interrupting the template strand of the t7 promoter ...€¦ · t7 rnap engages in a process of...

doi:10.1006/jmbi.2001.4793 available online at http://www.idealibrary.com on J. Mol. Biol. (2001) 310, 509±522

Interrupting the Template Strand of the T7 PromoterFacilitates Translocation of the DNA During Initiation,Reducing Transcript Slippage and the Release ofAbortive Products

Manli Jiang1, Minqing Rong1, Craig Martin2 and William T. McAllister1*

1Morse Institute of MolecularGenetics, Department ofMicrobiology and ImmunologySUNY Health Science Centerat Brooklyn, 450 ClarksonAvenue, BrooklynNY 11203, USA2Department of ChemistryUniversity of MassachusettsAmherst, MA 01003, USA

M.J. and M.R. contributed equallyAbbreviations used: T strand, tem

non-template; FC, elongation compstranded or duplex; pss, partially siRNAP, RNA polymerase.

E-mail address of the [email protected]

0022-2836/01/030509±14 $35.00/0

We have explored the effects of a variety of structural and sequencechanges in the initiation region of the phage T7 promoter on promoterfunction. At promoters in which the template strand (T strand) is intact,initiation is directed a minimal distance of 5 nt downstream from thebinding region. Although the sequence of the DNA surrounding the startsite is not critical for correct initiation, it is important for melting of thepromoter and stabilization of the initiation complex. At promoters inwhich the integrity of T strand is interrupted by nicks or gaps betweenÿ5 and ÿ2 the enzyme continues to initiate predominately at �1. How-ever, under these conditions there is a decrease in the release of abortiveproducts of 8-10 nt, a decrease in the synthesis of poly(G) products(which arise by slippage of the nascent transcript), and a defect in displa-cement of the RNA. We propose that unlinking the binding and initiationregions of the T strand changes the manner in which this strand isretained in the abortive complex, reducing or eliminating the need topack or ``scrunch'' the strand into the complex during initiation and low-ering a thermodynamic barrier to its translocation.

# 2001 Academic Press

Keywords: transcript slippage; nucleic acid ampli®cation; RNA:DNAhybrid; molecular motor; DNA ``scrunching''
*Corresponding author
Introduction

Promoters for phage T7 RNA polymerase(RNAP) consist of two domains; an upstream bind-ing region that extends from: ÿ17 to ÿ5, and aninitiation region from ÿ4 to �6 (where initiationoccurs at �1; see Figure 1). A variety of approacheshave been used to study T7 RNAP:promoter inter-actions including, most recently, crystallographicanalysis of an initiation complex in which the ®rst3 nt of nascent RNA have been synthesized.1 ± 11 Tosummarize these ®ndings, promoter recognitioninvolves interactions between a speci®city loop(amino acid residues 739-770) that projects into theDNA-binding cleft of the RNAP and makes major

to this work.plate strand; NT,

lex; ds, double-ngle-stranded;

ing author:

groove contacts with the DNA in the region fromÿ7 to ÿ11. Additional contacts from ÿ17 to ÿ13involve an AT-rich recognition loop (residues 93-101) that projects into the minor groove. The tran-sition from duplex DNA in the binding region tosingle-stranded DNA in the initiation region occursbetween base-pairs ÿ5 and ÿ4, and is stabilized byinteractions with a b-hairpin that includes Val237.The template strand (T strand) is led down into theactive site by additional contacts with the speci-®city loop and other regions of the RNAP. It hasbeen proposed that positioning of the templatebase at the start site may involve stacking inter-actions between residue Trp422 and the base in thetemplate strand at ÿ1.11 However, these inter-actions are apparently non-speci®c, as base-pairsubstitutions at ÿ1 have little effect on start siteselection.12

The non-template (NT) strand in the initiationregion is not required for promoter activity, andremoval of this strand downstream from ÿ5 doesnot affect start site selection, nor does it greatlyaffect kcat.

13 ± 15 The question arises, then, as to how

# 2001 Academic Press

Figure 1. Structural and functional elements of the T7promoter. The consensus promoter sequence is shown;positions are numbered relative to the start site of tran-scription at �1. The minimal binding region thatextends from ÿ17 to ÿ5 (shaded box) functions in theform of double-stranded DNA. The initiation regiondownstream of ÿ5 may be single-stranded, as removalof the non-template strand in this region (italics)enhances promoter binding while having no effect onstart site selection and only minor effects on the rate ofinitiation. The RNAP will tolerate the insertion of non-nucleosidic linkers in the T strand in the region betweenÿ4 and ÿ1 (curved loop). However, replacement of thebase at ÿ1 with an abasic linker shifts the site ofinitiation to �2, and disruption of the T strand betweenÿ1 and �1 prevents promoter activity.3,6,14,35,36

510 Phage T7 Promoter Topology

the RNAP chooses the start site: does it measurethe distance from the upstream binding site, and/or is there sequence information in the initiationregion of the template strand that directs the poly-merase to the correct position?

In support of the notion that initiation occurs apreferred distance downstream from the bindingregion, Imburgio et al. found that (with the excep-tion of substitutions at the start site itself) substi-tutions of individual base-pairs in the initiationregion had no effect on the choice of start site, andfurther, that when the initiation region was shifted1 bp closer to or further away from the bindingregion initiation still occurred the same distanceaway (i.e. 5 bp downstream from the bindingregion).12 On the other hand, studies of promotersin which non-nucleosidic linkers had been insertedinto the template strand between ÿ4 and ÿ2 ledWeston et al14 to conclude that the linker is loopedout and that sequence-speci®c information at ornear the start site directs the polymerase to initiatethere. In the same studies, it was found that repla-cing the base at ÿ1 with an abasic linker resultedin a shift in initiation to �2, suggesting that stack-ing interactions between the bases at ÿ1 and �1may be important in positioning the start site.14

However, the latter result could result from aloss of stacking interactions between the base atÿ1 and Trp422, as revealed by crystallographicanalysis.10,11

While the studies by Weston et al.14 allowedinsights into start site selection, a number offeatures of these experiments left key questionsunresolved. In particular, the use of abasic chemi-cal linkers as spacers between the upstream bind-ing region and the initiation region precludedinitiation in the spacer region (since there are nobases to direct nucleotide incorporation). Thus, the

question of whether the RNAP would initiate apreferred distance from the binding region in anunrelated sequence context if given an opportunityto do so remained open.

As is the situation with other RNA polymerases,T7 RNAP engages in a process of abortiveinitiation in which short nascent transcripts aresynthesized and released continuously until thepolymerase clears the promoter and forms a stableelongation complex (EC).16,17 The transition to astable EC is complex, and appears to involve mul-tiple stages.18 While the ®rst phase involves thesynthesis and release of transcripts 2-6 nt in length,other stages occur at 8-10 nt and a fully processivecomplex is not observed until after the synthesis of12-14 nt.12,19 During the ®rst phase (up to 6 nt) con-tacts between the RNAP and the upstream bindingregion of the promoter are maintained, while theleading edge of the polymerase moves down-stream.20,21 This is accomplished by packing or``scrunching'' of the template strand into a hydro-phobic pocket, and it has been suggested that it isthe ®lling of this pocket that signals the beginningof the transition to a stable elongation complex.10,11

Later stages (8-10 nt) involve displacement of thenascent RNA from the template strand and itsassociation with a portion of the speci®city loopthat was previously involved in promoterrecognition.22 Subsequently (at 12-14 nt), the tran-script becomes associated with a surface RNA-binding site that is located in the N-terminaldomain of the enzyme.22,23 Continued associationof the product with the latter site is thought to beimportant to the stability and processivity of theelongation complex.24

At a consensus T7 promoter that directsinitiation with �1 GGG . . . T7 RNAP carries out anadditional mode of RNA synthesis that involvesslippage of the nascent transcript on the three Cresidues present in the template strand from �1 to�3, followed by incorporation of an additional Gresidue.16 Repeated cycles of this process result inthe synthesis of poly(G) products ranging fromtwo to 14 nt in length. During the early stages ofinitiation, this process is in competition with thesynthesis of abortive products, and G-ladder pro-duction is observed even under optimal conditionsof transcription16,25 (see Figure 2).

In this work, we examined the effects of a var-iety of changes in the initiation region of the T7promoter on promoter function. When the tem-plate strand is intact, T7 RNAP prefers to initiatewith GTP 5 nt downstream from the bindingregion, regardless of the sequence of the surround-ing DNA. However, if the T strand is interruptedbetween the binding region and the initiationregion, there is greater ¯exibility in the choice ofthe start site. Strikingly, we found that disruptingthe T strand between the binding and initiationregions reduces or eliminates the synthesis ofpoly(G) products and of abortive products 8-10 ntin length, suggesting that these disruptions lower a

Phage T7 Promoter Topology 511

barrier for translocation of the template strandduring initiation.

Results

Effects of changes in promoter topology

To determine the effects of alterations in promo-ter structure, we constructed templates of variouscon®gurations by annealing together synthetic oli-gomers of DNA (Figure 2 and Table 1). The controlpromoter (template 1) consisted of duplex (ds)DNA that extended from ÿ24 to �20. Alterationsin this basic con®guration included templates inwhich the NT strand contained a segment that wasnot complementary to the T strand from ÿ4 to �5(resulting in a mismatched bubble or ``open pro-moter''; template 2); contained an insertion of sixnon-complementary bases between ÿ5 and ÿ4(resulting in an insertion ``loop''; template 3); wasdeleted downstream of ÿ5 (resulting in a partiallysingle-stranded, or pss promoter; template 4); orwas interrupted between ÿ5 and ÿ4 (resulting in a``nicked'' promoter; template 5). Other promotershad changes in the T strand. These included tem-plates in which the T strand was interruptedbetween ÿ5 and ÿ4 (a ``nicked'' promoter; tem-plate 6); or templates in which the bases at ÿ4 andÿ3 (template 7) were deleted (``gapped''templates).

Table 1. Synthetic oligomers

Oligo Sequence (50-30)

MJ-6 TCGAAATTAATACGACTCACTAMJ-7 ACGAGAGGTTGTGGTCTCCCTATMJ-8 GTGAGTCGTATTAATTTCGAMJ-9 ACGAGAGGTTGTGGTCTCCCTATMJ-11 TCGAAATTAATACGACTCACGTCMJ-12 TCGAAATTAATACGACTCACMJ-13 TATAGGGAGACCACAACCTCTCMJ-15 ACGAGAGGTTGTGGTCTCCCTATMJ-16 ACGAGAGGTTGTGGTCTCCCTATMJ-17 ACGAGAGGTTGTGGTCTCCCTAMJ-18 ACGAGAGGTTGTGGTCTCCCTMJ-19 ACGAGAGGTTGTGGTCTCCCMJ-20 TCGAAATTAATACGACTCACGTTMJ-21 TCGAAATTAATACGACTCACTAMJ-22 ACGAGAGGTTGTGGTCTCCCTATMJ-24 ACGAGAGGTTGTGGTCTCCMJ-25 ACGAGAGGTTGTGGTCTCMJ-26 ACGAGAGGTTGTGGTCTMJ-29 ACGAGAGGTTGTGGTCTCCCTATMJ-30 ACGAGAGGTTGTGGTCTCCCTATMJ-31 ACGAGAGGTTGTGGTCTCCCTATMJ-33 ACGAGAGGTTGTGGTCTCCCTATMJ-34 ACGAGAGGTTGTGGTCTCCCTATMJ-37 ACGAGAGGTTGTGGTTCAACTCMJ-38 ACGAGAGGTTGTGGTTCGAACMJ-46 ACGAGAGGTTGTGGTCTCCCTATMJ-50 ACGAGAGGTTGTGGTCTCCCTATMJ-51 ACGAGAGGTTGTGGTCTCCCTATMJ-52 ACGAGAGGTTGTGGTCTCCCTATMJ-71 ACGAGAGGTTGTGGTTCGAACTMJ-102 ACGAGAGGTTGTGGTTCGAACTMJ-103 ACGAGAGGTTGTGGTCTCTCTCT

The products synthesized from these templateswere labeled at their 50 end by incorporation of[g-32P]GTP and resolved by electrophoresis. Thecontrol (ds) promoter gave rise to a characteristicspectrum of abortive products in the range of twoto 14 nt, together with poly(G) products that resultfrom transcript slippage (identi®ed in the margin).A runoff product of the expected size (20 nt) plusan additional band that results from the additionof a non-templated nucleotide to the transcriptwhen the polymerase reaches the end of thetemplate15 were also observed.

Considering ®rst the behavior of templates withmodi®cations in the NT strand, the spectrum ofabortive products and the size of the predominantrunoff product were the same on these templatesas from the control (lanes 1-5), indicating thatinitiation had occurred at the same site. However,a signi®cant increase in the abundance of tran-scripts 11-14 nt in length was observed on themodi®ed templates (from 8 % of total products ontemplate 1 to 22 % on template 2). This increaseappears to be due to enhanced release of productsand not due to trapping of the complex at thisstage of transcription, as the relative abundance ofrunoff products remains the same on both types oftemplate. We also observed a decreased extensionof the runoff transcript to 21 nt and enhancedrelease of a shorter (19 nt) product, suggestingearly dissociation of the transcription complex at

TAGGGAGACCACAACCTCTCGTAGTGAGTCGTATTAATTTCGA

AGCATCTGCCACAACCTCTCGT

GT

ATCGAACGTGAGTCGTATTAATTTCGA

CGATATAGGGAGACCACAACCTCTCGTCAAGTATAGGGAGACCACAACCTCTCGT

ATGGAACGTGAGTCGTATTAATTTCGA

ATCGAACATCTCGAACGTGAGTCGTATTAATTTCGAATCGATCACGTGAGTCGTATTAATTTCGAATCGCTCACGTGAGTCGTATTAATTTCGAACCCCCCCCGTGAGTCGTATTAATTTCGA

GAAC

ATCGAACTCGAACGTGAGTCGTATTAATTTCGAACTGAACGTGAGTCGTATTAATTTCGAATTGAACGTGAGTCGTATTAATTTCGAATAGAACGTGAGTCGTATTAATTTCGA

CGAACTCGAACCGAACCTCTCTCT

Figure 2. Effects of changes in promoter structure on initiation. Templates were constructed by annealing togetherT and NT strand oligomers that extend from ÿ24 to �20, as indicated (see Table I). The templates were transcribedunder standard conditions using [g-32P]GTP as label, and the products were resolved by electrophoresis. Transcriptsare identi®ed by length and/or sequence in the margin (see Figure 5); asterisks indicate the positions of novel abor-tive products made from templates 6-8. Poly(G) products made from template 1 in the presence of GTP as the solesubstrate are shown in lane G and are identi®ed as G3, G4, etc. T7 RNAP is known to add an additional non-tem-plated nucleotide to the transcript when it reaches the end of the template (Milligan et al.,15 and see the text), account-ing for the band above the runoff product (20 nt). Densitometric scans of lanes 2, 3 and 8 are shown at the right.


the ends of the modi®ed templates. In previouswork in which we examined the stability of haltedelongation complexes, we found that changes intemplate topology that affect the resolution of thetranscription bubble and displacement of the nas-cent RNA, such as the use of supercoiled plasmidtemplates or templates with mismatched bubblessuch as those shown here, dramatically reduces thestability of transcription complexes, and that com-plexes halted at �10-14 are particularly sensitive tosuch changes. The enhanced release of transcripts11-14 nt in length on these templates, and thereduced stability of the transcription complexwhen it reaches the end of the template, likelyre¯ect the sensitivity of the RNAP to these changesin template topology during the transition to anEC.

Disruptions in the T strand led to a spectrum ofrunoff products and of abortive products that arelargely the same as on the control template, indi-cating that most initiation events had taken placeat the same start site (lanes 6-8). However, theappearance of some novel short products (markedwith asterisks in the margin of Figure 2) suggeststhat alternate start site selection may also occur on

these templates. Interestingly, we observed a sig-ni®cant decrease in the synthesis of abortive pro-ducts 8-10 nt in length, and a dramatic reductionor elimination in the synthesis of poly(G) productson the interrupted templates (see densitometricscans in (c)). As will be discussed below, thesedifferences are likely due to a change in the man-ner in which the T strand is retained in theinitiation complex, and a decreased barrier to itstranslocation.

Effects of insertions in the template strand

In previous work involving promoters havinginsertions of non-nucleosidic linkers between ÿ4and ÿ2, Weston et al. found that the enzyme canloop out the inserted linker and localize the startsite without regard to the intervening DNA.14

However, the use of abasic linkers in that studyprecluded initiation within the insert (as therewere no bases to direct nucleotide incorporation).We were therefore curious to determine howinserting an authentic DNA spacer would affectstart site selection.


To examine this, and to explore the effects ofchanging the topology of the promoter on otheraspects of promoter function, we synthesized a Tstrand having a 6 nt insertion (30 CAAGCT 50)between ÿ5 and ÿ4, and annealed this T strand tofour different types of NT strands (Figure 3). In the®rst series, the NT strand was complementary tothe T strand except for the interval that containedthe insertion (series A). In other constructs, the NTstrand was not complementary to the T strand inthe interval from ÿ5 to �5 (series B), or containeda non-complementary insertion (series C). Lastly,we made a template in which the 6 nt insert in theT strand was complementary to a 6 nt insert in theNT strand (series D).

In all cases, we observed that initiation wasdirected to the ®fth base in the inserted sequenceand not to the consensus initiation region furtherdownstream (Figure 3, lanes 4-7). This is evidentfrom the synthesis of a longer runoff transcript (26nt versus 20 nt), and from a change in the patternof short abortive transcripts from a pattern that ischaracteristic of initiation at �1 in the consensuspromoter to a new set of products. Signi®cantly,the base at the initiation site in the insert occupiesthe same position relative to the upstream bindingregion as the base at �1 in the consensus promoter(i.e., 5 nt downstream from the binding region).Furthermore, it is a C (which directs initiation withGTP). These ®ndings are consistent with our pre-vious observations that the enzyme prefers toinitiate 5 nt downstream from the binding region,with GTP.12,26

While the sequence around the start site doesnot appear to be critical for selecting the positionat which transcription is initiated, it does appear tobe important for melting the promoter and/ormaintaining the stability of the initiation complex.In previous studies it was shown that promotermelting affords little kinetic barrier to initiationunder optimal transcription conditions.13,25 Thus,the ef®ciency of initiation at a consensus promoteris nearly the same whether the initiation region isduplexed, mismatched, or single-stranded (seeFigure 2, lanes 2-6). In contrast, the ef®ciency ofinitiation within the heterologous insert is reducedsigni®cantly (by 64 %) when the insert is duplexedwith a complementary insert in the NT strand ver-sus when it is unpaired (cf. Figure 3, lane 7 withlane 6).

To explore further the tolerance of the RNAP forchanges in the initiation region, and in particularchanges in the base in the T strand at position 5,we altered the sequence of the insert in a variety ofways. First, we changed the C at the ®fth positionto T, G, or A (requiring initiation with ATP, CTP,or UTP; lanes 13-16). While little initiation wasobserved in these cases, substitution of T at the®fth position in combination with substitution of Cat the next position (which would allow transcrip-tion to initiate with �1 AG . . . ) resulted in moder-ate (26 %) activity (lane17 versus lane 13). Theseobservations are reminiscent of the behavior of T7

RNAP at promoter variants having similar substi-tutions at �112 and are consistent with the knownpreference of the enzyme to incorporate G residuesduring the early stages of initiation.

In light of the above, we explored whether,given a choice of C residues elsewhere in theinsert, the polymerase would maintain the samestart site. In the template shown in lane 11, C resi-dues were positioned at the ®rst, third, ®fth, andseventh position in the insert, while in the templateshown in lane 10, C residues were at every pos-ition. In both cases initiation was observed to occurpredominantly at the ®fth position. The behaviorof the RNAP on other templates having largerinserts or inserts with different sequences was con-sistent with the conclusion that the polymeraseprefers to initiate with GTP 5 nt downstream fromthe binding region (lanes 11-12).

The effects of nicks and gaps in thetemplate strand

In earlier studies, Weston et al. found that nick-ing of the template strand between ÿ1 and �1abolished promoter activity.14 While this obser-vation suggested that the integrity of the templatestrand between the upstream binding region andthe start site might be required for promoter func-tion, the effect of a nick at this position could alsore¯ect a critical role for the base at ÿ1 in position-ing the base at �1 in the active site.11,14

To explore this, we examined the effects of nicksor gaps in the T strand when these interruptionswere positioned elsewhere in the promoter; speci®-cally, at the boundary between the duplex bindingregion and the melted initiation region (i.e.between the bases at ÿ5 and ÿ4 in the consensuspromoter; Figure 4). The template strands in thesepromoters were either intact, nicked (having aninterruption in the phosphodiester backbone butwith no missing bases), or gapped (in which casebases were deleted). In the gapped templates, theupstream boundary of the discontinuity was main-tained at position ÿ5, while the downstream endof the T strand was progressively removed fromÿ4 to �4. As before, annealing the T strand oligo-mers to different NT strands allowed the construc-tion of promoters with multiple topologicalcon®gurations.

Interruptions in the T strand led to a number ofquantitative and qualitative changes in the tran-scription pattern. First, as noted in Figure 2, weobserved a signi®cant reduction in the synthesis ofabortive transcripts 8-10 nt in length as well asnearly complete disappearance of poly(G) products(which arise by transcript slippage) at the nickedpromoter (lane 2). Disruptions in the T strand alsoled to a general decrease in the production of run-off products.

With regard to start site selection, nicking of theT strand between ÿ5 and ÿ4 did not greatly affectthe choice of the start site, nor did removal ofnucleotides between ÿ4 and ÿ2 (as demonstrated

Figure 3. Effects of insertions in the template strand. Promoter templates were constructed by annealing together Tand NT strand oligomers as in Figure 2. T strand oligomers contained insertions as noted in the chart (the sequenceis given from 30 to 50). NT strand oligomers were: template A, MJ6; template B, MJ11; template C, MJ21; template D,MJ20 (see Table I). RNA products were labeled by incorporation of [a-32P]GTP and resolved by gel electrophoresis.The position of the start site was deduced from the size of the runoff product and the use of limiting mixtures of sub-strate to identify the short transcription products (see Figure 5; data not shown). The base in the T strand at the startsite is indicated in bold; the position of the start site within the insert and the initiating nucleotide are given in thelast column.


by the size of the predominant runoff product aswell as the pattern of short abortive initiation pro-ducts; lanes 2-4). However, deletion of the base atÿ2 resulted in enhanced initiation at �2, as evi-denced by increased production of a 19 nt runoffproduct and the appearance of novel bands amongthe abortive initiation products (lane 5). The shiftin the initiation site in the downstream directionwas even more prominent when the base at ÿ1was removed, in which case strong starts at �2and �3 were detected (lane 6). When the base at�1 was removed, initiation was strongly inhibitedand weak starts at �2 and �3 were observed (lane7). More ef®cient initiation was observed when thebases at �2 and �3 were removed, but nowinitiation shifted further downstream to �5 (thenext occurrence of C in the T strand) giving rise toa runoff transcript of 16 nt (lanes 8 and 9).

Similar results were obtained on templates inwhich the initiation region was unpaired betweenÿ4 and �5 (mismatched bubble or ``open'' promo-ter, series B). However, the open promoter

appeared to be more permissive for initiation atdownstream positions when the bases at �1 or �2were deleted than was the duplex promoter (com-pare lanes 6 and 7 with lanes 15 and 16). This per-missivity may result from the absence of the needto melt the DNA in the open promoter templates.25

Lastly, we explored the effects of inserting 6 ntof unpaired DNA into the NT strand between ÿ5and ÿ4 (series C). The results were similar to thoseobserved with duplex promoters (series A).

These experiments demonstrate that the integrityof the template strand between the upstream bind-ing region and the start site is not required forinitiation by T7 RNAP. The enzyme is able toinsert the 30 end of the interrupted T strand intothe active site and to localize the start site whetherthe end is paired with the NT strand (series A),unpaired with the NT strand (series B), or separ-ated by up to 6 nt of inserted DNA in the NTstrand (series C). On promoters in which the baseat ÿ1 or �1 is removed, initiation occurs not at the®rst C in the T strand (which would now be at the

Figure 4. Effects of nicks and gaps in the template strand. Promoter templates were constructed by annealingtogether T and NT strand oligomers as indicated. Three types of NT strand were utilized. The NT strand in series A(MJ6) is complementary to the T strand throughout. The NT strand in series B (MJ11) is not complementary to the Tstrand in the interval between ÿ5 and �6. The NT strand in series C (MJ21) contains an insertion of 6 nt between ÿ5and ÿ4. The T strand was either intact, nicked between ÿ5 and ÿ4, or gapped, as noted in the chart. In the gappedtemplates, the upstream boundary of the discontinuity was maintained at position ÿ5 while the downstream end ofthe T strand was deleted progressively from ÿ4 to �4. Transcription products from each template were resolved byelectrophoresis (right panel); the position of the start site was determined as in Figure 3, and is presented in thechart.


30 terminus of the T strand) but at the second. Thiswould be consistent with a need for a base justupstream of the start site in order to make appro-priate stacking interactions.11,14

Nicks and gaps in the template strandsuppress the synthesis of poly(G) products

During the early stages of transcription,elongation of the RNA product by translocation ofthe active site along the template is in competitionwith slippage of the RNA, and poly(G) products(which arise by transcript slippage) are observedeven under optimal conditions16 (see Figure 5).However, as the concentration of substraterequired for elongation by translocation is lowered,poly(G) synthesis comes to predominate.27 Asnoted above, synthesis of poly(G) products >3 nt isgreatly reduced on templates having nicks or gapsin the T strand. This de®cit is not due to an

inability of these templates to support poly(G) syn-thesis, for as observed in Figure 5(b), lanes 8-12,synthesis of poly(G) products up to 9 nt is nearlythe same on these templates as on the control tem-plates when GTP is provided as the only substrate.It thus appears that the decrease in poly(G) syn-thesis re¯ects a change in competition betweentranscript slippage and elongation.

To explore this, we examined the synthesis ofpoly(G) and abortive products at intact and nickedpromoters as a function of decreasing concen-trations of substrate (Figure 5(c)). When GTP isheld at 0.4 mM and the concentrations of the otherNTPs are progressively reduced, synthesis ofpoly(G) becomes increasingly prominent at thecontrol promoter (template A). In contrast, littlesynthesis of poly(G) is observed at the interruptedpromoter, even at the lowest concentrations ofATP, GTP and UTP (12.5 mM).


Disruptions in the T strand lead to defects inRNA displacement and/or release

Even though the rate of initiation at nicked orgapped promoters appears to be as high or higherthan at intact promoters (Figure 5(b), lanes 8-12),and fewer abortive products are released (Figures 2and 5(b)) the yield of runoff products is reducedon the these templates (Figures 2 and 5(b)). A poss-ible explanation for this apparent discrepancy isthat interrupting the template strand leads todefects in displacement of the RNA product, result-ing in the eventual conversion of the template intoan inactive form. Consistent with this, we observedthat whereas synthesis of runoff products from thecontrol template proceeded in a linear mannerduring a 40 minute reaction, the rate of synthesisfrom an interrupted template decreased rapidlyafter ®ve minutes (Figure 6(b)). Furthermore, theaddition of more downstream T strand oligomerafter 20 minutes stimulated transcription in reac-

Figure 5. Nicks and gaps in the template strand suppressTemplates were constructed by annealing T and NT strandtranscribed in the presence of the labeled substrates indicatedtrophoresis. The products were identi®ed as noted in the m[a-32P]GTP (aG) (lanes 1-3). (c). Templates A and E weredecreasing concentrations of ATP, CTP, and UTP (A,C,U); pATP, CTP and UTP is lowered, synthesis of poly(G) produnot on template E (lanes 9-13). An extra band migrating beonly at the lowest concentrations of ATP, CTP and UTP on bfrom misincorporation of GTP into the transcript at �4 or �5

tions that contained the nicked promoter, but didnot stimulate transcription in the control reaction(data not shown).

To explore this further, we examined the fate ofthe template strand directly by means of a gel shiftexperiment (Figure 6(c)). Promoter constructs hav-ing intact or interrupted T strands that had beenlabeled with polynucleotide kinase were tran-scribed for 20 minutes in the presence of unlabeledsubstrate, and the disposition of the templatestrand was then examined by non-denaturing gelelectrophoresis. Whereas the control promoterremained intact (with no shift in the migration ofthe labeled T strand during transcription), the Tstrand in the interrupted promoter was nearlyquantitatively displaced from the starting structureto a position that would be consistent with the for-mation of an extended RNA:DNA hybrid. We con-clude that displacement of the RNA product isdefective at the interrupted promoter, resulting insequestration of the T strand into an RNA:DNA

synthesis of poly(G) and abortive initiation products. (a)oligomers as described in Figure 2. (b) Templates were(0.4 mM each) and the products were resolved by elec-argin by labeling with [a-32P]ATP (aA), [g-32P]GTP or

transcribed in the presence of 0.4 mM [g-32P]GTP androducts are identi®ed as in (b). As the concentration of

cts comes to predominate on template A (lanes 1-6) buttween the 6 nt product (GGGAGA) and G6 is observedoth templates (asterisk); it is likely that this band results.


hybrid that is unable to support subsequent roundsof transcription.

We have not quanti®ed the transcription reac-tions and so cannot determine from this exper-iment how frequently displacement (and thusinactivation) of the template strand is occurring.However, given the rapid rate of initiation and theshort length of the transcript, the observation thatsynthesis of runoff products does not cease com-pletely even after ®ve minutes suggests that mul-tiple rounds of transcription occur before all of thetemplates are inactivated.

Initiation at branched promoters

The experiments shown in Figure 4 demonstratethat the integrity of the T strand is not required forinitiation at a T7 promoter, and that the RNAP caninsert the 30 end of the disrupted strand andinitiate transcription at the correct start site (or atthe ®rst suitable C residue if the consensus startsite has been deleted). However, these experimentswere carried out in the context of a consensusinitiation sequence, and it is appropriate to askwhether the results would have been the same ifthe sequence at the 30 end of the T strand was

(a)

(b)

Figure 6. Disruptions in the T strand lead to defects inannealing the T and NT strand oligomers indicated. For thewere labeled with 32P prior to annealing (asterisks). (b) Tethese conditions the promoter to RNAP ratio is 1.25. The prduction of runoff transcripts versus time was determinedassembled by annealing together the oligomers indicated anpresence of unlabeled substrates. Samples were analyzed bythe presence of 0.1 % (w/v) SDS. The positions of the labelestrand or to the RNA product are indicated in the margins.

different, or if the consensus initiation region wasnot present at all. To address this, we constructedbranched promoters in which a 6 nt tail wasappended to the 30 end of an interrupted T strand(Figure 7). The sequence of the branch was thesame as the sequence of the 6 nt insertion used inthe experiments described in Figure 3. In one seriesof promoters, the branch was appended to the 30end of the T strand at ÿ4, which leaves theinitiation region unchanged (series A-C). Inanother series, the entire initiation region from ÿ4to �5 was deleted and the branch was appendedto the 30 end of the T strand at �6 (series D-F).

Considering ®rst promoters in which theinitiation region was present (series A-C), weobserved some initiation in the branch in all cases,as evidenced by the synthesis of novel abortiveproducts that were not observed at the control (ds)promoter. However, if we consider only pro-ductive initiation events, which allow promoterescape and completion of a runoff product, thesituation is somewhat different. Productiveinitiation on templates A and B occurred predomi-nantly at the start site in the consensus initiationregion and not in the branch, resulting in pro-duction of a 20 nt runoff product (lanes 2 and 3).

(c)

RNA displacement. (a) Templates were constructed bygel shift experiment shown at the right, MJ7 and MJ17

mplates were transcribed using 40 ng of RNAP; underoducts were resolved by gel electrophoresis and the pro-

by PhosphorImagerTM analysis. (c). Templates wered, where noted, were transcribed for 20 minutes in theelectrophoresis in non-denaturing polyacrylamide gels ind template strand oligomers when hybridized to the NT


Early release of the transcription complex at theend of the template occurred on construct B, as evi-denced by decreased production of the 21 nt pro-duct (which arises by non-templated nucleotideaddition to the 30 end of the transcript) andenhanced production of the 19 nt product (lane 3).Such early release was observed also at promotersin which the consensus start site was not pairedwith a homologous NT strand (cf. Figure 2, lane 2).

In contrast to templates A and B, productiveinitiation on template C occurred predominantly inthe branch (at the ®fth position, with GTP), result-ing in synthesis of a 26 nt runoff product and adifferent spectrum of short abortive products(Figure 7, lane 4). The difference in these templatesis that construct C contains an insertion of 6 nt inthe NT strand (which increases the distance fromthe binding region to the consensus initiationregion when measuring along the NT strand),whereas constructs A and B lack this insert. Theextra spacing in template C may facilitate insertionof the 30 end of the branch or inhibit access of theRNAP to the consensus start site downstream.

We next considered initiation on templates inwhich the consensus initiation region was missingentirely and the branch was appended to the Tstrand at �6 (series D-F). While changes in the con-®guration of the NT strand had some effect on thesynthesis of abortive products, productiveinitiation occurred in all cases at the ®fth positionin the branch, with GTP. These results are signi®-cant because they show that a tethered bindingregion of the T7 promoter can direct the RNAP toinitiate at a heterologous start site.

We also explored the effect of changing thelength of the branch. On templates with branchesof six to 12 nt, productive initiation occurred at the®fth position from the protruding 30 end of thebranch (lanes 2-13). However, on branches longerthan 12 nt initiation occurred 7-8 upstream fromthe 50 boundary of the branch, regardless of thelength of the branch or of the length of the inter-vening tether (e.g. series F, which has a 6 nt insertin the NT strand). These results suggest that whenthe branch is too long to be accommodated in thebinding cleft of the RNAP, the selection of the startsite is affected by the distance to the double-stranded region downstream (which may resemblethe downstream edge of the transcription ``bubble''formed during initiation).

Another interesting observation in these exper-iments is the distinct pattern of short abortive pro-ducts made from templates B and E. Whereas theother templates in this series retain the consensusinitiation sequence in the NT strand, this regionhas been replaced by an unrelated sequence intemplates B and E. The different results obtainedwith the latter templates suggests that under theseparticular conditions the NT strand may play arole in start site selection.

Discussion

In this work, we have explored the effects ofchanges in topology and DNA sequence in theinitiation region of the T7 promoter on promoterfunction. At promoters in which the T strand is notinterrupted (i.e. the upstream binding region andthe downstream initiation region are continuous),there appears to be little sequence information inthe initiation region that is required for start siteselection. Under these conditions, initiation isdirected a minimal distance (5 nt) downstreamfrom the binding region of the promoter, and ifthere is a C residue in the template strand at thatposition, initiation commences at that site withGTP. Substitution of other residues in the T strandat the ®fth position results in greatly diminishedinitiation, and/or a shift to alternate C residuesfurther downstream (but not upstream). Recentwork indicates that the strong preference forinitiation with GTP may involve an interactionbetween residue H784 and the 30 RNA:templatebase-pair.28

While the sequence of the DNA in the initiationregion does not appear to be critical for start siteselection, the sequence of this region appears to beimportant for melting of the promoter and/orstabilization of the initiation complex. Thus, in con-trast to the situation with a consensus promoter,ef®cient transcription from a promoter having aheterologous initiation region is diminished greatlyin the presence of a complementary NT strand.

When the template strand is not intact and theinitiation region is not constrained by its linkage tothe upstream binding region, initiation may occurover a wider range: as close to the 30 end of theinterrupted template strand as the second base(in the context of a consensus promoter) or asfar away as 11 nt on heterologous branchedpromoters. The ®nding that initiation is notobserved at the terminal 30 base of the T strandwould be consistent with the need for a baseimmediately upstream of the start site in order toposition the base at �1 in the active site, either viastacking interactions with the base at ÿ1 or byinteraction of the base at ÿ1 with Trp422 in theRNAP.11,12,14

The observation that initiation occurs predomi-nantly at the ®fth base in promoters havingbranches six to 12 nt in length but shifts furtherdownstream at promoters with longer branches(Figure 7) indicates that the distance from the 30end of the inserted T strand is not the sole determi-nant of start site selection on such templates. Oneinterpretation of these results is that the presenceof duplex DNA downstream of the start site isimportant when the RNAP initiates on a branchedor nicked heterologous template, and that theRNAP prefers to initiate within 8 nt of the down-stream duplex.

During the early stages of transcription,elongation of the RNA product by translocation ofthe active site along the template is in competition

Figure 7. Effects of branches in the template strand. Templates were constructed by annealing together T and NTstrand oligomers as indicated. Three types of NT strand were utilized. The NT strand in templates A and D (MJ6) iscomplementary to the T strand over its entire length. The NT strand in templates B and E (MJ11) is not complemen-tary to the T strand in the interval between ÿ5 and �6. The NT strand in templates C and F (MJ21) contains an inser-tion of 6 nt between ÿ5 and ÿ4. The T strand in the control template (MJ7) contains the intact consensus promotersequence. The upstream portion of the T strand in templates A-F (MJ8) extends from ÿ24 to ÿ 5 and contains the con-sensus binding region; the nature of the downstream portion of the T strand in these templates is given in the chart.Templates were transcribed in the presence of [a-32P]GTP as label and the products were resolved by gel electrophor-esis. The position of the start site within the branch (indicated in large, bold font) was determined from the size ofthe runoff products as described in Figure 2.


with slippage of the RNA and the resulting syn-thesis of poly(G). Nicking or gapping of the Tstrand enhances elongation at the expense of slip-page, presumably by lowering a barrier to move-ment of the template strand (Figure 5). In thebinary crystal of T7 RNAP in association with itspromoter, it is observed that after its separationfrom the NT strand (at ÿ5) the T strand is leddown into the active site by contacts with thespeci®city loop, as well as elements of the ®ngersand palm domains.10 Contacts between the Tstrand and the surface of the RNAP in this intervalare apparently not sequence-speci®c, as initiationoccurs the same distance downstream from thebinding region regardless of the intervening DNA(Imburgio et al.12 and this work). In the structure ofan initiation complex in which the ®rst three basesin the template strand have been transcribed intoRNA, many of these contacts are disrupted and thesegment of the T strand between the upstream

binding region and the start site is displaced fromits original position into a hydrophobic pocket(DNA packing or scrunching).11 We propose thatunlinking the binding and initiation regions of theT strand by nicking or gapping changes the man-ner in which this strand is retained in the abortivecomplex, reducing or eliminating the need to packor scrunch the strand into the complex duringinitiation and lowering a thermodynamic barrier toits translocation (see Figure 8).

Cheetham and Steitz recently suggested that ®ll-ing of the hydrophobic pocket may trigger the iso-merization of the initiation complex to a stableelongation complex.11 The properties of gappedpromoters in which bases have been removed fromthe T strand are of interest in this regard. InFigure 5 we observe that the synthesis of abortiveproducts 2-6 nt in length from a promoter in whichthe two bases at ÿ4 and ÿ3 have been deleted isnearly identical with that from the intact promoter,

Figure 8. Interrupting the template lowers the barrier for translocation but results in a defect in RNA displacement.The model depicts the possible organization of the transcription complex during initiation and elongation at promo-ters in which the T strand is either intact, or is interrupted between the binding and initiation regions. (a) Promoterbinding involves interactions between the speci®city loop and the upstream binding region of the promoter (cross-hatched). Separation of the T and NT strands occurs between the active site and a b-hairpin loop that intercalatesbetween base-pairs ÿ5 and ÿ4.11 (b) During abortive initiation, the upstream binding contacts are maintained, whilethe active site moves along the T strand, drawing in downstream DNA (arrow). At the intact promoter, the portionof the T strand that lies between the upstream end of the growing RNA:DNA hybrid and the intercalation loop isaccommodated by packing or scrunching into a hydrophobic pocket (broken and continuous lines). In the interruptedpromoter, the 30 end of the T strand is unrestrained and may be extruded out of the complex. The unrestrained mobi-lity of the T strand in the interrupted promoter decreases a barrier to its translocation and shifts the equilibrium infavor of elongation versus transcript slippage. (c) When the RNA:DNA hybrid reaches a suitable length (8-9 bps) theinitiation complex isomerizes to a stable elongation complex. In the intact promoter this is accompanied by displace-ment of the nascent RNA from the T strand at the upstream end of the DNA:DNA hybrid, release of the upstreampromoter contacts, and association of the displaced RNA with the speci®city loop.22 It is not known if these eventsoccur at the interrupted promoter (question mark). Reannealing of the T and NT strands of the DNA at the trailingedge of the transcription bubble in the intact promoter ensures continued displacement of the nascent RNA duringelongation. In the interrupted promoter, the RNA is not displaced ef®ciently, resulting in the formation of anextended RNA:DNA hybrid. (d) Failure to displace the RNA ef®ciently from the interrupted promoter results in theeventual trapping of the T strand in an inactive RNA:DNA hybrid.


and that there is no shift of the products to a long-er size, as might be expected in a pocket-®llingmodel (cf. lanes 2 and 7). It therefore seems likelythat the transitions in the transcription cycleobserved up to 6 nt result from the synthesis of anascent RNA of a particular length, or by the for-mation of an RNA:DNA hybrid of a particularlength (neither of which would be altered by the

deletion of bases from the upstream portion of theT strand), rather than by constraints imposed byscrunching of the template or ®lling of the bindingpocket. The transitions that occur between 8 and10 nt, however, are sensitive to nicking or gappingof the template strand, and release of these tran-scripts is reduced greatly on the interrupted tem-plates (Figure 2). The altered behavior of the


interrupted promoters may re¯ect a different exitpathway for the unrestrained T strand (seeFigure 8).

While the studies reported here contribute to ourunderstanding of T7 RNAP initiation, they mayalso have practical signi®cance. The ®nding thatthe binding region of the promoter can directinitiation to an unrelated sequence in a ``branch''junction (Figure 7) suggests that constructs such asthis may have general utility in guiding transcrip-tion to a variety of heterologous templates. Givenprevious observations that T7 RNAP can utilizeRNA templates as well as DNA templates29 these®ndings suggest the possibility of adapting thisapproach to nucleic acid ampli®cation systems thatfunction without thermal cycling.

Materials and Methods

DNA templates and RNA polymerase

DNA oligomers were synthesized by MacromolecularResources (Colorado State University) and puri®ed bylow-pressure, reverse-phase chromatography. To preparesynthetic templates, the indicated combinations of oligo-mers were mixed together (®nal concentration 0.5 mMeach oligomer) in 40 ml of transcription buffer (20 mMTris-HCl (pH 7.9), 15 mM MgCl2, 0.1 mM EDTA, 0.05 %Tween-20)30 and the samples were heated to 70 �C forten minutes and cooled slowly to room temperature(two to three hours). The templates were either usedimmediately or stored at ÿ20 �C. T7 RNAP having a(His)6 amino terminal leader was puri®ed as described.30

Transcription assays

Unless otherwise noted, transcription was carried outin a volume of 10 ml of containing transcription buffer;0.5 mM ATP, CTP, GTP and UTP (Pharmacia Ultrapure);2 mCi of [a-32P]ATP or GTP (speci®c activity of 800 Cimmolÿ1; New England Nuclear) or [a-32P]GTP or ATP(speci®c activity 2000 Ci mmolÿ1); 20 nM RNA polymer-ase and 50 nM synthetic DNA. In reactions involvingtemplates with insertions or branches in the T strand(Figures 3 and 7) spermidine trihydrochloride (Sigma)was present at a concentration of 4 mM, as this wasfound to signi®cantly enhance transcription from thesetemplates (but not from other templates reported here).Reactions were incubated at 37 �C for ten minutes andterminated by the addition of 10 ml of stop buffer (7 Murea, 30 mM EDTA, 0.02 % (w/v) bromphenol blue,0.02 % (w/v) xylene cyanol) followed by heating to 98 �for two minutes. The products were resolved by electro-phoresis in 20 % (w/v) polyacrylamide gels containing7 M urea32 and analyzed by exposure to X-ray ®lm or toa PhosphorImager2 screen (Molecular Dynamics) usinga Storm 860 scanner and ImageQuaNT Version 4.2a soft-ware (Molecular Dynamics).31

RNA displacement assays

The T strand oligomers MJ7 and MJ17 were labeledwith phage T4 polynucleotide kinase32 and annealed toNT strand oligomers at a concentration of 0.125 mM, asdescribed above. Following transcription, the reactionswere terminated by the addition of an equal volume ofloading buffer (12 % (w/v) glycerol, 0.2 % (w/v) SDS, 2�

TBE buffer,32 0.05 % (w/v) bromphenol blue and 0.05 %(w/v) xylene cyanol) and the samples were analyzed byelectrophoresis in 10 % (w/v) polyacrylamide gels undernon-denaturing conditions.33,34 The gels were pre-equili-brated at 80 V for 30 minutes and electrophoresis wascarried out at 80 V for eight hours.

Acknowledgments

Work in the laboratory of W.T.M. was supported bygrant GM38147 from the National Institute of GeneralMedical Sciences and by bioMerieux, SA. Work in thelaboratory of C.M. was supported by grant GM55002from the National Institute of General Medical Sciences.This work will be submitted to the State University ofNew York in partial ful®llment of the requirements forthe doctoral degree of M.L.J. We thank Ray Castagna forassistance in carrying out these experiments, andEdward A. Esposito III and Iaroslav Kuzmine for helpfuldiscussions.

References

1. Muller, D. K., Martin, C. T. & Coleman, J. E. (1989).T7 RNA polymerase interacts with its promoterfrom one side of the DNA helix. Biochemistry, 28,3306-3313.

2. Jorgensen, E. D., Durbin, R. K., Risman, S. S. &McAllister, W. T. (1991). Speci®c contacts betweenthe bacteriophage T3, T7, and SP6 RNA polymerasesand their promoters. J. Biol. Chem. 266, 645-651.

3. Li, T., Ho, H. H., Maslak, M., Schick, C. & Martin,C. T. (1996). Major groove recognition elements inthe middle of the T7 RNA polymerase promoter.Biochemistry, 35, 3722-3727.

4. Schick, C. & Martin, C. T. (1995). Tests of a modelof speci®c contacts in T7 RNA polymerase-promoterinteractions. Biochemistry, 34, 666-672.

5. Maslak, M., Jaworski, M. D. & Martin, C. T. (1993).Tests of a model for promoter recognition by T7RNA polymerase: thymine methyl group contacts.Biochemistry, 32, 4270-4274.

6. Ujvari, A. & Martin, C. T. (1997). Identi®cation of aminimal binding element within the T7 RNA poly-merase promoter. J. Mol. Biol. 273, 775-781.

7. Diaz, G. A., Raskin, C. A. & McAllister, W. T.(1993). Hierarchy of base-pair preference in the bind-ing domain of the bacteriophage T7 promoter. J. Mol.Biol. 229, 805-811.

8. Raskin, C. A., Diaz, G. A., Joho, K. & McAllister,W. T. (1992). Substitution of a single bacteriophageT3 residue in bacteriophage T7 RNA polymerase atposition 748 results in a switch in promoter speci-®city. J. Mol. Biol. 228, 506-515.

9. Rong, M., He, B., McAllister, W. T. & Durbin, R. K.(1998). Promoter speci®city determinants of T7 RNApolymerase. Proc. Natl Acad. Sci. USA, 95, 515-519.

10. Cheetham, G., Jeruzalmi, D. & Steitz, T. A. (1999).Structural basis for initiation of transcription froman RNA polymerase-promoter complex. Nature, 399,80-83.

11. Cheetham, G. & Steitz, T. A. (1999). Structure of atranscribing T7 RNA polymerase initiation complex.Science, 286, 2305-2309.

12. Imburgio, D., Rong, M., Ma, K. & McAllister, W. T.(2000). Studies of promoter recognition and start site


selection by T7 RNA polymerase using a compre-hensive collection of promoter variants. Biochemistry,39, 10419-10430.

13. Maslak, M. & Martin, C. T. (1993). Kinetic analysisof T7 RNA polymerase transcription initiationfrom promoters containing single-stranded regions.Biochemistry, 32, 4281-4285.

14. Weston, B. F., Kuzmine, I. & Martin, C. T. (1997).Positioning of the start site in the initiation of tran-scription by T7 RNA polymerase. J. Mol. Biol. 272,21-30.

15. Milligan, J. F., Groebe, D. R., Witherell, G. W. &Uhlenbeck, O. C. (1987). Oligoribonucleotide syn-thesis using T7 RNA polymerase and syntheticDNA templates. Nucl. Acids Res. 15, 8783-8798.

16. Martin, C. T., Muller, D. K. & Coleman, J. E. (1988).Processivity in early stages of transcription by T7RNA polymerase. Biochemistry, 27, 3966-3974.

17. McAllister, W. T. (1997). Transcription by T7 RNApolymerase. In Nucleic Acids and Molecular Biology(Eckstein, F. & Lilley, D. M. J., eds), vol. 11, pp. 15-25, Springer, Berlin.

18. Jia, Y. & Patel, S. S. (1997). Kinetic mechanism oftranscription initiation by bacteriophage T7 RNApolymerase. Biochemistry, 36, 4223-4232.

19. Mentesana, P. E., Chin-Bow, S. T., Sousa, R. &McAllister, W. T. (2000). Characterization of haltedT7 RNA polymerase elongation complexes revealsmultiple factors that contribute to stability. J. Mol.Biol. 302, 1049-1062.

20. Place, C., Oddos, J., Buc, H., McAllister, W. T. &Buckle, M. (2000). Studies of contacts between T7RNA polymerase and its promoter reveal featuresin common with multisubunit RNA polymerases.Biochemistry, 38, 4948-4957.

21. Ikeda, R. A. & Richardson, C. C. (1986). Interactionsof the RNA polymerase of bacteriophage T7 with itspromoter during binding and initiation of transcrip-tion. Proc. Natl Acad. Sci. USA, 83, 3614-3618.

22. Temiakov, D., Mentesana, P. E., Ma, K., Mustaev,A., Borukhov, S. & McAllister, W. T. (2000). Thespeci®city loop of T7 RNA polymerase interacts ®rstwith the promoter and then with the elongatingtranscript, suggesting a mechanism for promoterclearance. Proc. Natl Acad. Sci. USA, 97, 14109-14114.

23. Sastry, S. S. & Ross, B. M. (1998). RNA-binding sitein T7 RNA polymerase. Proc. Natl Acad. Sci. USA,95, 9111-9116.

24. Muller, D. K., Martin, C. T. & Coleman, J. E. (1988).Processivity of proteolytically modi®ed forms of T7RNA polymerase. Biochemistry, 27, 5763-5771.

25. Villemain, J., Guajardo, R. & Sousa, R. (1997). Roleof open complex instability in kinetic promoterselection by bacteriophage T7 RNA polymerase.J. Mol. Biol. 273, 958-977.

26. Parrotta-Imburgio, D. (2000). Effects of changes inpromoter sequence on intiation by T7 RNA poly-merase, and the role of a conserved structural motif(DX2GR) in polymerase function. Doctoral Thesis,State University of New York, Health Science Centerat Brooklyn.

27. Guajardo, R., Gopal, V., Lopez, P. & Sousa, R.(1998). NTP concentration effects on initial transcrip-tion by T7 RNAP indicate that translocation occursthrough passive sliding and reveal that divergentpromoters have distinct NTP concentration require-ments for productive initiation. J. Mol. Biol. 281, 777-792.

28. Huang, J., Brieba, L. G. & Sousa, R. (2000). Misincor-poration by wild-type and mutant T7 RNA poly-merases: identi®cation of interactions that reducemisincorporation rates by stabilizing the catalyticallyincompetent open conformation. Biochemistry, 39,11571-11580.

29. Arnaud-Barbe, N., Cheynet-Sauvion, V., Mandrand,B. & Mallet, F. (1998). Transcription of RNAtemplates by T7 RNA polymerase. Nucl. Acids Res.26, 3550-3554.

30. Maslak, M. & Martin, C. T. (1994). Effects of solutionconditions on the steady-state kinetics of initiationof transcription by T7 RNA polymerase. Biochemis-try, 33, 6918-6924.

31. He, B., Rong, M., Lyakhov, D. L., Gartenstein, H.,Diaz, G. A., Castagna, R. C., McAllister, W. T. &Durbin, R. K. (1997). Rapid generation and puri®-cation of mutant phage RNA polymerases. ProteinExpr. Purif. 9, 142-151.

32. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989).Molecular Cloning: A laboratory Manual, 2nd edit.,Cold Spring Harbor Laboratory Press, Cold SpringHarbor, NY.

33. Daube, S. S. & von Hippel, P. H. (1994). RNAdisplacement pathways during transcription fromsynthetic RNA-DNA bubble duplexes. Biochemistry,33, 340-347.

34. He, B., Kukarin, A., Temiakov, D., Chin-Bow, S. T.,Lyakhov, D. L. & Rong, M. et al. (1998). Characteriz-ation of an unusual, sequence speci®c terminationsignal for T7 RNA polymerase. J. Biol. Chem. 273,18802-18811.

35. Chapman, K. A. & Burgess, R. R. (1987). Construc-tion of bacteriophage T7 late promoters with pointmutations and characterization by in vitro transcrip-tion properties. Nucl. Acids Res. 15, 5413-5432.

36. Chapman, K. A., Gunderson, S. I., Anello, M., Wells,R. & Burgess, R. R. (1988). Bacteriophage T7 latepromoters with point mutations: quantitative foot-printing and in vivo expression. Nucl. Acids Res. 16,4511-4524.

Edited by M. Gottesman

(Received 5 December 2000; received in revised form 4 May 2001; accepted 10 May 2001)

interrupting the template strand of the t7 promoter ...€¦ · t7 rnap engages in a process of...

Documents