flp-In vector, pEF5/FRT/V5-D-TOPO®

(Invitrogen), the forward cloning primer consisted of the TOPO recognition sequence (CACC)

followed by a full Kozak sequence and the first 20 to 29 nucleotides of the gene of interest.

The design of the reverse primer involved removing the stop codon of the gene so that a

fusion could be formed in frame with the V5 epitope.

Generation of stable Flp-In ES cell lines

4µL of Lipofectamine 2000 (Invitrogen) was used to co-transfect 0.2μg of pEF_myr-

myc-his-PDK1_FRT_V5 or pEF_HA-PKB-DD_FRT_V5 and 1.8μg of the pOG44 construct

(Invitrogen), which expresses Flp recombinase into the GSK-3β host cells lines. Fresh

72

maxipreps of pOG44 were performed either the same day or the day before to ensure that

the DNA was supercoiled and pure. Cells were placed in a 6-well plate (Corning) and selected

with 250μg/mL hygromycin (InvivoGen) after 48 hours. The selection media was changed

every day for the first few days then every couple of days until colonies were ready to be

picked 8-12 days later. Colonies were picked and expanded from 96-well plates to replica 24-

well plates where 1.2μg/mL puromycin selection medium was used in place of hygromycin for

one of the replica plates. Proper integration of the transgene into the knockout GSK-3β locus

through Flp recombination will result in colonies that are hygromycin resistant and puromycin

sensitive. Colonies were further expanded into 6cm dishes and lysed with RIPA buffer for

Western blot analysis of V5 expression.

Cytosolic lysate preparation

Cells from a 10cm2 tissue culture dish (Corning) were rinsed twice with PBS and

scraped into 500µL of cold hypotonic lysis buffer: 50mM Tris pH 7.4, 1mM EDTA, complete

protease inhibitor tablet (Roche), phasphatase inhibitor cocktail (Sigma), 1mM sodium

orthovanadate, 10mM NaF, 10mM, and β-glycerophosphate. Cells were incubated on ice for

15-20 minutes, and then pelleted by centrifuging in an ultra-centrifuge at 80 000 rpm for 30

minutes at 4⁰C. The supernatant containing the cytosolic fraction was transferred into a new

Eppendorf tube, and protein levels were quantified using the BCA Protein Assay (Pierce).

73

Western blot analysis

Protein lysates containing sample buffer and TECEP (Pierce) were boiled for 10

minutes and loaded onto an 8% SDS-PAGE gel, then transferred onto PVDF membrane

(Milliopore) after electrophoresis via semi-dry transfer. Primary antibody incubations were

done overnight at 4°C with gentle rocking. Next, the membrane was washed with TBST and

incubated with either goat-anti-mouse or goat-anti-rabbit (Bio-Rad) secondary antibodies

with gentle rocking for 90 minutes at room temperature. The membrane was washed again

and then exposed to film (Kodak) using ECL reagent (Molecular Probes).

Alkaline phosphatase activity

A single-cell suspension of 1000 cells/cm2 were seeded onto a 0.1% gelatin-coated well

of a 6-well plate (Corning) and grown in monolayer in differentiation medium. On day 5, cells

were washed in PBS, fixed in 2% paraformaldehyde/PBS for 30 minutes at room temperature,

washed again in PBS, and stained in the dark using the Vector Blue Phosphatase Substrate Kit III

(Vector Laboratories SK-5300) according to manufacturer’s instructions.

Embryoid body assay

Differentiation medium used to maintain embryoid bodies (EBs) were the same as ES-

DMEM but with 5% FBS and no LIF supplementation. EBs were generated using the hanging

drop method. 30µL drops containing 800 cells/drop were plated onto the lid of a 10cm2 tissue

culture dish (Corning) containing 5mL of PBS to prevent the drops from drying out. EBs were

maintained as hanging drops in a tissue culture incubator at 37⁰C and 5% CO 2 for 3 days and

74

then transferred to ultra-low-binding 96-well plates (Costar); differentiation medium was

changed every other day.

Immunofluorescence microscopy

Whole EBs were washed in PBS and fixed with ice-cold 4% paraformaldehyde/PBS

overnight at 4⁰C with gentle rocking. EBs were permeabilized with 0.5% Triton X-100/PBS (PBT)

at room temperature for 15 minutes twice with gentle rocking. They were then blocked in 2%

BSA/PBT for 1 hour and incubated with primary antibodies at 4⁰C overnight with gentle rocking.

EBs were gently washed 3 times in PBS before adding secondary antibody and TOPRO-3 iodide

(Invitrogen) and incubating at 4⁰C overnight with gentle rocking. Primary and secondary

antibodies were diluted to final working concentrations in 2% BSA/PBT. EBs were mounted

with ProLong gold anti-fade reagent (Invitrogen) after being gently washed 5 times in PBS.

Images were obtained with a Zeiss LSM510 confocal microscope and Leica Confocal Software.

Antibodies

The following primary antibodies were used for Western blot analysis and/or

immunofluorescent staining: mouse anti-V5 (Invitrogen R960-25), mouse β-actin (Abcam

ab6276), mouse anti-GAPDH (Abcam ab8245), mouse anti-β-catenin (BD Biosciences 610154),

rabbit anti-β-catenin (Cell Signaling Technology 9562), rabbit anti-Oct-4 (Santa Cruz sc-9081),

rabbit anti-PDK1 (Cell Signaling Technology 3062), rabbit anti-PKB (Cell Signaling Technology

9272), rabbit anti-PKB-S473 (Cell Signaling Technology 9271), rabbit anti-PKB-T308 (Cell

75

Signaling Technology 9275), rabbit anti-p70S6K-T389 (Cell Signaling Technology 9206), rabbit

anti-p70S6K-T371 (Cell Signaling Technology 9208).

For Western blot analysis, horseradish peroxidase-conjugated secondary antibodies

were purchased from Bio-Rad: goat anti-mouse (170-6516) and goat anti-rabbit (170-6515). For

immunofluorescent staining, fluorochrome-conjugated secondary antibodies were purchased

from Invitrogen: goat anti-mouse Alexa Fluor 488 (A11029) and goat anti-rabbit Alexa Fluor 468

(A11011).

RT-PCR

RNA was extracted from cells using TRIzol Reagent (Invitrogen) followed by cDNA

synthesis using SuperScript II Reverse Transcriptase (Invitrogen) according to manufacturer’s

instructions. The template for each PCR reaction was the cDNA obtained from 50 ng total RNA,

and the reactions were incubated in a BIO-RAD DNA Engine Dyad Peltier Thermal Cycler at 94⁰C

for 2 minutes, 30 cycles of 94⁰C for 30 seconds, 56⁰C for 30 seconds, and 68⁰C for 1 minute,

followed by a final extension at 68⁰C for 7 minutes. Primer sequences were forward: 5’-

AAGCCTGGCTCCAGAAGATCACAA-3’ and reverse: 5’-TTTGAGCCTTCA GCATCCTCCTGT-3’ for

Axin2 (Doble et al., 2007) and forward: 5’-TAGGCACCAGGGTGTGATGG-3’ and reverse: 5’-

CATGGCTGGGGTGTTGAAGG-3’ for β-actin (Storm et al., 2009).

76

CHAPTER 3

Analysis of activated PI3K signaling on teratoma formation

77

3.1 INTRODUCTION

The PI3K pathway lies downstream of hormonal receptors and receptor tyrosine kinase

(RTK)-mediated signaling to regulate vital biological processes such as cell survival and growth,

mitogenic signaling, migration, metabolic control, vesicular trafficking, degranulation, and

cytoskeletal rearrangement (reviewed in Katso et al., 2001). As described in Chapter 1, the

catalytic subunits of class I PI3Ks consist of four isoforms: p110α, p110β, p110δ and p110γ.

Deregulation of the PI3K pathway is linked to cell growth and proliferation, and occurs by

activating mutations in growth factor receptors or the PIK3CA locus coding for PI3Kα, by loss of

function of the lipid phosphatase and tensin homolog deleted in chromosome ten

(PTEN/MMAC/TEP1), by the up-regulation PKB/Akt, or via impairment of TSC1/2 (reviewed in

Zhao and Vogt, 2008).

Though the PI3K signaling pathway is one of the most frequently activated signal

transduction cascades in human cancer, and PKB is one of the most hyper-activated protein

kinases, it is extremely rare to find mutations in PKB itself (Samuels et al., 2004; Altomare and

Testa, 2005; Engelman et al., 2006). One known example is the E17K mutation in the PH

domain of PKB identified in ~4% of human breast, ovarian, and colorectal cancers, which leads

to association with the plasma membrane and constitutive activation of PKB (Carpten et al.,

2007). Interestingly, a number of cytokines, oncogenic growth factors, and angiogenic factors

lead to activation of PKB. Chronic stimulation of PKB promotes events that favor

tumorigenesis, such as cell survival, growth, and proliferation (reviewed in Cheng et al., 2005;

Yuan and Cantley, 2008; Hers et al., 2011). As mutations in PKB per se are rare, deregulation of

78

PKB activity typically results from mutation or altered expression of an upstream regulator of

PKB. Overexpression and activating mutations of upstream RTKs such as epidermal growth

factor receptor (EGFR) and human epidermal growth factor receptor 2 (HER2) have been

observed in human cancer, and lead to the activation of PKB (Giatromanolaki et al., 1996; Rusch

et al., 1997). Increased PKB signaling can also be induced by increased concentrations of

ligands, such as EGF and IGF-1 or decreased receptor turnover, resulting in more activated

receptors at the plasma membrane (Mukohara et al., 2003).

PI3K is also a well characterized effector pathway for Ras. Ras can directly bind to the

p110α catalytic subunit of PI3K in a GTP-dependent manner through the Ras effector site, and

this results in translocation of PI3K to the plasma membrane, leading to activation of PKB

signaling (Rodriguez-Viciana et al., 1994; Khwaja et al., 1997). Ras is mutated in approximately

25% of human tumors. These mutations act to inhibit hydrolysis of GTP, such that Ras remains

in its active GTP-bound form. Ras is involved in regulating cell proliferation, and when

constitutively activated, leads to uncontrolled cell growth, survival, and promotes invasiveness -

features involved in tumor development and progression (reviewed in Castellano and

Downward, 2011). PI3K is necessary for Ras-induced transformation in vitro, and is a vital

effector for Ras-driven tumorigenesis (Gupta et al., 2007). Mice with mutations in the PI3K

catalytic subunit p110α that block its ability to interact with Ras are highly resistant to

endogenous oncogenic K-Ras-induced lung tumorigenesis and H-Ras-induced skin

carcinogenesis. Deletion of PI3KCA causes a remarkable 95% reduction in a lung tumor model

driven by activated K-Ras (Johnson et al., 2001). Gupta et al., (2007) postulated that the failure

79

of tumors to develop in the PI3K mutant mice was due to lung epithelial cells expressing

activated Ras failing to activate PKB, which is directly required for their proliferation and

survival.

Teratomas are naturally occurring germ cell derived tumors that contain highly

organized tissues consisting of all three germ layers that represent abnormal, neoplastic

pathologies bearing genetic defects (Lensch et al., 2007). Teratomas are also a characterization

tool for stem cell research (reviewed in Aleckovic, 2008). In mice, experimentally induced

teratomas arise from ES cells injected into growth-permissive, ectopic sites, such as beneath

the testicular or kidney capsule or in the subcutaneous space. These teratomas tend to be

complex masses consisting of a range of differentiated somatic tissues, some of which appear

highly organized and resemble normal tissues found in the embryo and adult, including

respiratory epithelium (endoderm), cartilage and muscle (mesoderm), and neurons (ectoderm).

Teratoma formation in vivo is frequently used as a proof of differentiation capability and

is important for assessing the developmental potential of pluripotent stem cells. Interestingly,

Ritner and Bernstein (2010) developed a specialized teratoma formation assay to determine the

in vivo fate of selected or manipulated human ES cells. Standard characterization of stem cell

pluripotency usually begins with examining expression levels of markers of pluripotency, such

as Oct-4 and Nanog in vitro. In vivo teratoma formation is used as a functional proof of

pluripotency. In most studies, 104 to 106 stem cells are injected into severe combined

immunodeficiency (SCID) mice, and the teratomas are allowed to develop for several weeks

80

before the mice are sacrificed. Histological analysis is commonly used to characterize the

differentiation potential by looking for visually distinguishable tissue types, such as gut

epithelium, cartilage, and neuroectoderm, to confirm the presence of the three germ layers. In

this chapter, teratomas were formed from myr-PDK1 and PKB-DD ES cells and characterized by

histological analysis.

3.2 RESULTS

Equal initial numbers of myr-PDK1, PKB-DD, and host control ES cells were injected

subcutaneously into the hind limbs of SCID-beige mice and allowed to develop for three weeks.

The mice bearing myr-PDK1 and PKB-DD teratomas exhibited very large masses, in some cases

encompassing almost the entire hind limb such that their mobility was impeded. In contrast,

the mice injected with host control cells appeared unaffected and moved around normally; in

some cases the teratoma was so small it was barely palpable. Upon dissection, the size

difference between control and transgenic teratomas was noticeable (Fig. 3-1). In addition,

transgenic teratomas appeared to break through into surrounding muscle tissue, whereas host

control teratomas remained encapsulated within their borders (Fig. 3-2). Teratomas were

stained for V5 to ascertain the presence of transgene expression. As described in Chapter 2,

myr-PDK1 and PKB-DD cells were maintained in the presence of hygromycin due to loss of

transgene expression after serial passage in the absence of selection. As expected, V5 staining

in the teratomas is patchy in both myr-PDK1 and PKB-DD teratomas, and the transgene is not

expressed in every cell (Fig. 3-3).

81

host ctrl myr-PDK1

host ctrl

myr-PDK1 PKB-DD host ctrl PKB-DD PKB-DD

host ctrl PKB-DD myr-PDK1

Figure 3-1. Gross morphology of teratomas after 3 weeks of growth. The same number of cells were injected subcutaneously into the hind limbs of SCID-beige mice. To control for sidedness, different cell lines were injected into each hind limb of the same mouse and also in reverse so that each cell line had been injected into both the left and right sides of various animals. Mice bearing myr-PDK1 (n=35) and PKB-DD (n=15) teratomas exhibited impaired mobility, and teratomas appear larger than control (n=20) upon dissection. PKB-DD teratomas completely encompassed the entire hind limb, and could not be dissected as a whole; the PKB-DD teratoma pictured is the dorsal part of the mass.

82

host ctrl

myr-PDK1 myr-PDK1

host ctrl

V5

Figure 3-2. Histology of teratomas after 3 weeks of growth. Teratomas are stained purple, and the surrounding muscle fibers are pink. Host control teratomas are small and remain encapsulated, whereas myr-PDK1 teratomas grow into the surrounding muscle tissue. H&E stained; whole slide scanning, scale bar = 1mm.

83

Figure 3-3. myr-PDK1 and PKB-DD expression in teratomas. Teratomas were fixed, sectioned, and stained for the presence of the V5 tag (brownish red) to mark areas of protein expression. myr-PDK1 and PKB-DD expression is patchy throughout the teratoma. The boxed areas are magnified to show more detailed staining. Scale bar = 100μm.

myr-PDK1

host ctrl

PKB-DD

5X Mag. 20X Mag.

84

Histopathological examination of haematoxylin and eosin (H&E) stained tissue samples

revealed the presence of immature and mature features of tissues from all three germ layers

with the host control ES cell-injected tissue having smaller proportions of tissue and overall,

forming smaller teratomas. Many of the teratomas contained islands of epithelial tissue

resembling skin, including centers of keratinizing epithelium in some cases. The majority of the

teratomas contained regions with clusters of neuronal-like cells, including examples of gray

matter and squamous epithelium within nervous tissue. Most samples had abundant loose and

dense connective tissue, with some having more schirrous type connective tissue with similar

morphology to sarcomas. Muscle fibers and myocardial tissue can also be found. Scattered

throughout the tissues were duct-like structures lined by epithelial cells. Some duct-like

structures were lined by ciliated epithelium and some by mucous secreting cells - resembling

ciliated respiratory bronchiolar epithelium. In addition, some of these structures had many

goblet cells with a large mucous-filled apical cytoplasm. Many of the samples showed sloughed

epithelium, with necrotic debris in the lumen. Also scattered throughout the tissue were nests

of epithelium with epithelial cells that were large, round- to oval-shaped cells with a large

nucleus-to-cytoplasmic ratio (more like 1:2 in these cells; most normal cells have a ratio of 1:4

to 1:6) and large, very coarse, granular basophilic nuclei with prominent hyperchromatic

nucleoli. The nucleus to cytoplasmic ratio is an indicator of the maturity of a cell, because as a

cell matures, the size of its nucleus generally decreases. The epithelial nests were separated by

very fine fibrovascular stroma. There was a high proportion of mitotic figures as well as areas

of necrosis and apoptosis, indicating active cell division as well as cell death. The areas of

epithelial proliferation were interpreted as anaplastic, or poorly differentiated epithelial cells,

85

and this pattern of tissue architecture is reminiscent of basal cell carcinomas seen in mice and

in other species. Several of these areas have multiple duct-like structures that resemble neural

tubes, similar to those that can be found in teratocarcinomas. Moreover, some PKB-DD

teratomas contained blood-filled spaces and several small blood vessels, erythroid precursors,

and pools of mature red blood cells were found within myr-PDK1 teratomas. Other areas

showed the presence of more mature looking vessels, confirmed by CD31 staining of

endothelial cells (Fig. 3-4).

While handling the cells in tissue culture, myr-PDK1 cells needed to be passaged more

frequently than the host control cell line, and the PKB-DD cells even more so. When the same

number of cells were initially plated and allowed to grow over a period of 5 days, the myr-PDK1

cells grew at a faster rate than controls and PKB-DD cells grew the most quickly (Fig. 3-5a). In

analyzing the teratoma sections, overall, there was an increase in Ki67 staining compared to

caspase-3 staining (Fig. 3-5b). Staining was scored using a grading scheme based on the

proportion of tissue that contained positive signal: minimal (+ = <25% of the tissue), mild (++ =

26-50% of tissue), moderate (+++ = 51-75% of tissue) and complete (++++ = >75% of tissue).

Ki67 positive cells were present in fibroblasts, neurons, respiratory epithelial cells, and

teratocarcinoma structures. myr-PDK1 and PKB-DD teratomas were graded from mild to

moderate, whereas control samples were graded minimal. In all samples, the majority of the

positive Ki67 signal was found in the epithelial cells of the teratocarcinomas. So, the increased

staining of this cell type versus other cell types may be a bias of the grading scheme. Caspase-3

staining was found in neurons, respiratory epithelial cells, and teratocarcinomas structures.

86

host ctrl

myr-PDK1

Topro-3

Topro-3 CD31

CD31 Merged

Merged

CD31 Topro-3 CD31 Topro-3 host ctrl myr-PDK1

host ctrl myr-PDK1

A

B

C

Figure 3-4. Analysis of CD31 expression in teratomas. (a) Immunofluorescent staining of frozen teratoma sections for the endothelial cell marker, CD31. Positive staining for vessels is indicated by arrows. (b) Z-stack confocal image showing the presence of vessel-like structures in myr-PDK1 teratomas. Confocal, 40X mag. (c) Immunohistological staining of CD31 (brown) in host control and myr-PDK1 teratomas, scale bar = 100μm

87

Ki67 Caspase-3

myr-PDK1

host ctrl

PKB-DD

Figure 3-5. Analysis of cell numbers and survival. (a) An equal number of cells were plated and allowed to grow in standard tissue culture conditions. Cells were counted on days 3 and 5. (b) Immunohistological staining for Ki67 and Caspase-3 (brown) in teratomas. Scale bar = 100μm

B

A

1.00E+05

1.00E+06

1.00E+07

1.00E+08

Day 0 Day 3 Day 5

Num

ber o

f Cel

ls (l

og)

ES Cell Counts

host ctrl

myr-PDK1

PKB-DD

88

Host control teratoma samples were given a grade of mild for caspase-3, while myr-PDK1 and

PKB-DD teratoma samples were negative for caspase-3 staining.

To compare myr-PDK1 and PKB-DD teratomas to control teratomas of similar size, ES

cells were injected into SCID-beige mice, and teratomas were collected when they were just

palpable and between 5-10 mm in diameter. Due to their enhanced growth rate, PKB-DD and

myr-PDK1 teratomas were collected earlier than controls. Interestingly, when the teratomas

were small, there was no evidence of increased blood vessels or blood filled spaces, so it

appears that the increased hematopoeisis and angiogenesis seen in the large teratocarcinomas

is a function of tumor size. For a tumor to continue to grow, it must attract or supply itself with

blood for nutrient and waste exchange. While large myr-PDK1 and PKB-DD teratomas

differentiated into cells representing all three cell lineages, small myr-PDK1 and PKB-DD

teratomas tended to favor a nervous tissue phenotype. Complete Ki67 staining (75-90%) was

seen in myr-PDK1 and PKB-DD teratomas, whereas no evidence of Caspase-3 staining was

visible.

Though the increased number of blood vessels found in transgenic teratomas seemed to

be a function of the large tumor size, we were interested in investigating whether these blood

vessels were host- or donor-derived. In an in vitro assay, ES cells were driven to differentiate

into endothelial cells in culture. Since the cells lines tended to lose transgene expression after

serial passage in the absence of selection, a stable EGFP Flp-in ES cell line, which was generated

in the exact same manner as the myr-PDK1 and PKB-DD cell lines, acted as a control in the

89

presence of hygromycin selection. The control ES cells successfully differentiated into CD31-

positive endothelial cells, whereas the myr-PDK1 and PKB-DD ES cells did not fully differentiate

and stayed as compact colonies resembling differentiation impaired GSK-3 knockout ES cells

(Fig. 3-6). These colonies were lightly adherent, and tended to lift off the plate upon washing,

making it difficult to perform staining procedures. As such, we performed an in vivo assay

where the ES cell lines were injected into Tie2-GFP/Rag1-/- mice and allowed to develop for 3

weeks into teratomas. Tie2-driven GFP marks the host endothelial cells, and the V5 tag is a

marker of the donor myr-PDK1 or PKB-DD cells. After examining multiple regions throughout

the teratomas, from the periphery to the center, we found CD31-positive cells that were GFP-

positive, but were unable to find CD31-positive cells that were V5-positive, indicating that the

blood vessels infiltrating the teratomas are host-derived (Fig. 3-7). This is in accordance with

published literature where Gerecht-Nir et al. (2004) examined vasculogenesis within human ES

cell-derived teratomas, and reported that the main source of blood vessels developing within

the teratomas was provided by the murine host.

3.3 DISCUSSION

When transplanted into immunocompromised mice, pluripotent ES cells form teratomas

that consist of complex structures comprising differentiated cell types representing the major

germ line-derived lineages found during embryogenesis and in the adult. Today, formation of

teratomas from engrafted stem cells is seen as a standard proof for pluripotency. However,

bona fide pluripotency corresponds to the ability to colonize an organism entirely and give rise

to all its cell types. Thus, injection into tetraploid blastocysts represents the most rigorous test

90

GSK-3 DKO myr-PDK1 PKB-DD

Figure 3-6. In vitro endothelial differentiation assay. Cells were driven to differentiate into endothelial cells, which resemble a cobblestone-like morphology (arrows) and stain positive for CD31 by immunofluoresence, confocal, 40X mag. myr-PDK1 and PKB-DD failed to generate cobbestone-like cells and stayed as compact colonies resembling GSK-3 double knockout (DKO) cells, 10X mag.

EGFP Flp-In ctrl CD31

EGFP Flp-In ctrl

91

Figure 3-7. Teratoma formation in Tie2-GFP/Rag1-/- mice. Teratomas were allowed to develop for 3 weeks, and serial sections were stained separately for CD31, GFP, and V5 by immunohistochemisty. Representative fields were taken from the center of the masses. CD31-positive cells are GFP-positive; however, CD31-positive cells are not V5-positive. Scale bar = 100μm

host ctrl

CD31 V5

myr-PDK1

PKB-DD

CD31 GFP

host ctrl

myr-PDK1

PKB-DD

92

for pluripotentiality, because the resulting zygote consists only of injected donor stem cells that

form the entire embryo. By producing viable chimeric mice, Wernig et al. (2007) demonstrated

the pluripotency of iPS cells obtained from adult mouse skin fibroblasts that are able to

establish all cell lineages of the embryo, and hence have a similar developmental potential as ES

cells. In order to assess the true developmental potential of myr-PDK1 and PKB-DD ES cells,

production of viable chimeras will be important to prove, or disprove, capacity for full

differentiation. For example, GSK-3 null ES cells retain markers of pluripotency and remain

undifferentiated even when grown as teratomas. These cells fail to develop into embryos when

injected into blastocysts (Brad Doble, personal communication).

Teratomas could potentially serve as more than a proof of pluripotency due to their

unique properties, which can be applied to various research areas including embryogenesis,

tissue engineering, and studies of diseases. For example, teratomas may be a suitable model

for studying the biological properties of cancer within the context of a tumor

microenvironment. Teratomas provide a relatively facile experimental platform where human

cancer cells can be grown in the midst of a mixed population of normal differentiated cells for

investigating biological aspects of cancer biology, including tumor cell growth, proliferation

capacity, invasion, angiogenesis, or response to anti-cancer therapies (Tzukerman and Skorecki,

2006). Tzukerman et al. (2003) demonstrated that when HEY ovarian cancer cells stably

expressing a GFP fusion protein were injected into mature human teratomas in SCID-beige

mice, they developed into tumors after three weeks. This experimental approach allowed for

the tracking of tumor cell invasion and recruitment of human teratoma-derived blood vessels,

93

properties associated with malignancy. The observed growth, invasion, and human blood

vessel neoangiogenic response suggested that teratomas may be a valuable tool for

manipulating and studying the local microenvironment in tumor growth.

myr-PDK1 and PKB-DD teratomas grow more rapidly compared to controls, and exhibit

increased cell survival and cell proliferation. Activated PI3K signaling causes the constitutive

activation of downstream signaling molecules such as PKB, mTOR, and S6K that is commonly

observed in cancer cells (Arcaro and Guerreiro, 2007). The role of PKB in regulating cell survival

is well characterized. PKB signaling plays a crucial role in regulating cell survival by providing

cells with a survival signal that allows them to withstand apoptotic stimuli (Yao and Cooper,

1995). The role of PKB in regulating cell proliferation is less established, but there is evidence

that PI3K pathway activation leads to increased cell division. In hepatoblastoma, PI3K pathway

inhibition leads to a substantial increase in apoptosis and a decrease in cellular proliferation

linked to reduced Cyclin D1 and increased p27(KIP1) levels (Hartmann et al., 2009). In a recent

breast cancer study, Liu et al. (2011) examined whether expression of an activating mutation of

PIK3CA can initiate transformation of mammary epithelium using double transgenic mouse

mammary tumor virus (MMTV)-reverse tetracycline transcriptional activator (rtTA)/TetO-

PIK3CAH1047R mice, in which transgene expression is under the control of a tetracycline-inducible

promoter (TetO). The authors found that reduced cellular proliferation and increased apoptosis

were responsible for the initial phase of tumor regression after downregulation of oncogenic

PIK3CA. In tumors maintained on doxycycline, the authors reported a robust Ki67 signal and

only a few apoptotic cells. On the other hand, there were fewer proliferating cells after

94

doxycycline withdrawal with substantially more TUNEL-positive cells (Liu et al., 2011). Cell

growth is a prerequisite for cell cycle entry, because division requires induction of protein

synthesis and DNA duplication, and appropriate cell growth ensures that cell size and

composition are maintained in daughter cells. PI3K controls early and late events in

mammalian cell division, and may act as a coordinator of cell growth and cell cycle entry by

regulating mTOR and growth factor-induced activation of cyclin-dependent kinases (reviewed in

Garcia et al., 2006). When cells expressing PI3K mutants are stimulated with growth factors,

enhancement or reduction of transient PIP3 production accelerates or reduces protein synthesis

levels, respectively. In fact, these variations in PIP3 levels also affect cell cycle entry rates,

triggering changes in the time of division, but not in cell size (Alvarez et al., 2003). It has been

postulated that since growth factors induce increases in cyclin D levels required to activate

Cdk4 or Cdk6, which in turn lead to induction of cyclin E synthesis, by regulating cell growth,

PI3K may determine the level of cyclin E translation and the rate of S phase entry (Sherr and

Roberts, 1999; Garcia et al., 2006). Nonetheless, the precise mechanisms by which PI3K

coordinates cell growth and cell cycle progression have yet to be elucidated.

3.4 MATERIALS AND METHODS

Cell culture

ES cells were maintained on a MEF feeder layer in ES cell culture medium (ES-DMEM)

consisting of high glucose DMEM (Invitrogen) supplemented with 15% ES cell qualified FBS

(Hyclone), 50U penicillin/streptomycin (Invitrogen), 2mM GlutaMAX™ (Invitrogen), 0.1mM

MEM non-essential amino acids (Invitrogen), 1mM sodium pyruvate (Invitrogen), 0.1mM 2-

95

mercaptoethanol (Sigma), and 1000U/mL LIF (Millipore) at 37°C, 5% CO2. Cells were

maintained in the appropriate selection: 1.2µg/mL puromycin for the host cell line and

250µg/mL hygromycin for myr-PDK1 and PKB-DD cell lines. Before experiments, feeders were

removed, and ES cells were grown on plates coated with 0.1% gelatin (Sigma).

Teratoma formation

Cells grown for two passages on 0.1% gelatin-coated dishes to eliminate feeder

fibroblasts were trypsinized into single-cell suspensions and resuspended in PBS to a density of

107cells/mL. These cells (200 µL) were injected subcutaneously into the hind limbs of SCID-

beige mice (C.B-Igh-1bGbmsTac-Prkdcscid-LystbgN7) (The Jackson Laboratory), a strain of double-

mutant mice with impaired lymphoid development and reduced natural killer cell activity

(Przyborski, 2005), by using a 25 Ga needle. To control for possible sidedness, different cell

lines were injected into each hind limb of the same mouse and also in reverse so that each cell

line had been injected into both the left and right sides of various animals. Typically teratomas

were collected after 3 weeks. In a separate experiment, teratomas were collected when the

teratomas were just palpable and still small. The tissue was fixed with 10% neutral-buffered

formalin overnight at room temperature then stored in 70% ethanol for subsequent paraffin

embedding, sectioning, and histological and/or immunohistological staining. Samples were also

submerged in OCT and flash frozen in liquid nitrogen for subsequent frozen sectioning and

immunofluorescent staining.

96

Cell counting

200, 000 cells were plated in triplicate for each time points and grown under standard

ES cell tissue culture conditions. On days 3 and 5, adherent and floating cells from each plate

were collected and counted using a Beckman Coulter Z2 Coulter Particle Count and Size

Analyzer

Endothelial cell differentiation assay

Tissue culture plates were coated with a 250µg/mL collagen IV (Sigma) solution diluted

in PBS for 10 minutes and allowed to dry. After ES cells were trypsinized and resuspended,

3000 cells/well were plated into a 6-well tissue culture plate with α-MEM media containing 10%

FBS and the appropriate antibiotic selection. Medium was replaced on day 2, and cells were

screened for CD31-positive cells on day 7.

H&E staining

Sections from paraffin-embedded teratomas were dewaxed and rehydrated by

following standard procedures. Sections were treated with iodine for 5 minutes, washed, and

then treated with 3% sodium thiosulphate for 1 minute, and washed under running tap water.

Subsequently, slides were stained in Harris’ Haematoxylin for 5 minutes, washed, and rinsed in

95% ethanol before staining with eosin for 1 minute. Slides were then thoroughly washed in

running tap water, dehydrated in a series of alcohol rinses, and cleared in three changes of

xylene.

97

Immunohistological staining

Sections from paraffin-embedded teratomas were dewaxed and rehydrated by

following standard procedures. The following primary antibody concentrations were used:

chicken IgY anti-GFP (Invitrogen) 1:500, rabbit anti-RFP (Abcam) 1:400, rabbit anti-cleaved

Caspase-3 (Cell Signaling) 1:200, rabbit anti-Ki67 (Thermo Scientific) 1:100, and rabbit anti-CD31

(Abcam) 1:50. Antigen retrieval was performed using 10mM Sodium Citrate buffer for 20

minutes at 98⁰C. Kits specific for antigen detection in mouse tissues (Vector Labs and DAKO)

were used according to the manufacturers’ recommendations followed by DAB color

development.

Immunofluorescence microscopy

Tissues were embedded in OCT and flash frozen in liquid nitrogen. Frozen thick sections

were fixed with 4% PFA for 30 minutes, and permeabilized with 0.5% Triton X-100/PBS (PBT) at

room temperature for 1 hour. Samples were then blocked in 2% BSA/PBT for 1 hour and

incubated with primary CD31 (Clone MEC13.3, BD Pharmingen) antibody at 4⁰C overnight.

Tissues were gently washed 3 times in PBS before adding secondary antibody and TOPRO-3

iodide (Invitrogen) and incubating at 4⁰C overnight. Primary and secondary antibodies were

diluted to final working concentrations in 2% BSA/PBT. Samples were mounted with ProLong

gold anti-fade reagent (Invitrogen) after being gently washed several times in PBS. Images were

obtained with a Zeiss LSM510 confocal microscope and Leica Confocal Software.

98

CHAPTER 4

Discussion and future directions

99

4.1 PI3K signaling crosstalk

When this thesis project began in 2006, Dr. Brad Doble, a postdoctoral fellow in the

Woodgett Lab had recently generated and characterized GSK-3 double knockout (DKO) ES cells

and found that ES cells lacking all four alleles of GSK-3 exhibited a block in differentiation

capacity, as well as hyperactive Wnt/β-catenin signaling (Doble et al., 2007). This pioneering

work in stem cell biology proved β-catenin to be a bona fide GSK-3 target, and showed that the

increased β-catenin accumulation seen in GSK-3 DKO cells is indeed correlated to functional

changes of β-catenin in the cell nucleus. As such, the GSK-3 DKO ES cell phenotype is largely

mediated by the Wnt pathway. Since GSK-3 is an important component of both the Wnt and

PI3K signal transduction cascades, we sought to investigate the role of PI3K in regulating stem

cell pluripotentiality by generating and characterizing isogenic stable ES cell lines expressing

constitutive active alleles of PDK1 and PKB. The results of this work are presented in the

preceding chapters.

Of much recent interest is the possibility of crosstalk between the Wnt and PI3K

pathways through PKB phosphorylation of GSK-3 on Ser9/Ser21, and GSK-3 inhibition of β-

catenin as part of the Wnt regulated destruction complex. Is GSK-3 the common link between

the two pathways? As previously discussed in section 1.4, this has been a controversial topic of

discussion which has yet to be resolved. A study by Ding et al., (2000) indicated that the two

pathways do not crosstalk at the level of GSK-3. The authors reported that insulin induces

increased activity of glycogen synthase but has no influence on β-catenin protein levels, while

Wnt increases the cytosolic pool of β-catenin but not glycogen synthase activity. They also

100

found that, unlike insulin, neither the phosphorylation of GSK-3β on Ser9 nor the activity of PKB

is regulated by Wnt (Ding et al., 2000). However, since GSK-3 is a key component of both the

PI3K and Wnt pathways, many continue to assume that active PI3K signaling positively

regulates Wnt signaling by PKB-mediated inhibition of GSK-3. There are several studies since

2000 that report direct stabilization of β-catenin by the PI3K/PKB pathway (Sharma et al., 2002;

Agarwal et al., 2004; Gherzi et al., 2006; Fang et al., 2007). Interestingly, the discussion

continues as Ng et al. hypothesized that β-catenin/TCF-driven transcription would be activated

in tumors harboring PI3K-activating mutations if indeed GSK-3 represented the central node of

crosstalk between the two pathways. They tested a large panel of breast and prostate cancer

cell lines, and concluded that constitutive activation of the PI3K/PKB pathway does not

modulate Wnt-mediated transcriptional activity (Ng et al., 2009).

Generation and analysis of the myr-PDK1 and PKB-DD ES cell lines showed they

maintained a pluripotent phenotype. Given the GSK-3 DKO cells’ defect in differentiation, we

considered the potential for crosstalk between pathways and investigated whether the level of

β-catenin was induced in the cells with activated PI3K signaling. We concluded that in these

particular systems, active PI3K signaling did not result in a change in cytosolic β-catenin levels,

and in fact, maintenance of self-renewal in the transgenic cell lines was found to be GSK-3

independent. We were not surprised by this result given that Watanabe et al. (2006) reported

that the undifferentiated phenotype of myr-Akt-expressing mouse ES cells is independent of β-

catenin signaling. These authors showed by immunofluorescence that β-catenin is localized in

the plasma membrane with no observed nuclear accumulation in myr-Akt cells, and there was

101

no significant increase in transcriptional activity of the β-catenin/TCF complex. We confirmed

the independence of the PI3K and Wnt signaling pathways by using a genetically controlled

system in which a GSK-3 ser9 mutant is stably introduced into a GSK-3 DKO background, and

thus cannot be phosphorylated by PKB. Unlike previous reports, this system disconnects the

two pathways, and presents stronger evidence that enhanced PI3K signaling does not affect β-

catenin accumulation through PKB regulation of GSK-3. Furthermore, we present a novel

finding that the maintenance of Oct-4 expression by myr-PDK1 is GSK-3-independent.

Though the dedifferentiated GSK-3 DKO phenotype is mediated by Wnt/β-catenin

(Doble et al., 2007), the myr-PDK1 ES cell phenotype appears to be mediated by enhanced PI3K

signaling but not via β-catenin. Indeed, myr-PDK1/PKB-DD and GSK-3 DKO ES cells exhibit

different cellular phenotypes. In culture, myr-PDK1 and PKB-DD cells grow more quickly and

require more frequent passaging, whereas GSK-3 DKO ES cells tend to act more like normal ES

cells in their growth rate. Likewise, myr-PDK1 and PKB-DD teratomas, but not GSK-3 DKOs,

exhibit a much faster growth rate in vivo. The differentiation profiles of the cells are also very

dissimilar. Teratomas generated from GSK-3 DKO ES cells have a grossly undifferentiated

carcinomatous appearance and a complete absence of neuronal tissue, with the only

differentiated structures observed being spicules of bone (Doble et al., 2006). In contrast,

teratomas generated from myr-PDK1 and PKB-DD ES cells show cell types and structures from

all three germ layers, and actually show a preference towards the neuronal lineage. These

differences support our notion that PI3K and Wnt signaling act in distinct pathways with respect

to control of cell fate.

102

Although PI3K and Wnt signaling pathways share GSK-3 as a common regulatory

protein, mechanisms exist to insulate these pathways to prevent crosstalk. Approximately 95%

of GSK-3 must be inhibited in order to significantly increase β-catenin levels (Doble et al., 2007).

Axin, which is present at ~5% of the cellular levels of GSK-3, may shield the tightly associated

fraction of GSK-3 within the destruction complex from other protein kinases like PKB that can

phosphorylate and inactivate GSK-3 (Ng et al., 2009). Although the pool of GSK-3 that is not

directly associated with the complex may still be inhibited by PI3K-dependent mechanisms, the

GSK-3 molecules associated with the Axin complex are entirely sufficient to maintain

suppression of β-catenin accumulation (Voskas et al., 2010). Several publications that report

direct convergence between the PI3K and Wnt pathways are studied under the context of

unnatural genetic and chemical manipulation or cancerous disease states (Desbois-Mouthon et

al., 2001; Sharma et al., 2002; Agarwal et al., 2004). Under these circumstances, normal

insulation mechanisms that permit shared signaling components between pathways, while

maintaining the integrity of these pathways and resultant biological processes, may be

perturbed. Moreover, these insulating mechanisms may not be equally relevant or effective in

all tissues or cell types, so it would be prudent to restrict generalizations across biological

systems based on single studies. To address the normal biologically relevant mechanisms and

circumstances by which the PI3K pathway might impact β-catenin regulation, future

experiments will need to be conducted with cells or tissues that lack GSK-3 or β-catenin, and

have increased sensitivity to upstream manipulation of growth factor or Wnt signaling. In

addition, generation of cell lines in which components of the PI3K pathway can be rapidly

activated, such as using PKB-estrogen receptor fusions (Jin and Woodgett, 2005), for example,

103

should allow investigators to evaluate whether β-catenin levels are induced within the

expected time frame (β-catenin accumulation requires >30 minutes) (Voskas et al., 2010).

In mouse ES cells, enhanced PKB signaling maintains the undifferentiated state

independent of the STAT-3, ERK and β-catenin signaling pathways (Watanabe et al., 2006). It

will be interesting to investigate whether PI3K signaling coverges with other signal transduction

cascades such as Notch or Hedgehog, since GSK-3 has also been directly implicated in the

suppression of those pathways. A study by Palomero et al. (2007) identifies loss of PTEN as a

critical event leading to resistance to Notch inhibition in human T-ALL. In the absence of PTEN,

PKB signaling leads to aberrant pro-survival and proliferative signaling independent of Notch1

pathway activity, thus leading to resistance to Notch1 inhibition. PKB regulates Myc activation

through the inhibition of GSK-3-mediated inactivation of the Myc protein (reviewed in Gutierrez

and Look, 2007). The following year, the same group investigated the transcriptional regulatory

networks downstream of oncogenic Notch1, and found that the central role that Notch1 plays

in promoting leukemic cell growth is connected to Myc and the PI3K pathway (Palomero et al.,

2008; reviewed in Palomero and Ferrando, 2008). It would be interesting to determine

whether similar interactions between the Notch and PI3K pathways also occur in other types of

human cancers and to assess whether this is mediated via GSK-3. As described in Section 1.3,

GSK-3 is a core component of the Hedgehog signaling pathway and there is recent evidence

suggesting that the SHH and PI3K signaling pathways interact in promoting myogenic

proliferation and differentiation (Madhala-Levy et al., 2011). In order to delineate possible

crosstalk between the SHH and PI3K pathways, a system with a GSK-3 null background would

104

be suitable. For example, it would be interesting to generate and characterize stable cell lines

in which an activating SHH mutation is introduced into cells that only express GSK-3β S9A. In

such a system, there is no wild type GSK-3, and one can more clearly investigate whether PI3K

signaling through phosphorylation and inactivation of GSK-3 directly affects SHH targets.

4.2 Stem cell heterogeneity

During normal embryonic development, pluripotency exists as a transitory state where

ES cells are present only during a brief window of development. Totipotent cells of the embryo

become restricted in their developmental potential during embryogenesis, becoming either

progenitors that form extra-embryonic tissues or progenitors which form the three primary

germ layers that constitute the organism. As the embryo develops, progenitor cells lose their

potency range as they differentiate. In contrast, stem cells derived from these pluripotent or

multipotent embryonic cells can be maintained indefinitely in a state of self-renewal under

specific tissue culture conditions. There is increasing evidence for stem cell heterogeneity in

recent years. In mice, different types of pluripotent stem cells, such as ES cells, early primitive

endoderm-like (EPL) cells, and epiblast stem cells (EpiSCs), and lineage-restricted stem cells

such as trophoblast stem (TS) cells and extra-embryonic endoderm (XEN) stem cells, have

distinct phenotypes, and can be derived from the embryo directly, suggesting that these cells

have reached different states of developmental potential, and that the pluripotent state is not a

distinct state but rather a continuum of states (reviewed in Pera and Tam, 2010).

105

Although myr-PDK1 and PKB-DD ES cells maintain Oct-4 and differentiate into cells and

tissues representing all three germ layers in teratomas, it remains to be determined exactly in

what state of pluripotency these cells rest in the pluripotency continuum. The observation that

myr-PDK1 and PKB-DD ES cells have a preference to differentiate into the neuronal lineage first

suggests that these cells may not be fully pluripotent and may exhibit a predilection towards

commitment to neuronal progenitor cells. Similar to the in vitro endothelial cell differentiation

assay, driving the cells to differentiate into specific cell lineages may shed light on the cells’

differential capacity and tendencies. Based on the teratoma data, we would expect myr-PDK1

and PKB-DD ES cells to be more likely to generate neurospheres and differentiate into terminal

neuronal lineages. In addition, it would be interesting to allow the cells to differentiate

randomly, and perform microarray analysis to see which lineage-specific genes are prominent,

and whether neuronal markers are in fact up-regulated. Moreover, Andras Nagy’s group at the

Samuel Lunenfeld Research Institute is currently heading a large-scale data mining study called

Project Grandiose, in which somatic cells are reprogrammed into iPS cells, and at each day of

the over 30 day reprogramming process, cells are profiled using a variety of “-omics” tools

currently available. Their objective is to generate a comprehensive profile of the continuum of

the states of pluripotency, de-differentiation and lineage commitment. Aligning the myr-PDK1

and PKB-DD profiles to that of Project Grandiose may elucidate the state of pluripotency of

these cells.

106

4.3 Clinical implications

ES cells are valuable because they possess unique properties that allow researchers to

learn about early developmental processes that are otherwise inaccessible, study diseases, and

establish strategies that could lead to therapies designed to restore or replace damaged tissues.

Currently, blood stem cells are the most frequently used stem cells for therapy. For the last 50

years, physicians have been using bone marrow transplants to transfer blood stem cells to

patients, and more advanced techniques for collecting blood stem cells are now being used to

treat leukemia, lymphoma, and several inherited blood disorders. Umbilical cord blood, like

bone marrow, is often collected as a source of blood stem cells and in certain cases, is being

used as an alternative to bone marrow transplantation. Acute promyelocytic leukaemia (APL) is

an example of a disease that has been cured through targeted therapies by removing the block

to normal myeloid differentiation thought to be caused by the fusion oncogene, promyelocytic

leukaemia (PML)–retinoic acid receptor α (RARα) (reviewed in de Thé and Chen, 2010). Other

stem cell treatments are still at early experimental stages, but appear promising. In October,

2010, Geron announced the initiation of a clinical trial involving human ES cell-derived

oligodendrocyte progenitor cells, GRNOPC1. GRNOPC1 contains hESC-derived oligodendrocyte

progenitor cells that have demonstrated remyelinating and nerve growth stimulating

properties, leading to restoration of function in animal models of acute spinal cord injury. The

main objective of this Phase I study is to assess the safety and tolerability of GRNOPC1 in

patients with complete American Spinal Injury Association (ASIA) Impairment Scale grade A

thoracic spinal cord injuries (Geron news release). This is the first clinical trial involving human

ES cells, and hence an important milestone in the field of human ES cell-based therapies.

107

Before stem cells can be used to treat a wide range of diseases, several challenges must

be addressed. Firstly, it is important to have a close match between the donor tissue and the

recipient to minimize the risk of rejection or graft-versus-host disease. As such, iPS cells are

very attractive, because they can be used to generate pluripotent stem cell lines that are

specific to a particular disease or even to an individual patient for personalized medicine.

Disease-specific stem cells can be a useful tool for drug testing, and development of patient-

specific stem cells can have a major advantage in reducing the serious complications of

rejection and immunosuppression that can occur after transplants from unrelated donors.

However, iPS cells are often produced using viruses, and it is important to establish methods of

reprogramming that are safe for clinical use. Currently, the processes for the generation of iPS

cells are complex, time-consuming, and not yet standardized. Secondly, a reliable system for

delivering the donor cells to the right location, and having the new cells integrate and function

together with other cells in the body, is necessary. Stem cells are affected by their

microenvironment, and it is important to elucidate how different stem cell niches and other

extrinsic factors dictate stem cell behavior. Finally, it is important to identify ways to generate

an abundant source of homogeneous stem cells, especially in the case of rare adult stem cells.

Unlike mouse ES cells, physically isolated single human pluripotent stem cells do not survive

well in vitro during serial passage (Hope and Bhatia, 2011). Given the role of the PI3K-PKB

pathway in promoting cell survival, and recent evidence that PI3K signaling drives

hematopoietic stem and progenitor cell expansion by inducing proliferation while

simultaneously inhibiting apoptosis (Perry et al., 2011), it may be useful to investigate how

various components of the PI3K cascade regulate human ES cells by generating transgenic

108

human ES cell lines. Perhaps the introduction of a drug-inducible, activated allele of PDK1 or

PKB may enable human cells to grow robustly in culture. If this is indeed that case, finding

drugs that transiently activate the pathway when required or designing a transgenic system

where the transgene can be easily and safely removed before transplanting into patients would

be important. On the other hand, since the PI3K pathway is frequently mutated in human

cancers, and acts to maintain cell survival (reviewed in Chen et al., 2011), considering

combinatorial therapy by including an appropriate PI3K inhibitor may help to decrease

proliferation and induce apoptosis where required. Thus, the PI3K signaling cascade remains an

attractive potential target for cancer therapies.

109

BIBLIOGRAPHY

110

Abkowitz, J.L. and Chen., J. Studies of c-Mpl function distinguish the replication of hematopoietic stem cells from the expansion of differentiating clones. Blood, 2007, 109: 5186-90.

Agarwal, A., Das, K., Lerner, N., Sathe, S., Cicek, M., Casey, G., and Sizemore, N. The AKT/I kappa B kinase pathway promotes angiogenic/metastatic gene expression in colorectal cancer by activating nuclear factor-kappa B and beta-catenin. Oncogene, 2004, 24: 1021-31.

Akiyoshi, T., Nakamura, M., Koga, K., Nakashima, H., Yao, T., Tsuneyoshi, M., Tanaka, M., and Katano, M. Gli1, downregulated in colorectal cancers, inhibits proliferation of colon cancer cells involving Wnt signaling activation. Gut, 2006, 55: 991-9.

Aleckovic, M. Is teratoma formation in stem cell research a characterization tool or a window to developmental biology? Reprod., BioMed., Online, 2008, 2: 270-80.

Alessi, D.R., Andjelkovic, M., Caudwell, B., Cron, P., Morrice, N., Cohen, P., and Hemmings, B.A. Mechanism of activation of protein kinase B by insulin and IGF-1. EMBO J., 1996, 15: 6541-51.

Al-Hajj, M., Wicha, M.S., and Benito-Hernandez, A. Prospective identification of tumorigenic breast cancer cells. PNAS, 2003, 100: 3983–3988.

Altomare, D.A., and Testa, J.R. Perturbations of the AKT signaling pathway in human cancer. Oncogene, 2005, 24: 7455-64.

Amabile, G., and Meissner, A. Induced pluripotent stem cells: current progress and potential for regenerative medicine. Trends Mol. Med., 2009, 15: 59-68.

Arcaro, A., and Guerreiro, A.S. The phosphoinositide 3-kinase pathway in human cancer: genetic alterations and therapeutic implications. Curr. Genomics, 2007, 8: 271-306.

Armstrong, L., Hughes, O., Yung, S., Hyslop, L., Stewart, R., Wappler, I., Peters, H., Walter, T., Stojkovic, P., Evans, J., Stojkovic, M., and Lako, M. The role of PI3K/AKT, MAPK/ERK and NFkappabeta signaling in the maintenance of human embryonic stem cell pluripotency and viability highlighted by transcriptional profiling and functional analysis. Hum. Mol. Genet., 2006, 15: 1894-913.

Attisano, L., Cárcamo, J., Ventura, F., Weis, F.M., Massagué J, and Wrana JL. Identification of human activin and TGF beta type I receptors that form heteromeric kinase complexes with type II receptors. Cell, 1993, 75: 671-80.

Azura, V., Perry, P., Sauer S., Spivakov, M., Jørgensen, H.F., John, R.M., Gouti, M., Casanova, M., Warnes, G., Merkenschlager, and M., Fisher, A.G. Chromatin signatures of pluripotent cell lines. Nat. Cell Biol., 2006, 8: 532-8.

111

Bader, A.G., Kang, S., and Vogt, P.K. Cancer-specific mutations in the PI3KCA are oncogenic in vivo. PNAS, 2006, 103: 1475-9.

Bader, A.G., Kang S., Zhao, L., and Vogt, P.K. Oncogenic PI3K deregulates transcription and translation. Nat. Rev. Cancer, 2005, 5: 921-9.

Bardeesy, N., Cheng, K.H., Gerger, J.H., Chu, G.C., Pahler, J., Olson, P., Hezel, A.F., Horner, J., Lauwers, G.Y., Hanahan, D., and DePinho, R.A. Smad4 is dispensable for normal pancreas development yet critical in progression and tumor biology of pancreas cancer. Genes and Development, 2006, 20: 3130-46.

Bayascas, J.R. Dissecting the role of the 3-phosphoinositide-dependent protein kinase-1 (PDK1) signaling pathways. Cell Cycle, 2008, 19: 2978-82.

Beachy, P.A., Karhadkar, S.S., and Berman, D.M. Tissue repair and stem cell renewal in carcinogenesis. Nature, 2004, 432: 324–31.

Bechard, M., and Dalton, S. Subcellular localization of glycogen synthase kinase 3β controls embryonic stem cell self-renewal. Mol. Cell. Biol., 2009, 29: 2092-104.

Becker, A.J., McCulloch, E.A., and Till, J.E. Cytological demonstration of the clonal nature of spleen colonies derived from transplanted mouse marrow cells. Nature, 1963, 197: 452-4.

Bellacosa, A., Testa, J.R., Stall, S.P., and Tsichlis, P.N. A retroviral oncogene, akt, encoding a serine-threonine kinase containing an SH2-like region. Science, 1991, 254: 274-7.

Benchabane, H., Hughes, E.G., Takacs, C.M., Baird, J.R., and Ahmed, Y. Adenomatous polyposis coli is present near the minimal level required for accurate graded responses to the Wingless morphogen. Development, 2008, 135: 963-71.

Bird, A.P., and Wolffe, A.P. Methylation-induced repression—belts, braces, and chromatin. Cell, 1999: 451-4.

Bolos, V., Grego-Bessa, J., and de la Pompa, J.L. Notch signaling in development and cancer. Endocr. Rev., 2007, 28: 339-63.

Bone, H.K., Daminao, T., Bartlett, S., Perry, A., Letchford, J., Sanchez Ripoll, Y., Nelson, A.S., and Welham, M.J. Involvement of glycogen synthase kinase-3 in regulation of murine embryonic stem cell self-renewal revealed by a series of bisindolymaleimides. Chem. Biol., 2009, 16: 15-27.

Bonnet, D., and Dick, J.E. Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat. Med., 1997, 3: 730–7.

112

Borycki, A., Brown, A.M., and Emerson, C.P. Jr. Shh and Wnt signaling pathways converge to control Gli gene activation in avian somites. Development, 2000, 127: 2075–87.

Boyer, L.A., Mathur, D., and Jaenisch, R. Molecular control of pluripotency. Curr. Opin. Genetics & Development, 2006, 16: 1-8.

Briscoe, J. Making a grade: Sonic Hedgehog signaling and the control of neural cell fate. EMBO J., 2009, 28: 457-65.

Brugge, J., Hung, M., and Mills, M.C. A new mutational AKTivation in the PI3K pathway. Cancer Cell, 2007, 12: 104-7.

Cakir, M., and Grossman, A.B. Targeting MAPK (Ras/ERK) and PI3K/Akt pathways in pituitary tumorigenesis. Expert Opin. Ther. Targets, 2009, 13: 1121-34.

Canham, M., Sharov, A., Ko, M., and Brickman, J.M. Functional heterogeneity of embryonic stem cells revealed through translational amplification of an early endodermal transcript. PloS Biol., 2010, 8: e1000379

Cantrell, D.A. Phosphoinositide 3-kinase signaling pathways. J. Cell Sci., 2001, 114: 1439-45.

Castello E., and Downward, J. RAS interaction with PI3K: more than just another effector pathway. Genes and Cancer, 2011, 2: 261-74.

Carpten, J.D., Faber, A.L., Horn, C., Donoho, G.P., Briggs, S.L., Robbins, C.M., Hostetter, G., Boguslawski, S., Moses, T.Y., Savage, S., Uhlik, M., Lin, A., Du, J., Qian, Y.W., Zeckner, D.J., Tucker-Kellogg, G., Touchman, J., Patel, K., Mousses, S., Bittner, M., Schevitz, R., Lai, M.H., Blanchard, K.L., and Thomas, J.E. A transforming mutation in the pleckstrin homology domain of AKT1 in cancer. Nature, 2007, 448: 439-44.

Chambers, I., Colby, D., Robertson, M., Nichols, J., Lee, S., Tweedie, S., and Smith, A. Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell, 2003, 113: 643-55.

Chambers, I., Silva, J., Colby, D., Nichols, J., Nijmeijer, B., Robertson, M., Vrana, J., Jones, K., Grotewold, L., and Smith, A. Nanog safeguards plruipotency and mediates germline development. Nature, 2007, 450: 1230-8

Chambers, I., and Smith, A. Self-renewal of teratocarcinoma and embryonic stem cells. Oncogene, 2004, 23: 7150-60.

Chen, Y., Wang, B.C., and Xiao, Y. PI3K: A potential therapeutic target for cancer. J. Cell. Physiol., 2011, doi: 10.1002/jcp.23038.

113

Cheng, J.Q., Lindsley, C.W., Cheng, G.Z., Yang, H., and Nicosia, S.V. The Akt/PKB pathway: molecular target for cancer drug discovery. Oncogene, 2005, 24: 7482-92.

Cheung, H.O., Zhang, X., Ribeiro, A., Mo, R., Makino, S., Puviindran, V., Law, K.K., Briscoe, J., and Hui, C.C. The kinesin protein Kif7 is a critical regulator of Gli transcription factors in mammalian hedgehog signaling. Sci. Signal., 2009, 2: ra29.

Cohen, P., Alessi, D.R., and Cross, D.A. PDK1, one of the missing links in insulin signal transduction? FEBS Lett., 1997, 410: 3-10.

Collins, F.J., Deak, M., Aurthur, J.s., Armit, L.J., and Alessi, D.R. In vivo role of PIF-binding docking site of PDK1 defined by knock-in mutation. EMBO J., 2003, 22: 4202-11.

Cooper, A.F., Yu, K.P., Brueckner, M., Brailey, L.L., Johnson, L., McGrath, J.M., and Bale, A.E. Cardiac and CNS defects in a mouse with targeted disruption of suppressor of fused. Development, 2005, 132: 4407-17.

Corbit, K.C., Aanstad, P., Singla, V., Norman, A.R., Stainier, D.Y., and Reiter, J.F. Vertebrate Smoothened functions at the primary cilium. Nature, 2005, 437: 1018-21.

Cross, D.A., Alessi, D.R., Cohen, P., Andjelkovich, M., and Hemmings, B.A. Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature, 1995, 378: 785-9.

Cwinn, M.A., Mazerolle, C., McNeill, B., Ringuette, R., Thurig, S., Hui, C.C., and Wallace, V.A. Suppressor of fused is required to maintain the multipotency of neural progenitor cells in the retina. J. Neurosci., 2011, 31: 5169-80.

Dani, C., Chambers, I., Johnstone, S., Roberton, M., Ebrahimi, B., Saito, M., Taga, T., Li, M., Burdon, T., Nichols, J., and Smith, A. Paracrine induction of stem cell renewal by LIF-deficient cells: a new ES cell regulatory pathway. Dev. Biol., 1998, 203: 149-62.

Darnell, J.E. Validating Stat3 in cancer therapy. Natural Medicines, 2005, 11: 595-6.

Das, I., Craig, C., Funahashi, Y., Jung, K.M., Kim, T.W., Byers, R., Weng, A.P., Kutok, J.L., Aster, J.C., and Kitajewski, J. Notch oncoproteins depend on gamma-secretase/presenilin activity for processing and function. J. Biol. Chem., 2004, 279: 30771-80.

Davies, M.A. Stemke-Hale, K., Tellez, C., Calderone, T.L., Deng, W., Prieto, V.G., Lazar, A.J., Gershenwald, J.E., and Mills, G.B. A novel AKT3 mutation in melanoma tumors and cell lines. Br. J. Cancer, 2008, 99: 1265-8.

Davis, L.A., and Zur Nieden, N.I. Mesodermal fate decisions of a stem cell: the Wnt switch. Cell. Mol. Life Sci., 2008, 65: 2658-74.

114

Deregowski, V., Gazzerro, E., Priest, L., Rydziel, S., and Canalis, E. Role of the RAM domain and ankyrin repeats on notch signaling and activity in cells of osteoblastic lineage. J. Bone Miner. Res., 2006, 8: 1317-26.

Desbois-Mouthon, C., Cadoret, A., Blivet-Van Eggelpoël, M.J., Bertrand, F., Cherqui, G., Perret, C., and Capeau, J. Insulin and IGF-1 stimulate the beta-catenin pathway through two signaling cascades involving GSK-3beta inhibition and Ras activation. Oncogene, 2001, 20: 252-9.

de Thé, H., and Chen, Z. Acute promyelocytic leukaemia: novel insights into the mechanisms of cure. Nat. Rev. Cancer., 2010, 10: 775-83.

Ding, V.W., Chen, R.H., and McCormick, F. Differential Regulation of Glycogen Synthase Kinase 3β by Insulin and Wnt Signaling. J. Biol. Chem., 2000, 275: 32475-81.

Doble, B.W, Patel S., Wood, G.A., Kockeritz, L.K., and Woodgett, J.R. Functional redundancy of GSK-3alpha and GSK-3beta in Wnt/beta-catenin signaling shown by using an allelic series of embryonic stem cell lines. Dev. Cell, 2007, 12: 857-71.

Doble, B.W. and Woodgett, J.R. GSK-3: tricks of the trade for a multi-tasking kinase. J. Cell Sci., 2003, 116: 1175-86.

Dontu, G., Jackson, K.W., McNicholas, E., Kawamura, M.J., Abdallah, W.M., and Wicha, M.S. Role of Notch signaling in cell-fate determination of human mammary stem/progenitor cells. Breast Cancer Res., 2004, 6: R605-R615.

Dreesen, O. and Brivanlou, A.H. Signaling pathways in cancer and embryonic stem cells. Stem Cell Rev., 2007, 3: 7-17.

Dvorak, P., Dvorakova, D., and Hampl, A. Fibroblast growth factor signaling in embryonic and cancer stem cells. FEBS Lett., 2006, 580: 2869-74.

Endoh-Yamagami, S., Evangelista, M., Wilson, D., Wen, X., Theunissen, J.W., Phamluong, K., Davis, M., Scales, S.J., Solloway, M.J, de Sauvage, F.J., and Peterson, A.S. The mammalian Cos2 homolog Kif7 plays an essential role in modulating Hh signal transduction during development. Curr. Biol., 2009, 19: 1320-6.

Engelman, J.A., Luo, J., and Cantley, L.C. The evolution of phosphatidylinositol 3-kinase as regulators of growth and metabolism. Nat. Rev. Genetics, 2006, 7: 606-19.

Evans, M.J., and Kaufman, M.H. Establishment in culture of plruipotential cells from mouse embryos. Nature, 1981, 292: 154-6.

115

Fang, D., Hawke, D., Zheng, Y., Xia, Y., Meisenhelder, J., Nika, H., Mills, G.B., Kobayashi, R., Hunter, T., and Lu, Z. Phosphorylation of beta-catenin by AKT promotes beta-catenin transcriptional activity. J. Biol. Chem., 2007, 282: 11221-9.

Friedman, R.C., Farth, K.K., Burge, C.B., and Bartel, D.P. Most mammalian mRNAs are conserved targets of microRNAs. Genome Res., 2009, 92-105.

Garcia, Z., Kumar, A., Marques, M., Cortes, I., and Carrera, A.C. Phosphoinositide 3-kinase controls early and late events in mammalian cell division. EMBO J., 2006, 25: 655-61.

Gerecht-Nir, S. Osenberg, S., Nevo, O., Ziskind, A., Coleman, R., and Itskovitz-Eldor, J. Vascular development in early human embryos and in teratomas derived from human embryonic stem cells. Biol. Reprod., 2004, 71: 2029-36.

Gharaee-Kermani, M., Gyetko, M.R., Hu, B., and Phan, S.H. New insights into the pathogenesis and treatment of idiopathic pulmonary fibrosis: a potential role for stem cells in the lung parenchyma and implications for therapy. Pharm. Res., 2007, 24: 819-41.

Gherzi, R., Trabucchi, M., Ponassi, M., Ruggiero, T., Corte, G., Moroni, C., Chen, C.Y., Khabar, K.S., Andersen, J.S., and Briata, P. The RNA-binding protein KSRP promotes decay of beta-catenin mRNA and is inactivated by PI3K-AKT signaling. PLoS Biol., 2006, 5: e5.

Giatromanolaki, A., Koukourakis, M.I., O'Byrne, K., Kaklamanis, L., Dicoglou, C., Trichia, E., Whitehouse, R., Harris, A.L., and Gatter, K.C. Non-small cell lung cancer: c-erbB-2 overexpression correlates with low angiogenesis and poor prognosis. Anticancer Res., 1996, 16: 3819-25.

Gilbert, S.F. Developmental biology (Sixth Edition), 2000, Sinauer Associates, Inc., Sunderland, pp. 25-27 and 223-8.

Giles, R.H., van Es, J.H., and Clevers, H. Caught up in a Wnt storm: Wnt signaling in cancer. Biochimica et Biophysica Acta, 2003, 1653: 1-24.

Goetz, S.C., Ocbina, P.J., and Anderson, K.V. The primary cilium as a Hedgehog signal transduction machine. Methods Cell Biol., 2009, 94: 199-222.

Gomperts, B.D., Kramer, I.M., and Tatham, P.E.R. Signal Transduction: Second Edition. Elsevier Inc., 2009: 327-37.

Gringras, A.C., Raught, B., and Sonenberg, N. Regulation of translation initiation by FRAP/mTOR. Genes Dev., 2001, 15: 807-26.

Gu, D., Yu, B., Zhao, C., Ye, W., Lv, Q., Hua, Z., Ma, J., and Zhang Y. The effect of pleiotrophin signaling on adipogenesis. FEBS Letters, 2007, 581: 382-8.

116

Gupta, P.B., Chaffer, C.L., and Weinberg, R.A. Cancer stem cells: mirage or reality? Nat. Med., 2009, 15: 1010-2.

Gupta, S., Ramjaun, A.R., Haiko, P., Wang, Y., Warne, P.H., Nicke, B., Nye, E., Stamp, G., Alitalo, K., and Downward, J. Binding of ras to phosphoinositide 3-kinase p110alpha is required for ras-driven tumorigenesis in mice. Cell, 2007, 129: 957-68.

Gutierrez, A., and Look, A.T. NOTCH and PI3K-AKT pathways intertwined. Cancer Cell, 2007, 12: 411-3.

Hartmann, W., Küchler, J., Koch, A., Friedrichs, N., Waha, A., Endl, E., Czerwitzki, J., Metzger, D., Steiner, S., Wurst, P., Leuschner, I., von Schweinitz,D., Buettner, R., and Pietsch, T. Activation of phosphatidylinositol-3'-kinase/AKT signaling is essential in hepatoblastoma survival. Clin Cancer Res., 2009, 15: 4538-45.

Haslam, R.J., Koide, H.B., and Hemmings, B.A. Pleckstrin domain homology. Nature, 1993, 363: 309-10.

Hattori, N., Nishino, K., Ko, Y.G., Hattori, N., Ohgane, J., Tanaka, S., and Shiota, K. Epigenetic control of mouse Oct-4 gene expression in embryonic stem cells and trophoblast stem cells. J. Biol. Chem., 2004: 279: 17063-9.

He, X.C., Zhang, J., Tong, W.G., Tawfik, O., Ross, J., Scoville, D.H., Tian, Q., Zeng, X., He, X., Wiedemann, L.M., Mishina, Y., and Li, L. BMP signaling inhibits intestinal stem cell self-renewal through suppression of Wnt–beta-catenin signaling. Nat. Gen., 2004, 36: 1117-21.

Hemmati, H.D., Nakano, I., Lazareff, J.A., Masterman-Smith, M., Geschwind, D.H., Bronner-Fraser, M., and Kornblum, H.I. Cancerous stem cells can arise from pediatric brain tumors. PNAS, 2003, 100: 15178–83.

Hers, I., Vincent, E.E., and Tavare. Akt signaling in health and disease. Cell. Signal., 2011, 23: 1515-27.

Hollander, M.C., Blumenthal, G.M., and Dennis, P.A. PTEN loss in the continuum of common cancers, rare syndromes and mouse models. Nat. Rev. Cancer, 2011, 11: 289-301. Hope, K. and Bhatia, M. Clonal interrogation of stem cells. Nat. Methods, 2011, 8: S36-40.

Huang, H, and He, X. Wnt/beta-catenin signaling: new (and old) players and new insights. Curr. Opin. Cell Biol., 2008, 20: 119-25.

Huangfu, D., Osafune, K., Maehr, R., Guo, W., Eijkelenboom, A., Chen, S., Muhlestein, W., and Melton, D.A. Induction of pluripotent stem cells from primary human fibroblasts with only Oct4 and Sox2. Nat. Biotechnol., 2008, 26: 1269-75.

117

Hui, C.C., and Angers, S. Gli Proteins in Development and Disease. Annu. Rev. Cell Dev. Biol., 2011, 21: 23.1-23.25.

Hui, C.C., and Joyner, A.L. A mouse model of Greig cephalo−polysyndactyly syndrome: the extra−toes mutation contains an intragenic deletion of the Gli3 gene. Nat. Genetics, 1993, 3: 241 – 246.

Hunter, C. Smith, R., Cahill, D.P., Stephens, P., Stevens, C., Teague, J., Greenman, C., Edkins, S., Bignell, G., Davies, H., O'Meara, S., Parker, A., Avis, T., Barthorpe, S., Brackenbury, L., Buck, G., Butler, A., Clements, J., Cole, J., Dicks, E., Forbes, S., Gorton, M., Gray, K., Halliday, K., Harrison, R., Hills, K., Hinton, J., Jenkinson, A., Jones, D., Kosmidou, V., Laman, R., Lugg, R., Menzies, A., Perry, J., Petty, R., Raine, K., Richardson, D., Shepherd, R., Small, A., Solomon, H., Tofts, C., Varian, J., West, S., Widaa, S., Yates, A., Easton, D.F., Riggins, G., Roy, J.E., Levine, K.K., Mueller, W., Batchelor, T.T., Louis, D.N., Stratton, M.R., Futreal, P.A., and Wooster, R. A hypermutation phenotype and somatic MSH6 mutations in recurrent human malignant gliomas after akylator chemotherapy. Cancer Res., 2006, 66: 3987-91.

Isakoff, S.J., Engelman, J.A., Irie, H.Y., Luo, J., Brachmann, S.M., Pearline, R.V., Cantley, L.C., and Brugge, J.S. Breast cancer-associated PI3KCA mutations are oncogenic in mammary epithelial cells. Cancer Res., 2005, 65: 10992-1000.

Ishibe, S., Haydu, J.E., Togawa, A., Marlier, A., and Cantley, L.G. Cell Confluence Regulates Hepatocyte Growth Factor-Stimulated Cell Morphogenesis in a beta-Catenin-Dependent Manner. Mol. Cell. Biol., 2006, 26: 9232-43. Iwatsuki, K., Liu, H.X., Gronder, A., Singer, M.A., Lane, T.F., Grosschedl, R., Mistretta, C.M., and Margolskee, R.F. Wnt signaling interacts with Shh to regulate taste papilla development. Proc. Natl. Acad. Sci., 2007, 104: 2253–8. James, D., Levine, A.J., Besser, D., and Hammati-Brivanlou, A. TGFbeta/activin/nodal signaling is necessary for the maintenance of pluripotency in human embryonic stem cells. Development, 2005, 132: 1273-82.

Jenuwein T., and Allis, C.D. Translating the histone code. Science, 2001, 293: 1074-80.

Jin, J., and Woodgett, J.R. Chronic activation of protein kinase Bbeta/Akt2 leads to multinucleation and cell fusion in human epithelial kidney cells: events associated with tumorigenesis. Oncogene, 2005, 24: 5459-70.

Jirmanova, L., Afanassieff, M., Gobert-Gosse, S., Markossian, S., and Savatier, P. Differential contributions of ERK and PI3-kinase to the regulation of cyclin D1 expression and to the control of the G1/S transition in mouse embryonic stem cells. Oncogene, 2002, 21: 5515-28.

118

Johnson L, Mercer K, Greenbaum D, Bronson RT, Crowley D, Tuveson DA, Jacks T. Somatic activation of the K-ras oncogene causes early onset lung cancer in mice. Nature, 2001, 410: 1111-6.

Kale, S., Kariholoo, A., Clark, P.R., Kashgarian, M., Krause, D.S., and Cantley, L.G. Bone marrow stem cells contribute to repair of the ischemically injured renal tubule. J. Clin. Invest. 2003, 112: 42-9.

Katso, R, Okkenhaug, K., Ahmadi, K., White, S., Timms, J., and Waterfield, M.D. Cellular function of phosphoinositide 3-kinases: implications for development, homeostasis, and cancer. Annu. Rev. Cell Dev. Biol., 2001, 17: 615-75.

Kelly, K.F., Ng, D.Y., Jayakumaran, G., Wood, G.A., Koide, H., and Doble BW. β-catenin enhances Oct-4 activity and reinforces pluripotency through a TCF-independent mechanism. Cell Stem Cell, 2011, 8: 214-27.

Khwaja, A., Rodriguez-Viciana, P., Wennström, S., Warne, P.H., and Downward J. Matrix adhesion and Ras transformation both activate a phosphoinositide 3-OH kinase and protein kinase B/Akt cellular survival pathway. EMBO J., 1997, 16: 2783-93.

Kielman, M.F., Rindapää, M., Gaspar, C., van Poppel, N., Breukel, C., van Leeuwen, S., Taketo, M.M., Roberts, S., Smits, R., and Fodde R. Apc modulates embryonic stem-cell differentiation by controlling the dosage of beta-catenin signaling. Nat. Genet., 2002, 32: 594-605.

Kikani, C.K., Dong, L.Q, and Liu, F. “New”-clear functions of PDK1: beyond a master kinase in the cytosol? J. Cell. Biochem., 2005, 96: 1157-62.

Kim, J.B., Zaehres, H., Wu, G., Gentile, L., Ko, K., Sebastiano, V., Araúzo-Bravo, M.J., Ruau, D,, Han, D.W., Zenke, M., and Schöler, H.R. Pluripotent stem cells induced from adult neural stem cells by reprogramming with two factors. Nature, 2008, 454: 646-50.

Kim, J.S., Kim, B.S., Kim, J., Park, C.S., and Chung, I.Y. The phosphoinositide-3-kinase/Akt pathway mediates the transient increase in Nanog expression during differentiation of F9 cells. Arch. Pharm. Res., 2010, 33: 1117-25.

Kimura H., Tada, M., Nakatsuji, N., and Tada, T. Histone code modifications on plruipotential nuclei of reprogrammed somatic cells. Mol. Cell. Biol., 2004, 24: 5710-20.

Kingham, E., and Welham, M. Distinct roles for isoforms of the catalytic subunit of class-IA PI3K in the regulation of behaviour of murine embryonic stem cells. J. Cell Sci., 2009, 122: 2311-21.

Kleinsmith, L.J. and Pierce, G.B. Jr. Multipotentiality of single embryonal carcinoma cells. Cancer res., 1964, 24: 1544-51.

119

Knobbe, C.B., Lapin, V., Suzuki, A., and Mak, T.W. The roles of PTEN in development, physiology, and tumorigenesis in mouse. Oncogene, 2008, 27: 5398–5415.

Kobayashi, T. and Kageyama, R. Hes1 oscillations contribute to heterogeneous differentiation responses in embryonic stem cells. Genes, 2011, 2: 219-28.

Kobielak, K., Stokes, N., de la Cruz, J., Polak, L., and Fuchs, E. Loss of a quiescent niche but not follicle stem cells in the absence of bone morphogenetic protein signaling. PNAS, 2007, 104: 10063-8.

Kohn, A.D., Barthel, A., Kovacina, K.S., Boge, A., Wallach, B., Summers, S.A., Birnbaum, M.J., Scott, P.H., Lawrence J.C. Jr., and Roth, R.A. Construction and characterization of a conditionally active version of the serine/threonine kinase Akt. J. Biol. Chem., 1998, 273: 11937-43.

Krishna, K.A., Roa, G.V. and Roa, K.S. Stem cell-based therapy for the treatment of Type 1 diabetes mellitus. Regen. Med. , 2007, 2: 171-7.

Lapidot, T., Sirard, C., Vormoor, J., et al. A cell initiating human acute myeloid leukaemia after transplantation into SCID mice. Nature, 1994, 367: 645-8.

Lee, E., Salic, A., Kruger, R., Heinrich, R., and Kirschner M.W. The roles of APC and Axin derived from experimental and theoretical analysis of the Wnt pathway. PLoS Biol 2003, 1: E10.

Lemmon, M.A. and Ferguson, K.M. Signal-dependent membrane targeting by pleckstrin homology (PH) domains. Biochem. J., 2000, 350: 1-18.

Lensch, M.W., Schlaeger, T.M., Zon, L.I., and Daley, G.Q. Teratoma formation assays with human embryonic stem cells: a rationale for one type of human-animal chimera. Cell Stem Cell, 2007, 1: 253-8.

Li, Y., McClintick, J., Zhong, L., Edenberg, H.J., Yoder, M.C., and Chan, R.J. Murine embryonic stem cell differentiation is promoted by SOCS-3 and inhibited by the zinc finger transcription factor Klf4. Blood, 2005, 105: 635-7.

Li, J., Yen, C., Liaw, D., Podsypanina, K., Bose, S., Wang, S.I., Puc, J., Miliaresis, C., Rodgers, L., McCombie, R., Bigner, S.H., Giovanella, B.C., Ittmann, M., Tycko, B., Hibshoosh, H., Wigler, M.H., and Parsons R. PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, and prostate cancer. Science, 1997, 275: 1943-7.

Lianguzova, M. S., Nordheim, A., and Pospelov, V.A. Phosphoinositide 3-kinase inhibitor LY294002 but not serum withdrawal suppresses proliferation of murine embryonic stem cells. Cell. Biol. Int., 2007, 31:330-7.

120

Lin, G.L., and Hankenson, K.D. Integration of BMP, Wnt, and Notch signaling pathways in osteoblast differentiation. J. Cell. Biochem., 2011, doi: 10.1002/jcb.23287. [Epub ahead of print]

Liu, P., Cheng, H., Roberts, T.M., and Zhao, J.J. Targeting the phosphoinositide 3-kinase pathway in cancer. Nat. Rev. Drug Disc., 2009, 8: 627-43.

Liu, P., Cheng, H., Santiago, S., Raeder, M., Zhang, F., Isabella, A., Yang, J., Semaan, D.J., Chen, C., Fox, E.A., Gray, N.S., Monahan, J., Schlegel, R., Beroukhim, R., Mills, G.B., and Zhao, J.J. Oncogenic PIK3CA-driven mammary tumors frequently recur via PI3K pathway-dependent and PI3K pathway-independent mechanisms. Nat Med., 2011, 17: 1116-20.

Liu, F., Pan, X., Chen, G., Jiang, D., and Cong, X., Fei., R., and Wei., L. Hematopoietic stem cells mobilized by granulocyte colony-stimulating factor partly contribute to liver graft regeneration after partial orthotopic liver transplantation. Liver Transpl. 2006a, 12: 1129-37.

Liu, F., Pan, X.B., Chen, G.D., Jiang, D., and Cong, X., Fei., R., Chen, H.S., and Wei., L. Hematopoietic stem cell mobilization after rat partial orthotopic liver transplantation. Transplant Proc. 2006b, 38: 1603-9.

Luger, K., Mader, A.W., Richmond, R.K., Sargent, D.F., and Richmond, T.J. Crystal structure of the nucleosome core particle at 2.8 Å resolution. Nature, 1997, 389: 251-60.

MacDonald, B.T., Tamai, K., and He, X. Wnt/β-catenin signaling: components, mechanisms, and diseases. Dev. Cell, 2009, 17: 9-26.

Madhala-Levy, D., Williams, V.C., Hughes, S.M., Reshef, R., and Halevy, O. Cooperation between Shh and IGF-I in promoting myogenic proliferation and differentiation via the MAPK/ERK and PI3K/Akt pathways requires Smo activity. J. Cell. Physiol., 2011, doi: 10.1002/jcp.22861.

Maes, C., Goossens, S., Bartunkova, S., Drogat, B., Coenegrachts, L., Stockmans, L., Moermans,

K., Nyabi, O., Haigh, K., Naessens, M., Haenebalcke, L., Tuckermann, J.P., Tjwa, M., Carmeliet, P., Mandic, V., David, J.P., Behrens, A., Nagy, A., Carmeliet, G., and Haigh, J.J. Increased skeletal VEGF enhances β-catenin activity and results in excessively ossified bones. EMBO J., 2010, 29: 424-41.

Manning, B.D., and Cantley, L.C. AKT/PKB signaling: navigating downstream. Cell, 2007, 129: 1261-74.

Martin, G.R. Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. PNAS, 1981, 78: 7634-8.

121

Masters, T.A., Calleja, V., Armoogum, D.A., Marsh, R.J., Applebee, C.J., Laguerre, M., Bain, A.J., and Larijani, B. Regulation of 3-phosphoinositide-dependent protein kinase 1 activity by homodimerization in live cells. Sci. Signal., 2010, 3: ra78.

Matsui, S. Nakatake, Y., Toyooka, Y., Shimosato, D., Yagi, R., Takahashi, K., Okochi, H., Okuda, A., Matoba, R., Sharov, A.A., Ko, M.S., and Niwa H. Pluripotency governed by Sox2 via regulation of Oct3/4 expression in mouse embryonic stem cells. Nat. Cell Biol., 2007, 6: 625-35.

Mayer, B.J., Ren, R., Clark, K.L., and Baltimore, D. A putative modular domain present in diverse signaling molecules. Cell, 1993, 73: 629-30.

McManus, E.J., Sakamoto, K., Armit, L.J., Ronaldson, L., Shpiro, N., Marquez, R., and Alessi DR. Role that phosphorylation of GSK3 plays in insulin and Wnt signaling defined by knockin analysis. EMBO J., 2005, 24: 1571-83. McNeill, H., and Woodgett, J.R. When pathways collide: collaboration and connivance among signaling proteins in development. Nature Rev. Mol. Cell. Biol., 2010, 11: 404-13.

Mora, A., Komander, D., van Aalten, D.M., D.R., and Alessi, D.R. PDK1, the master regulator of AGC kinase signal transduction. Semin. Cell Dev. Biol., 2004, 15: 161-70.

Mukohara, T., Kudoh, S., Yamauchi, S., Kimura, T., Yoshimura, N., Kanazawa, H., Hirata, K., Wanibuchi, H., Fukushima, S., Inoue, K., and Yoshikawa, J. Expression of epidermal growth factor receptor (EGFR) and downstream-activated peptides in surgically excised non-small-cell lung cancer (NSCLC). Lung Cancer. 2003, 41: 123-30.

Murakami, M., Ichisaka, T., Maeda, M., Oshiro, N., Hara, K., Edenhofer, F., Kiyama, H., Yonezawa, K., and Yamanaka, S. mTOR is essential for growth and proliferation in early mouse embryos and embryonic stem cells. Mol. Cell. Biol., 2004, 24: 6710-8.

Murphy, M.J., Wilson, A., and Trumpp, A. More than just proliferation: Myc function in stem cells. Trends Cell Biol., 2005, 15: 128-37.

Nagy, A., Rossant, J., Nagy, R., Abramow-Newerly, W., and Roder, J. C. Derivation of completely cell culture-derived mice from early-passage embryonic stem cells. PNAS, 1993, 90: 8424-8.

Nagy, A. and Rossant, J. Production and analysis of ES-cell aggregation chimeras. In Gene Targeting: A Practical Approach (ed. A. L. Joyner, Second Edition), 1999, Oxford University Press Inc., New York, pp. 177-206.

Nakagawa, M. Koyanagi, M., Tanabe, K., Takahashi, K., Ichisaka, T., Aoi, T., Okita, K., Mochiduki, Y., Takizawa, N., and Yamanaka, S. Generation of induced pluripotent stem cell without Myc from mouse and human fibroblasts. Nat. Biotechnol., 2008, 26: 101-6.

122

Ng, S.S., Mahmoudi, T., Danenberg, E., Bejaoui, I., de Lau, W., Korswagen, H.C., Schutte, M., and Clevers, H. Phosphatidylinositol 3-Kinase Signaling Does Not Activate the Wnt Cascade. J. Biol. Chem., 2009, 284: 35308-13.

Nichols, J., Zevnik, B., Anastassiadis, K., Niwa, H., Klewe-Nebenius, D., Chambers, I., Scholer, H., and Smith, A. Formation of the pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct4. Cell, 1998, 95: 379-91.

Niwa, H. How is pluripotency determined and maintained? Development, 2007, 134: 635-46.

Niwa, H., Miyazaki, J., and Smith, A.G. Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal in stem cells. Nat. Genet., 2000, 24: 372-6.

Niwa, H., Ogawa, K., Shimosato, D., and Adachi, K. A parallel circuit of LIF signaling pathways maintains pluripotency of mouse ES cells. Nature, 2009, 460: 118-22.

Noggle, S.A., James, D., and Brivanlou, A.H. A molecular basis for human embryonic stem cell pluripotency. Stem Cell Review, 2005, 1: 111-8.

Noubissi, F.K., Goswami, S., Sanek, N.A., Kawakami, K., Minamoto, T., Moser, A., Grinblat, Y., and Spiegelman, V.S. Wnt signaling stimulates transcriptional outcome of the Hedgehog pathway by stabilizing GLI1 mRNA. Cancer Res., 2009, 69: 8572-8.

Paling, N.R., Bone, H.K., and Welham, M.J. Regulation of embryonic stem cell self-renewal by phosphoinositide 3-kinase-dependent signaling. J. Biol. Chem., 2004, 279: 48063-70.

Pan, G., and Thomson J.A. Nanog and transcriptional networks in embryonic stem cell pluripotency. Cell Research, 2007, 17: 42-9.

Palomero, T., Dominguez, M., and Ferrando, A.A. The role of the PTEN/AKT Pathway in NOTCH1-induced leukemia. Cell Cycle, 2008, 7: 965-70.

Palomero, T., and Ferrando, A. Oncogenic NOTCH1 control of MYC and PI3K: challenges and opportunities for anti-NOTCH1 therapy in T-cell acute lymphoblastic leukemias and lymphomas. Clin. Cancer Res., 2008, 14: 5314-7.

Palomero, T., Sulis, M.L., Cortina, M., Real, P.J., Barnes, K., Ciofani, M., Caparros, E., Buteau, J., Brown, K., Perkins, S.L., Bhagat, G., Agarwal, A.M., Basso, G., Castillo, M., Nagase, S., Cordon-Cardo, C., Parsons, R., Zúñiga-Pflücker, J.C., Dominguez, M., and Ferrando, A.A. Mutational loss of PTEN induces resistance to NOTCH1 inhibition in T-cell leukemia. Nat. Med., 2007, 13: 1203-10.

Park, J.K., Liu, X., Strauss, T.J., McKearin, D.M., and Liu, Q. The miRNA pathway intrinsically controls self-renewal of drosophila germline stem cells. Curr. Biol., 2007, 17: 533-8.

123

Passegué, E., Jamieson, C.H.M., Ailles, L.E., and Weissman, I.L. Normal and leukemic hematopoiesis: Are leukemias a stem cell disorder or a reacquisition of stem cell characteristics? PNAS, 2003, 100: 11842-9.

Patel, S., Doble, B., and Woodgett, J.R. Glycogen synthase-3 in insulin and Wnt signaling: a double-edged sword. Biochem. Soc. Trans., 2004, 32: 803-8.

Pessina, A. and Gibraldo, L. The key role of adult stem cells: therapeutic perspectives. Curr. Med. Res. Opin. 2006, 22: 2287-300.

Peacock, C.D., Wang, Q., Gesell, G.S., Corcoran-Schwartz, I.M., Jones, E., Kim, J., Devereux, W.L., Rhodes, J.T., Huff, C.A., Beachy, P.A., Watkins, D.N., and Matsui, W. Hedgehog signaling maintains a tumor stem cell compartment in multiple myeloma. PNAS, 2007, 104: 4048-53.

Pera, M.F., and Tam, P.P.L. Extrinsic regulation of pluripotent stem cells. Nature, 2010, 465: 713-20.

Perry, J.M., He, X.C., Sugimura, R., Grindley, J.C., Haug, J.S., Ding, S., and Li, L. Cooperation between both Wnt/β-catenin and PTEN/PI3K/Akt signaling promotes primitive hematopoietic stem cell self-renewal and expansion. Genes Dev., 2011, 25: 1928-42.

Polesskaya, A., Cuvellier, S., Naguibneva, I., Duquet, A., Moss, E.G., and Harel-Bellan, A. Lin-28 binds IGF-2 mRNA and participates in skeletal myogenesis by increasing translation efficiency. Genes Dev., 2007, 21: 1123-38.

Przyborski SA. Differentiation of human embryonic stem cells after transplantation in immune-deficient mice. Stem Cells, 2005, 23: 1242-50.

Ritner, C., and Bernstein, H.S. Fate mapping of human embryonic stem cells by teratoma formation. J. Vis. Exp., 2010, 1: pii: 2036.

Rodriguez-Viciana, P., Warne, P.H., Dhand, R., Vanhaesebroeck, B., Gout, I., Fry, M.J., Waterfield, M.D., and Downward, J. Phosphatidylinositol-3-OH kinase as a direct target of Ras. Nature, 1994, 370: 527-32.

Rohatgi, R., Milenkovic, L., and Scott, M.P. Patched1 regulates hedgehog signaling at the primary cilium. Science, 2007, 17: 372-6.

Rusch, V., Klimstra, D., Venkatraman, E., Pisters, P.W., Langenfeld, J., and Dmitrovsky, E. Overexpression of the epidermal growth factor receptor and its ligand transforming growth factor alpha is frequent in resectable non-small cell lung cancer but does not predict tumor progression. Clin Cancer Res., 1997, 3: 515-22.

124

Samuels, Y., Diaz, L.A. Jr., Schmidt-Kittler, O., Cummins, J.M., Delong, L., Cheong, I., Rago, C., Huso, D.L., Lengauer C., Kinzler, K.W. Vogelstein, B., and Velculescu, V.E. Mutant PI3KCA promotes cell growth and invasion of human cancer cells. Cancer Cell, 2005, 7: 561-73.

Samuels, Y., Wang, Z., Bardelli, A., Silliman, N., Ptak, J., Szabo, S., Yan, H., Gazdar, A., Powell, S.M., Riggins, G.J., Willson, J.K., Markowitz, S., Kinzler, K.W., Vogelstein, B., and Velculescu, V.E. High frequency of mutations of the PIK3CA gene in human cancers. Science, 2004, 304: 554.

Samuels, Y. and Velculescu, V.E. Oncogenic mutations of PI3KCA in human cancers. Cell Cycle, 2004, 3: 1221-24.

Sarbassov, D., Guertin, D., Ali, S., and Sabatini, D. Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex. Science, 2005, 307: 1098–101.

Sato, N., Meijer, L., Skaltsounis, L., Greengard, P., and Brivanlou, A.H. Maintenance of pluripotency in human and mouse embryonic stem cells through activation of Wnt signaling by a pharmacological GSK-3-specific inhibitor. Nat. Med., 2004, 10: 55-63.

Saunders, F.R. and Wallace, H.M. Polyamine metabolism and cancer prevention. Biochem. Soc. Trans., 2007, 35: 364-8.

Scheid, M.P., Marignani, P.A., and Woodgett, J.R. Multiple phosphoinositide 3-kinase-dependent steps in activation of protein kinase B. Mol. Cell. Biol., 2002, 22: 6247-60.

Scheid, M.P., Parsons, M., and Woodgett, J.R. Phosphoinositide-dependent phosphorylation of PDK1 regulates nuclear translocation. Mol. Cell. Biol., 2005, 25: 2347-63.

Scheid, M.P., and Woodgett, J.R. PKB/AKT: functional insights from genetic models. Nature Rev. Mol. Cell Biol., 2001, 2: 760-8.

Scheid, M.P., and Woodgett, J.R. Unravelling the activation mechanisms of protein kinase B/Akt. FEBS Letter, 2003, 546: 108-12.

Schmidt, E.V. The role of c-myc in cellular growth control. Oncogene, 1999, 18: 2988-96.

Shackleton, M., Vaillant F., Simpson, K.J., Singl, J., Smyth, G.K., Asselin-Labat, M.L., Wu, L., Lindeman, G.J., and Visvader, J.E. Generation of a functional mammary gland from a single stem cell. Nature 2006, 439: 84–8.

Shamblott, M.J., Axelman J., Wang S., Bugg E.M., Littlefield J.W., Donovan P.J., Blumenthal P.D., Huggins G.R., Gearhart J.D. Derivation of pluripotent stem cells from cultured human primordial germ cells. PNAS, 1998, 95: 13726-31.

125

Sharma, M., Chuang, W.W., and Sun, Z. Phosphatidylinositol 3-kinase/Akt stimulates androgen pathway through GSK3beta inhibition and nuclear beta-catenin accumulation. J. Biol. Chem., 2002, 277: 30935-41.

Sherr, C.J., and Roberts, J.M. CDK inhibitors: positive and negative regulators of G1-phase progression. Genes Dev., 1999, 13: 1501-12.

Silva, J., Barrandon, O., Nichols, J., Kawaguchi, J., Theunissen, T.W., and Smith A. Promotion of reprogramming to ground state pluripotency by signal inhibition. PLoS Biol., 2008, 6: e253.

Singh, S.K., Clarke, I.D., Terasaki, M., Bonne, V.E., Hawkins, C., Squire, J., and Dirks, P.B. Identification of a cancer stem cell in human brain tumors. Cancer Res., 2003, 63: 5821–8.

Singh, S.K., and Dirks, P.B. Brain tumor stem cells: identification and concepts. Neurosurg. Clin. N. Am., 2007, 18: 31-8.

Singh, S.K., Hawkins, C., Clarke, I.D., Squire, J.A., Bayani, J., Hide, T., Henkelman, R.M., Cusimano, M.D., and Dirks, P.B. Identification of human brain tumour initiating cells. Nature, 2004, 432: 396-401.

Smith, K., and Dalton, S. Myc transcription factors: key regulators behind establishment and maintenance of pluripotency. Regen Med., 2010, 5: 947-59.

Smith, K.N., Lim, J.M., Wells, L., and Dalton S. Myc orchestrates a regulatory network required for the establishment and maintenance of pluripotency. Cell Cycle, 2011, 10: 592-7.

Solter, D. From teratocarcinomas to embryonic stem cells and beyond: a history of embryonic stem cell research. Nat. Rev. Genet., 2006, 7: 319-27.

Spangrude, G.J., Heimfeld, S., and Weissman, I.L. Purification and characterization of mouse hematopoietic stem cells. Science, 1988, 241: 58–62.

Stambolic, V., Suzuki, A., de la Pompa, J.L., Brothers, G.M., Mirtsos, C., Sasaki, T., Ruland, J., Penninger, J.M., Siderovski, D.P., and Mak T.W. Negative regulation of PKB/Akt-dependent cell survival by the tumor suppressor PTEN. Cell, 1998, 95: 29-39.

Stambolic, V., and Woodgett, J.R. Functional distinctions of protein kinase B/Akt isoforms defined by their influence on cell migration. Trends Cell. Biol., 2006, 16: 461-6.

Stiles, B., Gilman, V., Khanzenzon, N., Lesche, R., Li, A., Qiao, R., Liu, X. and Wu, H. Essential role of AKT-1/protein kinase B alpha in PTEN-controlled tumorigenesis. Mol. Cell. Biol., 2002, 22: 3842–3851.

126

Stoltz, J.F., Bensoussan, D., Decot, V., Ciree, A., Netter, P., and Gillet, P. Cell and tissue engineering and clinical applications: an overview. Biomed. Mater. Eng., 2006, 16: S3-S18.

Storm, M.P., Kumpfmueller, B., Thompson, B., Kolde, R., Vilo, J., Hummel, O., Schulz, H., and Welham, M.J. Characterization of the phosphoinositide 3-kinase-dependent transcriptome in murine embryonic stem cells: identification of novel regulators of pluripotency. Stem Cells, 2009, 27: 764-75.

Sumi, T., Fujimoto, Y., Nakatsuji, N., and Suemori, H. STAT3 is dispensable for maintenance of self-renewal in nonhuman primate embryonic stem cells. Stem Cells, 2004, 22: 861-72.

Sun, H., Lesche, R., Li, D.M., Liliental, J., Zhang, H., Gao, J., Gavrilova, N., Mueller, B., Liu, X., and Wu, H. PTEN modulates cell cycle progression and cell survival by regulating phosphatidylinositol 3,4,5,-trisphosphate and Akt/protein kinase B signaling pathway. PNAS, 1999, 96: 6199-204.

Suzuki, A., de la Pompa, J.L., Stambolic, V., Elia, A.J., Sasaki, T., del Barco Barrantes, I., Ho, A., Wakeham, A., Itie, A., Khoo, W., Fukumoto, M., Mak, T.W. High cancer susceptibility and embryonic lethality associated with mutation of the PTEN tumor suppressor gene in mice. Curr. Biol., 1998, 8: 1169-78.

Suzuki, A., Nakano, T., Mak, T.W., and Sasaki, T. Portrait of PTEN: messages from mutant mice. Cancer Sci., 2008, 99: 209-13.

Takahashi, K., Mitsui, K., and Yamanaka, S. Role of ERas in promoting tumor-like properties in mouse embryonic stem cells. Nature, 2003, 423: 541-5.

Takahashi, K., Murakami, M., and Yamanaka, S. Role of the phosphoinositide 3-kinase pathway in mouse embryonic stem (ES) cells. Biochem. Soc. Trans., 2005, 33: 1522-5.

Takahashi, K., Nakagawa, M., Young, S.G., and Yamanaka, S. Differential membrane localization of ERas and Rheb, two Ras-related proteins involved in the phosphatidylinositol 3-kinase/mTOR pathway. J. Biol. Chem., 2005, 280: 32768-74.

Takahashi, K., and Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell, 2006, 126: 663-76.

Tan, B.T., Park, C.Y., Ailles, L.E., and Weissman, I.L. The cancer stem cell hypothesis: a work in progress. Laboratory Investigation, 2006, 86: 1203–7.

Tani, S., Kurooka, H., Aoki, T., Hashimoto, N., and Honjo, T. The N- and C-terminal regions of RBP-J interact with the ankyrin repeats of Notch1 RAMIC to activate transcription. Nucleic Acids Res., 2001, 29: 1373–80.

127

Tay, Y., Zhang, J., Thomson, A.M., Lim, B., and Rigoutsos, I. MicroRNAs to Nanog, Oct4 and Sox2 coding regions modulate embryonic stem cell differentiation. Nature, 2008, 455: 1124-8.

Till, J.E., and McCulloch, E.A. A direct measurement of the radiation sensitivity of normal mouse bone marrow cells. Radiat. Res., 1961, 14: 213-22.

Tiscornia, G., and Belmonte, J.C.I. MicroRNAs in embryonic stem cell function and fate. Genes and Dev., 2010, 24: 2732-41.

Tominaga, Y, Tamguney, T, Kolesnichenko, M, Bilanges, B., and Sokoe, D. Translational deregulation in PDK1-/- embryonic stem cells. Mol. Cell. Biol., 2005, 25: 8465-75.

Torres-Padilla, M.E., Parfitt, D.E., Kouzarides, T., and Zernicka-Goetz, M. Histone arginine methylation regulates pluripotency in the early mouse embryo. Nature, 2007, 445: 214-8.

Tukachinsky, H., Lopez, L.V., and Salic, A. A mechanism for vertebrate Hedgehog signaling: recruitment to cilia and dissociation of SuFu-Gli protein complexes. J. Cell. Biol., 2010, 191: 415-28.

Tzukerman, M., Rosenberg, T., Ravel, Y., Reiter, I., Coleman, R., and Skorecki, K. An experimental platform for studying growth and invasiveness of tumor cells within teratomas derived from human embryonic stem cells. PNAS, 2003, 100: 13507-12.

Tzukerman, M., and Skoreckim K.L. A novel experimental platform for investigating cancer growth and anti-cancer therapy in a human tissue microenvironment derived from human embryonic stem cells. Methods Mol. Biol., 2006, 331: 329-46.

Uchida, N., Buck, D.W., He, D., Reitsma, M.J., Masek, M., Phan, T.V., Tsukamoto A.S., Gage, F.H., and Weissman, I.L. Direct isolation of human central nervous system stem cells. PNAS, 2000, 97: 14720–14725.

Uetsuki, T., Naito, A., Nagata, S., and Kaziro, Y. Isolation and characterization of the human chromosomal gene for polypeptide chain elongation factor-1 alpha. J. Biol. Chem. ,1989, 264: 5791-8.

van Amerongen R, Nusse R. Towards an integrated view of Wnt signaling in development. Development, 2009, 136: 3205-14.

Viswanathan, S.R., Daley, G.Q, and Gregory, R.I. Selective blockade of microRNA processing by Lin28. Science, 2008, 320: 97-100.

Vivanco, I., and Sawyers, C.L. The phosphatidylinositol-3-kinase AKT pathway in human cancers. Nat. Rev., 2002, 2: 489-501.

128

Voskas, D., Ling, L.S., and Woodgett, J.R. Does GSK-3 provide a shortcut for PI3K activation of Wnt signaling? F1000 Biol. Rep.., 2010, 2: 82.

Watanabe, S., Umehara, H., Murayama, K., Okabe, M., Kimura, T., and Nakano, T. Activation of Akt signaling is sufficient to maintain pluripotency in mouse and primate embryonic stem cells. Oncogene, 2006, 25: 2697-707.

Watt, F.M., Estrach, S., and Ambler, C.A. Epidermal Notch signaling: differentiation, cancer and adhesion. Curr. Opin. Cell Biol., 2008, 20: 171-9.

Welham, M.J., Kingham, E., and Bone, H.K. Phosphoinositide 3-kinases and regulation of embryonic stem cell fate. Biochem. Soc. Trans., 2007, 35: 225-8.

Welham M.J., Kingham, E., Sanchez-Ripoll, Y., Kumpfmueller B., Storm M., and Bone, H. Controlling embryonic stem cell proliferation and pluripotency: the role of PI3K- and GSK-3- dependent signaling. Biochem. Soc. Trans., 2011, 39: 674-8.

Weng, A.P., Ferrando, A.A., Lee, W., Morris, J.P. 4th, Silverman, L.B., Sanchez-Irizarry, C., Blacklow, S.C., Look, A.T., and Aster J.C. Activating mutations of NOTCH1 in human T cell acute lymphoblastic leukemia. Science, 2004, 306: 269-71.

Wernig, M. Meissner, A., Cassady, J.P., and Jaenisch, R. c-Myc is dispensable for direct reprogramming of mouse fibroblasts. Cell Stem Cell, 2008, 2: 10-2.

Wernig, M., Meissner, A., Foreman, R., Brambrink, T., Ku, M., Hochedlinger, K., Bernstein, B.E., and Jaenisch, R. In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state. Nature, 2007, 448: 318-24.

Williams, M.R., Authur, J.S., Balendra, A., van der Kaay, J., Poli V, Cohen, P., and Alessi, D.R. The role of 3-phosphoinositide-dependent protein kinase 1 in activating AGC kinases defined in embryonic stem cells. Curr. Biol., 2000, 10: 439-48.

Wood, S.A., Allen, N.D., Rossant, J., Auerbach, A. and Nagy, A. Non-injection methods for the production of embryonic stem cell-embryo chimaeras. Nature, 1993, 365: 87-89.

Woodgett, JR. Molecular cloning and expression of glycogen synthase kinase-3/factor A. EMBO J., 1990, 9: 2431-8.

Woodgett, J.R. Recent advances in the protein kinase B signaling pathway. Curr. Opin. Cell Biol., 2005, 17: 150-7.

Wrana, J.L., Attisano, L., Cárcamo, J., Zentella, A., Doody, J., Laiho, M., Wang, X.F., and Massagué, J. TGF beta signals through a heteromeric protein kinase receptor complex. Cell, 1992, 71: 1003–14.

129

Wray, J., Kalkan, T., and Smith, A.G. The Ground State of Pluripotency. Biochem. Soc. Trans., 2010, 38: 1027-32.

Wu, R., Hendrix-Lucas, N., Kuick, R., Zhai, Y., Schwartz, D.R., Akyol, A., Hanash, S., Misek, D.E., Katabuchi, H., Williams, B.O., Fearon, E.R., and Cho KR. Mouse model of human ovarian endometrioid adenocarcinoma based on somatic defects in the Wnt/beta-catenin and PI3K/Pten signaling pathways. Cancer Cell, 2007, 11: 321-33.

Wu, H., and Sun, Y.E. Epigenic regulation of stem cell differentiation. Pediatr. Res., 2006, 59: 21R-5R.

Wu, G., Huang, H., Garcia Abreu, J., and He X. Inhibition of GSK3 phosphorylation of beta-catenin via phosphorylated PPPSPXS motifs of Wnt coreceptor LRP6. PLoS One, 2009; 4: e4926.

Xu, N., Papagiannakopoulos, T., Pan, G., Thomson, J.A., and Kosik, K.S. MicroRNA-145 regulates Oct4, Sox2, and Klf4 and represses pluripotency in human embryonic stem cells. Cell, 2009, 137: 647-58.

Yamada Y., and Watanabe A. Epigenetic codes in stem cells and cancer stem cells. Adv. Genet., 2010, 70: 177-99.

Yao, R. and Cooper, G.M. Requirement for phosphatidylinositol-3 kinase in the prevention of apoptosis by nerve growth. Science, 1995, 267: 2003-6.

Ying, Q.L., Nichols, J., Chambers, I., and Smith, A. BMP induction of Id proteins suppresses differentiation and sustains embryonic stem cell self-renewal in collaboration with STAT3. Cell, 2003, 115: 281-292.

Ying, Q.L., Wray, J., Nichols, J., Batlle-Morera, L., Doble, B., Woodgett, J., Cohen, P., and Smith, A. The ground state of embryonic stem cell self-renewal. Nature, 2008, 453: 519-23.

Yu, F., Li, J., Chen, H., Fu, J., Ray, S., Huang, S., Zheng, H., and Ai, W. Kruppel-like factor 4 (KLF4) is required for maintenance of breast cancer stem cells and for cell migration and invasion. Oncogene, 2011, 30: 2161-72.

Yu, J., Vodyanik, M.A., Smuga-Otto, K., Antosiewiez-Bourget, J., Frane, J.L., Tian, S., Nie, J., Jonsdottir, G.A., Ruotti, V., Stewart R., Slukvin, I.I., and Thomson, J.A. Induced pluripotent stem cell lines derived from human somatic cells. Science, 2007, 318: 1917-20.

Yuan, T.L., and Cantley, L.C. PI3K pathway alterations in cancer: variations on a theme. Oncogene, 2008, 27: 5497-510.

130

Zhao, W., Hisamuddin, I.M., Nandan, M.O., Babbin, B.A., Lamb, N.E., Yang, V.W. Identification of Krüppel-like factor 4 as a potential tumor suppressor gene in colorectal cancer. Oncogene, 2004, 23: 395-402.

Zhao, L., and Vogt, P.K. Class I PI3K in oncogenic cellular transformation. Oncogene, 2008, 27: 5486-96.

Zhao, J.J., Wang, L., Shin, E., Loda, M.F., and Roberts, T.M. The oncogenic properties of mutant p110alpha and p110beta phosphatidylinositol 3-kinases in human mammary epithelial cells. PNAS, 2005, 102: 18443-8.

Zhong, L., Wu, J., Maina, N., Han, Z., and Srivastava, A. Adeno-associated virus-mediated gene transfer in hematopoietic stem/ progenitor cells as a therapeutic tool. Curr. Gene Ther., 2006, 6: 683-98.

Zimmerman, W.H., and Eschenhagen, T. Embryonic stem cells for cardiac muscle engineering. Trends Cardiovasc. Med., 2007, 17: 134-40.

131