1

Intrafetal glucose infusion alters glucocorticoid signalling and reduces surfactant 1

protein mRNA expression in the lung of the late gestation sheep fetus 2

3

Erin V. McGillick1,2

, Janna L Morrison1, I. Caroline McMillen

1 and Sandra Orgeig

2 4

5

AUTHOR CONTRIBUTIONS 6

EM, ICM, SO and JLM were responsible for the conception and design of the experiments. 7

EM, ICM, SO and JLM were each involved in data acquisition. 8

EM, ICM, SO and JLM were involved in analysis and interpretation of the data. 9

EM, ICM, SO and JLM drafted the article and all authors contributed to the final version. 10

11

AFFILIATIONS 12

Early Origins of Adult Health Research Group1 and Molecular & Evolutionary Physiology of 13

the Lung Laboratory2,

School of Pharmacy & Medical Sciences, Sansom Institute for Health 14

Research, University of South Australia, Adelaide, SA, Australia, 5001 15

16

RUNNING TITLE: Glucose infusion delays surfactant maturation 17

18

Corresponding author: 19

A/Prof Sandra Orgeig 20

Molecular & Evolutionary Physiology of the Lung Laboratory 21

School of Pharmacy & Medical Sciences, Sansom Institute for Health Research 22

University of South Australia 23

GPO Box 2471, Adelaide SA, AUSTRALIA 5001 24

Phone: 61 8 83022649; FAX: 61 8 83021087; Email: Sandra.Orgeig@unisa.edu.au 25

26

27

Articles in PresS. Am J Physiol Regul Integr Comp Physiol (July 2, 2014). doi:10.1152/ajpregu.00053.2014

Copyright © 2014 by the American Physiological Society.

2

ABSTRACT 28

Increased circulating fetal glucose and insulin concentrations are potential inhibitors of fetal 29

lung maturation and may contribute to the pathogenesis of respiratory distress syndrome 30

(RDS) in infants of diabetic mothers. In this study, we examined the effect of intrafetal 31

glucose infusion on mRNA expression of glucose transporters, insulin-like growth factor 32

signalling, glucocorticoid regulatory genes and surfactant proteins in the lung of the late 33

gestation sheep fetus. The numerical density of the cells responsible for producing surfactant 34

was determined using immunohistochemistry. Glucose infusion for 10d did not affect mRNA 35

expression of glucose transporters or insulin like growth factors (IGF), but did decrease IGF-36

1R expression. There was reduced mRNA expression of the glucocorticoid converting 37

enzyme HSD11B-1 and the glucocorticoid receptor, potentially reducing glucocorticoid 38

responsiveness in the fetal lung. Furthermore, surfactant protein (SFTP) mRNA expression 39

was reduced in the lung following glucose infusion, while the number of SFTP-B positive 40

cells remained unchanged. These findings suggest the presence of a glucocorticoid-mediated 41

mechanism regulating delayed maturation of the surfactant system in the sheep fetus 42

following glucose infusion and provide evidence for the link between abnormal glycemic 43

control during pregnancy and the increased risk of RDS in infants of uncontrolled diabetic 44

mothers. 45

KEYWORDS: glucose, diabetes, obesity, surfactant, 46

47

INTRODUCTION 48

In the face of a world-wide obesity epidemic, there has been an increase in the 49

proportion of women entering pregnancy either overweight or obese (11, 29). With 45% of 50

women being obese at delivery (1), there has been an increase in obstetric complications in 51

3

this population, including gestational diabetes and preterm birth (9), which are both 52

associated with an increased risk of neonatal respiratory failure (59). 53

Maternal metabolic regulation throughout pregnancy, particularly glucose 54

homeostasis, is an important factor affecting fetal growth and development (3). Pregnancy is 55

characterised by a state of insulin resistance in late gestation, which is essential to provide 56

substrates to the developing fetus (13). Whilst there is a natural decrease in insulin sensitivity 57

throughout gestation, obese women are less insulin sensitive than lean and overweight 58

women prior to conception and remain this way throughout pregnancy (7, 8). As a result they 59

are at an increased risk of developing gestational diabetes. Worldwide, 3-10% of pregnancies 60

are complicated by abnormal glycemic control, caused mostly by gestational diabetes (39). 61

Uncontrolled diabetes in pregnancy results in exposure of the developing fetus to increased 62

plasma glucose concentrations, as a result of increased placental transfer, as well as increased 63

secretion of insulin through fetal pancreatic activity in response to the increased fetal plasma 64

glucose concentrations. Furthermore, exposure to maternal diabetes can alter fetal glucose 65

transport due to changes in the expression of the solute carrier family 2 (facilitated glucose 66

transporter) (SLC2A), which is expressed in the lung (49). In addition, insulin plays an 67

important role in lung development (28) and its effects are mediated by IGF signalling, 68

including insulin-like growth factor (IGF)-1, IGF-2 and IGF-1 receptor (IGF-1R). These 69

growth factors have been associated with altered lung development (17) and respiratory 70

complications, such as respiratory distress syndrome (RDS) following birth in neonates (10). 71

Infants of diabetic mothers were at a 6-fold increased risk of developing RDS when 72

compared to infants of non-diabetic mothers (47). RDS is associated with both structural and 73

biochemical immaturity of the neonatal lung; of particular importance is the delay in the 74

maturation of the surfactant system (2). The presence of pulmonary surfactant, a complex 75

mixture of lipids and proteins, at the air-liquid interface of the lung is required to prevent 76

4

alveolar collapse throughout the breathing cycle and aids in the transition to air breathing at 77

birth (12). The surfactant complex is synthesised, stored and secreted from type II alveolar 78

epithelial cells (AECs) which line the alveoli (34). Maturation of the surfactant system occurs 79

in late gestation, in parallel with the prepartum cortisol surge, and plays a vital role in 80

preparing the fetus for the transition to extrauterine life (55). The lipid component of 81

surfactant is primarily responsible for reducing surface tension, however, surfactant proteins 82

(SFTP) -B and -C aid in their adsorption to the air-liquid interface and in the dynamic 83

regulation of the functional surfactant film (43). SFTP-A and -D play important roles in 84

innate immunity within the lung (24). 85

Maternal diabetes has also been associated with a reduction in SFTP-A protein (51) 86

and lipid profiles (35) in amniotic fluid, suggesting a delay in fetal lung maturation. In vitro 87

and in vivo studies using rodents have shown that increased glucose and/or insulin 88

concentrations result in a reduction of both the protein and lipid components of pulmonary 89

surfactant (19, 20, 22, 23, 45). The molecular mechanism regulating this delayed maturation 90

of the surfactant system has not been investigated. It was proposed that insulin may act 91

indirectly by antagonising the stimulatory effects of cortisol (14), the endogenous 92

glucocorticoid (GC), in the lung which normally plays a major role in stimulating lung and 93

surfactant maturation. The bioavailability of cortisol in the lung may be affected, for example 94

through alterations in the regulatory enzyme isoforms, hydroxysteroid (11-beta) 95

dehydrogenase (HSD11B)-1, which catalyses the conversion of inactive cortisone to cortisol, 96

or HSD11B-2, which catalyses the conversion of bioactive cortisol to cortisone (56). 97

Alternatively, GC signalling may be affected by alterations in the levels of the GC receptor 98

(nuclear receptor subfamily 3, group C, member 1; NR3C1) and the mineralocorticoid 99

receptor (nuclear receptor subfamily 3, group C, member 2; NR3C2), the intracellular 100

mediators of GC activity (37). 101

5

With the exception of one model examining factors including glycogen regulation, 102

surfactant lipid content (65), β-cell receptor binding (62) and surface active material flux in 103

tracheal fluid (60, 63) in the lung of the fetal sheep following exposure to hyperglycemia and 104

hyperinsulinemia, analogous to the conditions experienced by a fetus in an uncontrolled 105

diabetic pregnancy, no studies have evaluated the effect on regulation of SFTP expression in 106

a large animal model with a developmental lung pattern similar to that of humans. 107

Furthermore, no molecular mechanism has been identified to explain the historical link 108

between uncontrolled diabetes in pregnancy and RDS in infants of diabetic mothers. Here, we 109

investigate the impact of intrafetal glucose infusion on pathways that may regulate maturation 110

of the surfactant system in the lung of the late gestation sheep fetus. 111

112

GLOSSARY 113

AEC, alveolar epithelial cell; GC, glucocorticoid; GRE, glucocorticoid response element; Hb, 114

Haemoglobin; HSD11B, hydroxysteroid (11-beta) dehydrogenase; IGF, insulin like growth 115

factor; NR2C1, glucocorticoid receptor; PaCO2, arterial partial pressure of carbon dioxide; 116

PaO2, arterial partial pressure of carbon dioxide; qRT-PCR, quantitative reverse transcription 117

polymerase chain reaction; RDS, respiratory distress syndrome; SaO2, oxygen saturation; 118

SFTP, surfactant protein; SLC2A, solute carrier family 2 (facilitated glucose transporter). 119

120

METHODS 121

All procedures were approved by the University of Adelaide Animal Ethics Committee. 122

123

Animals and Surgery 124

Twenty-one pregnant Merino ewes were housed in individual pens in animal holding rooms, 125

with a 12:12h light/dark cycle, and fed once daily with water ad libitum. At 118-120d 126

6

gestation, general anaesthesia was induced in the ewe with an intravenous injection of sodium 127

thiopentone (1.25g, Pentothal, Rhone Merieux, Pinkenba, Qld, Australia) and maintained 128

with 2.5-4% halothane inhalation anaesthetic (Fluothane, ICI, Melbourne, Vic, Australia) in 129

oxygen. Vascular catheters were implanted in the ewe’s jugular vein, a carotid artery and 130

jugular vein of the fetus, and in the amniotic cavity as previously described (38). Ewes 131

received an intramuscular injection of antibiotics (3.5ml of Norocillin (150mg/ml procaine 132

penicillin and 112.5mg/ml benzathine penicillin; Norbrook Laboratories Ltd., Gisborne, 133

Australia) and 2ml of 125mg/ml Dihydrostreptomycin in sterile saline (Sigma, St Louis, MO, 134

USA) for 3d following surgery. Antibiotics (500mg; sodium ampicillin, Commonwealth 135

Serum Laboratories) were administered intraamniotically to all fetal sheep daily for 4d post-136

operatively. Ewes were allowed at least 4d to recover from surgery prior to the experimental 137

protocol. 138

139

Arterial Blood Gas Measurements 140

Fetal arterial blood was collected throughout the infusion period and at each time point whole 141

blood arterial partial pressure of oxygen (PaO2), arterial partial pressure of carbon dioxide 142

(PaCO2), pH, oxygen saturation (SaO2), and Hb content were measured using an ABL 520 143

analyser (Radiometer, Copenhagen, Denmark) with the temperature corrected to 39°C. 144

145

Intrafetal Infusion Regime 146

Glucose-infused fetuses received an intravenous infusion of 50% dextrose in saline from 130-147

140d gestation (n=9). Infusion began at an initial rate of 1.9ml/h for 24h and was then 148

increased in a stepwise manner by 1.9ml/h per day for the next three days. The final infusion 149

rate of 7.5ml/h obtained on the fourth day of the infusion was maintained until post mortem. 150

Saline-infused fetuses received saline intravenously from 130-140±1d gestation (n=12). The 151

7

timing of this infusion regime coincides with the time during which the surfactant system is 152

undergoing maturation. The glucose infusion protocol resulted in a significant increase in 153

both fetal plasma glucose and insulin concentrations (38), with mean values throughout the 154

10d infusion period for plasma glucose (saline-infused, 1.10±0.09mmol/l; glucose infused, 155

2.20±0.18mmol/l; P<0.05) and insulin (saline-infused, 4.93±1.03mmol/l; glucose infused, 156

9.77±1.38mmol/l; P<0.05). 157

158

Post Mortem Procedures 159

At 140±1d gestation, ewes were humanely killed with an overdose of sodium pentobarbitone 160

administered via the jugular vein (Virbac Pty Ltd, Peakhurst, NSW, Australia) and fetal sheep 161

were delivered by hysterectomy. The lungs were removed, weighed and snap frozen in liquid 162

nitrogen and stored at -80°C for molecular analysis. A section of lung tissue was fixed in 4% 163

paraformaldehyde for immunohistochemical analysis. Fetal weight and neuroendocrine 164

function data have been published previously (38). 165

166

Quantification of mRNA Transcripts within the Fetal Lung 167

Total RNA extraction: Total RNA was extracted from fetal lung samples (~50mg) using 168

Invitrogen Trizol Reagent Solution and Qiagen RNeasy purification columns as per the 169

manufacturer’s guidelines (Invitrogen) (18, 34). Total RNA integrity from all extracted tissue 170

samples was assessed by running samples on an agarose gel stained with ethidium bromide. 171

Total RNA was quantified by spectrophotometric measurements at 260 and 280nm and 172

checked for protein and DNA contamination. cDNA was synthesised using Superscript III 173

First Strand Synthesis System (Invitrogen) using 2µg of total RNA in a final volume of 20µl 174

as per the manufacturer’s guidelines. Controls containing either no RNA transcript or no 175

8

Superscript III were used to test for reagent contamination and genomic DNA contamination, 176

respectively. 177

178

Quantitative real-time RT-PCR: 179

Initially, the geNorm component of qbaseplus 2.0 software (Biogazelle, Zwijnaarde, 180

Belgium) was used to determine the most stable reference genes from a panel of candidate 181

genes (57) and the minimum number of reference genes required to calculate a stable 182

normalization factor as previously described (34, 52). For qRT-PCR data output 183

normalisation, three stable housekeeping genes (β-actin (ACTB; U39357), peptidylprolyl 184

isomerase A (PPIA; AY251270) (42) and tyrosine 3-monooxygenase (YWHAZ; AY970970) 185

(34)) were run in parallel with target genes as previously described (34, 52). Previously 186

published or specifically designed (Table 1) primer sets were validated and optimised as 187

previously described (41). The gene expression of the glucose transporters (SLC2A1 188

(U89029) and SLC2A4 (AB005283.1)), IGF signalling (IGF1 (DQ152962), IGF2 (M89789) 189

and IGF1R (AY162434) (18)), GC regulatory genes (HSD11B-1, NM_001009395.1; 190

HSD11B-2, NM_001009460.1; NR3C1, NM_001114186.1; NR3C1, AF349768.1 (34)), 191

surfactant proteins (SFTP-A, AF211856; SFTP-B, AF07544; SFTP-C, AF076634 and SFTP-192

D, AJ133002 (34, 41)) were measured by qRT-PCR using Fast SYBR® Green Master Mix 193

(Applied Biosystems) in a final volume of 6µl on a ViiA7 Fast Real-time PCR system 194

(Applied Biosystems) as previously described (34). Each qRT-PCR well contained 3 µl Fast 195

SYBR Green Master Mix (2X), 2µl of forward and reverse primer mixed with H2O to obtain 196

final primer concentrations (Table 1) and 1µl of diluted relevant cDNA. The abundance of 197

each transcript relative to the abundance of stable housekeeping genes (27) was calculated 198

using DataAssist 3.0 analysis software (Applied Biosystems) and expressed as mRNA mean 199

normalised expression (MNE)±SEM (34, 52). 200

9

201

Quantification of type II AECs within the fetal lung 202

SP-B immunoreactivity to identify mature type II AECs: In a subset of animals 203

(saline-infused, n=5; glucose-infused, n=6), immunohistochemistry was performed (34) using 204

a monoclonal antibody to SFTP-B (produced by Dr Y. Suzuki, Kyoto University, Japan and 205

kindly donated by F. Possmayer, University of Western Ontario, Canada), staining of which 206

is restricted to type II AECs in the alveolar epithelium and Clara cells in the bronchiolar 207

epithelium (32). Paraformaldehyde fixed, paraffin processed lung tissue sections of 7μm 208

thickness were deparaffinised and rehydrated before endogenous peroxide solution activity 209

was blocked, and followed with antigen retrieval. Slides were incubated overnight with the 210

aforementioned SFTP-B antibody (1:1000) at 4°C. Negative control slides were performed in 211

parallel with test slides. A Histostain-Plus broad spectrum kit (Zymed Laboratories Inc., 212

California, USA) was utilised with horseradish peroxidase and 3,3-diaminobenzidine 213

chromagen (Metal Enhanced DAB Substrate Kit, Pierce Biotechnology, Illinois, USA) for 214

visualisation of SFTP-B positive cells. All sections were counterstained with Mayer’s 215

Haematoxylin. 216

217

Quantitative assessment of type II AEC in the fetal lung: Sections were examined 218

using Visiopharm NewCAST software (Visiopharm, Hoersholm, Denmark) as previously 219

described (34). Analysis was carried out by a single trained individual who was blinded to 220

treatment groups. Sixty counting frames (×400 magnification) of the alveolar epithelium 221

were randomly selected per section. Point-counting using an unbiased counting frame with an 222

area of 20,000µm2 was used to estimate the numerical density of SFTP-B positive cells 223

within the fetal lung. Using the four corners of the test frame, the reference space was 224

estimated from the points falling on lung tissue. The numerical density of SFTP-B positive 225

10

cells expressed as SFTP-B positive cells per mm2 of lung tissue was obtained using the 226

following equation (5, 34): 227

- positive cells

[

] , 228

where ∑Q¯ (SFTP-B Positive) represents the total number of SFTP-B positive cells counted 229

in all counting frames of one fetal lung tissue section; ∑P (lung) represents the total number 230

of points falling on lung tissue (i.e. the reference space); P is the number of points which 231

were used to count the points hitting the reference space (i.e. 4 corners per counting frame); 232

and a was the area of the counting frame. Tissue sections were photographed using a digital 233

camera DP72 (Olympus Australia Pty. Ltd), which was connected to a BX53 Research 234

Microscope (Olympus Australia Pty. Ltd). 235

236

Statistical Analyses 237

PaO2, PaCO2, pH, SaO2, and Hb were calculated as the mean of the values collected on the 238

day before post mortem. Fetal weight, crown-rump length, lung weight and relative lung 239

weight were recorded at post mortem. All statistical analyses were carried out using 240

tatistical Package for ocial ciences ( P ) v20.0 (Chicago, U A). A tudent’s unpaired 241

t-test was used to compare all data between the saline- and glucose-infused fetuses. All data 242

are presented as mean standard error of the mean (SEM). A probability level of 5% 243

(P<0.05) was considered significant. 244

245

RESULTS 246

247

Impact of intrafetal glucose infusion on fetal blood gases and body and organ weight: 248

Mean PaO2, PaCO2, pH, Hb and SaO2 were not different between saline- and glucose- infused 249

fetuses on the day before post mortem (Table 2). Glucose infusion did not affect fetal weight, 250

11

crown-rump length, abdominal circumference, lung weight or relative lung weight to body 251

weight ratio when compared to saline-infused controls (Table 3). 252

253

Effect of intrafetal glucose infusion on expression of genes regulating glucose transport 254

and insulin signalling in the fetal lung: Lung mRNA expression of glucose transporters 255

(SLC2A1 and SLC2A4), IGF1, IGF2 were not different between the saline- and glucose-256

infused fetuses. However, IGF1R mRNA expression was reduced in the lung of the glucose-257

infused fetus (Table 4). 258

259

Effect of intrafetal glucose infusion on expression of genes regulating GC availability 260

and signalling in the fetal lung: Lung mRNA expression of HSD11B-1 and NR3C1 were 261

reduced in glucose-infused fetuses (Figure 1A and C). There was no difference in mRNA 262

expression of HSD11B-2 or NR3C2 (Figure 1 B and D) in the fetal lung. 263

264

Effect of glucose infusion on surfactant protein mRNA expression and the numerical 265

density of type II AECs in the fetal lung: Glucose infusion resulted in a reduction of SFTB-266

A, -B, -C and -D mRNA expression in the fetal lung (Figure 2). The numerical density of 267

SFTP-B positive cells in the alveolar epithelium of the fetal lung was not different between 268

saline- and glucose-infused fetuses (Figure 3). 269

270

DISCUSSION 271

Intra-fetal glucose infusion increased plasma glucose and insulin concentrations (38), 272

resulting in a reduction in the expression of genes regulating GC availability and signalling in 273

the lung. These findings represent a potential mechanism regulating the observed reduction of 274

SFTP mRNA expression in the lung of the hyperglycaemic and hyperinsulinemic late 275

gestation sheep fetus. These findings provide evidence for a molecular mechanism regulating 276

12

the delay in surfactant system maturation in infants of uncontrolled diabetic mothers and may 277

explain the increased incidence of RDS (47, 59). 278

Whilst increased plasma glucose and insulin concentrations are experienced by the 279

fetus in a diabetic pregnancy, the specific effects at the cellular level can be determined by 280

the extent of glucose uptake due to modulation of alterations in glucose signalling or indirect 281

action on other pathways normally regulating fetal lung development. In fetal life, SLC2A1 is 282

the primary regulator of cellular glucose uptake across the plasma membrane by carrier-283

mediated facilitated diffusion in a wide variety of tissues, including the lung (49). 284

Furthermore, in response to the secondary hyperinsulinemia induced by fetal glucose infusion 285

it is necessary to consider the role of the insulin-dependent glucose transporter, SLC2A4 286

whose action on glucose uptake has been widely characterised in insulin responsive tissues. 287

These factors are important as they have been implicated in the regulation of glucose 288

signalling in the fetal lung by exposure to high or low concentrations of glucose in vitro (49).. 289

It has been suggested that a limitation in utilisation of the glucose as a substrate for surfactant 290

synthesis or lung liquid clearance may correlate with the historical incidence of RDS in 291

infants of poorly controlled diabetic mothers (49). Despite these findings on SCL2 expression 292

following exposure to increased glucose and/or insulin concentrations, we observed no 293

change in the mRNA expression of either SLC2A1 or SLC2A4 in the lung of the sheep fetus 294

following glucose infusion in this study. These results suggest that it is unlikely that the 295

observed changes in the fetal lung following glucose infusion are regulated directly by 296

glucose availability; rather changes occur by indirect regulation by the action of these factors 297

at the tissue level. 298

In addition to regulation of fetal development by glucose, insulin and IGF-1 are key 299

mediators of normal lung development (46, 53). Within the fetal lung IGF1 and IGF2 both 300

bind to the IGF-1 receptor (IGF1R) to regulate normal lung development and cellular 301

13

proliferation during both fetal and postnatal life (17, 28). It has previously been demonstrated 302

that changes in expression of these growth factors between lung tissue components are 303

associated with respiratory complications including RDS and BPD (10) in addition to lethal 304

respiratory failure following birth (33). Disruption of normal IGF-1R signalling has also been 305

shown to alter vascularisation and result in dramatic changes in fetal lung morphology in vitro (25). 306

Murine models of IGF-1, -2 and -1R null mutations display effects on global growth, organ 307

hypoplasia and neonatal survival demonstrating the key role of these factors in normal 308

growth and postnatal survival (33). More specifically, IGF-1R knockout studies have 309

demonstrated effects on distal lung branching morphogenesis in the mouse lung (17) and 310

targeted deletion of IFG-1 or –2 in mice leads to delayed lung maturation as evidenced by 311

morphological and structural changes to AEC proportions and lung tissue density (36, 44, 48). 312

Despite no change in IGF1 or IGF2 mRNA expression following glucose infusion, there was 313

a decrease in IGF1R mRNA expression in the lung of the glucose-infused fetuses suggesting 314

that there may be alterations to cellular proliferation and airway development in the lung, 315

which may be associated with increased risk of complications at birth in infants of poorly 316

controlled diabetic mothers (17, 33). 317

While the maturational effects of endogenous/exogenous GCs on the fetal lung are 318

widely understood, the impact of glucose and insulin either individually or synergistically 319

and their interaction with GC on SFTP expression, is less well characterised. Insulin has been 320

shown to inhibit the GC stimulated incorporation of choline into the major surfactant 321

phospholipid, phosphatidylcholine, by fetal rat type II AECs in culture (50). Furthermore, the 322

presence of hyperglycemia and secondary hyperinsulinemia was found to inhibit the 323

stimulatory effects of cortisol on surface active material flux into tracheal fluid (61). An 324

antagonistic relationship between GCs and insulin is well established in insulin-sensitive 325

tissues, and includes impairment of insulin-dependent glucose uptake, increased lipolysis and 326

14

enhanced gluconeogenesis (26), altered insulin signalling (16) and inhibition of insulin 327

secretion from the pancreatic β-cells (4, 30). Furthermore, the opposing effects have been 328

characterised in clinical situations such as type 2 diabetes, in which treatment with GCs 329

decreased both insulin sensitivity (40) and NRC31 expression in skeletal muscle (58). 330

Interestingly, high plasma concentrations of insulin alone decrease both SFTP-A and -B 331

mRNA expression (15), whilst this concentration in combination with cortisol increases 332

SFTP-A expression in a dose-dependent manner in human fetal lung explants (14). It has 333

been suggested that a link between hyperinsulinemia and RDS may involve a reduction in 334

glycerol-3-phosphate and dihydroxyacetone phosphate production which impairs surfactant 335

phospholipid synthesis in the lung (54). A further potential mechanism regulating changes in 336

the fetal lung following exposure to hyperglycemia and hyperinsulinemia involves β-receptor 337

binding which plays a vital role in surfactant release and reabsorption of fetal lung liquid. 338

(62, 64). Interestingly, whilst the latter study demonstrated a negative impact of 339

hyperglycemia and hyperinsulinemia , similar to that experienced in this study, on β-receptor 340

binding in the lung, there was a greater effect in males than females (62). This represents a 341

potential mechanism for male disadvantage in respiratory morbidity following exposure to 342

uncontrolled diabetes during pregnancy. Although this presents as an interesting factor, a 343

limitation of the current study is that there was not sufficient statistical power to determine 344

differences due to fetal sex. 345

Despite the above observations in previous studies, a molecular mechanism regulating 346

the maturation of the protein component of the surfactant system under these conditions 347

during fetal life has not been established. Here, we have demonstrated that following 348

exposure to increased glucose and insulin concentrations in utero, there is a reduction in 349

HSDB11-1 mRNA expression in the fetal lung. This result suggests a reduction in the rate of 350

cortisol activation, and thus glucose infusion may result in pre-receptor regulation of GC 351

15

action in the fetal lung in late gestation. In addition to regulation of GC availability, there is a 352

reduction in the mRNA expression of NR3C1 in the lung of the glucose-infused fetus. The 353

NR3C1 is the intracellular mediator of GC function, which has been widely characterised 354

both by direct action on genes with a GC response element (GRE) and indirect mechanisms 355

via the action of transcription factors and cofactors to promote both normal lung and 356

surfactant system maturation (37). These changes in GC availability and signalling provide 357

evidence for a molecular mechanism linking increased glucose and insulin concentrations 358

with delayed lung maturation in utero. 359

Moreover, we have demonstrated that following exposure to increased glucose and 360

insulin concentrations, there is a concomitant reduction of SFTP mRNA in the fetal sheep 361

lung in late gestation. While a rat model has previously been utilised to examine the effects of 362

induced diabetes on Sftp mRNA expression in the fetal lung (22, 23), we have utilised a more 363

clinically relevant model to investigate the effect of increased glucose and insulin 364

concentrations in utero on lung development and pulmonary surfactant maturation. The fetal 365

sheep is an ideal model of human lung development because of its similar phasic pattern of 366

development and relative proportions of gestation when compared to humans (34). Whilst 367

increased glucose concentrations, similar to the ones achieved in this study, have been 368

associated with abnormalities in surfactant phospholipid content, lung stability and glycogen 369

regulation in the fetal sheep lung (65), here, we provide evidence for changes in the protein 370

component of the surfactant system. A reduction in all four SFTPs is likely to impair both the 371

surface tension regulating and the innate immune functions (24, 31) of the surfactant system, 372

potentially impairing the smooth transition to postnatal life and increasing the risk of RDS 373

following birth in infants of diabetic mothers. 374

To determine if the changes in SFTP expression observed at the molecular level in 375

this study were due to changes at the cellular level within the lung, we evaluated the number 376

16

of SFTP-B positive cells in the alveolar epithelium which are able to produce the components 377

of pulmonary surfactant. Whilst it has previously been demonstrated that insulin inhibits type 378

II AEC differentiation in fetal rat lung explants (21), the impact of high glucose and insulin at 379

the cellular level has not been evaluated in vivo. In this study we found no difference in the 380

number of SFTP-B positive cells in the alveolar epithelium between the saline- and glucose-381

infused fetuses. These results suggest that there were no structural changes in cell density 382

within the fetal lung, however, it is likely that the overall reduction in SFTP mRNA 383

expression observed in the glucose-infused fetuses in this study was due to a reduced 384

functional capacity of the surfactant-producing cells that are present in the lung of the 385

glucose-infused fetus during late gestation. 386

Following glucose infusion in the late gestation sheep fetus, we have identified 387

changes in GC signalling as a mechanism regulating the observed delay in maturation of the 388

surfactant system following exposure to increased glucose and insulin concentrations. It is 389

likely that this effect on SFTP mRNA expression is mediated at the molecular level through 390

an alteration to the functional output of cells able to produce surfactant, as there was no 391

change to the number of SFTP-B positive cells present in the alveolar epithelium. 392

The mRNA changes observed in this study are seen in whole lung tissue, thus it is 393

important to consider that changes in expression of some genes cannot be compared as 394

simply as the expression of surfactant protein markers that are primarily restricted to the 395

respiratory epithelium and alveolar type II cells in vivo. Despite this, the changes observed in 396

this study highlight the multifactorial impact that exposure to increased plasma glucose and 397

insulin concentrations has to modulate lung development on a whole, which ultimately leads 398

to changes at the surfactant protein mRNA expression level and correlates with the 399

historically observed increase in RDS in infants of poorly controlled diabetic mothers. 400

401

17

PERSPECTIVES & SIGNIFICANCE 402

It is undisputed that there are more women of reproductive age who are classified as 403

overweight or obese (11, 29), and that factors associated with obese obstetric populations and 404

diabetic pregnancies contribute to an increased risk of maternal and fetal complications, 405

preterm birth and an increased risk of RDS following birth (6, 9). By investigating the effects 406

in vivo of increased glucose and insulin concentrations in the lung of the late gestation sheep 407

fetus, we have demonstrated that conditions analogous to those experienced by a fetus in an 408

uncontrolled diabetic pregnancy result in changes to GC signalling and are associated with 409

downregulation of SFTP mRNA expression, which may complicate the fetuses’ transition to 410

air breathing at birth. These findings provide evidence for a GC-mediated mechanism to 411

support the link between abnormal glycemic control in utero and RDS observed in infants of 412

mothers with uncontrolled diabetes. What is clear is that glucose regulation and homeostatic 413

feedback mechanisms throughout pregnancy are important and that early intervention to 414

maintain tight maternal glycemic control throughout gestation is a key factor that will lead to 415

minimising the effects of excessive glucose and insulin concentrations on the molecular 416

regulation of lung development and the risk of RDS in pregnancies complicated by diabetes. 417

418

ACKNOWLEDGEMENTS 419

We acknowledge the assistance of Esther Marrocco, Beverley Mühlhäusler, Anne Jurisevic 420

and Laura O’Carroll in performing the surgical procedures, providing expert post-surgical 421

care of the ewe and her fetus and performing the glucose infusion. We thank Darran Tosh for 422

assistance with real-time PCR and Stacey Dunn and Kimberley Botting for assistance with 423

immunohistochemistry and cell counting, respectively. 424

425

426

18

GRANTS 427

The animal component of the work was funded by a NHMRC Program Grant (ICM). The molecular 428

component of the work and JLM were funded by a South Australian Cardiovascular Research 429

Network Fellowship (CR10A4988). 430

431

DISCLOSURES 432

The authors have no conflict of interest. 433

434

435

19

REFERENCES 436

1. Athukorala C, Rumbold A, Willson K, and Crowther C. The risk of adverse 437

pregnancy outcomes in women who are overweight or obese. BMC pregnancy and childbirth 438

10: 56, 2010. 439

2. Avery ME, and Mead J. Surface properties in relation to atelectasis and hyaline 440

membrane disease. AMA Journal of Diseases in Children 97: 517-523, 1959. 441

3. Barbour LA, McCurdy CE, Hernandez TL, Kirwan JP, Catalano PM, and 442

Friedman JE. Cellular mechanisms for insulin resistance in normal pregnancy and 443

gestational diabetes. Diabetes Care 30: S112-119, 2007. 444

4. Brindley D. Role of glucocorticoids and fatty acids in the impairment of lipid 445

metabolism observed in the metabolic syndrome. International journal of obesity and related 446

metabolic disorders: journal of the International Association for the Study of Obesity 19: 447

S69, 1995. 448

5. Brüel A, Oxlund H, and Nyengaard JR. The total length of myocytes and 449

capillaries, and total number of myocyte nuclei in the rat heart are time-dependently 450

increased by growth hormone. Growth hormone & IGF research 15: 256-264, 2005. 451

6. Callaway LK, Prins JB, Chang AM, and McIntyre HD. The prevalence and impact 452

of overweight and obesity in an Australian obstetric population. The Medical Journal of 453

Australia 184: 56-59, 2006. 454

7. Catalano P, Tyzbir E, Roman N, Amini S, and Sims E. Longitudinal changes in 455

insulin release and insulin resistance in nonobese pregnant women. American journal of 456

obstetrics and gynecology 165: 1667, 1991. 457

8. Catalano PM, Huston L, Amini SB, and Kalhan SC. Longitudinal changes in 458

glucose metabolism during pregnancy in obese women with normal glucose tolerance and 459

gestational diabetes mellitus. American journal of obstetrics and gynecology 180: 903-916, 460

1999. 461

9. Cedergren MI. Maternal morbid obesity and the risk of adverse pregnancy outcome. 462

Obstetrics & Gynecology 103: 219-224, 2004. 463

10. Chetty A, Andersson S, Lassus P, and Nielsen HC. Insulin‐like growth factor‐1 464

(IGF‐1) and IGF‐1 receptor (IGF‐1R) expression in human lung in RDS and BPD. Pediatric 465

pulmonology 37: 128-136, 2004. 466

11. Chu SY, Kim SY, and Bish CL. Prepregnancy obesity prevalence in the United 467

States, 2004–2005. Maternal and Child Health Journal 13: 614-620, 2009. 468

12. Creuwels L, Van Golde L, and Haagsman H. The pulmonary surfactant system: 469

biochemical and clinical aspects. Lung 175: 1-39, 1997. 470

13. Dahlgren J. Pregnancy and insulin resistance. Metabolic Syndrome and Related 471

Disorders 4: 149-152, 2006. 472

14. Dekowski SA, and Snyder JM. The combined effects of insulin and cortisol on 473

surfactant protein mRNA levels. Pediatric Research 38: 513-521, 1995. 474

15. Dekowski SA, and Snyder JM. Insulin regulation of messenger ribonucleic acid for 475

the surfactant-associated proteins in human fetal lung in vitro. Endocrinology 131: 669-676, 476

1992. 477

16. Dimitriadis G, Leighton B, Parry-Billings M, Sasson S, Young M, Krause U, 478

Bevan S, Piva T, Wegener G, and Newsholme EA. Effects of glucocorticoid excess on the 479

sensitivity of glucose transport and metabolism to insulin in rat skeletal muscle. Biochemical 480

Journal 321: 707, 1997. 481

17. Epaud R, Aubey F, Xu J, Chaker Z, Clemessy M, Dautin A, Ahamed K, Bonora 482

M, Hoyeau N, and Fléjou J-F. Knockout of Insulin-Like Growth Factor-1 Receptor Impairs 483

Distal Lung Morphogenesis. PloS one 7: e48071, 2012. 484

20

18. Gentili S, Morrison JL, and McMillen IC. Intrauterine growth restriction and 485

differential patterns of hepatic growth and expression of IGF1, PCK2, and HSDL1 mRNA in 486

the sheep fetus in late gestation. Biology of reproduction 80: 1121-1127, 2009. 487

19. Gewolb IH. Effect of high glucose on fetal lung maturation at different times in 488

gestation. Experimental Lung Research 22: 201-211, 1996. 489

20. Gewolb IH, and O'brien J. Surfactant secretion by type II pneumocytes is inhibited 490

by high glucose concentrations. Experimental Lung Research 23: 245-255, 1997. 491

21. Gross I, Smith G, Wilson C, Maniscalco W, Ingleson L, Brehier A, and Rooney 492

S. The influence of hormones on the biochemical development of fetal rat lung in organ 493

culture. II. Insulin. Pediatric Research 14: 834-838, 1980. 494

22. Guttentag S, Phelps D, Warshaw J, and Floros J. Delayed hydrophobic surfactant 495

protein (SP-B, SP-C) expression in fetuses of streptozotocin-treated rats. American Journal of 496

Respiratory Cell and Molecular Biology 7: 190-197, 1992. 497

23. Guttentag SH, Phelps DS, Stenzel W, Warshaw JB, and Floros J. Surfactant 498

protein A expression is delayed in fetuses of streptozotocin-treated rats. American Journal of 499

Physiology-Lung Cellular and Molecular Physiology 262: L489-494, 1992. 500

24. Haagsman HP, Hogenkamp A, van Eijk M, and Veldhuizen EJA. Surfactant 501

collectins and innate immunity. Neonatology 93: 288-294, 2008. 502

25. Han RN, Post M, Tanswell AK, and Lye SJ. Insulin-like growth factor-I receptor–503

mediated vasculogenesis/angiogenesis in human lung development. American journal of 504

respiratory cell and molecular biology 28: 159-169, 2003. 505

26. Hasselgren PO. Glucocorticoids and muscle catabolism. Current Opinion in Clinical 506

Nutrition & Metabolic Care 2: 201-205, 1999. 507

27. Hellemans J, Mortier G, De Paepe A, Speleman F, and Vandesompele J. qBase 508

relative quantification framework and software for management and automated analysis of 509

real-time quantitative PCR data. Genome Biology 8: R19.11-R19.14, 2007. 510

28. Humbel RE. Insulin‐like growth factors I and II. European Journal of Biochemistry 511

190: 445-462, 1990. 512

29. LaCoursiere D, Bloebaum L, Duncan JD, and Varner MW. Population-based 513

trends and correlates of maternal overweight and obesity, Utah 1991-2001. American Journal 514

of Obstetrics and Gynecology 192: 832-839, 2005. 515

30. Lambillotte C, Gilon P, and Henquin JC. Direct glucocorticoid inhibition of insulin 516

secretion. An in vitro study of dexamethasone effects in mouse islets. Journal of Clinical 517

Investigation 99: 414, 1997. 518

31. LeVine AM, and Whitsett JA. Pulmonary collectins and innate host defense of the 519

lung. Microbes and Infection 3: 161-166, 2001. 520

32. Lin S, Na CL, Akinbi HT, Apsley KS, Whitsett JA, and Weaver TE. Surfactant 521

protein B (SP-B)-/- mice are rescued by restoration of SP-B expression in alveolar type II 522

cells but not Clara cells. Journal of Biological Chemistry 274: 19168-19174, 1999. 523

33. Liu J-P, Baker J, Perkins AS, Robertson EJ, and Efstratiadis A. Mice carrying 524

null mutations of the genes encoding insulin-like growth factor I (< i> Igf-1</i>) and type 1 525

IGF receptor (< i> Igf1r</i>). Cell 75: 59-72, 1993. 526

34. McGillick EV, Orgeig S, McMillen IC, and Morrison JL. The fetal sheep lung 527

does not respond to cortisol infusion during the late canalicular phase of development. 528

Physiological Reports 1: 2013. 529

35. Moore TR. A comparison of amniotic fluid fetal pulmonary phospholipids in normal 530

and diabetic pregnancy. American journal of obstetrics and gynecology 186: 641-650, 2002. 531

36. Moreno‐Barriuso N, López‐Malpartida AV, de Pablo F, and Pichel JG. 532

Alterations in alveolar epithelium differentiation and vasculogenesis in lungs of LIF/IGF‐I 533

double deficient embryos. Developmental dynamics 235: 2040-2050, 2006. 534

21

37. Morrison JL, Botting KJ, Soo PS, McGillick EV, Hiscock J, Zhang S, McMillen 535

IC, and Orgeig S. Antenatal Steroids and the IUGR Fetus: Are Exposure and Physiological 536

Effects on the Lung and Cardiovascular System the Same as in Normally Grown Fetuses? 537

Journal of Pregnancy 2012: 2012. 538

38. Muhlhausler B, Adam C, Marrocco E, Findlay P, Roberts CT, McFarlane JR, 539

Kauter KG, and McMillen IC. Impact of glucose infusion on the structural and functional 540

characteristics of adipose tissue and on hypothalamic gene expression for appetite regulatory 541

neuropeptides in the sheep fetus during late gestation. The Journal of physiology 565: 185-542

195, 2005. 543

39. Nold JL, and Georgieff MK. Infants of diabetic mothers. Pediatric Clinics of North 544

America 51: 619-637, 2004. 545

40. Olefsky JM, and Kimmerling G. Effects of glucocorticoids on carbohydrate 546

metabolism. The American journal of the medical sciences 271: 202, 1976. 547

41. Orgeig S, Crittenden TA, Marchant C, McMillen IC, and Morrison JL. 548

Intrauterine growth restriction delays surfactant protein maturation in the sheep fetus. 549

American Journal of Physiology-Lung Cellular and Molecular Physiology 298: L575-583, 550

2010. 551

42. Passmore M, Nataatmadja M, and Fraser JF. Selection of reference genes for 552

normalisation of real-time RT-PCR in brain-stem death injury in Ovis aries. BMC Molecular 553

Biology 10: 72-80, 2009. 554

43. Pérez-Gil J. Structure of pulmonary surfactant membranes and films: the role of 555

proteins and lipid-protein interactions. Biochimica et Biophysica Acta 1778: 1676-1695, 556

2008. 557

44. Pichel JG, Fernández-Moreno C, Vicario-Abejón C, Testillano PS, Patterson PH, 558

and de Pablo F. Developmental cooperation of leukemia inhibitory factor and insulin-like 559

growth factor I in mice is tissue-specific and essential for lung maturation involving the 560

transcription factors Sp3 and TTF-1. Mechanisms of development 120: 349-361, 2003. 561

45. Rayani HH, Gewolb IH, and Floros J. Glucose decreases steady state mRNA 562

content of hydrophobic surfactant proteins B and C in fetal rat lung explants. Experimental 563

Lung Research 25: 69-79, 1999. 564

46. Retsch-Bogart GZ, Moats-Staats BM, Howard K, D'Ercole AJ, and Stiles AD. 565

Cellular localization of messenger RNAs for insulin-like growth factors (IGFs), their 566

receptors and binding proteins during fetal rat lung development. American journal of 567

respiratory cell and molecular biology 14: 61-69, 1996. 568

47. Robert M, Neff R, Hubbell J, Taeusch H, and Avery M. Association between 569

maternal diabetes and the respiratory-distress syndrome in the newborn. The New England 570

Journal of Medicine 294: 357-360, 1976. 571

48. Silva D, Venihaki M, Guo W-H, and Lopez MF. Igf2 deficiency results in delayed 572

lung development at the end of gestation. Endocrinology 147: 5584-5591, 2006. 573

49. Simmons R, Flozak A, and Ogata E. Glucose regulates glut 1 function and 574

expression in fetal rat lung and muscle in vitro. Endocrinology 132: 2312-2318, 1993. 575

50. Smith B, Giroud C, Robert M, and Avery M. Insulin antagonism of cortisol action 576

on lechithin synthesis by cultured fetal lung cells. The Journal of pediatrics 87: 953, 1975. 577

51. Snyder JM, Kwun JE, O'brien JA, Rosenfeld CR, and Odom MJ. The 578

concentration of the 35-kDa surfactant apoprotein in amniotic fluid from normal and diabetic 579

pregnancies. Pediatric Research 24: 728-734, 1988. 580

52. Soo PS, Hiscock J, Botting KJ, Roberts CT, Davey AK, and Morrison JL. 581

Maternal undernutrition reduces P-glycoprotein in guinea pig placenta and developing brain 582

in late gestation. Reproductive Toxicology 374-381, 2012. 583

22

53. Stiles AD, and D'Ercole AJ. The insulin-like growth factors and the lung. Am J 584

Respir Cell Mol Biol 3: 93-100, 1990. 585

54. Stubbs W, and Stubbs S. Hyperinsulinism, diabetes mellitus, and respiratory distress 586

of the newborn: A common link? The Lancet 311: 308-309, 1978. 587

55. Tan RC, Ikegami M, Jobe AH, Yao LY, Possmayer F, and Ballard PL. 588

Developmental and glucocorticoid regulation of surfactant protein mRNAs in preterm lambs. 589

American Journal of Physiology-Lung Cellular and Molecular Physiology 277: L1142-1148, 590

1999. 591

56. Tomlinson JW, and Stewart PM. Cortisol metabolism and the role of 11 [beta]-592

hydroxysteroid dehydrogenase. Best Practice & Research Clinical Endocrinology & 593

Metabolism 15: 61-78, 2001. 594

57. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, and 595

Speleman F. Accurate normalization of real-time quantitative RT-PCR data by geometric 596

averaging of multiple internal control genes. Genome Biology 3: research0034.0031-597

0030.0034.0011, 2002. 598

58. Vestergaard H, Bratholm P, and Christensen NJ. Increments in insulin sensitivity 599

during intensive treatment are closely correlated with decrements in glucocorticoid receptor 600

mRNA in skeletal muscle from patients with Type II diabetes. Clinical Science 101: 533-540, 601

2001. 602

59. Vignoles P, Gire C, Mancini J, Bretelle F, Boubli L, Janky E, and Carcopino X. 603

Gestational diabetes: a strong independent risk factor for severe neonatal respiratory failure 604

after 34 weeks. Archives of Gynecology and Obstetrics 284: 1099-1104, 2011. 605

60. Warburton D. Chronic hyperglycemia reduces surface active material flux in 606

tracheal fluid of fetal lambs. Journal of Clinical Investigation 71: 550, 1983. 607

61. Warburton D. Chronic hyperglycemia with secondary hyperinsulinemia inhibits the 608

maturational response of fetal lamb lungs to cortisol. Journal of Clinical Investigation 72: 609

433, 1983. 610

62. Warburton D, Buckley S, Parton L, and Saluna T. Chronic Glucose Infusion 611

Inhibits Development of β-Receptor Binding in Fetal Lamb Lung. Pediatric research 24: 612

171-174, 1988. 613

63. Warburton D, Lew CD, and Platzker AC. Primary hyperinsulinemia reduces 614

surface active material flux in tracheal fluid of fetal lambs. Pediatric research 15: 1422-1424, 615

1981. 616

64. Warburton D, Parton L, Buckley S, Cosico L, and Saluna T. Effects of beta-2 617

agonist on tracheal fluid flow, surfactant and pulmonary mechanics in the fetal lamb. Journal 618

of Pharmacology and Experimental Therapeutics 242: 394-398, 1987. 619

65. Warburton D, Parton L, Buckley S, Cosico L, and Saluna T. Effects of glucose 620

infusion on surfactant and glycogen regulation in fetal lamb lung. Journal of Applied 621

Physiology 63: 1750-1756, 1987. 622

623

624

625

23

Table 1. qRT-PCR primer sequences for designed target genes. 626

627

Accession numbers refer to the published cDNA sequences from which the primer sequences 628

were designed. 629

630

Primer

Name

Sequence

5’ 3’

Primer

Concentration

(μM)

Accession

No.

SLC2A1

U89029.1

Forward

Reverse

ATCGTGGCCATCTTTGGCTTTGTG

CTGGAAGCACATGCCCACAATGAA

0.45

0.45

SLC2A4

AB005283

Forward

Reverse

TGGCACTTCCTTGGAATTCTTGCC

AGCCTGCCATGTGAGAAGTGAGAT

0.45

0.45

24

Table 2. Mean arterial blood gas and pH values on the day before post mortem in saline- and 631

glucose-infused fetuses. 632

Saline-infused (n=12) Glucose-infused (n=9)

PaO2 (mmHg) 21.6 ± 0.5 21.4 ± 1.0

PaCO2 (mmHg) 51.1 ± 1.2 53.5 ± 0.7

pH 7.383 ± 0.008 7.393 ± 0.007

SaO2 (%) 64.9 ± 1.7 62.0 ± 2.6

Hb (ml/dl) 10.4 ± 0.3 11.2 ± 0.7

Data expressed as mean±SEM. Data were analysed by a tudent’s unpaired t-test. P<0.05 633

was considered statistically significant. PaO2, arterial partial pressure of oxygen; PaCO2, 634

arterial partial pressure of carbon dioxide; SaO2, oxygen saturation; Hb, Haemoglobin. 635

636

637

25

Table 3. Effect of intravenous saline and glucose infusion on fetal and lung growth. 638

Saline-infused (n=12) Glucose-infused (n=9)

Gestational age at post-mortem (d) 140 ± 1 140 ± 0*

Fetal weight (kg) 4.81 ± 0.16 5.12 ± 0.13

Crown-rump length (cm) 58.3 ± 1.4 56.9 ± 1.3

Lung weight (g) 157.97 ± 6.7 158.04 ± 8.9

Relative lung weight (g/kg) 33.1 ±1.4 30.8 ± 1.3

Data expressed as mean±SEM. Data were analysed by a tudent’s unpaired t-test. *P<0.05 639

was considered statistically significant. 640

641

642

643

26

Table 4. Effect of intravenous infusion on the mRNA expression of genes regulating glucose 644

uptake and insulin signalling in the fetal lung. 645

Gene Saline-infused Glucose-infused

SLC2A1 0.0155 ± 0.0012 0.0138 ± 0.0008

SLC2A4 0.0015 ± 0.0003 0.0008 ± 0.0001

IGF1 0.0347 ± 0.0041 0.0393 ± 0.0042

IGF2 14.10 ± 0.61 11.91 ± 0.97

IGF1R 0.0837 ± 0.0029 0.0689 ± 0.0037*

Data expressed as mean normalised expression (MNE)±SEM. Data were analysed by a 646

tudent’s unpaired t-test between saline- (n=12) and glucose-infused (n=9) fetuses. 647

*P<0.05 was considered statistically significant. 648

649

650

27

Legends for Figures 651

Figure 1. Intrafetal glucose infusion decreased GC activating enzyme and receptor 652

mRNA expression in the fetal lung. Lung mRNA e pression of 11β hydro ysteroid 653

dehydrogenase isoform -1 (HSD11B-1, A) and glucocorticoid receptor (NR3C1, C) decreased 654

in glucose-infused fetuses. There was no change in expression of HSD11B-2 (B) or 655

mineralocorticoid receptor (NR3C2, D). Data expressed as mean±SEM. *P<0.05 was 656

considered significant. Saline-infused fetuses, open bars (n=12); Glucose-infused fetuses, 657

closed bars (n=9). 658

Figure 2. Intrafetal glucose infusion decreased SFTP mRNA expression in the fetal 659

lung. Normalised mRNA expression of surfactant protein (SFTP)-A (A), SFTP-B (B), SFTP-660

C (C) and SFTP-D (D) decreased in the lung of glucose-infused fetuses. Data expressed as 661

mean±SEM. *P<0.05 was considered significant. Saline-infused fetuses, open bars (n=12); 662

Glucose-infused fetuses, closed bars (n=9). 663

Figure 3. Evaluation of SFTP-B positive alveolar epithelial cells (AEC) in the fetal lung. 664

Micrographs demonstrating SFTP-B immunoreactivity of type II AEC in the saline-infused 665

(A) and glucose-infused (B) fetal lung (200x magnification, scale bar = 50µm). Glucose 666

infusion did not change the numerical density of SFTP-B positive type II AEC per mm2 of 667

lung tissue (C). Data expressed as mean±SEM. P<0.05 was considered significant. Saline-668

infused fetuses, open bars (n=5); Glucose-infused fetuses, closed bars (n=6). 669

670

671

672

673

674

675

676

677

678

679

680