intro to next generation sequencing
DESCRIPTION
Intro to Next Generation Sequencing. Nick Loman and James Hadfield. http:// omicsmaps.com /. Koboldt et al., 2010 (Figure 3). Bench work to build libraries and sequence. Clean up and QA reads. Alignments to Genome or Transcriptome. Analysis of Alignments. Koboldt et al., 2010. - PowerPoint PPT PresentationTRANSCRIPT
![Page 1: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/1.jpg)
DM Church Last Updated: 7 May 2012
Intro to Next Generation Sequencing
![Page 2: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/2.jpg)
DM Church Last Updated: 7 May 2012
http://omicsmaps.com/ Nick Loman and James Hadfield
![Page 3: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/3.jpg)
DM Church Last Updated: 7 May 2012
![Page 4: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/4.jpg)
DM Church Last Updated: 7 May 2012
Koboldt et al., 2010 (Figure 3)
![Page 5: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/5.jpg)
DM Church Last Updated: 7 May 2012
![Page 6: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/6.jpg)
DM Church Last Updated: 7 May 2012
Bench work to build libraries and
sequence
Clean up and QA reads
Alignments to Genome or
Transcriptome
Analysis of Alignments
![Page 7: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/7.jpg)
DM Church Last Updated: 7 May 2012
Koboldt et al., 2010
Sample Contamination
Library chimeras
Sample mix-upsTumor-normal
switches
Run quality
![Page 8: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/8.jpg)
DM Church Last Updated: 7 May 2012
Koboldt et al, (Fig 4A)
![Page 9: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/9.jpg)
DM Church Last Updated: 7 May 2012
![Page 10: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/10.jpg)
DM Church Last Updated: 7 May 2012
Chor et al., 2009
![Page 11: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/11.jpg)
DM Church Last Updated: 7 May 2012
CCL Bio
![Page 12: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/12.jpg)
DM Church Last Updated: 7 May 2012
GCTACGGCATTCAGGCATCAGGCATTAGCAGGGCATTCAGGGATCAGGCATTAGC->
<-CATGGCATTCAGGGATCAGGCATT<-GCCATGGCATTCAGGGATCAGGC
CATTCAGGGATCAGGCATTAGCAG->
GGCATTCAGGGATCAGGCATTAGC->CATTCAGGGATCAGGCATTAGCAG->
GGCATTCAGGGATCAGGCATT-><-GGATCAGGCATTAGCAG<-GATCAGGCATTAGCAG<-GGATCAGGCATTAGCAG
![Page 13: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/13.jpg)
DM Church Last Updated: 7 May 2012
High Coverage: qualities may not be needed
![Page 14: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/14.jpg)
DM Church Last Updated: 7 May 2012
Low Coverage: qualities are important
![Page 15: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/15.jpg)
DM Church Last Updated: 7 May 2012
Custodia-Lora et al., 2003
![Page 16: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/16.jpg)
DM Church Last Updated: 7 May 2012
FASTQ Example
FASTQ example from: Cock et al. (2009). Nuc Acids Res 38:1767-1771.
For analysis, it may be necessary to convert to the Sanger form of FASTQ…For example,
Illumina stores quality scores ranging from 0-62;Sanger quality scores range from 0-93.
Solexa quality scores have to be converted to PHRED quality scores.
![Page 17: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/17.jpg)
DM Church Last Updated: 7 May 2012
SAM (Sequence Alignment/Map)
• It may not be necessary to align reads from scratch…you can instead use existing alignments in SAM format– SAM is the output of aligners that map reads to a
reference genome– Tab delimited w/ header section and alignment
section• Header sections begin with @ (are optional)• Alignment section has 11 mandatory fields
– BAM is the binary format of SAM
http://samtools.sourceforge.net/
![Page 18: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/18.jpg)
DM Church Last Updated: 7 May 2012http://samtools.sourceforge.net/SAM1.pdf
Mandatory Alignment Fields
![Page 19: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/19.jpg)
DM Church Last Updated: 7 May 2012http://samtools.sourceforge.net/SAM1.pdf
Alignment Examples
Alignments in SAM format
![Page 20: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/20.jpg)
DM Church Last Updated: 7 May 2012
chr1 86114265 86116346 nsv433165chr2 1841774 1846089 nsv433166chr16 2950446 2955264 nsv433167chr17 14350387 14351933 nsv433168chr17 32831694 32832761 nsv433169chr17 32831694 32832761 nsv433170chr18 61880550 61881930 nsv433171
chr1 16759829 16778548 chr1:21667704 270866 -chr1 16763194 16784844 chr1:146691804 407277 +chr1 16763194 16784844 chr1:144004664 408925 -chr1 16763194 16779513 chr1:142857141 291416 -chr1 16763194 16779513 chr1:143522082 293473 -chr1 16763194 16778548 chr1:146844175 284555 -chr1 16763194 16778548 chr1:147006260 284948 -chr1 16763411 16784844 chr1:144747517 405362 +
Valid BED files
![Page 21: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/21.jpg)
DM Church Last Updated: 7 May 2012
GTF
![Page 22: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/22.jpg)
DM Church Last Updated: 7 May 2012
##gff-version 3##gvf-version 1.02##species http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=10090##genome-build NCBI MGSCv36##assembly-name MGSCv36##assembly-accession GCF_000001635.15##file-date 2011-11-18# Study_accession: Combined studies on MGSCv36# Display_name: Combined studies on MGSCv36# Study_description: Combined studies on MGSCv36chr1 dbVar copy_number_variation 90044442 90114410 . . .
ID=nsv433533;Name=nsv433533;Start_range=.,90044442;End_range=90114410,.chr4 dbVar copy_number_variation 121483931 121646639 .
. .ID=nsv433534;Name=nsv433534;Start_range=.,121483931;End_range=121646639,.chr9 dbVar copy_number_variation 109128634 109146964 .
. .ID=nsv433535;Name=nsv433535;Start_range=.,109128634;End_range=109146964,.chr17 dbVar copy_number_variation 30240627 30614866 . . .
ID=nsv433536;Name=nsv433536;Start_range=.,30240627;End_range=30614866,.chr17 dbVar copy_number_variation 30983722 31036099 . . .
ID=nsv433537;Name=nsv433537;Start_range=.,30983722;End_range=31036099,.chr17 dbVar copy_number_variation 34907088 34962504 . . .
ID=nsv433538;Name=nsv433538;Start_range=.,34907088;End_range=34962504,.
GVF format
![Page 23: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/23.jpg)
DM Church Last Updated: 7 May 2012
http://www.ncbi.nlm.nih.gov/dbvar
http://www.ebi.uk/dgva
http://www.ncbi.nlm.nih.gov/snp
Derived data
![Page 24: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/24.jpg)
DM Church Last Updated: 7 May 2012
Derived data
![Page 25: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/25.jpg)
DM Church Last Updated: 7 May 2012
Actual data
![Page 26: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/26.jpg)
DM Church Last Updated: 7 May 2012Oct-00 Feb-02 Jun-03 Nov-04 Mar-06 Aug-07 Dec-08 May-10 Sep-11
100000000
1000000000
10000000000
100000000000
1000000000000
10000000000000
100000000000000
1000000000000000 Trace and SRA Holdings
TraceArchive Bases
SRA Bases
SRA Bytes
Getting exponential growth under control
![Page 27: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/27.jpg)
DM Church Last Updated: 7 May 2012
Trace Organizationseq1
seq2
FASTAQualityChromatogramExperimental infoSample
FASTAQualityChromatogramExperimental infoSample
SRA Organization
Experiments
Samples
Sequences and Qualities
![Page 28: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/28.jpg)
DM Church Last Updated: 7 May 2012Feb-08 Sep-08 Mar-09 Oct-09 May-10 Nov-10 Jun-11 Dec-110
1
2
3
4
5
6
7
8
9
10
Bytes per base in SRA
CummulitiveIncrementalMoving Av-erage
Era of NGS Explosion FASTQ Era Bits/Base Era
As of April 10, 2012 SRA contains less bytes then bases
![Page 29: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/29.jpg)
DM Church Last Updated: 7 May 2012
New CycleDecision Circle
What data series to
store
Redundancy removal
Normalization
Lossy vs Lossless
Compression tuning
Practical Application
BAM and similar formats containing both raw
reads and alignments become primary output
of raw sequencing
Increases the number of data
series
Compression By Reference
reduces sizes of other data series
New sets of tradeoffs
New compression algorithms
![Page 30: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/30.jpg)
DM Church Last Updated: 7 May 2012
Analyzing New Compression MethodData from 1000 Genome Project
• All available combinations of samples, platforms, and aligners
• 3114 files• 27 Tb of disk space after compression
BAMs from 1000 Genome Project
• Names are dropped after restoring mates• Only sequencing quality score is saved• None of non-redundant optional tags are preserved
BAM treatment
• Occasional alignments to stretches of Ns on the reference and beyond the reference were converted to unaligned
• Different PCR duplicate flags for mates
Correction of BAM
inconsistencies
![Page 31: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/31.jpg)
DM Church Last Updated: 7 May 2012
Changes To SRA Run Browser
![Page 32: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/32.jpg)
DM Church Last Updated: 7 May 2012
http://aws.amazon.com/datasets/4383
![Page 33: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/33.jpg)
DM Church Last Updated: 7 May 2012
https://main.g2.bx.psu.edu/
![Page 34: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/34.jpg)
DM Church Last Updated: 7 May 2012
http://www.genomespace.org/
![Page 35: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/35.jpg)
DM Church Last Updated: 7 May 2012
Science 1 July 2011:Vol. 333 no. 6038 pp. 53-58DOI: 10.1126/science.1207018
![Page 36: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/36.jpg)
DM Church Last Updated: 7 May 2012
Li et al., 2011, Figure 1
![Page 37: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/37.jpg)
DM Church Last Updated: 7 May 2012
Li et al., 2011Fig. 2
![Page 38: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/38.jpg)
DM Church Last Updated: 7 May 2012
Kleinman et al., 2012Fig 1
![Page 39: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/39.jpg)
DM Church Last Updated: 7 May 2012
Kleinman et al., 2012Table 1
![Page 40: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/40.jpg)
DM Church Last Updated: 7 May 2012
Lin et al., 2012Fig 1
![Page 41: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/41.jpg)
DM Church Last Updated: 7 May 2012
Lin et al., 2012Fig 2
![Page 42: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/42.jpg)
DM Church Last Updated: 7 May 2012
Pickrell et al., 2012Fig 1
![Page 43: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/43.jpg)
DM Church Last Updated: 7 May 2012
Li et al, 2012Fig 1
![Page 44: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/44.jpg)
DM Church Last Updated: 7 May 2012
Li et al., 2012Fig 2
![Page 45: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/45.jpg)
DM Church Last Updated: 7 May 2012
Li et al., 2012Fig 3
![Page 46: Intro to Next Generation Sequencing](https://reader035.vdocuments.us/reader035/viewer/2022062315/56816471550346895dd65592/html5/thumbnails/46.jpg)
DM Church Last Updated: 7 May 2012
Li et al, 2012Fig 4