Introduction to Python

September 26, 2011

04/21/23 2

Bioinformatics Languages

Low-level, compiled languages: C, C++, Java…

Pros: performance

Cons: slower programming (harder to both write &read)

Statistical languages: R, MATLAB, Octave…

Pros: many functions are provided.

Cons: limited applicability to non-statistical problems (and some major ones are non-free).

Scripting languages: Python, Perl, Ruby...

Pros: fast programming. Python is easy to read.

Cons: slower run times and larger memory footprint (sometimes by orders of magnitude).

04/21/23 3

Python

Started in 1989. Currently in version 2.7/3.3

More than most languages – very readable & clear

"There should be one – and preferably only one – obvious way to do it."

Like most scripting languages:

Interpreted

Garbage Collected (no need for memory management)

High memory usage (wasteful)

04/21/23 4

1 for x in [0,1,2,3,4]:2 result = x**2 – 53 print result

Printing and Loops

Suppose we want to evaluate the expression x2 – 5 for the integers 0 through 4

A Python keyword indicating a loop.Other option for loops is while.

Four spaces. In Python,whitespace matters.Shows block structure.

A Python list. Like an arrayin other languages. Indicatedby the brackets.

Colon shows beginning of block.

Single equals sign assignsvalue to variable

A built-in function. Prints to stdout.

04/21/23 5

Running Python Interactively

Start the Python interpreter:

$ python

Enter commands at >>> prompt.

04/21/23 6

A Python Program

Structure of a program:

04/21/23 7

A Python Program

Write program in editor of your choice. There are many options

See http://stackoverflow.com/questions/60784/poll-which-python-ide-editor-is-the-best

04/21/23 8

1 def little_function(n):2 return n**2 – 5

1 for x in [0,1,2,3,4]:2 result = little_function(x)3 print result

Declaring a function

Suppose our goal is similar, but we want to separate the details of the calculation into a function.

A Python keyword indicating a newfunction.

The name of the function.

A Python keywordindicating the valeto return.

We replace our previousexpression with a functioncall.

The parameters to thefunction.

04/21/23 9

Modules and Imports

Now suppose instead of finding x2-5, we want to find log(x)

Python has “batteries included”, meaning it has a broad standard library

1 import math

1 def little_function(n):2 return math.log(n)

1 for x in [0,1,2,3,4]:2 result = little_function(x)3 print result

Python keyword at beginning of file tomake a module available.

The name of the module to import. In this case, we're usingmath. Other common standardlibrary modules include sys, os,re, datetime, and zlib.

Dot is member access/scope operator in Python

04/21/23 10

Conditional Statements

Python uses if/elif/else

Suppose we want to

print “Less than zero.”

or “Zero.” rathen than the value.

1 import math2 def little_function(n):3 return math.log(n)4 for x in [0,1,2,3,4]:5 result = little_function(x)6 if result < 0:7 print “Less than zero.”8 elif result == 0:9 print “Zero.”10 else:11 print result

If blocks use same colon and indentrules as for loops.

Elif and else are optional.

Double equals tests for equality.

04/21/23 11

Modules and Imports

Now suppose instead of finding x2-5, we want to find log(x)

Python has “batteries included”, meaning it has a broad standard library

1 import math

1 def little_function(n):2 return math.log(n)

1 for x in [0,1,2,3,4]:2 result = little_function(x)3 print result

Python keyword at beginning of file tomake a module available.

The name of the module to import. In this case, we're usingmath. Other common standardlibrary modules include sys, os,re, datetime, and zlib.

Dot is member access/scope operator in Python

04/21/23 12

Strings

1 s = 'Hello'2 print s[0]3 print s[4]4 print s[-1]5 print s[1:3]6 print s[2:]7 print s[:3]8 print s[::2]9 print s[::-1]10 print len(s)

Single or double quotes denote a string

Brackets access characters of the stringby index:

“Slices” can be taken with indicesseparated by a colon

Third term in slice determines step size.

'H''o''o'

'el'

'llo''Hel'

'Hlo'

'olleH'

5 len() gives length of string.

04/21/23 13

String Methods

s.lower(), s.upper() -- returns the lowercase or uppercase version of the string

s.strip() -- returns a string with whitespace removed from the start and end

s.isalpha()/s.isdigit()/s.isspace()... -- tests if all the string chars are in the various character classes

s.startswith('other'), s.endswith('other') -- tests if the string starts or ends with the given other string

s.find('other') -- searches for the given other string (not a regular expression) within s, and returns the first index where it begins or -1 if not found

s.replace('old', 'new') -- returns a string where all occurrences of 'old' have been replaced by 'new'

s.split('delim') -- returns a list of substrings separated by the given delimiter. The delimiter is not a regular expression, it's just text. 'aaa,bbb,ccc'.split(',') -> ['aaa', 'bbb', 'ccc']. As a convenient special case s.split() (with no arguments) splits on all whitespace chars.

s.join(list) -- opposite of split(), joins the elements in the given list together using the string as the delimiter. e.g. '---'.join(['aaa', 'bbb', 'ccc']) -> aaa---bbb---ccc

04/21/23 14

Practice

Write a function that takes a string and returns another string consisting of the first two and last two characters of the input string. If the input string has fewer than two characters, return an empty string.

Write a function that takes two strings and returns the number of times the second string appears in the first.

04/21/23 15

Lists

Lists in Python are similar to arrays in other languages

1 z = [17,19, 23, 29, 31]2 print z[0]3 print z[4]4 print z[-1]5 print z[-3]6 print z[1:3]7 print z[2:]8 print z[:3]9 print z[::-1]10 print range(5)

Square brackets indicate list.

Brackets also accesselements in the list. Notethey are 0-indexed.

Negative index starts from end.

Colon inidicates “slice” fromlist.

Idiom for reversing a list.

1731

31

23[19, 23]

[23, 29, 31]

[17, 19, 23][31, 29, 23, 19, 17]

[0, 1, 2, 3, 4] range(n) return a list of integers

04/21/23 16

List Methods

list.append(elem) -- adds a single element to the end of the list. Common error: does not return the new list, just modifies the original.

list.insert(index, elem) -- inserts the element at the given index, shifting elements to the right.

list.extend(list2) adds the elements in list2 to the end of the list. Using + or += on a list is similar to using extend().

list.index(elem) -- searches for the given element from the start of the list and returns its index. Throws a ValueError if the element does not appear (use "in" to check without a ValueError).

list.remove(elem) -- searches for the first instance of the given element and removes it (throws ValueError if not present)

list.sort() -- sorts the list in place (does not return it). (The sorted() function shown below is preferred.)

list.reverse() -- reverses the list in place (does not return it)

list.pop(index) -- removes and returns the element at the given index. Returns the rightmost element if index is omitted (roughly the opposite of append()).

04/21/23 17

Practice

Write a function that takes a list of strings, return a list with the strings in sorted order, except group all the strings that begin with 'x' first.

Write a function that takes a list of numbers and returns a list where all adjacent == elements have been reduced to a single element, so [1, 2, 2, 3] returns [1, 2, 3].

04/21/23 18

Dictionaries

Python's key/value hash table is called a dictionary

1 d = {}2 d['a'] = 'alpha'3 d['g'] = 'gamma'4 print d['a']5 print d['z']6 if 'z' in d:7 print d['z']8 print d.keys()9 print d.values()10 print d.items()

Curly braces indicate a dictionary

Associate keys with values

Retrieve values associated with keys'alpha'

KeyError

Check if key in dictionary.

['a', 'g']

['alpha', 'gamma']

[('a', 'alpha'), ('g', 'gamma')]

04/21/23 19

Files

1 f = open('file.txt', 'r')2 outf = open('output.txt', 'w')3 for line in f:4 print line5 outf.write(line)6 f.close()7 outf.close()8 wholefile = file('file.txt').read()9 oneline = file('file.txt').readline()

Files in Python are generally handled line by lineopen returns a file object

The second argument to open setsthe mode. 'r' means read, 'w' meanswrite. Note the write mode completelyoverwrites an existing file.

You can iterate through lines in a file usinga for loop.

The write method of a file object in write mode writesa string to the file.

You can use the shorter file(filename) syntax to get a file object in read mode.

The read method with no arguments returns the contents of the whole file.The readline() method returns a single line

from a file object.

04/21/23 20

Command Line Arguments

The sys module has a list called argv that contains the arguments used at the command line.

1 import sys2 3 def main(word_to_print):4 print word_to_print

1 if __name__ == '__main__':2 print sys.argv3 main(sys.argv[1])

['scriptname.py', 'argument1', 'argument2', ...]

Here select the second element of the list since we don't care about thename of the script.

04/21/23 21

Practice

Sequencing data comes in files in the FASTQ format:

Write a program that reads a FASTQ file and writes only the reversed sequences to another file. The names of in input and output files should be passed as command line parameters.

@SEQ_ID1GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT+!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65@SEQ_ID2AGTGCGGGAAATATCACCGTACATTCATCGCCCCCCTGAACAATACCCATAGATCACTT+!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65...

04/21/23 22

Getting Help

Python has an online tutorial and reference at http://docs.python.org/

The “help” command gives help in interactive mode:

Google “python” + your question

For windows users:

http://www.richarddooling.com/index.php/2006/03/14/python-on-xp-7-minutes-to-hello-world/

help(len)len(...) len(object) -> integer Return the number of items of a sequence or mapping.