introduction of opportunity and challenge in biostatistics and bioinformatics...

45
Introduction of opportunity and challenge in Biostatistics and Bioinformatics to Math major students George C. Tseng Department of Biostatistics Department of Human Genetics University of Pittsburgh

Upload: others

Post on 01-Mar-2020

0 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

Introduction of opportunity and challenge in Biostatistics and

Bioinformatics to Math major students

George C. TsengDepartment of Biostatistics

Department of Human GeneticsUniversity of Pittsburgh

Page 2: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

Possible applications of probability and statisticsBiostatistics

Academic researchIndustry

BioinformaticsTransitions

Application => Ph.D. student => Research/JobSome final words

Curriculum and preparationStudying abroad??

Outline

Page 3: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

My CV

University of PittsburghBiostatistics03~

Harvard UniversityPh.D. Biostatistics00-03

UCLAStatistics99-00

National Taiwan Univ.M.S. Statistics97-99

National Taiwan Univ.B.S. Mathematics93-97

Page 4: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

IncomeBrain

Epidemiologist

Physician

Biostatistician

Statistician

Applied Mathematician

Low

High

MathematicianHigh

Low

Page 5: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

I. Applications of statistics

Agricultural scienceSocial science: education, psychology,…Financial mathematicsActuarial scienceBiomedical science

Biostatistics, medical imaging, Biomath, Biophysics...Bioinformatics, Computational Biology

……

Page 6: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

II. Biostatistics

Statistical research usually motivated by applications of public health, medicine or genetics.Research results should at least have one area of application.Harvard, Johns Hopkins, U Washington, U North Carolina-Chapel Hill, U Michigan, U Minnesota, U Pittsburgh, Case Western Reserve Univ., Columbia Univ., Emory Univ., Boston Univ., UCLA, U Wisconsin-Madison

Page 7: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

Research Areas: (from the dept. website)

Dept. of Biostatistics at HarvardAIDS researchCancer researchComputational biology & BioinformaticsEnvironmental statisticsGenetic epidemiologyNeurostatisticsPsychiatric biostatistics

II. Biostatistics

Page 8: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

II. Biostatistics

Research Areas: (from the dept. website)

Dept. of Biostatistics at Univ. PittsburghCancer treatment trialsHealth outcomes/health services researchEnvironmental & occupational epidemiologyRadiological imaging systemPsychiatric researchComputational biology & BioinformaticsStatistical methodology

Page 9: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

II. BiostatisticsA simple example of survival analysis:

ID group relapse survival

1 1 1 12

2 1 0 60

3 1 0 60

4 1 0 60

5 1 1 12

6 1 0 60

7 1 0 60

8 1 0 60

9 1 0 60

10 1 0 60

11 0 1 1

12 1 0 60

A new drug and an old drug are applied to cancer patients. Survival time of each patients are recorded after treatment. The study was terminated at 60 months.

New drug (1):196 patientsOld drug (0): 35 patientsRelapse (1): diedRelapse (0): survived over

Q: How do we rigorously and confidently decide the new drug is better than the old drug?

Page 10: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

Kaplan-Meier curve

II. BiostatisticsA simple example of survival analysis:

Page 11: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

Compare the difference of two survival curves.Modelling censoring and survival model.

Early drop out patientsPatients participate in interim of study

Experimental designCase-control matched studyEarly termination

II. BiostatisticsA simple example of survival analysis:

Page 12: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

II. Biostatistics

96181Total12Deceased7 23Unknown

2 20Other (includes students continuing for doctoral degree)

2331Private Industry

425Other Health Research Groups*

1128Government Agencies4852Academic InstitutionsPh.D/Sc.D.M.S./M.P.H.Type of Employment

Employment of alumni (Dept. of Biostatistics, Univ. of Pittsburgh)

Page 13: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

Tenure trackResearch (publication and academic activity)

Methodology researchCollaborative research

TeachingGrant proposalsService (committees, advising students…)

Research trackResearch

CollaborativeMethodology

Grant proposals

II. Biostatistics: working in university

Page 14: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

Centers for Disease Control National Institutes of Health U.S. Census Bureau National Center for Health Statistics Food and Drug Administration

II. Biostatistics: working in government

Page 15: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

Merck: one of the largest drug companies in the US

• Global, research-driven pharmaceutical company

– ~62,000 employees worldwide in 26 countries– In 2004, $22.9 billion in sales, $5.8 billion in net income,

$3 billion invested in research• Broad range of products• Ranked in “100 Best to Work For” and “America’s Most Admired” and “Global Most Admired”

II. Biostatistics: working in pharmaceutical company

Info. from Merck & Co., Inc.

Page 16: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

Manufacturing/ Quality Control

Pharmacology/ Toxicology

Regulatory Affairs

Data Management

EpidemiologyClinical Trials

Market ResearchManagement

Research AdministrationDiscovery

Areas of Application

Genomics

Statistician

Info. from Merck & Co., Inc.

II. Biostatistics: working in pharmaceutical company

Page 17: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

Creation Role of Statistician

Creation

New Drug Development

Analyze high throughput screening resultsDesign screening strategies and select analogsAnalyze dose-response studiesEmploy bioassay techniquesEvaluate carcinogenic potentialEvaluate reproductive and genetic toxicology

Drug discoveryChemical synthesisLaboratory testingAnimal testingFormulation of ingredients

(2 - 4 Years)

Info. from Merck & Co., Inc.

II. Biostatistics: working in pharmaceutical company

Page 18: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

Human Testing Role of Statistician

Creation INDSubmission

Human Testing

Propose statistical methodologyApprove study protocolsInteract with Project TeamAnalyze and interpret early studies

Phase I - SafetyPhase II a - Proof of ConceptPhase II b - Dose-RangingPhase III - Safety and Efficacy

(3 - 7 Years)

New Drug Development

Info. from Merck & Co., Inc.

II. Biostatistics: working in pharmaceutical company

Page 19: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

Role of Statistician

New Drug Application Role of Statistician

Creation INDSubmission

Human Testing NDASubmission

Summarize across studiesPrepare statistical technical sectionPresent methodology and results to FDA

FDA submission and reviewNew drug available to patients and physicians

(1 - 3 years to prepare,1 year to review)

New Drug Development

Info. from Merck & Co., Inc.

II. Biostatistics: working in pharmaceutical company

Page 20: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

Role of Statistician

Further Evaluation Role of Statistician

Creation INDSubmission

Human Testing NDASubmission

FDAApproval

FurtherEvaluation

Design and analyze post-marketing studiesSubmit papers for publication

OngoingAdditional usesAdditional side effectsModification of dosage or form

New Drug Development

Info. from Merck & Co., Inc.

II. Biostatistics: working in pharmaceutical company

Page 21: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

Info. from Merck & Co., Inc.

II. Biostatistics: working in pharmaceutical company

Page 22: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

Combinatorial Gene Regulation

A microarray experiment showed that when gene X is knocked out, 20 other genes are not expressed

How can one gene have such drastic effects?

III. BioinformaticsA simple example of motif finding

From http://www.bioalgorithms.info/

Page 23: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

Regulatory ProteinsGene X encodes regulatory protein, a.k.a. a transcription factor (TF)

The 20 unexpressed genes rely on gene X’s TF to induce transcription

A single TF may regulate multiple genes

III. BioinformaticsA simple example of motif finding

From http://www.bioalgorithms.info/

Page 24: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

Transcription Factors and Motifs

III. BioinformaticsA simple example of motif finding

From http://www.bioalgorithms.info/

Page 25: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

Motifs and Transcriptional Start Sites

geneATCCCG

geneTTCCGG

geneATCCCG

geneATGCCG

geneATGCCC

III. BioinformaticsA simple example of motif finding

From http://www.bioalgorithms.info/

Page 26: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

Motif Logos: An Example

III. BioinformaticsA simple example of motif finding

From http://www.bioalgorithms.info/

Page 27: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

Random Sampleatgaccgggatactgataccgtatttggcctaggcgtacacattagataaacgtatgaagtacgttagactcggcgccgccg

acccctattttttgagcagatttagtgacctggaaaaaaaatttgagtacaaaacttttccgaatactgggcataaggtaca

tgagtatccctgggatgacttttgggaacactatagtgctctcccgatttttgaatatgtaggatcattcgccagggtccga

gctgagaattggatgaccttgtaagtgttttccacgcaatcgcgaaccaacgcggacccaaaggcaagaccgataaaggaga

tcccttttgcggtaatgtgccgggaggctggttacgtagggaagccctaacggacttaatggcccacttagtccacttatag

gtcaatcatgttcttgtgaatggatttttaactgagggcatagaccgcttggcgcacccaaattcagtgtgggcgagcgcaa

cggttttggcccttgttagaggcccccgtactgatggaaactttcaattatgagagagctaatctatcgcgtgcgtgttcat

aacttgagttggtttcgaaaatgctctggggcacatacaagaggagtcttccttatcagttaatgctgtatgacactatgta

ttggcccattggctaaaagcccaacttgacaaatggaagatagaatccttgcatttcaacgtatgccgaaccgaaagggaag

ctggtgagcaacgacagattcttacgtgcattagctcgcttccggggatctaatagcacgaagcttctgggtactgatagca

III. BioinformaticsA simple example of motif finding

Page 28: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

Implanting Motif AAAAAAAGGGGGGGatgaccgggatactgatAAAAAAAAGGGGGGGggcgtacacattagataaacgtatgaagtacgttagactcggcgccgccg

acccctattttttgagcagatttagtgacctggaaaaaaaatttgagtacaaaacttttccgaataAAAAAAAAGGGGGGGa

tgagtatccctgggatgacttAAAAAAAAGGGGGGGtgctctcccgatttttgaatatgtaggatcattcgccagggtccga

gctgagaattggatgAAAAAAAAGGGGGGGtccacgcaatcgcgaaccaacgcggacccaaaggcaagaccgataaaggaga

tcccttttgcggtaatgtgccgggaggctggttacgtagggaagccctaacggacttaatAAAAAAAAGGGGGGGcttatag

gtcaatcatgttcttgtgaatggatttAAAAAAAAGGGGGGGgaccgcttggcgcacccaaattcagtgtgggcgagcgcaa

cggttttggcccttgttagaggcccccgtAAAAAAAAGGGGGGGcaattatgagagagctaatctatcgcgtgcgtgttcat

aacttgagttAAAAAAAAGGGGGGGctggggcacatacaagaggagtcttccttatcagttaatgctgtatgacactatgta

ttggcccattggctaaaagcccaacttgacaaatggaagatagaatccttgcatAAAAAAAAGGGGGGGaccgaaagggaag

ctggtgagcaacgacagattcttacgtgcattagctcgcttccggggatctaatagcacgaagcttAAAAAAAAGGGGGGGa

III. BioinformaticsA simple example of motif finding

Page 29: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

Where is the Implanted Motif? atgaccgggatactgatAAAAAAAAGGGGGGGggcgtacacattagataaacgtatgaagtacgttagactcggcgccgccg

acccctattttttgagcagatttagtgacctggaaaaaaaatttgagtacaaaacttttccgaataAAAAAAAAGGGGGGGa

tgagtatccctgggatgacttAAAAAAAAGGGGGGGtgctctcccgatttttgaatatgtaggatcattcgccagggtccga

gctgagaattggatgAAAAAAAAGGGGGGGtccacgcaatcgcgaaccaacgcggacccaaaggcaagaccgataaaggaga

tcccttttgcggtaatgtgccgggaggctggttacgtagggaagccctaacggacttaatAAAAAAAAGGGGGGGcttatag

gtcaatcatgttcttgtgaatggatttAAAAAAAAGGGGGGGgaccgcttggcgcacccaaattcagtgtgggcgagcgcaa

cggttttggcccttgttagaggcccccgtAAAAAAAAGGGGGGGcaattatgagagagctaatctatcgcgtgcgtgttcat

aacttgagttAAAAAAAAGGGGGGGctggggcacatacaagaggagtcttccttatcagttaatgctgtatgacactatgta

ttggcccattggctaaaagcccaacttgacaaatggaagatagaatccttgcatAAAAAAAAGGGGGGGaccgaaagggaag

ctggtgagcaacgacagattcttacgtgcattagctcgcttccggggatctaatagcacgaagcttAAAAAAAAGGGGGGGa

III. BioinformaticsA simple example of motif finding

Page 30: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

Implanting Motif AAAAAAGGGGGGG with Four Mutations

atgaccgggatactgatAgAAgAAAGGttGGGggcgtacacattagataaacgtatgaagtacgttagactcggcgccgccg

acccctattttttgagcagatttagtgacctggaaaaaaaatttgagtacaaaacttttccgaatacAAtAAAAcGGcGGGa

tgagtatccctgggatgacttAAAAtAAtGGaGtGGtgctctcccgatttttgaatatgtaggatcattcgccagggtccga

gctgagaattggatgcAAAAAAAGGGattGtccacgcaatcgcgaaccaacgcggacccaaaggcaagaccgataaaggaga

tcccttttgcggtaatgtgccgggaggctggttacgtagggaagccctaacggacttaatAtAAtAAAGGaaGGGcttatag

gtcaatcatgttcttgtgaatggatttAAcAAtAAGGGctGGgaccgcttggcgcacccaaattcagtgtgggcgagcgcaa

cggttttggcccttgttagaggcccccgtAtAAAcAAGGaGGGccaattatgagagagctaatctatcgcgtgcgtgttcat

aacttgagttAAAAAAtAGGGaGccctggggcacatacaagaggagtcttccttatcagttaatgctgtatgacactatgta

ttggcccattggctaaaagcccaacttgacaaatggaagatagaatccttgcatActAAAAAGGaGcGGaccgaaagggaag

ctggtgagcaacgacagattcttacgtgcattagctcgcttccggggatctaatagcacgaagcttActAAAAAGGaGcGGa

III. BioinformaticsA simple example of motif finding

Page 31: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

Where is the Motif??? atgaccgggatactgatagaagaaaggttgggggcgtacacattagataaacgtatgaagtacgttagactcggcgccgccg

acccctattttttgagcagatttagtgacctggaaaaaaaatttgagtacaaaacttttccgaatacaataaaacggcggga

tgagtatccctgggatgacttaaaataatggagtggtgctctcccgatttttgaatatgtaggatcattcgccagggtccga

gctgagaattggatgcaaaaaaagggattgtccacgcaatcgcgaaccaacgcggacccaaaggcaagaccgataaaggaga

tcccttttgcggtaatgtgccgggaggctggttacgtagggaagccctaacggacttaatataataaaggaagggcttatag

gtcaatcatgttcttgtgaatggatttaacaataagggctgggaccgcttggcgcacccaaattcagtgtgggcgagcgcaa

cggttttggcccttgttagaggcccccgtataaacaaggagggccaattatgagagagctaatctatcgcgtgcgtgttcat

aacttgagttaaaaaatagggagccctggggcacatacaagaggagtcttccttatcagttaatgctgtatgacactatgta

ttggcccattggctaaaagcccaacttgacaaatggaagatagaatccttgcatactaaaaaggagcggaccgaaagggaag

ctggtgagcaacgacagattcttacgtgcattagctcgcttccggggatctaatagcacgaagcttactaaaaaggagcgga

III. BioinformaticsA simple example of motif finding

Page 32: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

Why Finding (15,4) Motif is Difficult?atgaccgggatactgatAgAAgAAAGGttGGGggcgtacacattagataaacgtatgaagtacgttagactcggcgccgccg

acccctattttttgagcagatttagtgacctggaaaaaaaatttgagtacaaaacttttccgaatacAAtAAAAcGGcGGGa

tgagtatccctgggatgacttAAAAtAAtGGaGtGGtgctctcccgatttttgaatatgtaggatcattcgccagggtccga

gctgagaattggatgcAAAAAAAGGGattGtccacgcaatcgcgaaccaacgcggacccaaaggcaagaccgataaaggaga

tcccttttgcggtaatgtgccgggaggctggttacgtagggaagccctaacggacttaatAtAAtAAAGGaaGGGcttatag

gtcaatcatgttcttgtgaatggatttAAcAAtAAGGGctGGgaccgcttggcgcacccaaattcagtgtgggcgagcgcaa

cggttttggcccttgttagaggcccccgtAtAAAcAAGGaGGGccaattatgagagagctaatctatcgcgtgcgtgttcat

aacttgagttAAAAAAtAGGGaGccctggggcacatacaagaggagtcttccttatcagttaatgctgtatgacactatgta

ttggcccattggctaaaagcccaacttgacaaatggaagatagaatccttgcatActAAAAAGGaGcGGaccgaaagggaag

ctggtgagcaacgacagattcttacgtgcattagctcgcttccggggatctaatagcacgaagcttActAAAAAGGaGcGGa

AgAAgAAAGGttGGG

cAAtAAAAcGGcGGG..|..|||.|..|||

III. BioinformaticsA simple example of motif finding

Page 33: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

Questions:How to develop a good probabilistic model for the motifs?Is the computation affordable to search the whole genome? (Human genome is around 3 billion base pair long.)How to evaluate the statistical significance of the motifs you find?

III. BioinformaticsA simple example of motif finding

Page 34: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

IV. Transitions

Under-graduate

Preparation;Military service

Ph.D. study Post-doctoral position

Assistant Professor

Associate Professor

Full Professor

4-5 yrs 2-3 yrs 6 yrs

Tenure evaluation

School application

Job application

Page 35: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

IV. Transitions: Application

GRE, TOEFL, GPARecommendation letterStudy plan

Prepare and ask around early: take GRE and TOEFL; identify professors for recommendation letters and advisesAcademia Sinica (a good place to stay for short term transition and preparation)

Page 36: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

Settle down and enjoyImprove English; think open and AmericanProfessor, classmates, office-mates, colleagues are good assets for your future

Financial situation:Stipend (US$1600-$300tax) from TA or RARent US$400~500. Living cost $300~500.

IV. Transitions: Ph.D. study

Page 37: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

Going to academic is usually more busy than going to industry but with more freedom.No boss v.s. with a bossIrregular/flexible working hour v.s. regular working hour

IV. Transitions: Research/Job

?? $$$ ??

Page 38: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

IV. Transitions: Research/Job

University (9 months)

From Amstat News

Page 39: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

IV. Transitions: Research/Job

Industry

From Amstat News

Page 40: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

Government

IV. Transitions: Research/Job

From Amstat News

Page 41: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

V. Some final words: course preparation

Life Sciences Cell Biology/Molecular BiologyBiochemistryGenetics

Computer Science Intermediate/Advanced Programming (JAVA, C++)Fundamental Data Structures and Algorithms Algorithms

Physical Sciences Statistical Thermodynamics or Physical Chemistry

Mathematics and StatisticsVector CalculusLinear AlgebraProbability & Statistics

Computational BiologyComputational Biology; Bioinformatics

Page 42: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

Try to go abroad if possible

There are very good graduate programs in Taiwan. If you choose to stay, try to apply for a one-year exchange program abroad.

V. Some final words: Taiwan or abroad

Page 43: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

V. Some final words: Preparation

Course preparationImprove English (take GRE and TOEFL early)Talk to some researchers in NTU and SinicaGet good recommendation letters and write a good essayGo to talks (NTU Math, NTU biostatistics, Sinica)Apply as many (good) schools as you can.Money should not be an issue if you get stipend support.

Page 44: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

V. Some final words: after you get there

Continue to improve EnglishFind a good advisor (reputation in research, personality)Be collegial and collaborative; change our viewpoint and re-interpret what you see without bias.

Page 45: Introduction of opportunity and challenge in Biostatistics and Bioinformatics …ctseng/presentations/051221_NTU.pdf · 2005-12-22 · Introduction of opportunity and challenge in

Thanks for your attention!