international journal of entomology
TRANSCRIPT
![Page 1: International Journal of Entomology](https://reader031.vdocuments.us/reader031/viewer/2022013012/61cf590af62aa3633b6bbeb5/html5/thumbnails/1.jpg)
![Page 2: International Journal of Entomology](https://reader031.vdocuments.us/reader031/viewer/2022013012/61cf590af62aa3633b6bbeb5/html5/thumbnails/2.jpg)
24/4/2018 Editorial Board | International Journal of Entomology Research
http://www.entomologyjournals.com/board 1/9
Search SEARCH
ISSN:2455-4758
InternationalJournalofEntomologyResearch
HOME EDITORIAL BOARD ARCHIVES INSTRUCTIONS MEMBERSHIP INDEXING CONTACT US
SIDEBAR
Home
Editorial Board
Archives
Instructions
Indexing andAbstracting
Contact Us
Publication Ethics
CERTIFICATE
UGCApprovedJournal
EditorialBoard
EDITOR-IN-CHIEF
Dr. B. S. Chandel (M.Sc., Ph.D., D.Sc. (Zoology-Entomology) FESI,FSLSc., FSESc., IAES, FANSF, SPPS. FAEB) Associate Professor & Head Biopesticides and Toxicological Laboratory, Department of Zoology,D.B.S. College, A�liated to CSJM University, Kanpur, India
ASSOCIATE EDITORS
Dr. Surya Prakash Mishra (Ph.D., .Z.S.I., F.A.I.R., F.I.A.E.S., F.S.L.Sc.) Associate Professor and Head, P.G. Department of Zoology, Ganpat Sahai P.G. College, Sultanpur,Uttar Pradesh, India
Rouhollah Radjabi (Ph.D.) Researcher Plant Protection Department, Agricultural Faculty, Islamic AzadUniversity, Dezful Branch, Dezful, Iran
Dr. Saroj Kumar Ghosh (M.Sc., M.Phil., Ph.D.) Assistant Professor, Department of Zoology, Bejoy Narayan Mahavidyalaya, Itachuna,Hooghly, West Bengal, India
Dr. Abhishek Shukla (Ph.D.) Senior Acarologist and Associate Professor Department of Entomology Navsari Agricultural University, Navsari,Gujarat, India
Neeraj Kumar Sharma (Ph. D.) Department of Zoology, H.N.B Garhwal University, Tehri GarhwalUttarakhand, India
Dr. (Mrs.) Ranjana Saxena (M. Sc., Ph.D.) Associate Professor Dyal Singh College, University of Delhi, Delhi, India
Dr. Hany M. R. Abdel-Latif ((DVM, MVSc, PhD) Lecturer of Fish diseases Department of Poultry and Fish diseases, Faculty of Veterinarymedicine, Alexandria University Ed�na, Behera province, Egypt
Syed Ishtiaq Anjum (Ph.D.) Lecturer Department of Zoology, Kohat University of Science and Technology,Kohat-26000, Khyber Pakhtunkhwa, Pakistan
Dr. Nayan Roy (M. Sc., Ph.D.) Assistant Professor MUC Women’s College, Department of Zoology, West Bengal, India
Instructions to Reviewer Click Here
Online and PrintJournal
Indexed Journal
Refereed Journal
Peer Reviewed Journal
SUBMIT YOURARTICLE AT
INDEXED IN
JOIN EDITORIALBOARD
Journals List
Research Journals
![Page 3: International Journal of Entomology](https://reader031.vdocuments.us/reader031/viewer/2022013012/61cf590af62aa3633b6bbeb5/html5/thumbnails/3.jpg)
24/4/2018 Editorial Board | International Journal of Entomology Research
http://www.entomologyjournals.com/board 2/9
Dr. Semra BENZER Assistant Professor Education Faculty, Gazi University, Ankara, Turkey
Dr. Deepak Sumbria (Ph.D.) Teaching Associate Department of Veterinary Parasitology Post-Graduate Institute ofVeterinary Education and Research jaipur, Rajasthan, India
Prof. Dr. Muhammad Faheem Malik (M. Sc., Ph.D.) Dean (Director) of Faculty of Sciences University of Gujrat, Ha�z Hayat Campus, Gujrat, Pakistan
Dr. R. Raveen (M.Sc., M.Phil., Ph.D.) Assistant Professor, Department of Zoology, Madras Christian College, Chennai, TamilNadu, India
Hameed Ur Rehman Researcher Department of Chemistry, Kohat University of Science andTechnology, Khyber Pakhtunkhwa, Pakistan
Dr. Selçuk Altınsaçlı (M. Sc., Ph.D.) Faculty of Fisheries, İstanbul University, Istanbul, Turkey
Dr. Amit Tomar (M.Sc. Botany, Ph.D., F.L.S. London, D.Sc.) Assistant Professor Department of Botany Meerut College, Meerut, Uttar Pradesh, India
Dr. Buddhadeb Manna (M. Sc., Ph.D.) Professor, Department of Zoology, University of Calcutta, India
Mandakini Singla (Ph.D.) Lecturer Govt Science College, Jagraon, Punjab, India
Dr. Meera Srivastava (M. Sc., Ph.D.) Head, PG Department of Zoology Govt. Dungar College, Bikaner, Rajasthan,India
Dr.abid Farid (M. Sc., Ph.D.) Associate Professor/Head, Department of Agriculture, University of Haripur, Haripur, Pakistan
Dr. Alexander V. Ilyinykh (Ph.D., D.Sc.,) Institute of Systematics and Ecology of Animals SB PAS, Novosibirsk,Russia
Prof. Dr. Naim Saglam (M. Sc., M.A., Ph.D.) Department of Aquaculture and Fish Diseases, Faculty of Fisheries,Firat University, Turkey
Prof. Dr. Ahmad-Ur-Rahman Saljoqi (M. Sc., Ph.D.) Professor, Department of Plant Protection, The University of Agriculture,Peshawar, Pakistan
Prof. Dr. Emel Ergun (Ph.D.) Department of Histology and Embryology, Faculty of VeterinaryMedicine, Ankara University, Turkey
Journals List
Research Journals
![Page 4: International Journal of Entomology](https://reader031.vdocuments.us/reader031/viewer/2022013012/61cf590af62aa3633b6bbeb5/html5/thumbnails/4.jpg)
24/4/2018 Editorial Board | International Journal of Entomology Research
http://www.entomologyjournals.com/board 3/9
Dr. R.a. Tripathi Professor (Retd.), Division of Entomology, C.S. Azad University of Agriculture andTechenology, Kanpur, Uttar Pradesh, India
Prof. Dr. Bilal Dik (D.M.V., Ph.D.) Department of Parasitology, Selcuk University, Turkey
Prof. Bhaweshwar Singh (M. Sc., Ph.D.) Prof-in-Charge, Gerontology, University Department of Zoology, L.N. Mithila University,Darbhanga, India
Prof. C.p.m Tripathi Head, Department of Zoology, D.D.U. University of Gorakhpur, Gorakhpur,India
Prof. Abdurasulov Yrysbek (Ph.D.) Consultant, FAO National Farm Animal Genetic Resources of Kyrgyzstan,Kyrgyzstan
Assoc. Prof. Dr. Mustafa Garip (D.V.M., Ph.D.) Division of Animal Nutrition and Zootechnics, Faculty of VeterinaryMedicine, Selcuk University, Turkey
Prof. Dr. Svetlana G. Nesterova (Ph.D.) Department of Biodiversity and Bioresources, Faculty of Biology andBiotechnology, Al-Farabi Kazakh National University, Kazakhstan
Dr. J.p. Shukla Head, Department of Zoology, Shiv Harsh Kisan P.G. College, Basti, India
Dr. Ravneet Kaur Division of Entomology, Punjabi University, Patiala, Punjab, India
Prof. S.c. Joshi Department of Zoology, Rajasthan University Jaipur, Jaipur, Rajasthan,India
Prof. Nogoybayev Mukambetov Daiyrovich Head, Head of the Department of Internal Medicine Animals, Kyrgyz NationalAgrarian University, Kyrgyzstan
Dr. Oguzhan Avci Department of Virology, Faculty of Veterinary, Medicine, University ofSelcuk, Turkey
Dr. Ashish Tripathi (M.Sc., Ph.D., F.I.S.C.A.) P.G. Department of Zoology and Entomology, Janta College Bakewar,Etawah, Uttar Pradesh, India
Dr. Varuna Verma (M.Sc., Ph.D.) Environmental Engineering, Geetanjali Institute of Technical Studies,Dabok, Udaipur, India
Dr. Matiyar Rahaman Khan (M.Sc., Ph.D.) Associate Professor AICRP (Nematode), Directorate of Research/Department of AgrilEntomology, Bidhan Chandra Krishi Viswavidyalaya, Kalyani, Nadia,
Journals List
Research Journals
![Page 5: International Journal of Entomology](https://reader031.vdocuments.us/reader031/viewer/2022013012/61cf590af62aa3633b6bbeb5/html5/thumbnails/5.jpg)
24/4/2018 Editorial Board | International Journal of Entomology Research
http://www.entomologyjournals.com/board 4/9
West Bengal, India
Dr. Samuel Tennyson (M.Sc., Ph.D.) Assistant Professor, Department of Zoology, Madras Christian College, Chennai, TamilNadu, India
Dr. S. Arivoli (M.Sc., M.Phil, Ph.D.) Assistant Professor, Department of Zoology, Thiruvalluvar University, Vellore, Tamil Nadu,India
Assoc. Prof. Dr. Ali Satar (M.Sc., Ph.D.) Dicle University Department of Biology, Diyarbakır, Turkey
Dr. Md. Abdur Rashid (M.Sc., Ph.D.) Genetics and Molecular Biology Lab. Department of Zoology,University of Dhaka, Bangladesh
Dr. Jainder Singh Chhilar (M.Sc., Ph.D., P.G.D.B.I.) Assistant Professor, Department of Zoology, Pt CLS Government PG College, Karnal,Haryana, India
Asist. Prof. Dr. M. Yeşim çelik (M.Sc., Ph.D.) Department of Aquaculture, Sinop University, Turkey
Dr. Melek Zeybek (Ph.D.) Department of Biology. Süleyman Demirel University, Turkey
Dr. Shivaji Bhagwan Ubarhande (M.Sc., Ph.D.) Head, Department of Zoology, Rajarshi Shahu Arts, Commerce and ScienceCollege, Pathri Phulambri, Aurangabad, India
Dr. Meral Apaydın Yağcı (Ph.D.) Fisheries Engineer Fisheries Research Station, Eğirdir-Isparta, Turkey
Dr. B. N. Pandey (M.Sc., Ph.D.) P.G.Department of Zoology. Purnea College, Purnia, Bihar, India
Dr. Sanjay Shamrao Nanware (M.Sc., Ph.D., F.H.S.I.,F.S.L.Sc.,F.Z.S.I.,F.I.A.S.N.) Assistant Professor, Post Graduate Department of Zoology, Yeshwant Mahavidyalaya,Nanded, Maharashtra, India
Dr. Dhanraj Balbhim Bhure (M.Sc., Ph.D.) Assistant Professor, Post Graduate Department of Zoology, Yeshwant Mahavidyalaya,Nanded, Maharashtra, India
Dr. Sebastian C. D. (M.Sc., Ph.D.) Associate Professor, Department of Zoology Director, School of Health Sciences Universityof Calicut, Kerala, India
Dr. Omer Kucuk (M.Sc., Ph.D.) Chamber of forest Engineer, Society of Kastamonu University, Turkey
Journals List
Research Journals
![Page 6: International Journal of Entomology](https://reader031.vdocuments.us/reader031/viewer/2022013012/61cf590af62aa3633b6bbeb5/html5/thumbnails/6.jpg)
24/4/2018 Editorial Board | International Journal of Entomology Research
http://www.entomologyjournals.com/board 5/9
Dr. P.k. Mittal (M. Sc., Ph.D.) Scientist National Institute of Malaria Research, New Delhi, India
Prof. Tinatin Doolotkeldieva (M. Sc., Ph.D.) Head and Prof. of Plant Protection Department, Agriculture Faculty, Kyrgyz-Turkish Manas University,Kyrgyzstan
Dr. Sarwan Kumar (M.Sc., Ph.D.) Assistant Entomologist (Oilseeds), Department of Plant Breeding and Genetics, Punjab AgriculturalUniversity, Ludhiana, Punjab, India
Dr. Mamata Kumari (M.Sc., Ph.D.) Ramdayalusingh College, B.R.A. Bihar University, Muzaffarpur, Bihar,Indian
Dr. M. Serajuddin (M.Sc., Ph.D.) Associate Professor, Department of Zoology, University of Lucknow, Lucknow, India
Associate. Prof. Dr. Hasan Kalyoncu (M.Sc., Ph.D.) Faculty of Art and Science, Departmant of Biology, University of Süleyman Demirel, Isparta,Turkey
Dr. S. Rajashekara (M.Sc., Ph.D.) Centre for Applied Genetics, Department of Zoology, Jnana BharathiCampus, Bangalore University, Bengaluru, Karnataka, India
Dr. Muhammad Zubair (M.Sc., Ph.D.) Lecturer (currently on study leave), Faculty of Veterinary and Animal Science,The Univeristy of Poonch, Rawalakot, Azad Jammu & Kashmir,Pakistan
Dr. Hassan Nasirian (M.Sc., Ph.D.) Department of Medical Entomology and Vector Control, School ofPublic Health, Tehran University of Medical Sciences, Tehran, Iran
Prof. Poduri Nagaraja Rao (M.Sc., Ph.D., FPPAI., FSPPS.,FAEB.,FAZRA,) Professor of Zoology, Department of Zoology, Osmania University, India
Dr. Youssef Dewer (M.Sc., Ph.D.) Department of Biological Chemistry and Crop Protection, RothamstedResearch, Harpenden, United Kingdom
Dr.El-Sayed Abdel-Malek El-Sheikh (M.Sc., Ph.D.) Associate Prof. Associate Prof. of Pesticides Biotechnology and Toxicology, Facultyof Agriculture, Zagazig University, Egypt
Dr. Soad I. Abd El-Razak Ramadan (M.Sc., Ph.D.) Plant Protection Research Institute, Agricultural Research Center,Sabahia, Baccous, Alexandria, Egypt
Dr. Pratibha Menon (M.Sc., Ph.D.) Division of Entomology, Indian Agricultural Research Institute, Delhi,India
Prof. Dr Mou�d Yassine (Ph.D.) Tishreen university, Latakia, Syria
Journals List
Research Journals
![Page 7: International Journal of Entomology](https://reader031.vdocuments.us/reader031/viewer/2022013012/61cf590af62aa3633b6bbeb5/html5/thumbnails/7.jpg)
24/4/2018 Editorial Board | International Journal of Entomology Research
http://www.entomologyjournals.com/board 6/9
Dr. Muhammad Saeed Assistant Professor Department of Agriculture, University of Haripur, Khyber Pakhtunkhwa,Pakistan
Dr. Ali Darvishzadeh (M. Sc., Ph.D.) Department of Plant Protection, College of Agriculture and NaturalResources, University of Tehran, Karaj, Alborz, Iran
Prof. Dr. Uğur Uslu (M. Sc., Ph.D.) Vice Dean Selcuk Universite, Veterinary Medicine Parasitology Department,Kampus-Konya, Turkey
Dr. Y. Norma-Rashid (Ph.D.) Professor, Ecology & Biodiversity Programme, Institute of Biological Sciences,Faculty of Science, University of Malaya, Kuala Lumpur, Malaysia
Dr. Dushyant Mishra (Ph.D.) Research Associate, Department of Molecular and Cellular Medicine, Reynolds MedicalBldg. Texas A&M Health Science Center, College Station, Texas, USA
Dr. Jayaprada Rao Chunduri (M.Sc., M.Phil., Ph.D., PGDB) Assistant Professor, Biotechnology Department, Mithibai College of Arts, Chauhan Instituteof Science and AJ college of commerce and economics (A�td. toMUMBAI university), Vile Parle(W), Mumbai, India
Dr. Showket Ahmad Dar (Ph.D.) Sher e Kashmir University of Agricultural Sciences and TechnologyKashmir, Shalimar, Srinager, India
Mukesh Kumar Chaubey (Ph.D) Assistant Professor Department of Zoology, Mahatma Gandhi Post Graduate College,Gorakhpur, Uttar Pradesh, India
Luis Carlos Martínez (Ph.D) Researcher Department of Entomology, Universidade Federal De Viçosa, MinasGerais, Brazil
Bolormaa Ganbaatar (Master) P.o.b 53/15. Institute of Plant Protection, Ub. Khan-uul, Zaisan, Ulaanbaatar,Mongolia
Dr. Kalim Shaikh (M.Sc, B.Ed, Ph.D(Zoology)) Assistant Professor Poona College of Arts, Science & Commerce New, Modikhana Camp,Pune, Maharashtra, India
Grace Beena Paul (M.sc, B.Ed, Ph.D) Editorial Board Member Department of Zoology, St.pious X Degree & Pg College Fr Women,Hyderabad, Telangana, India
Dr. Nitin Kulkarni (Ph.D) Scientist G
Journals List
Research Journals
![Page 8: International Journal of Entomology](https://reader031.vdocuments.us/reader031/viewer/2022013012/61cf590af62aa3633b6bbeb5/html5/thumbnails/8.jpg)
24/4/2018 Editorial Board | International Journal of Entomology Research
http://www.entomologyjournals.com/board 7/9
Forest Entomology Division, Tropical Forest Research Institute,Jabalpur, Madhya Pradesh, India
Dr. Rajendra Kumar Kalyan (M.Sc.(Ag. Ento.), Ph.D.(Ento)) Assistant Professor(entomology) Agricultural Research Station-borwat Farm, Maharan Pratap Universityof Agriculture & Technology-udaipur, Banswara, Rajasthan, India
Dr. G. Ramkumar (M.Sc., Ph.D) Research Scientist Department of Biotechnology, Periyar University, Salem, Tamil Nadu,India
Dr. Lingathurai (M.Sc., M.Phil., Ph.D) Assistant Professor Department of Biotechnology, Madura College, Madurai, Tamil Nadu,India
Dr. A. Prakasam (M.Sc., M.Phil., M.B.A., Ph.D) Assistant Professor Department of Physics, Thiruvalluvar Government Arts College,Namakkal, Tamil Nadu, India
Dr. Fazil Hasan (Ph.D., Post Doc.) Post Doctoral Division of Entomology, icar-indian Agricultural Research Institute,New Delhi, Delhi, India
Dr. Prabhakar ramchandra pawar (M.Sc. Ph.D) Vice-principal & Head Department of Zoology, Veer Wajekar Arts Science and CommerceCollege, Navi Mumbai, Maharashtra, India
Dr. A. Najitha Banu (Ph.D) Assistant Professor Department of Zoology, School of Bioengineering and Biosciences,Lovely Professional University, Punjab, India
Dr. Snehangsu Sinha (BVSc, MVSc, NET, D.Tech, PD.Tech) Teaching Associate Department of Anatomy, College of Veterinary Science, Guwahati,Assam, India
Dr. C. V. Sreeranjitkumar (MSc., MPhil, PhD, PDF) Associate Professor Head of Department, P. G and Research Department of Zoology, Govt.Victoria College, Palakkad, Kerala, India
Dr. Partha Pratim Chakravorty (M.Sc., PhD, FZS) Associate Professor & Head Post Graduate Department of Zoology, Raja N. L. Khan Women &College, Gope Palace, Vidyasagar University, Midnapore, West Bengal,India
Dr. Manish Sharma (MSc, MPhil, PhD) Assistant Professor in Zoology PG Department of Agriculture, General Shivdev Singh DiwanGurbachan Singh Khalsa College, Patiala, Punjab, Patiala, Punjab,India
Dr. Angsuman Chanda (M. Sc., Ph. D.) Associate Professor
Journals List
Research Journals
![Page 9: International Journal of Entomology](https://reader031.vdocuments.us/reader031/viewer/2022013012/61cf590af62aa3633b6bbeb5/html5/thumbnails/9.jpg)
24/4/2018 Editorial Board | International Journal of Entomology Research
http://www.entomologyjournals.com/board 8/9
PG Department of Zoology, Raja N. L. Khan Women & College,Medinipur, Paschim Medinipur, West Bengal, India
Dr. Kathirvelu Baskar (Ph.D Entomology) Senior Scientist Optimurz Biotechnology Internships Training Chennai, Shenoy NagarWest, Chennai, Tamil Nadu, India
Dr. Ankush M. Raut (Ph.D) Assistant Professor Department of Plant Protection, School of Agriculture, LovelyProfessional University, Jalandhar, Punjab, India
ASSISTANT EDITORS
Tamizhazhagan (M.Sc., B.Ed., M.Phil., Ph.D.,) Researcher Department of Zoology, Annamalai University, Chidambaram, TamilNadu, India
ASSISTANT EDITOR
Haseeb Jan (M.Sc(Hons) Entomology) Researcher in Acarology Laboratory Department of Entomology University of Agriculture, Faisalabad,Pakistan
Dr. Sameera Siraj (Ph.D) Assistant Professor Department of zoology, S. P. college Srinagar, Cluster universitysrinagar, Srinagar, Jammu and Kashmir, India
Dr Priyankar Sanphui (M.Sc, Ph.D) Assistant Professor Department of Zoology, Sree Chaitanya College, West Bengal, India
Shivashankara (M.Sc., Ph.D) Department of Entomology, Colleage of Agriculture, G. B. PantUniversity of Agriculture and Technology, Pantnagar, Uttarakhand,India
Ramesh Singh Yadav (M.Sc. NET) Assistant Teacher Govt School Dehariya, Zamaniya, Ghazipur, Uttar, Pradesh, India
Mainak Bhattacharyya (M.Sc., B.Ed, Ph.D) Department of Agricultural Entomology, Bidhan Chandra KrishiViswavidyalaya, Mohanpur, Nadia, West Bengal, India
Dr. Jitendar Kumar Sharma (Ph.D) Assistant Professor Department of Plant Pathology, School of Agriculture, Rai University,Ahmedabad, Gujarat, India
G. Dineshkumar (M.Sc.,M.Phil.,(Ph.D)) Department of Zoology, Biotechnologya V. Vm Sri Pushpam College(Autonomous) Poondi, Thanjavur, Tamilnadu, India
Dr. Shabir Ahmad Bhat (Ph.d) Assistant Professor
Journals List
Research Journals
![Page 10: International Journal of Entomology](https://reader031.vdocuments.us/reader031/viewer/2022013012/61cf590af62aa3633b6bbeb5/html5/thumbnails/10.jpg)
24/4/2018 Editorial Board | International Journal of Entomology Research
http://www.entomologyjournals.com/board 9/9
Junior Scientist (SS), Temperate Sericulture Reserach Institute,Mirgund SKUAST, Jammu and Kashmir, India Email: [email protected] Phone: 08803343509
ASSOCIATE EDITOR
Dr. Sudhakar Gupta (M.Sc. Ph.D.) Associate Professor Department of Zoology, Suraj Degree (PG) College, Mahendergarh,Haryana, India
Dr. Abdul Rasheed War (Ph.D) Scientist World Vegetable Centre-South Asia, ICRISAT Campus, Hyderabad,Telangana, India
Dr. Bhanvi Wadhawan (M.Sc, Ph.D) Assistant Professor Department of Zoology, M. M. Modi College, Patiala, Punjab, India
Dr. Aditya Prasad Acharya (PhD) Assistant Professor Department of Veterinary Pathology, College of Veterinary Science &Animal Husbandry, OUAT, Bhubaneswar, Odisha, India
Dr. Mrs. Rajendramani Gnaneswaran (Ph.D) Department of Zoology University of Jaffna, Jaffna, Sri Lanka
Dr. Palem Harinath (Ph.D) Department of Zoology, Yogi Vemana University, Vemana Puram, YogiVemana University Road, Ganganapalle, Andhra Pradesh, India
Dr. Rajendramani Gnaneswaran (Ph.D) Department of Zoology, University of Jaffna, Jaffna, Sri Lanka
Chinnaperumal Kamaraj (M.Sc.,M.Phil.,Ph.D.,) Department of Biotechnology, School of Biosciences, PeriyarUniversity, Salem, Tamil Nadu, India
Dr. Deepak Rawal (M. Sc., SET, CSIR-NET, Ph. D.) Assistant Professor Department of Zoology, UCOS, Mohanlal Sukhadia University, Udaipur,Ganesh Nagar, Udaipur, Rajasthan, India
Dr. Sushil Kumar Saxena (M.Sc.(Agril), Ph.D. (Forest Ento.), Ph.D.(Agril. Ento.)) Professor and Head Department of Entomology, ASPEE College of Horticulture andForestry, Navsari Agricultural University, Navsari, Gujarat, India
Apply for Editorial Board Member Click Here
HOME EDITORIAL BOARD ARCHIVES INSTRUCTIONS MEMBERSHIP INDEXING CONTACT US
COPYRIGHT © 2016 - 2018. ALL RIGHTS RESERVED.
Journals List
Research Journals
![Page 11: International Journal of Entomology](https://reader031.vdocuments.us/reader031/viewer/2022013012/61cf590af62aa3633b6bbeb5/html5/thumbnails/11.jpg)
Vol. 3, Issue 2 (2018)
S. No. Title and Authors Name Country
21 Incidence and diversity of lepidopterous insect pests and their parasitoids (natural enemies) on cole crops at danderkhah location in Srinagar District (J&K, India)
Deen Mohd Bhat
[ABSTRACT][DOWNLOAD]
PAGES: 107-113 | 69 VIEWS 29 DOWNLOADS
India
22 The moths (Lepidoptera: Heterocera) of vagamon hills (Western Ghats), Idukki district, Kerala, India
Pratheesh Mathew, Sekar Anand, Kuppusamy Sivasankaran, Savarimuthu Ignacimuthu
[ABSTRACT][DOWNLOAD]
PAGES: 114-120 | 65 VIEWS 27 DOWNLOADS
India
23 Histopathological effects of chlorpyrifos on the midgut of 3rd larval instar of oriental latrine fly, Chrysomya megacephala(Fabricius) (Diptera:
Calliphoridae)
Shagufta Yasmeen, Mohammad Amir
[ABSTRACT][DOWNLOAD]
PAGES: 121-126 | 66 VIEWS 35 DOWNLOADS
India
24 Location specific morphological peculiarity of honey bee Apis indica in Amethi, region Uttar Pradesh, India: Revealization from an identification and characterization studied
Saleem Ahamad, Rajneesh Tripathi
[ABSTRACT][DOWNLOAD]
PAGES: 127-129 | 57 VIEWS 24 DOWNLOADS
India
25 Oviposition deterrent, repellent and ovicidal activity of Pterolobium hexapetalum (Fab.) against the stored grain pest, Callosobruchus maculatus (Coleoptera: Chrysomelidae)
Saranya J, Elumalai Kuppusamy
[ABSTRACT][DOWNLOAD]
PAGES: 130-138 | 31 VIEWS 17 DOWNLOADS
India
26 Larvicidal activity of selected essential oils against Aedes aegypti (Insecta: Diptera: Culicidae)
Christina Pauline M, Mary Fabiola, Johnson Amala Justin, JMV Kalaiarasi
[ABSTRACT][DOWNLOAD]
PAGES: 139-142 | 34 VIEWS 20 DOWNLOADS
India
27 Expression patterns of epsilon glutathione S – transferases genes in developmental stages of susceptible and DDT resistant lines of Anopheles arabiensis strains
Yayo AM, Ado A, Habibu UA, Mohammed BR, Ebere N, Hemingway J
[ABSTRACT][DOWNLOAD]
PAGES: 143-151 | 36 VIEWS 23 DOWNLOADS
Nigeria
28 Population dynamics study for triple-e sustainable management of a major pest, Leptocorisa oratorius fabricius (Hemiptera: Alydidae)
Nayan Roy
[ABSTRACT][DOWNLOAD]
PAGES: 152-158 | 20 VIEWS 11 DOWNLOADS
India
29 Evaluation of toxicity of biopesticides against okra moth, Earias vittella (Fabricius) (Noctuidae: Lepidoptera) India
![Page 12: International Journal of Entomology](https://reader031.vdocuments.us/reader031/viewer/2022013012/61cf590af62aa3633b6bbeb5/html5/thumbnails/12.jpg)
Pratibha, Rajendra Singh
[ABSTRACT][DOWNLOAD]
PAGES: 159-163 | 22 VIEWS 13 DOWNLOADS
30 Field efficacy of emamectin benzoate 1.9 EC against shoot and fruit borer of okra
Karthikeyan Rajuponnu, Ayysamy Regupathy
[ABSTRACT][DOWNLOAD]
PAGES: 164-167 | 20 VIEWS 11 DOWNLOADS
India
31 Molecular identification of house fly, Musca domestica L. (Diptera :
Muscudae), using mitochondrial DNA partial genes cytochrome oxidase sub unit 1 (CO1) in Manado city
Ivonne E Rotty, Odi Pinontoan, Max Tulung, Inneke Rumengan, Mokosuli Yermia Semuel
[ABSTRACT][DOWNLOAD]
PAGES: 168-176 | 34 VIEWS 27 DOWNLOADS
Indonesia
32 Physico-chemical characteristics of larval hatritat waters of mosquitoes in and around Bangalore, Karnataka, India
BM Sreedhara Nayaka
[ABSTRACT][DOWNLOAD]
PAGES: 177-179 | 15 VIEWS 8 DOWNLOADS
India
33 Insect faunal diversity of chintamani kar bird sanctuary and other protected areas of West Bengal
Bulganin Mitra, Arjan Basu Roy, Apurva Das, Suresh Kumar Shah, Sarika Baidya, Devsena Roy Chaudhury, Debapriya Mukherjee, Balaram Panja
[ABSTRACT][DOWNLOAD]
PAGES: 180-189 | 14 VIEWS 7 DOWNLOADS
India
34 Taxonomic studies on subfamily Phaneropterinae (Orthoptera: Tettigoniidae) from Uttar Pradesh, India
Mohd. Kaleemullah Farooqi, Mohd. Kamil Usmani
[ABSTRACT][DOWNLOAD]
PAGES: 190-195 | 2 VIEWS 2 DOWNLOADS
India
35 Diversity and abundance of the myrmicofauna in Chalisgaon, North Maharashtra region, India
Arun Sawarkar
[ABSTRACT][DOWNLOAD]
PAGES: 196-199 | 6 VIEWS 4 DOWNLOADS
India
36 Leafhoppers and their morphology, biology, ecology and contribution in ecosystem: A review paper
Bismillah Shah, Yating Zhang
[ABSTRACT][DOWNLOAD]
PAGES: 200-203 | 8 VIEWS 7 DOWNLOADS
China
![Page 13: International Journal of Entomology](https://reader031.vdocuments.us/reader031/viewer/2022013012/61cf590af62aa3633b6bbeb5/html5/thumbnails/13.jpg)
Editorial Board
EDITOR-IN-CHIEF
Dr. B. S. Chandel (M.Sc., Ph.D., D.Sc. (Zoology-Entomology) FESI, FSLSc., FSESc., IAES, FANSF, SPPS. FAEB) Associate Professor & Head Biopesticides and Toxicological Laboratory, Department of Zoology, D.B.S. College, Affiliated to CSJM University, Kanpur, India
ASSOCIATE EDITORS
Dr. Surya Prakash Mishra (Ph.D., .Z.S.I., F.A.I.R., F.I.A.E.S., F.S.L.Sc.) Associate Professor and Head, P.G. Department of Zoology, Ganpat Sahai P.G. College, Sultanpur, Uttar Pradesh, India
Rouhollah Radjabi (Ph.D.) Researcher Plant Protection Department, Agricultural Faculty, Islamic Azad University, Dezful Branch, Dezful, Iran
Dr. Saroj Kumar Ghosh (M.Sc., M.Phil., Ph.D.) Assistant Professor, Department of Zoology, Bejoy Narayan Mahavidyalaya, Itachuna, Hooghly, West Bengal, India
Dr. Abhishek Shukla (Ph.D.) Senior Acarologist and Associate Professor Department of Entomology Navsari Agricultural University, Navsari, Gujarat, India
Neeraj Kumar Sharma (Ph. D.) Department of Zoology, H.N.B Garhwal University, Tehri Garhwal Uttarakhand, India
Dr. (Mrs.) Ranjana Saxena (M. Sc., Ph.D.) Associate Professor Dyal Singh College, University of Delhi, Delhi, India
Dr. Hany M. R. Abdel-Latif ((DVM, MVSc, PhD) Lecturer of Fish diseases Department of Poultry and Fish diseases, Faculty of Veterinary medicine, Alexandria University Edfina, Behera province, Egypt
Syed Ishtiaq Anjum (Ph.D.) Lecturer Department of Zoology, Kohat University of Science and Technology, Kohat-26000, Khyber Pakhtunkhwa, Pakistan
Dr. Nayan Roy (M. Sc., Ph.D.) Assistant Professor MUC Women’s College, Department of Zoology, West Bengal, India
Dr. Semra BENZER Assistant Professor Education Faculty, Gazi University, Ankara, Turkey
Dr. Deepak Sumbria (Ph.D.)
![Page 14: International Journal of Entomology](https://reader031.vdocuments.us/reader031/viewer/2022013012/61cf590af62aa3633b6bbeb5/html5/thumbnails/14.jpg)
Teaching Associate Department of Veterinary Parasitology Post-Graduate Institute of Veterinary Education and Research jaipur, Rajasthan, India
Prof. Dr. Muhammad Faheem Malik (M. Sc., Ph.D.) Dean (Director) of Faculty of Sciences University of Gujrat, Hafiz Hayat Campus, Gujrat, Pakistan
Dr. R. Raveen (M.Sc., M.Phil., Ph.D.) Assistant Professor, Department of Zoology, Madras Christian College, Chennai, Tamil Nadu, India
Hameed Ur Rehman Researcher Department of Chemistry, Kohat University of Science and Technology, Khyber Pakhtunkhwa, Pakistan
Dr. Selçuk Altınsaçlı (M. Sc., Ph.D.) Faculty of Fisheries, İstanbul University, Istanbul, Turkey
Dr. Amit Tomar (M.Sc. Botany, Ph.D., F.L.S. London, D.Sc.) Assistant Professor Department of Botany Meerut College, Meerut, Uttar Pradesh, India
Dr. Buddhadeb Manna (M. Sc., Ph.D.) Professor, Department of Zoology, University of Calcutta, India
Mandakini Singla (Ph.D.) Lecturer Govt Science College, Jagraon, Punjab, India
Dr. Meera Srivastava (M. Sc., Ph.D.) Head, PG Department of Zoology Govt. Dungar College, Bikaner, Rajasthan, India
Dr.abid Farid (M. Sc., Ph.D.) Associate Professor/Head, Department of Agriculture, University of Haripur, Haripur, Pakistan
Dr. Alexander V. Ilyinykh (Ph.D., D.Sc.,) Institute of Systematics and Ecology of Animals SB PAS, Novosibirsk, Russia
Prof. Dr. Naim Saglam (M. Sc., M.A., Ph.D.) Department of Aquaculture and Fish Diseases, Faculty of Fisheries, Firat University, Turkey
Prof. Dr. Ahmad-Ur-Rahman Saljoqi (M. Sc., Ph.D.) Professor, Department of Plant Protection, The University of Agriculture, Peshawar, Pakistan
Prof. Dr. Emel Ergun (Ph.D.) Department of Histology and Embryology, Faculty of Veterinary Medicine, Ankara University, Turkey
![Page 15: International Journal of Entomology](https://reader031.vdocuments.us/reader031/viewer/2022013012/61cf590af62aa3633b6bbeb5/html5/thumbnails/15.jpg)
Dr. R.a. Tripathi Professor (Retd.), Division of Entomology, C.S. Azad University of Agriculture and Techenology, Kanpur, Uttar Pradesh, India
Prof. Dr. Bilal Dik (D.M.V., Ph.D.) Department of Parasitology, Selcuk University, Turkey
Prof. Abdurasulov Yrysbek (Ph.D.) Consultant, FAO National Farm Animal Genetic Resources of Kyrgyzstan, Kyrgyzstan
Assoc. Prof. Dr. Mustafa Garip (D.V.M., Ph.D.) Division of Animal Nutrition and Zootechnics, Faculty of Veterinary Medicine, Selcuk University, Turkey
Prof. Dr. Svetlana G. Nesterova (Ph.D.) Department of Biodiversity and Bioresources, Faculty of Biology and Biotechnology, Al-Farabi Kazakh National University, Kazakhstan
Prof. Nogoybayev Mukambetov Daiyrovich Head, Head of the Department of Internal Medicine Animals, Kyrgyz National Agrarian University, Kyrgyzstan
Dr. Oguzhan Avci Department of Virology, Faculty of Veterinary, Medicine, University of Selcuk, Turkey
Dr. Varuna Verma (M.Sc., Ph.D.) Environmental Engineering, Geetanjali Institute of Technical Studies, Dabok, Udaipur, India
Dr. Omer Kucuk (M.Sc., Ph.D.) Chamber of forest Engineer, Society of Kastamonu University, Turkey
Associate. Prof. Dr. Hasan Kalyoncu (M.Sc., Ph.D.) Faculty of Art and Science, Departmant of Biology, University of Süleyman Demirel, Isparta, Turkey
Dr. Hassan Nasirian (M.Sc., Ph.D.) Department of Medical Entomology and Vector Control, School of Public Health, Tehran University of Medical Sciences, Tehran, Iran
Dr. Youssef Dewer (M.Sc., Ph.D.) Department of Biological Chemistry and Crop Protection, Rothamsted Research, Harpenden, United Kingdom
Dr.El-Sayed Abdel-Malek El-Sheikh (M.Sc., Ph.D.) Associate Prof. Associate Prof. of Pesticides Biotechnology and Toxicology, Faculty of Agriculture, Zagazig University, Egypt
Dr. Soad I. Abd El-Razak Ramadan (M.Sc., Ph.D.)
![Page 16: International Journal of Entomology](https://reader031.vdocuments.us/reader031/viewer/2022013012/61cf590af62aa3633b6bbeb5/html5/thumbnails/16.jpg)
Plant Protection Research Institute, Agricultural Research Center, Sabahia, Baccous, Alexandria, Egypt
Prof. Dr Moufid Yassine (Ph.D.) Tishreen university, Latakia, Syria
Dr. Muhammad Saeed Assistant Professor Department of Agriculture, University of Haripur, Khyber Pakhtunkhwa, Pakistan
Dr. Ali Darvishzadeh (M. Sc., Ph.D.) Department of Plant Protection, College of Agriculture and Natural Resources, University of Tehran, Karaj, Alborz, Iran
Prof. Dr. Uğur Uslu (M. Sc., Ph.D.) Vice Dean Selcuk Universite, Veterinary Medicine Parasitology Department, Kampus-Konya, Turkey
Dr. Y. Norma-Rashid (Ph.D.) Professor, Ecology & Biodiversity Programme, Institute of Biological Sciences, Faculty of Science, University of Malaya, Kuala Lumpur, Malaysia
Dr. Dushyant Mishra (Ph.D.) Research Associate, Department of Molecular and Cellular Medicine, Reynolds Medical Bldg. Texas A&M Health Science Center, College Station, Texas, USA
Luis Carlos Martínez (Ph.D) Researcher Department of Entomology, Universidade Federal De Viçosa, Minas Gerais, Brazil
Bolormaa Ganbaatar (Master) P.o.b 53/15. Institute of Plant Protection, Ub. Khan-uul, Zaisan, Ulaanbaatar, Mongolia
![Page 17: International Journal of Entomology](https://reader031.vdocuments.us/reader031/viewer/2022013012/61cf590af62aa3633b6bbeb5/html5/thumbnails/17.jpg)
Instructions to Author
Submit Manuscript: Manuscript can be submitted through email attachment at [email protected]
Download Copyright form. Click Here
Download Sample Paper. Click Here
These articles should clearly describe new and carefully confirmed results and experimental procedure which
should be given in required details for others to verify the work.
The manuscript should be prepared in English using "MS Word". "Times New Roman" font should be used. The
font size should be of 12pt but main subheadings may be of 14pt. All research articles should have the following
sections: Title page, Abstract, Key words, Introduction, Materials and methods, Results, Discussion, Conclusion,
Acknowledgement (if any) and References.
Title: The title should then followed by the author name and the institution name and address by indicating
suitable superscripts. Title page should contain title of the paper in bold face, title case, names of the authors in
normal face, upper case (font size 12) followed by the address(es) in normal face lower case. An asterisk (*)
must be placed after the corresponding authors name as superscript whose email id, fax, telephone number can
be given. Corresponding author has the responsibility to ensure that all co-authors are aware and approve the
contents of the submitted manuscript.
Abstract: This section should detail the problems, experimental approach, major findings and conclusion in one
paragraph and should appear on the second page. Avoid abbreviation, diagram and references in the abstract.
Keywords: Author(s) must give key words which can identify the most important subjects covered by the paper.
They must be placed at the end of the abstract.
Introduction: The manuscript should include the purpose of the investigation and relating the manuscript to similar
previous research. Only information essential to the arguments should be presented.
Materials and Methods: This section must contain specific details about the materials studied, instruments used,
specialized chemicals source and related experimental details which allows other research worker to reproduce
the results. Obtain permission for all fully borrowed, adapted, and modified tables and provide a credit line in the
footnote. Results and Discussions The results should be concisely presented. Results and discussion may be
separate or combined based on the author’s requirement. Tables and figures should be designed to maximize
the comprehension of the experimental data. The interpreted results should be explained clearly in discussions
and should relate them to the existing knowledge in the field as clearly as possible. Tables, Graphs and figures
(Illustrations) should be inserted in to the main text at respective place they should appear when published and
should have appropriate numbers and titles with an explanatory heading. Labels of the table, graph and figures
MUST be in the text form and should not form part of the image. Colour photographs and illustrations (line
drawings, halftones, photos, photomicrographs etc) must be clean originals or digital files would be charged that
may be intimated along with the acceptance letter. Those photographs must be clear and sharp. Digital files are
recommended for highest quality reproduction.
Acknowledgement (if any): This section can be kept at the end of the manuscript before reference section. This
section can be used to acknowledge the help of those who do not qualify for authorship or to acknowledge
funding, donated resources or significant contribution to the research.
![Page 18: International Journal of Entomology](https://reader031.vdocuments.us/reader031/viewer/2022013012/61cf590af62aa3633b6bbeb5/html5/thumbnails/18.jpg)
References: References to the literature cited for the manuscript should be numbered in order of appearance in
the manuscript and cited in the text with superscript numbers. The reference number should follow the following
format.
For Journals Format: Author(s) of article (surname initials). Title of the manuscript. Journal title abbreviated Year
of publication; volume number (issue number): page numbers.
Standard journal article (If more than six authors, the first six shall be listed followed by et al. )
Hornung H, Woolley K, Kori M L, Bennani L K, Bundgaard R K, Charles C S
et al. Anti-Inflammatory and analgesic activity of Jatropha gossypifolia in experimental animal models. Global
Journal of Pharmacology 2009; 3(1):1-5.
For Books and other monograph Format: Author AB, Author BB, Author CC. Title of Book. Ed, Vol, Publisher,
City, year, page numbers.
Faycal K M, Indian Materia Medica. Edn 3, Vol. I, London, 2000, 242-246.
For Patent Reference: H. Aviv, D. Friedman, A. Bar-Ilan and M. Vered. Submicron emulsions as ocular drug
delivery vehicles, U.S. Patent US 5496811; 1996.
For Website Reference: Quick dissolving tablets. http://www.biospace.com. 27 may, 2001.
Ethical Matters: Authors involving in the usage of experimental animals and human subjects in their research
article should seek approval from the appropriate Ethical committee in accordance with "Principles of Laboratory
Animal Care". The Method section of the manuscript should include a statement to prove that the investigation
was approved and that informed consent was obtained.
![Page 19: International Journal of Entomology](https://reader031.vdocuments.us/reader031/viewer/2022013012/61cf590af62aa3633b6bbeb5/html5/thumbnails/19.jpg)
Indexing and Abstracting
International Journal of Entomology Research is indexed in following database.
Index Copernicus
Google Scholar
![Page 20: International Journal of Entomology](https://reader031.vdocuments.us/reader031/viewer/2022013012/61cf590af62aa3633b6bbeb5/html5/thumbnails/20.jpg)
International Journal of Entomology Research
168
International Journal of Entomology Research
ISSN: 2455-4758
Impact Factor: RJIF 5.24
www.entomologyjournals.com
Volume 3; Issue 2; March 2018; Page No. 168-176
Molecular identification of house fly, Musca domestica L. (Diptera : Muscudae), using mitochondrial
DNA partial genes cytochrome oxidase sub unit 1 (CO1) in Manado city
Ivonne E Rotty1, Odi Pinontoan2, Max Tulung3, Inneke Rumengan4*, Mokosuli Yermia Semuel5 1 Ph.D Student, Department of Entomology, Graduate Program, Sam Ratulangi University, Manado, Indonesia
2, 3 Professor in Entomology, Department of Entomology, Graduate Program, Sam Ratulangi University, Manado, Indonesia 4 Department of Entomology, Graduate Program, Sam Ratulangi University, Manado, Indonesia.
5 Laboratory of Bioactivity and Molecular Biology, Department of Biology, State University of Manado, Indonesia
Abstract
Musca domestica L. becomes a serious problem in tropical country. Its role as a vector of many pathogenic microbes has caused
many health problems for humans. A study was conducted to identify house fly in Manado City, using partial gene cytochrome
oxidase sub unit 1 (CO1). House fly is obtained from nine different habitats in Manado City. Isolation of DNA were used DNA
extraction and purification Kit. Amplification of CO1 gene by PCR method. Sequence analysis using Geneous and MEGA 6.0.
The result of this research showed, the sequence of house fly CO1 gene : IBP, IBS, IBT, IKT, IMT and IPB have the highest
similarity level with Musca domestica cytochrome oxidase subunit I (COI) gene [MG557665.1], while the CO1 gene of IKP and
IKT has the highest similarity level with Musca domestica ISOLATE CSU 140601CBJI A $ cytochrome oxidase subunit I (COI)
gene [KY001857.1]. CO1 gene of IKS showed similarity with Musca domestica ISOLATE CSU 140601CBJI A$ cytochrome
oxidase subunit I (COI) gene. Intraspecies genetic variation of house flies in Manado city based on partial CO1 gene, are high.
Keywords: Musca domestica L., cytochrome oxidase sub unit 1 gene, Manado, Indonesia
Introduction
The house fly (Musca domestica L.) is the most frequent
house fly species transmitting pathogenic bacteria in humans
(Sembel, 2008; Kassiri et al. 2012) [8]. House flies can act as
vectors of transmission of gastrointestinal diseases, such as
cholera, dysentery, typhoid and also carry protozoa, eggs and
worm larvae (Santi, 2001; Chandra, 2005). Furthermore,
house flies are considered as annoying insects because it is a
mechanical vector of several diseases including
gastrointestinal infections (Hastutiek, 2007). Transmission of
the disease mechanically, i.e. through all parts of the body
flies. Disease germs from animal feces, humans and trash can
stick to body hair, hairs on legs and probosis. House fly, can
spread Helicobacter pylori, Escherichia coli, Cryptosporidium
parvum, even H5N1 virus (Hastutiek, 2007.
Manado city has 16 working areas of Community Health
Center (Loacal Name : Puskesmas). In 2015, the total
population of Manado City amounted to 425,633 inhabitants.
Diarrhea disease in Manado City 2014 reportedly amounted to
3174 patients; in 2015 increased to 4967 sufferers. For the
work area of Puskesmas Minanga, 2015 was 180 patients,
Puskesmas Bahu was 260 patients, Puskesmas Ranotana was
284 patients and Puskesmas Wenang was 182 patients.
Government General Hospital, Prof. Dr. R.D. Kandou, in
2015 reportedly handles 480 diarrhea sufferers. Diarrhea is
one of the 10 largest infectious diseases in North Sulawesi. In
many reports, the highest cases of diarrhea in areas with poor
sanitation in Manado City (BPS Sulawesi Utara, 2015) [2].
Based on previous research, population of house fly, at
various location in Manado city, founded mixed population of
flies with other flies species. Morphological studies have
found variations in morphological characteristics such as wing
length, body length, head structure, compound eye color, limb
structure and abdominal structure of houseflies originating
from various locations in Manado City (Rotty, 2017).
However, morphological characteristics have not been
sufficient to distinguish the species of house fly, which exist
in Manado city. Answering the problem was a genotypic
analysis using mitochondrial DNA of CO1 gene as a
molecular barcode used universally for animal identification.
The structure and composition of the genetic information
contained in mitochondrial DNA has been extensively
researched, can characterize a population, phylogenetic and
make it possible to reconstruct evolutionary history (Hebert et
al. 2003; Lessinger et al., 2000; Mokosuli, 2013) [6, 10].
Mitochondrial DNA is maternalistic, so there is no
recombination with parental male mitochondrial DNA
(Nelson and Cox, 2005; Alberts et al. 2005) [15, 1]. In
mitochondrial DNA, there is a conservative region that can be
used to construct an animal evolutionist relationship (Bruce et
al. 2006; Hebert et al. 2003) [6]. Since, Cytochrome c oxidase
subunit 1 (CO1) gene is considered as one of the widely used
markers in the studies of population genetics and evolution
(Hebert et al. 2003; Shao et al., 2007) [6] because it is among
the most conservative protein-coding genes found in the
mitochondrial genomes of animals (Bruce et al. 2006). The
cytochrome oxidase sub unit 1 (CO1) is one of the genes
present in the mitochondrial genome and is widely used for
![Page 21: International Journal of Entomology](https://reader031.vdocuments.us/reader031/viewer/2022013012/61cf590af62aa3633b6bbeb5/html5/thumbnails/21.jpg)
International Journal of Entomology Research
169
animal molecular identification. The application of a universal
CO1 gene for molecular identification of insects in North
Sulawesi has been done on Apis dorsata Binghami (Mokosuli,
2013) [14], Aedes sp. (Kaunang et al. 2015), Anopheles sp.
(Manuahe et al. 2016) [12]; (Timah and Mokosuli, 2017) [20],
and bed bugs (Kalangi et al. 2016) [9], marine gerridae
(Warouw et al. 2015) [23], frehwater gerridae (Waha et al.
2016) [22] and demselfly (Rantung et al. 2015).
Materials and Methods
Samples
Adult home fly is obtained by direct capture technique. The
location of catching house flies, done in some places in
Manado, among others, traditional markets, residential areas
and bus terminals. Flies captured, preserved in 70% ethanol.
Subsequently used as a sample for DNA analysis. Body parts
of flies used as tissue sources for DNA extraction are thorax
and legs. This research was conducted in Laboratory
Bioactivity and Biology Molecular, Department of Biology,
Manado State University. DNA sequencing using ABI PRISM
3730xl sequence Genetic Analyzer engine developed by
Applied Biosystems, USA, at First BASE Laboratories Sdn
Bhd, Singapore.
Tools and Materials
The tools used in this research were : tissue ruptor (Qiagen),
vortex V-1 plus (Biosain), orbitals shaker OS-20 (Biosain),
micropipette (eppendorf), mini personal centrifuge Tommy
Digital Biology, P-class Nanofotometer, centrifuse 5430R
(eppendorf), master cycles pro s (eppendorf), gel
documentation system fire reader UVitec, Qiaxel automatic
electrophoresis (Qiagen), sequence ABI PRISM 3730xl
Genetic Analyzer develop by Applied Biosystems, USA. The
materials used are: ethanol p.a. (merck), chloroform p.a.
(merck), Genomic DNA Mini KIT (Tissue) Geneaid, 2x
MyTaq HS Red Bioline Mix (USA), Qiaxel DNA Screening
gel kit and 2 μl tips - 100 μl Qiagen, CO1 Universal primer:
LCO1490: GGTCAACAAATCATAAAGATATTGG
HCO2198: AACTTCAGGGTGACCAAAAAATCA (Folmer
et al. 1994),
DNA extraction and purification
a. Extraction of house fly DNA
DNA extraction and purification using the Geneaid Mini KIT
(Tissue) Genomic DNA procedure. Initial stage before
entering on extraction is tissue dissociation consisting of
taking 30 mg tissue legs and thorax of house fly, then inserted
in vial eppendof 1,5 ml. In the vial, 200 μl of GT Buffer is
added. Furthermore, 20 μl Proteinase K was added. The
incubation was modified from 30 minutes to 24 hours. The
next step follows the Kit protocol. The result of DNA
extraction of house fly, then analyzed the concentration and
purity by using Implant nanophotometer. DNA purity can be
seen with an A260 / A280 ratio of between 1.8 - 2.0 nm. If
<1.8 is contaminated with protein and or protein derivate
contaminant components that affect DNA molecules, and if>
2.0 means contaminated with RNA (Protocol Kit).
b. Amplification of house fly CO1 gene, by PCR method
The PCR process used 2x MyTaq HS Red Mix Bioline (USA)
and CO1 primer is Forward LCO 1490:
5'GGTCAACAAATCATAAAGATATTGG3' and Reverse
HCO 2198: 5'TAAACTTCAGGGTGACCAAAAAATCA3'.
The PCR component and PCR conditions applied are shown
in Table 1 and Table 2.
Table 1: PCR Component
PCR Component Volume (µL)
2x MyTaq HS Red Mix Bioline 25
Primer Forward 1
Primer Reverse 1
DNA of house fly* 2
ddH2O 21
Total 50
Table 2: PCR Condition
Cycle Time (Seconds) Temperatur (°C) Phase
35 x
60 94 Denaturasi
30 50 Annealing
30 72 Ekstension
60 72 Final Ekstension
Visualization of PCR products
Amplicons of CO1 gene of house flies, produced at the PCR
stage, were visualized using automatic electrophoresis
(Qiaxel), by applying a Qiaxel DNA Screning gel (Qiagen)
kit. Visualization of PCR results was also performed using
conventional electrophoresis.
Sequences analyses and phylogeny trees reconstruction
Obtained sequences were aligned using MEGA 6.0 and
Geneous 6.0 software. Sequences were subjected to Basic
Local Alignment Search Tool (BLAST) in order to perform
sequence similarity searches (www.ncbi.nih.gov.com).
Nucleotide frequencies were calculated using MEGA 6.0
software (Tamura et. al. 2013) [19]. The genetic distances
(number of nucleotide substitutions per site) among sequences
were calculated using the Maximum Composite Likelihood
model in Geneous 6.0 software. Phylogenetic trees were
reconstructed using two different reconstruction methods: (1)
neighbor joining (NJ) and (2) Minimum Evolution (ME). The
NJ tree was reconstructed using the Maximum Composite
Likelihood method. Phylogenetic analyses were conducted in
MEGA 6.0 software. Bootstrap support values were obtained
by 1,000 replications using both methods (Tamura et. al.
2013) [19].
Results and Discussion
DNA extraction of house flies (Musca sp.) from Manado
city
The highest DNA purity of nine house flies samples was 1,75
(sample IKP). While the lowest DNA purity was 1,55 (IKT
Samples). In the other hand, the highest DNA concentration
was 53.2 µg/ml (IMT sample) while the lowest total DNA
concentration was 40.25 µg/ml (IBP sample). DNA purity is
not linear, with the DNA concentration of house flies obtained
(Figure 1).
![Page 22: International Journal of Entomology](https://reader031.vdocuments.us/reader031/viewer/2022013012/61cf590af62aa3633b6bbeb5/html5/thumbnails/22.jpg)
International Journal of Entomology Research
170
Fig 1: Concentration and Purity dsDNA of house fly from Manado City
Based on the concentration and purity of the extracted DNA, it
showed that the Genomic DNA Mini KIT (Tissue) Geneaid,
which is used to extract house fly DNA, has effective in
extracting total DNA from legs and thorax flies. The difficulty
in extracting insect DNA, compared with other animal
samples is the number of complex biomolecule contaminants
from the exoskeleton. Common contaminants found in insect
DNA extraction are chitin, complex proteins and peptides
from exoskeleton. This contaminant may decrease the
effectiveness of buffers and proteinase enzymes in the kit
(Timah and Mokosuli, 2017; Manuahe et al. 2015; Mokosuli,
2013) [20, 14]. In this research, modification of protocol kit is
done by the destruction of thorax and legs, using tissue ruptor
and tissue immersion time with protenase K according to
protocol kit, 30 minute has modified to 24 hours. This
modification proved to increase the concentration and purity
of the house fly DNA extraction results. The total DNA
concentration distribution based on the Kit protocol used was
30 μg / ml up to 70 μg / ml. Thus the total DNA concentration
obtained in this study is quite good. While total DNA purity is
at the distribution of 1,7 - 2,0 (A260 / A280). Total DNA
purity of the results of this study is still quite good. However,
the mitochondrial DNA content present in extracted DNA is
known after amplification of the target gene, using a universal
CO 1 primer.
PCR and Visualization of Amplikon Gen CO1 Home Flies
(Musca sp.) From Manado
Extracted DNA, amplified by PCR method. Of the 4 stages of
PCR, the annealing is the most important stage, so
temperature and time modification greatly affect the
optimization of CO1 gene amplification. In this study,
modified annealing temperatures are proven to produce
amplicons as targeted. Visualization of amplicons content of
CO1 gene is done by electrophoresis technique.
Electrophoresis condition was 0.8% agarose gel, the number
of ladder DNA that is applied to each well 0.2 μg with the
volume of samples per well 1 μl. The band on the electrogram
shows the amplicon content of the flies CO1 gene successfully
amplified by the PCR method. The PCR results show that
sample amplicons are 6. (IKP), 7. (IKT), 8. (IKS), 9. (IMT),
10. (IPB). was formed optimally while sample 3. (IBS), 4.
(IBP), the band is very thin (Figure 2).
Fig 2: Visualization of CO1 gene amplicons, house flies from
Manado City. Description :1. (control) 2. (IBT), 3. (IBS), 4. (IBP), 5.
(IMS), 6. (IKP), 7.(IKT), 8. (IKS), 9. (IMT), 10. (IPB).
Sequensing
Output sequencing from First BASE Singapore, read with
Geneous 10.1. and MEGA 6.0. Based on the chromatogram of
sequenced results, the sequencing showed well. This is
evidenced by chromatogram bands representing different
types of nucleotides perfectly or not coincident (Appendix 1.).
After the contig analysis, the length of the CO1 gene sequence
of flies from Manado was between 558bp - 691 bp and HQ
(68.5% - 92.8%). Characteristics of the CO1 fly gene
sequence from Manado were then shown in Table 2. The
sequence of CO1 gene lies at length 600 - 700 bp (Herbert,
2003). Thus, the nine sequences of the fly fly CO1 gene from
Manado were on the long-range CO1 gene, according to the
characteristics of the CO1 gene as molecular barcodes for
animal identification.
![Page 23: International Journal of Entomology](https://reader031.vdocuments.us/reader031/viewer/2022013012/61cf590af62aa3633b6bbeb5/html5/thumbnails/23.jpg)
International Journal of Entomology Research
171
Table 2: Characteristics of CO1 gene house fly sequences, from Manado City
No Sample Lenght of Sequens (bp) MW dsDNA (kDa) HQ (%) Nucleotide Composition
A C G T % GC
1 IBP 682 421,29 92,7 259 (38%) 111(16,3%) 108 (15,8%) 204(29,9%) 219(32,1%)
2 IBS 558 344,69 68,5 160(28,7%) 82(14,7%) 90(16,1%) 214(38,4%) 171(31,5%)
3 IBT 695 429,32 84,3 195(28,1%) 109(15,7%) 117(16,8%) 274(39,4%) 226(32,5%)
4 IKP 691 426,85 92,8 204(29,5%) 113(16,4%) 114(16,5%) 260(37,6%) 227(32,9%)
5 IKT 694 428,71 91,2 201(29,0%0 110(15,9%) 119(17,1%) 264(38,0%) 229(33,0%)
6 IKS 690 426,23 92,8 200(29,9%) 108(15,7%) 112(16,2%0 270(39,1%) 220(31,9%)
7 IMS 686 423,76 92,3 201(29,3%) 109(15,9%) 111(16,2%) 265(38,6%) 220(32,1%)
8 IMT 683 421,91 93,1 258(37,8%) 111(16,3%) 108(15,8%) 207(30,2%) 219(32,1%)
9 IPB 682 421,28 92,7 259(38%0 111(16,3%) 109(15,0%) 203(29,8%) 220(32,2%)
Alignment analysis with the NCBI BLAST Method
(https://blast.ncbi.nlm.nih.gov/Blast.cgi)
The consensus area of the house fly CO1 gene sequence from
Manado City, each used for alignment analysis with the
BLAST method on the NCBI website. The BLAST results
indicate that nine CO1 gene sequences of flies in Manado City
have the highest percentage of similarities with the three
Musca domestica CO1 gene sequences that have been
recorded in the gene bank NCBI. The sequence of CO1 gene
IBP, IBS, IBT, IKT, IMT and IPB have the highest similarity
level with Musca domestica cytochrome oxidase subunit I
(COI) gene [MG557665.1], while the CO1 IKP gene sequence
has the highest similarity level with Musca domestica
ISOLATE CSU 140601CBJI A $ cytochrome oxidase subunit
I (COI) gene [KY001857.1] (table 3). The nucleotide
difference between flies from nine sites in Manado is shown
in Table 4. The nucleotide difference is indicated by the dot,
on the output of the alignment analysis.
Table 3: Similarity level of house fly in Manado City, based on alignment analysis on NCBI website
No Samp
les
Percentage
Similarity Similarity Species
Assesion
Number Author and Country Origins
1 IBP 99%
Musca domestica
cytochrome oxidase subunit
I (COI) gene
MG557665.1
Aslam,A.F.M., Rain,F.F. and Howlader,A.J.
Submitted (22-NOV-2017) Zoology, DNA Barcoding Laboratory,
Department of Zoology, Jahangirnagar University, Dhaka, Savar 1342,
Bangladesh
2 IBS 99%
Musca domestica
cytochrome oxidase subunit
I (COI) gene
MG557665.1
Aslam,A.F.M., Rain,F.F. and Howlader,A.J.
Submitted (22-NOV-2017) Zoology, DNA Barcoding Laboratory,
Department of Zoology, Jahangirnagar University, Dhaka, Savar 1342,
Banglades
3 IBT 99%
Musca domestica
cytochrome oxidase subunit
I (COI) gene
MG557665.1
Aslam,A.F.M., Rain,F.F. and Howlader,A.J.
Submitted (22-NOV-2017) Zoology, DNA Barcoding Laboratory,
Department of Zoology, Jahangirnagar University, Dhaka, Savar 1342,
Bangladesh
4 IKP 99%
Musca domestica
cytochrome oxidase subunit
I (COI) gene
MG557665.1
Alkhedir,H., Mashaly,A.M.A. and Karlovsky,P.
Submitted (22-JAN-2016) Agricultural Entomology and Molecular
Phytopathology and Mycotoxin Research, Georg-August-University
Goettingen,Grisebachstrasse 6, Goettingen 37077, Germany
5 IKT 99%
Musca domestica
cytochrome oxidase subunit
I (COI) gene
MG557665.1
Alkhedir,H., Mashaly,A.M.A. and Karlovsky,P.
Submitted (22-JAN-2016) Agricultural Entomology and Molecular
Phytopathology and Mycotoxin Research, Georg-August-University
Goettingen,Grisebachstrasse 6, Goettingen 37077, Germany
6 IKS 99%
Musca domestica ISOLATE
CSU 140601CBJI A$
cytochrome oxidase subunit
I (COI) gene
KY001857.1
Guo,Y.-D., Cai,J.-F. and Ren,L.-P.
Submitted (17-OCT-2016) Department of Forensic Medicine, Central South
University, Tongzipo Road No. 172, Changsha, Hunan 410013, China
7 IMS 99%
Musca domestica
cytochrome oxidase subunit
I (COI) gene
MG557665.1
Aslam,A.F.M., Rain,F.F. and Howlader,A.J.
Submitted (22-NOV-2017) Zoology, DNA Barcoding Laboratory,
Department of Zoology, Jahangirnagar University, Dhaka, Savar 1342,
Bangladesh
8 IMT 99%
Musca domestica
cytochrome oxidase subunit
I (COI) gene
MG557665.1
Aslam,A.F.M., Rain,F.F. and Howlader,A.J.
Submitted (22-NOV-2017) Zoology, DNA Barcoding Laboratory,
Department of Zoology, Jahangirnagar University, Dhaka, Savar 1342,
Bangladesh
9 IPB 99%
Musca domestica
cytochrome oxidase subunit
I (COI) gene
MG557665.1
Submitted (22-NOV-2017) Zoology, DNA Barcoding Laboratory,
Department of Zoology, Jahangirnagar University, Dhaka, Savar 1342,
Bangladesh
![Page 24: International Journal of Entomology](https://reader031.vdocuments.us/reader031/viewer/2022013012/61cf590af62aa3633b6bbeb5/html5/thumbnails/24.jpg)
International Journal of Entomology Research
172
Table 4: Analysis of alignment, the CO1 gene of house flies in Manado
Table 5: Genetic distance of house flies from Manado and similarity sequence of BLAST result on NCBI webs
Description
1. (IBT), 2. (IBS), 3. (IBP), 4. (IMS), 5. (IKP), 6.(IKT), 7.
(IKS), 8. (IMT), 9. (IPB), 10. Musca domestica
[KY001857.1], 11 Musca domestica [KY001856.1], 12.
Musca domestica [KY001855.1], 13. Musca domestica
[KY001854.1], 14. Musca domestica [KT272839.1], 15.
Musca domestica [KT272838.1], 16. Musca domestica
[KT272837.1], 17. Musca domestica [KT272836.1], 18.
Musca domestica [KT272834.1], 19. Musca domestica
[KT272833.1], 20. Musca domestica [KT272831.1], 21.
Musca domestica [KT272830.1], 22. Musca domestica
[KT272829.1], 23. Musca domestica [KR921687.1], 24.
Musca domestica [KT444442.1], 25. Musca domestica
[KP713680.1], 26. Musca domestica [KJ496775.1], 27. Musca
domestica [JX861432.1], 28. Musca domestica [JX861431.1],
29. Musca domestica [KF562113.1],
Subtitution Matrix
The analysis of the substitution matrix, nine gene sequences of
house flyflies from Manado with BLAST sequenced
![Page 25: International Journal of Entomology](https://reader031.vdocuments.us/reader031/viewer/2022013012/61cf590af62aa3633b6bbeb5/html5/thumbnails/25.jpg)
International Journal of Entomology Research
173
sequences, was performed using the MEGA 6.0 program,
using the Maximum Likelihood model. Adenine nucleotide
frequency (32.8%), Timin (38.30%), Cytosin (14.24% and
Guanin (14.58%)) The average transition substitution was
printed with bold numbers while the average transversion
substitution was printed with italics in table 4.
Table 6: Substitution matrix with maximum likelihood model
A T/U C G
A - 11.72 4.36 3.63
T/U 10.07 - 7.31 4.46
C 10.07 19.67 - 4.46
G 8.18 11.72 4.36 -
Discussion
Modified Genomic DNA Mini KIT (Tissue) Geneaid, can
optimize the concentration and purity DNA of house flies.
Insect DNA extraction has its own difficultie, compared with
mammals (Mege and Mokosuli, 2017) [13]. This is caused,
among others, by exoskeleton in adult insects. The exosketon
is often mixed in the tissue to be extracted because the insect
tissue is in the exoskeleton. This affects the purity and
concentration of targeted DNA. Because this study uses genes
present in mitochondrial DNA, mitochondrial DNA must be
extracted and purified optimally, in order to become templete
in the process of CO1 gene amplification. On the other hand,
the use of thoracic and legs, in which there were many muscle
tissues, has successfully isolated mitochondrial DNA on
insects optimally. Extraction and purification of insect DNA
using legs and thorax have been performed on Aedes sp.
(Timah and Mokosuli, 2017; Anopheles sp. (Manuahe et al.
2016) [12], Droshophila sp. (Sumampouw and Mokosuli, 2017) [17] and bed bugs (Kalangi et. 2017) [9], Apis dorsata Binghami
(Mokosuli et al. 2013). Thus thorax and legs were best used
for the isolation of mitochondrial DNA in insects.
The results of the alignment analysis with the BLAST method
on the NCBI site showed that house fly in Manado City had
the closest similarity, with 3 species of house fly in three
different countries (Table 3). This reinforces, that the variation
intraspecies, house fly in Manado City is high. Alignment
between the CO1 gene sequence of flies in Manado City, has
found many polymorphic sites or sites where nucleotide
differences occur (Table 4). Furthermore, genetic distance
analysis also showed differences in genetic distance between
house flies from nine sites in Manado City had more than one
(Table 5). This showed the proportion of nucleotides of the
CO1 gene, the nine house flies in Manado City have shown
high genetic variation. Previous morphological analysis has
also found morphological variations, especially in the thorax,
legs and body length. Although morphology in general still
shows the characteristics of house fly (Figure 3). Variations of
CO1 gene, commonly found in insects. Aedes sp. in North
Sulawesi, which lives in different habitat characteristics, has
shown a high variation of CO1 gene (Timah and Mokosuli,
2016) [12].
Fig 3: House fly from different habitat in Manado City
The reconstruction of phylogeny trees was carried out using
two models. Neither Neighbor Joining nor Minimum
Evolution models was showed the same phylogenetic tree
topography. The phylogeny tree was built with 500x bootsrap.
The phylogeny tree was built, consisting of 2 monophyletic
clades. IBS, IBP and ITS were on the first monophyletic
clade, however IBT, IKP, IKS, IMT, IPB and IKT were in
other monophyletic clades. Thus the species of house fly in
Manado City has varied based on the evolutionary
relationship.
![Page 26: International Journal of Entomology](https://reader031.vdocuments.us/reader031/viewer/2022013012/61cf590af62aa3633b6bbeb5/html5/thumbnails/26.jpg)
International Journal of Entomology Research
174
Fig 4: Reconstruction of the house fly phylogeny tree in Manado, Neighbor Joining model (Bootsrap 500x).
Fig 5: Reconstruction of the house fly phylogeny tree in Manado, Minimum Evolution model (Bootsrap 500x).
![Page 27: International Journal of Entomology](https://reader031.vdocuments.us/reader031/viewer/2022013012/61cf590af62aa3633b6bbeb5/html5/thumbnails/27.jpg)
International Journal of Entomology Research
175
Reconstruction of phylogeny trees based on partial gene CO1,
house fly from Manado obtained two monophyletic clade. The
first clade consists of IKT, IPB, IMS (one node) and IBT, IBS
(one node). While the second clade consists of IPB and IMT
(one node). IKP and IKS form their own nodes. From the
phylogenetic tree formed on the CO1 gene, it was found that
the genetic variation of flies in manado based on the CO1
gene was high. Based on the phylogeny tree formed, then
house fly IKP and IKS,the oldest by evolution (Figure 6).
Fig 6A
Fig 6B
Fig 6: Reconstruction of phylogeny trees, house flies in Manado
originating from nine locations. (a). Model Neighbor Joining
(Bootsrap 500x). (b). Model Minimum Evolution (Bootsrap 500x).
Conclusion
The sequence of CO1 gene IBP, IBS, IBT, IKT, IMT and IPB
have the highest similarity level with Musca domestica
cytochrome oxidase subunit I (COI) gene [MG557665.1],
while the CO1 gene of IKP and IKT has the highest similarity
level with Musca domestica ISOLATE CSU 140601CBJI A $
cytochrome oxidase subunit I (COI) gene [KY001857.1]. CO1
of IKS showed similarity with Musca domestica ISOLATE
CSU 140601CBJI A$ cytochrome oxidase subunit I (COI)
gene. Genetic variation intraspecies, house fly in Manado city
based on CO1 gene, was high.
References
1. Alberts B, Johnson A, Lewis J, Raff M, Roberts K,
Walter P. Molecular Biology of the Cell, 4th edition. New
York: Garland Science, 2005.
2. BPS [Badan Pusat Statistik], Provinsi Sulawesi Utara,
Indonesia. https://sulut.bps.go.id/
3. Boonchu NS. Piangjai KL, Sukontason K. Sukontason,
Comparison of the effectiveness of baits used in traps for
adult fly collection, Southeast Asian J Trop. Med. Public
Health. 2003; 34(3).
4. Clary DO, Wolstenholme DR. The mitochondrial DNA
molecule of Drosophila yakuba: Nucleotide sequence,
gene organization, and genetic code. J Mol. Evol. 1985;
22:252-271.
5. Friedrich M, Tautz D. Evolution and phylogeny of the
Diptera: A molecular phyogenetic analysis using 28S
rDNA sequence. Syst. Biol. 1997; 46:674-698.
6. Hebert PDN, Ratnasingham S, deWaard JR. Barcoding
anmal life: cytochrome c oxidase subunit I divergences
among closely related species. Proc. R. Soc. Lond. B
(suppl.). 2003; 270:s96-s99.
7. Iwasa M, dan Ishiguro N. Genetic and morphological
differences of Haematobia irritans and H. exigua, and
molecular phylogeny of Japanese Stomoxyini flies
(Diptera, Muscidae). Med. Entomol. Zool. 2010; 61:335-
344.
8. Kassiri H, Akbarzadeh K, Ghaderi A. Isolation of
Pathogenic Bacteria on the House Fly, Musca domestica
L. (Diptera: Muscidae), Body Surface in Ahwaz
Hospitals, Southwestern Iran. Asian Pacific Journal of
Tropical Biomedicine. 2012; S1116-S1119.
www.elsevier.com/locate/apjtb
9. Kalangi G, Tulung M, Salaki M, Mandey L.
Morphological characteristics of bedbugs (Cimex sp.)
from Manado and Sitaro north Sulawesi, Indonesia.
International Journal of Entomology Research. 2017;
2(2):70-75.
10. Lessinger AC, Junquiera MCA, Lemos TA, Kemper EL,
Da Silva FR, Vettore AL. The mitochondrial genome of
the primary screwworm fly Cochliomyia hominivorax
(Diptera: Calliporidae). Ins. Mol. Biol. 2000; 9:521-529.
11. Michel Veuille e, Ge´ rard Duvallet a. Phylogenetic
analyses of mitochondrial and nuclear data in
haematophagous flies support the paraphyly of the genus
Stomoxys (Diptera: Muscidae). Infection, Genetics and
Evolution. 2011; 11:663-670.
12. Manuahe C, Mokosuli YS, Roring VIY. Optimization of
DNA extraction and the position of mosquito Species
from southeast minahasa in North sulawesi using NADH
dehydrogenase Gene and Cytochrome oxidase Sub Unit 1
Gene. Journal of Entomology and Zoology Studies. 2016;
4(4):498-508.
13. Mege RA, Mokosuli YS. NA Barcoding of local pigs in
minahasa, north sulawesi. International Journal of Fauna
and Biological Studies. 2017; 4(5):82-87.
14. Mokosuli YS. Karakter Morfologi, Sumber Pakan, Dan
Bioaktivitas Farmakologis Racun Lebah Madu Endemik
Sulawesi Apis dorsata Binghami DAN Apis nigrocincta
Smith (Hymenoptera: Apidae). (Disertasi). Program
Pascasarjana Universitas Sam Ratulangi, Manado, 2013.
15. Nelson DL, Cox MM. Lehninger Principles of
Biochemistry 4th edition. W.H. Freeman and
Company. New York. 2005.
![Page 28: International Journal of Entomology](https://reader031.vdocuments.us/reader031/viewer/2022013012/61cf590af62aa3633b6bbeb5/html5/thumbnails/28.jpg)
International Journal of Entomology Research
176
16. Preativatanyou K, Sirisup N, Payungporn S, Poovorawan
Y, Thavara U, Tawatsin A. Mitochondrial DNA-based
identification of some forensically important blowflies in
Thailand. Forensic Science International. 2010; 202:97-
101.
17. Sumampouw HM, Mokosuli YS, Oka DN. Analysis of
cythochrome oxidase sub unit 1 Gene (CO1) of fruit fly
(Droshophila sp.) from pineapples and aplication in
teaching DNA in Senior high school. International
Journal of Advanced Education and Research. 2014-
2017; 2(2):71-77. www.alleducationjournal.com
18. Sukontason KLP, Narongchai D, Sripakdee N, Boonchu
T, Chaiwong R, Ngern-Klun S, et al., First report of
human myiasis caused by Chrysomya megacephala and
Chrysomya rufifacies (Diptera: Calliphoridae) in
Thailand, and its implication in forensic entomology, J.
Med. Entomol. 2005; 42:702-704.
19. Tamura K, Dudley J, Nei M, Kumar S. Molecular
evolutionary genetic analysis (MEGA) Software version
4. Mol. Biol. E. 2007; 24:1596-1599.
20. Timah S, Mokosuli YS. Morphometry and Phylogeny
reconstruction Aedes sp. based DNA Mitochondrial
cytochrome oxidase gene sub unit 1 (CO1) in North
Sulawesi. International Journal of Mosquito Research.
2017; 4(3): 98-106.
21. Vossbrinck CR, Friedman S. A 28s ribosomal RNA
phylogeny of certain cyclorrhaphous Diptera based upon
a hypervariable region. Syst. Entomol. 1989;14:417-431.
22. Waha D, Tullung M, Berhimpon S and Mantiri F.
Phylogeny reconstruction of Gerridae from River
Ratatotok and River Talawaan North Sulawesi Based on
Mitochondrial DNA 16 S RNA Gene. International
Journal of Fauna and Biological Studies 2017; 4(2):81-87.
23. Warouw V, Salaki C, Mangindaan REP, Tulung M,
Maramis RTD, Mokosuli YS. Isolation and
Characterization of Partial Mitochondrial CO1 Gene from
Marine Insect Gerridae, Stenobates biroi from Mokupa
Beach Manado, North Sulawesi Indonesia. Journal of
Biology, Agriculture and Healthcare. ISSN (Paper) ISSN
2225-093X (Online). 2016; 6(6):41-472224-3208.