intercom spring 2013

Division 7 Tampa Bay, District 7 Division 7 Tampa Bay, District 7 United States Coast Guard AuxiliaryUnited States Coast Guard AuxiliaryVolume XXXVI Issue 1 Spring 2013Volume XXXVI Issue 1 Spring 2013

Division 7 Elected Officers 2013

Div 7 Division Commander J. Michael Shea, DCDRDiv 7 Division Vice Commander James Newman, VCDRDiv 7 Immed. Past Division Commander Amos Johnson, IPDCDR

FL-72 Flotilla Commander Gene Keller, FC Flotilla Vice Commander Bryan Cook, VFCFL-74 Flotilla Commander Jeffery Gines, FC Flotilla Vice Commander Leonard Chiacchia, Jr. VFCFL-75 Flotilla Commander Oscar Kramer, FC Flotilla Vice Commander Ray Stewart, VFCFL-78 Flotilla Commander Jim Armstrong, FC Flotilla Vice Commander Karen Cohen, VFCFL-79 Flotilla Commander Paul Cooke, FC Flotilla Vice Commander Linda Churchill, VFCFL-7-16 Flotilla Commander Donald Hershman, FC Flotilla Vice Commander Kelleigh Weeks, VFC

Division 7 Appointed Staff 2013

Communications Gene Keller, SO-CMCommunication Systems Robin Conn, SO-CS CS Assistant Terry HickoxFinance Oscar Kramer, SO-FNInformation Systems Theresa Johnson, SO-ISHuman Resources Marla Short, SO-HRMaterials Ronald G. Matz, SO-MAMarine Safety Robert Starns, SO-MSMember Training David Langdon, SO-MTNavigation Systems Marvin Bayles, SO-NSOperations Clifford J. Martin, SO-OP OP Assistant Conrad Palermo, ASO-OPPublic Affairs Timothy Teahan, SO-PAPublications Dorothy J. Riley, SO-PB PB Assistant George Papabeis, ASO-PBPublic Education Steven B. Plass, SO-PEProgram Visitor Donald Rimel, SO-PVSecretary Judith Clapp, SO-SRVessel Examinations David Perillo, SO-VE VE Assistant Glenn Dobos, ASO-VEDivision Liaison Richard ShortFellowship Open

We’re on the web!http://A07007.wow.uscgaux.

info

The Intercom is a publication of the United States Coast Guard Auxiliary, Division Seven, District Seven. The cost of publication is provided by dues-paying members of the Auxiliary, an organization of unpaid, civilian volunteers whose mission is to assist the U.S. Coast Guard in promoting boating safety. Articles may be reprinted only with the express consent of the author or photographer, with proper credit given to same. For permissions or for more information, please con-tact the editor, Dorothy Joan Riley,

SO-PB, Email address: [email protected]

You can contact any of our officers on the Division 7 web

page!

INTERCOMNewsletter for Division 7 Tampa Bay, District 7, USCG Auxiliary

Volume XXXVI Issue 1 Spring 2013

Cover photo: The José Gasparilla with its pirate krewe prepares to dock at the Tampa Convention Center and invade the city on Jan. 26, 2013. The mayor will then sur-render the keys to the city at this annual event, after which the pi-rates march triumphantly through the city. Photo by D. Riley

Volume XXXVI Issue 1 Winter 2013

Division Seven has been busy for the past few months and that pace will continue into the near fu-ture. Below are some ef-forts which are underway:

Liaison Program: This program with Station St Petersburg is working well; we are now helping them more on a day-to-day basis and they are doing the same for us. The Auxiliary should continue to support Coast Guard stations but ensure that all activities are conducted effi ciently due to fuel con-straints. With that in mind, never compromise safety!

Crew Training: Twenty-three trainees are in our boat crew training program currently underway at Flotilla 79, one of the largest classes in recent years. I am de-lighted to see the strong interest in the training and real-ize that it will take a lot of coordination over the next few months, as many other activities will take place during the training.

Say So Long to POMS: The POMS program is on the way out and a new National Coast Guard in-house sys-tem, called Auxiliary Operations Management (AOM), will replace it. Ensign Shawn Antonelli of Sector St. Petersburg will be involved in initiating the program for Division Seven. The new web-based, user-friendly program is already in use in several other districts and will roll out here in mid-April. ENS Antonelli said “As long as there is transparency between the Auxiliary and the station, Auxiliarists will be able to activate orders.” One new requirement is when submitting a Form 5132; a picture of the fuel receipt must be included. This could present a challenge for coxswains who conduct several patrols using fuel from a single receipt, but a new procedure will allow coxswains to account for fuel used on subsequent patrols. A PowerPoint presentation demonstrating how to use AOM will be available soon for review. Active duty personnel will submit complet-ed 5132s to the Finance Center and Auxiliarists will no longer have to submit on their own.

Standard Operating Procedures: We are in the pro-cess of updating the Division’s Standard Operating Procedures (SOP). ENS Antonelli recently provided Division Commanders with a draft copy of the ‘Sector

Dbm

t

From the HelmJ. Michael Shea, Division Commander

St. Petersburg Auxiliary Instruction Straw Manual,’ an outline of sorts for the SOPs. It follows national and district instruction manuals but goes into more detail for Sector commanders and is a living document, open to suggestions and changes. Each division may still uti-lize its own SOP.

Auxiliary Skills Bank: Due to budget cuts, the Coast Guard plans to more fully utilize the Auxiliary’s Skills Bank to fi nd qualifi ed Auxiliarists to help augment CG missions. Division members are urged to complete or update their skills bank data before March 31. This can be accomplished on-line through AUX OFFICER.

Budget Issues: The Division is operating now on 50% of last year’s budget and our current operations tempo is down compared to last year because of budget cuts. We have been requested to maintain effi ciency on pa-trols by using smaller facilities and saving larger facili-ties for SARs, night operations and special events. At present, only training missions are authorized.

Sequestration: It is entirely possible that questions may be posed to Division Seven members during boat-ing safety classes, patrols, at trade shows or in other situations about how the Coast Guard and the Auxiliary are managing sequestration issues. Sector St. Peters-burg is relying on its active duty personnel, reservists, civilian employees and Auxiliarists to ensure that the Coast Guard message to the public is consistent, posi-tive and clear.

If asked, the best response is a positive one, such as: “essential Coast Guard missions are continuing – it is business as usual.” Please do not speculate (including offering an opinion, a feeling or an idea) about the is-sue. Another response might be: “We are proud to serve the citizens of Florida’s west coast and all normal op-erations are continuing.”

Focused Lens: LCDR Gino Sciortino of Sector’s Re-sponse Department has introduced a survey, called Fo-cused Lens, to help evaluate potential risk areas and risk management issues. Collected information will go into a database, called MSRAM, for evaluation. I have appointed Conrad Palermo as the Division Seven point of contact to coordinate with the Sector. This is a fea-

Continued on page 4

Intercom USCG Auxiliary Division 7, District 7

ture we will be adding to our patrol missions. Look for a Focused Lens Handbook very soon.

Offer for Use Form: If you own an Auxiliary facility, but are not a coxswain and cannot be aboard your vessel for a patrol, you must specify on the form the name of the coxswain who can operate your boat; otherwise the ‘Offer for Use’ will be rejected. An updated instruction booklet will be available soon. .

Emergency Operations Coordinators Meeting: To prepare for the 2013 hurricane season, an emergency operations coordinators meeting and exercise drills are in the planning stages. The watchword for these exercises is: accountability. Sector St .Pete needs to know where its people are, including Auxiliarists, be-fore and after storms and includes all people in Auxil-iary member households, including visitors, etc. These drills take place every May and include activation of our ‘telephone tree’ to contact every member in every fl otilla to and determine their whereabouts. It is there-fore very important to advise your Flotilla Commander of any travel plans you have over the summer months.

Division Strategic Plan: We are working with Braxton Ezell, District Captain-West, to develop the Division Seven Strategic Plan, a major undertaking. The Dis-trict’s Strategic Plan serves as a guide for each division

plan and is a way of measuring attainment of our goals using the district ‘dashboard.’ Accurately and regularly uploading operations and member training hours into AUXDATA on a timely basis, is critical. We will hold a leadership-training program in the next few months to train our Flotilla offi cers how to track data within each fl otilla and division.

Awards Luncheon: The Division Awards Luncheon is set for Saturday, April 13 at the Rusty Pelican Res-taurant, on Courtney Campbell Causeway, beginning at 11:30 AM. Many Division members will be recognized for their efforts throughout 2012; in addition, annual trophies recognizing the overall efforts of our fl otillas in a variety of categories will be presented. This event is the highlight of the Division year and I am hopeful that all members will be able to attend. Please keep submitting awards throughout the year.

Finally, I want to thank all who participated during the Gasparilla Pirate Invasion and for the recent Coast Guard Open House, especially Rick Short and David Perillo.

J. Michael Shea, Division CommanderDivision 7, District 7USCG Auxiliary

Continued from page 3

The 2013 Gasparilla Pirate Invasion 5-7Flotilla 72 8Build a Better First Aid Kit 9Flotilla 74 10-11Flotilla 75 12Water Safety is Elementary 13Flotilla 78 14-15Flotilla 79 16-17In Memoriam: Passing of COMMO Donald Frasch 17Flotilla 7-16 18Auxiliary Assists With CLEAR Training 19Annual Frogman Swim 20-21Staff Reports and Program Updates 22-25Telecommunications Operator Training 26-27Sector St. Petersburg Open House 28-29Take Out That Smartphone! 30Big Bend Power Station’s Manatee Viewing Center 31-33Parting Shots (more member photos) 34

In this Issue....


The 2013 Gasparilla Pirate Invasion --One of the Safest Ever -- Again! By Tim Teahan, SO-PA

The annual Gasparilla Pirate Invasion, Tampa’s version of New Orleans’ Mardi Gras, went off again smoothly again this year, thanks to the par-

ticipation of 25 Auxiliary facilities and 85 coxswains, boat crew, trainees and radio watchstanders from three Auxiliary divisions: Seven, Eight and Eleven. The Auxiliary’s involvement in the January 26, 2013 event bested its 2012 efforts by a few facilities and crewmem-bers, making it the largest Division Seven mission in the 50-plus years the Auxiliary has participated in the Gasparilla event.

Auxiliary vessels monitored security zones in the Port of Tampa, mostly along Seddon and Sparkman chan-nels, providing a security deterrent and safety presence in several key locations along the parade route. In addi-tion, Auxiliary facilities served as manatee watch boats, coordinated by the Hillsborough County Environmen-tal Protection Commission (EPC) representatives from Ash Engineering. This year, winds and water tem-peratures combined to create optimum conditions for manatee movement from one of their favorite habitats,

the eastern end of the Port Sutton Channel in the Port of Tampa. Auxiliary vessels with manatee watchers aboard, including Love @ 1st Sight, the manatee watch ‘mother’ boat, smaller Auxiliary vessels in addition to an EPC boat and a helicopter from News Channel Eight and all combined to keep a constant eye on the mana-tees and to control traffi c. Kathi Kruczek, coxswain aboard Water Won Two, ably coordinated Auxiliary boat movements for the manatee watch effort. Fortu-nately, manatee movement towards the parade route ap-peared to be minimal, and the Gasparilla event was not appreciably delayed.

In a departure from previous years, Auxiliary ves-sel movement during the event was coordinated from aboard the Tampa Fire Rescue fi reboat Patriot, together with the Coast Guard Patrol Commander and law en-forcement representatives and medical fi rst responders. The concept was for the Auxiliary to be right next to these individuals so to be able to more effectively com-municate any observed safety, security or medical emer-gencies reported from Auxiliary vessels to the agency assets closet to the incident/situation. Dave Perillo, FL 72, Assistant Division Operations Offi cer, was aboard the Patriot and served as Auxiliary (AUXCOM) Com-

Continued on page 6

TAMPA BAY, FLA - The Luv @1st Site maintains po-sition during the 2013 Gar-parilla Pirate Invasion. The Luv @ 1st Site, owned and coxswained by Gene Keller from Flotilla 72, was the designated mother boat for “Opertion Manatee Con-trol.” The U.S. Coast Guard Auxiliary provided vessels to protect Manatees from harm during the festivities. Photo by George Papabeis.

Intercom USCG Auxiliary Division 7, District 7Page 6 Intercom USCG Auxiliara y y Divisionn 77, , DDisistrtricict t 7

munications Control during the parade, man-aging movement of Auxiliary assets.

As has been the case for years, Flotilla 79’s Tampa Radio One radio station provided the guard for the 25 Auxiliary facilities entering Tampa Bay and during their transit to assigned positions along the parade route and after re-lease from duty stations. Watchstanders John Sanchez, FL 74, Len Chicaccia FL 74 and Linda Barnard, FL 72 opened the watch at 6 a.m. and stayed on the air until 3:30 p.m., pro-viding the radio guard for Auxiliary vessels en route to Tampa Bay from points north and south as well as during their voyages home after the parade. The communications com-ponent of the mission ran smoothly despite the very heavy traffi c, including routine and operational reports, parade progress updates and related traffi c between Tampa Radio One, AUXCOM Control, the Coast Guard Patrol Commander, the 25 Auxiliary facilities, Eagle Eight and law enforcement and Coast Guard boats.

For the 2013 event, the Coast Guard and pa-rade organizers continued the practice begun in 2011 to establish wider ‘No Wake Zones’ in and around the parade route to better control participating vessel speeds. The effort was again successful, due in large part to highly-visible “No Wake Zone” and “Slow Down” signboards created by Robin Conn, FL 79 and utilized by crewmembers aboard Auxiliary vessels.

Auxiliary Division Seven’s efforts in plan-ning and coordinating its involvement in the 2013 Gasparilla event and the dedication and time involvement of Auxiliary coxswains, crewmembers, radio watchstanders and op-erations offi cers from and its fl otillas and oth-er divisions who participated were specially recognized by Capt. Sheryl Dickinson, Sector St. Petersburg Commander in a note to Divi-sion Commander Mike Shea following the event.


ma

ATgTpl

Lave

aptoaACEb

Friapav

uv

An2tceer

e

u

Volume XXXVI Issue 1 Winter 2013 Volume XXXVI Issue 1 Winter 2013 Pagagee 7

Captions page 6:

Top of page: TAMPA BAY, Fla.- Coxswain Joe Lamb, FL 79, with a dab of sunscreen on his nose, maintains a a sharp lookout from the deck of the Catalina during the 2013 Gasparilla Pirate Invasion. The aft watch is maintained by Roger Sneden FL 74. Photo by George Papabeis.

Mid-page: Linda Churchill, crewmember aboard the C Lover, with Larry Neu, cox-swain, and Paul Cooke, crewmember, all from FL 79. Photo by Paul Cooke

Lower photo: A “special edition” buoy marks the route of the 2013 Gasparilla Pirate Invasion. The photo was taken from the deck of the Catalina, with Joe Lamb, coxswain and Roger Sneden and George Papabeis, crew. Photo by George Papabeis.

Captions this page: Brian Garry, crew aboard the Lucky Dog takes a break. Photo by Richard Rioles

Mid-page right: The Jose Gasparilla prepares to enter the turning basin before the pirate’s fi nal “assault” on the city. Photo by D. Riley

Below: The Lynx, a private sailing ship dedicated to maritime and historical edu-cation, came to Tampa for Gasparilla this year. Photo by Richard Rioles

To see more member Gasparilla pho-tos in a fun, video format,

click on this pirate hat.

http://youtu.be/A1mHe_CxnnU


Flotilla 72 St. PetersburgGene Keller, Flotilla Commander

FL 72 facility Miss Marla by George Papabeis

Several major projects have kept Flotilla 72 ex-tremely busy for the last two months.

1) We decided to move beyond the mentor pro-gram for new members

and established a new monthly program that we call “72 New Member Boot Camp”. Every fi rst Wednesday of each month, we ask our new members and experienced members to join us and to participate in two Auxil-iary functions. Each month, two Flotilla Staff Offi cers present an informative class on each area of Auxiliary programs and areas of activity. The program lasts six months then repeats.

2) We also decided to introduce a monthly Flotilla Staff Offi cer meeting. All members are invited to attend. This is an in depth interactive program to encourage a greater degree of cooperation between our leaders. For example, we are working on a higher level of integra-tion in the area of public relations. Our working group calls this effort “Operation Outreach”

“Operation Outreach” is our effort to be better at public relations and has reached several major goals in the past

two months:

a) We created a database of almost 3000 email address-es of local individuals who are involved with on the water activities.

b) We created a February and March “USCG Auxiliary Flotilla 72 Boater Safety Bulletin.” We have transmit-ted it twice and hope to grow our database to over 5000 names in the next year.

c) We created a new logo to go on all of our public com-munications to support our branding efforts. We pro-duced this logo in the form of a challenge coin as well.

d) We have rewritten our public boater education and safety brochure in color bearing our new logo and links to our Facebook page and our web site.

e) We have begun the process of integrating our Face-book, web site, Boater safety bulletin and printed mate-rial to have a sense of co-branding and an overall look.

3) We have also been working hard to improve our building. The meeting rooms are clean and neat and decorated with historical photos to enhance the experi-ence of our visitors and prospective new members.

While sailing aboard their 43-foot catamaran Vitamin Sea in the main ship channel in Key West a few months ago,

Marla and Rick Short came upon this line fl oating on the surface at marker G-5. Marla told Rick, who was at the helm, “It looks like its is longer than 100 yards, which is

a risk to boaters.” With that, Marla put on her sailing gloves and guided Rick to to the location “MOB style.”

With the grasp of a boat hook, all of the line was brought aboard and later safely disposed of ashore. “That line was an accident waiting to happen,” said Rick. Photo

provided by Marla Short.


• Sea Sickness medicines and/or remedies• Sanitized fi rst aid solution, such as sterile saline to

fl ush and disinfect wounds• Dry blankets for warmth in the winter • Shade if someone suffers from heat exhaustion or

heat stroke• Suffi cient water, food, and personal medications

(always take more water along than you think you will need.)

• Additional 4”x 4” dressings and bandages • A large, fresh bottle of hand sanitizer which can be

used very effectively for both cleansing a wound and for cleansing the fi rst-aid provider both prior to and after treating an injured person.

Stock your kit well and gain the knowledge to use it properly! Share this information

with boaters when conducting Vessel Examinations or Public Educa-tion classes. It could help save a life.

Build A Better First Aid Kit to Help Save LivesBy: Loren D. Reuter, FSO-PA 72

If you haven’t fi gured it out, you will -- things can go wrong on the water in a matter of sec-onds. A responsible boater is prepared for fore-seeable problems, and one of the most fore-seeable is that someone may become injured or seriously ill on a boat and require immedi-ate medical attention. We are fortunate to have competent emergency response providers and are accustomed to nearly instantaneous help in most emergencies by simply dialing 911 – on land. However, boaters should be prepared to render medical assistance for a longer period than on land, and that can mean the difference between life and death.

In addition to obtaining fi rst-aid and/or CPR training, which is readily available from several organizations for a nominal fee, one of the best things you can have on a boat is a very good marine fi rst aid kit and to know how to use it properly.

Basic fi rst-aid kits are readily available at most pharmacies and boating supply stores and in general, have all of the basic items needed to deal with simple injuries. I encourage you to use them as the foundation upon which to build a good marine fi rst aid kit. Some of the items they contain typically in-clude dressings, bandages – (a bandage holds a dressing in place over a wound and duct tape can be used very effi ciently as a bandage), gauze, compresses, shears, splints, burn gel, latex gloves, alcohol wipes. Howev-er, to be truly prepared for an on the water emergency medical situation, you should also include the follow-ing items

• Stainless steel pliers with sharp cutters to remove embedded fi shhooks

• Stainless or titanium knife or scissors or shears• White Vinegar or hot fresh water to neutral-

ize marine life stings like jellyfi sh, stingrays and fi re coral

• Tweezers or forceps for removing jellyfi sh tentacles

• Sunburn relief gel-aloe• Clean or sanitized cloths or

compresses to use as direct pressure

Basic fi rst aid kits are readily available at most pharmacies and boating supply stores. Use them as the foundation upon which to build a good marine fi rst aid kit .

Stock your kit wuse it pro

with bExtl

r to neutral-yfi sh,

g


Flotilla 74 BrandonJeffrey Gines, Flotilla Commander

Flotilla 74 conducts Ves-sel Safety Checks at both Riverview Park and Civic Center and at Wil-liams Park in Riverview on alternating Saturdays. These two locations keep

our Vessel Examiners busy and provide us many oppor-tunities to interact with boaters and promote our boat-ing safely programs.

The Public Education team presents “Boating Skills and Seamanship” course modules on Monday nights but have also presented the “About Boating Safely” public education course this year.

In addition to our facilities, coxswains and crew who assisted with Gasparilla on the water, Len Chiacchia and John Sanchez, two of our Auxiliary Telecommu-

nications Operators, staffed Tampa Radio One and pro-vided radio guard to all of the Auxiliary vessels for the boat parade.

Our members participated in, and were present during every major event and training within Division 7 this year.

Flotilla 74 member George Papabeis provides Public Affairs/ Publications support in his roles as Flotilla Staff Offi cer-Public Affairs and as Assistant Staff Of-fi cer-Publications. Papabeis took photographs during Gasparilla Pirate Invasion and Boat Parade on January 26, and he provides extensive photographic support for our many Coast Guard and Auxiliary missions includ-ing the Coast Guard Sector St. Petersburg Open House on March 2, 2013. His work is found throughout this publication and contributes greatly to the Intercom’s overall look and presentation.

Williams Park, Riverview, Fla. by D. Riley

TAMPA, Fla.--Len Chiacchia, Linda Bar-nard, and John Sanchez (not shown), Auxil-iary Telecommunications Operators, staffed Tampa Radio One and provided a radio guard for all of the Auxiliary vessels partici-pating in the annual Gasparilla Boat Parade and manatee count on January 26 in Tampa Bay. Photo by John Sanchez

ST. PETERSBURG, Fla.-- U.S. Coast Guard Auxiliarist Len Chiacchia mans his post during the 2013 Sector St. Petersburg open house. Close to 60 Auxiliarists volunteered their time in order to assist the Coast Guard with the event. Photo by George Papabeis.


ST. PETERSBURG, Fla.-- A rescue swimmer signals for a retrieval during the 2013 Sector St. Petersburg open house. Photo by George Papabeis

ST. PETERSBURG, Fla.-- PO3 Ferguson looks thoughtfully over her shoulder on the deck of the USCGC Joshua Appleby during the 2013 USCG Open House at Sector St. Petersburg. Photo by George Papabeis.


Flotilla 75 RuskinOscar Kramer, Flotilla Commander

E.G. Simmons Park, Ruskin, Fla. by D. Riley

Flotilla 75 received some local recognition from a search that ended in a suc-cessful rescue late in 2012.

Two days before Thanksgiving, two boaters battered by winds and waves that eventually overturned their vessel, were seen in the water by persons on shore who put in a call to Station St. Petersburg. They in turn notifi ed Ruskin Radio, which was providing a radio guard for two Flotilla 75 facilities out on a train-ing mission.

Legal Limit, owned by Pat Costello, and Gulf Lady, owned by Walt Wagner, were engaged in training exercises near the large spoil islands. Both vessels were quick to respond and headed for the probable search and rescue areas. Legal Limit was fi rst on the scene just off the shore at Apollo Beach and quickly and effi ciently rescued the two men in the water. Once aboard and donning life jackets, the two men were secured while Auxiliary crewmembers Ted Cohen, Fred Kramer, Gary Mull and Joe Lamb secured the overturned boat to prevent it from sinking.

“Helicopters dispatched by Coast Guard Station St. Petersburg and the sheriff’s department monitored the situation from above while Coast Guard boats, Air Force patrol boats from MacDill, and boats from the sheriff’s Department and Fish and Wildlife aided in the search and stood by to render any additional assistance. “ (SCC Observer, Dec. 13, 2012. Photos submitted by Ray Stewart)

Volume XXXVI Issue 1 Winter 2013 Volume XXXVI Issue 1 Winter 2013 Page 13

After watching a brief video about the rescue of a pygmy sperm whale called ‘Inky the Whale,’ 128 fi rst graders at Corr Elemen-

tary School in Gibsonton, Fla., en-thusiastically demonstrated their in-terests and concerns regarding water pollution and water safety. “Where do whales go to the bathroom?” “Why do whales think plastic bags are food?” “If I can swim, do I re-ally need a life jacket?” And the best question of all, “If you are in the water is there still gravity?”

Teacher Katie Seligson had invited the US Coast Guard Auxiliary Flotilla 75 to edu-cate eight fi rst grade classes on the dangers and safety precautions when playing around beach-es, pools, and boats. Ray Stewart, Public Affairs

Offi cer explained the impor-tance of having a ‘buddy’ or an adult with you at all times around the water. The fi rst graders were es-

pecially interested in how much garbage gets in the water. Using a leaf blow-

er, Stewart demonstrated how garbage is inadvertent-

ly and occasionally blown out of a boat.

A video of boating bloopers in-troduced fl otilla member Pat

Stone who showed the stu-dents how important it is to not only have a life jacket,

but a properly fi tting one as well.

She impressed upon the stu-dents the value of knowing how to swim and of being confi dent around the water, but most impor-tantly; to always wear a life jacket when around bodies of water and in boats.

The fl otilla members stressed that all children under the age of six must wear a weight-appropriate life jacket when aboard any boat less than 26 feet in length and while underway, and that even while wearing a life jacket, children and adults may not legally sit at the very bow of the boat.

Supplied with ‘Inky the Whale’ coloring books and crayons, ‘Wear It’ life jacket stickers and Coast Guard Auxiliary beads, 128 fi rst graders were bet-ter educated about water safety.

wel

She dents

troSdentnot out a

A

Sdn

buwel

For Corr First Graders, Water Safety is ElementaryBy Ray Stewart, VFC, FSO-PA 75

beach-Aff i

dtoartanwin

Th

Sd

GIBSONTON, Fla.- Feb. 26, 2013 --Flotilla 75 member Pat Stone helped educate 128 pupils at Corr Ele-mentary School about water safety and the importance of wear-ing a properly fi tting life jacket. Photo by Judy Kramer

GIBSOONNTTONN,, FFFFFFFFFFFFFllllllllllaaaaa.-

Offi ctanc

r mhpmwr,w

tanortimTh

pmw

erhow

GIBSOOOOOOOOOONNNNNNNNNNNNNNNTTTTTTTTONNNNNNNNNNNN FFFFFFFFFFFFFFFllllllllllaaaaaaaa


Flotilla 78 Pass-a-GrilleJim Armstrong, Flotilla Commander

who have little or no experience.

Last year, 2012, we started 43 students in our continu-ous Boating Skills and Seamanship and had 36 gradu-ates. We also had two fewer than 17-year-old students enroll and graduate. Bravo Zulu to all of our Instructors!

We also have one AuxChef in our fl otilla, Karen Co-hen, our Flotilla Vice Commander. She volunteers on the USCGC Joshua Appleby periodically to serve nutri-tious meals to the crew.

(Submitted by Val Fernandes)

Flotilla 78 facility, Thin Blue Line, by Elizabeth Kreiter

J

Flotilla 78 has conducted three patrols to date. We have checked all our PA-TONS (private aids to navigation) except for several in Bunces Pass and a small channel known as

South Dent. South Dent has become non-navigable for our facility due to the shallow water at its entrance.

We had three more patrols scheduled for the remainder of March, but they were cancelled due to sequestra-tion. Luckily, we were able to complete a night naviga-tion mission and most of our division training tasks. Because of the outstanding cooperation and camaraderie within the division, our boat crew qualifi ed members have also been on patrols with oth-er fl otillas.

Three of our members partici-pated in the recent Sector St Pete Open House. One of our members attended the Aux-iliary Telecommunications Operator training at Flotilla 72 conducted by Gene Keller, and one member attended the recent Human Resources training conducted by Marla Short at Flotilla 72. We thank those involved for the excel-lent training opportunities they provided!

Our Public Education pro-gram is going strong with 15 students. We run a con-tinuous Boating Skills and Seamanship program so our instructors are teaching a class every Tuesday of every month throughout the year. The only time they take a break and suspend class is during the Christmas holi-days. We feel that the 13-week class, although more taxing on our members, is more educational and more in-depth than the eight-hour class for the boating public

ST. PETERSBURG, Fla.--Flotilla 78 member Karen Cohen, serves as AUXCHEF aboard the USCGC Joshua Appleby in September, 2012. Karen is the current Flotilla Vice Commander 78. Coast Guard Auxil-iary photograph


ST. PETERSBURG, Fla.--Flotilla 78 members Keith Anderson, Amanda Davis and Valerie Fernandes on the USCGC Joshua Appleby during the Coast Guard Sector St. Petersburg Open House on March 2, 2013. USCG Auxiliary photo-graph

Above: Valerie Fernandes caught Miss Marla owned by Rick Short (coxswain) from Flotilla 72 alongside a Coast Guard facility at the Coast Guard Sector St. Petersburg Open House on March 2, 2013.

Right: John Sanchez,Flotilla 74 checks for an-chored vessels in the restricted zone under the Skyway Bridge from the bow of Gene Keller’s vessel. Flotilla 78 has several crewmembers who crew for other vessels within Division 7. Photo by Valerie Fernandes


Flotilla 79 TampaPaul Cooke, Flotilla Commander

Gandy Boat Ramp, Tampa, Fla. by D. Riley

Twenty-e i g h t m e m -bers of the Coast

Guard Auxiliary Divisions 7 and 11 and 23 active duty guardians from Sector St. Petersburg attended the Team Coordination Training con-ducted on March 9, 2013, at Flotilla 79 in Tampa. Amos Johnson facili-tated the eight-hour training while Brian Garry, AUXCHEF graduate prepared lunch assisted by his wife, Phyllis, and Flotilla 79 members Tim Teahan, Brian Giacobbe and Kathy Curry.

Taken from the course introduction, “Team Coordination Training (TCT) is a program that focuses on reduc-ing the probability for human error by increasing individual and team ef-fectiveness. Safety has long been the Commanding Offi cer’s responsibil-ity and, until recently, was assumed to be the logical result of fi nely tuned technical skills. USCG mishap data suggests that while technical skills are an essential component of any job, they alone will not ensure safe-ty.”

The training modules include Effec-tive Leadership, Effective Mission Analysis, Adaptability and Flexibil-ity’ Situational Awareness, Decision-Making, Effective Communication and Assertiveness.

Top: TAMPA, Fla.--Twenty-eight members of the Coast Guard Auxiliary Divisions 7 and 11 and 23 active duty guardians from Sector St. Petersburg attended the eight-hour Team Coordination Training conducted on March 9, 2013, at Flotilla 79 in Tampa. Photo by Paul Cooke

Lower Image :TAMPA, Fla.--Brian Garry, a graduate of the Auxiliary Chef program (in white hat) prepared lunch for the course attendees. He was assisted by his wife, Phyl-lis (behind the counter), members Tim Teahan (not shown) and Barry Giacobbe. Linda Churchill (seated) assisted with service. Photo by Tim Teahan


Flotilla 79 Rolls Out New Challenge CoinFor several years, Flotilla 79 planned a challenge coin. The pro-cess, from initial design to fi nal distribution was a lengthy one. While the coin was designed when Tim Teahan was Flotilla Commander, it was Heleyde Aponte who authorized its minting during her term as commander. The coins were delivered late in 2012, and Paul Cooke, Flotilla Commander, was fi rst to make these coins available to the members in January 2013. The coin commemorates our fl otilla and its seventy-year history. Members and collectors alike are encouraged to obtain one. Flotilla 79 challenge coins are offered at the reasonable price of $5.00 each.

See Paul Cooke, Flotilla Commander to obtain yours today!

In MemoriamCommodore Donald L. Frasch

October 1, 1939 - January 13, 2013

Donald L. Frasch, 73, of Hudson Florida died on January 13, 2013. He is survived by his wife, Sandra, three children, eight grandchildren and his brother William. Don and Sandy recently celebrated their fi ftieth wedding anniversary on October 6, 2012.Commodore Donald L. Frasch most recently served the United States Coast Guard Auxiliary as Deputy Nation-al Commodore, Recreational Boating Safety and LANT Area East 2011-12. He previously served as District Com-modore in the Seventh Coast Guard District Auxiliary in 2009-10, District Vice Commodore in 2007-08, and as Division Captain, Division Eleven in 2005-06.Commodore Frasch joined the U.S. Coast Guard Aux-iliary in May of 1985 in District Nine, Eastern Region. While in Rochester, New York, he served as Vice Flotilla Commander, Flotilla 42, Flotilla Commander, Vice Di-vision Captain, Division Four and as Division Captain. He then served three successive District Commodores as Coordinator, Special Projects and as the District Awards Chairman. Upon his retirement in 2000, he relocated to Hudson Florida where he resumed his service to the Auxiliary. He has achieved qualifi cations as Coxswain, Vessel Examiner, Instructor, and Uninspected Passenger Vessel Examiner.


Flotilla 7-16 GulfportDonald Hershman, Flotilla Commander

Boca Ciega Bay, Gulfport, Fla. by D. Riley

Flotilla 7-16 saw a substantial increase in membership in 2012 with the ad-dition of 11 new members and transfers. Many of the new members became aware of the Auxiliary through the About Boating Safely courses they attended while others transferred to Flotilla 7–16 because of the fl otilla’s proximity to where they live, and the excellent standards and fellowship set by the Flotilla.

Terry Hershman, Flotilla Commander, wants to continue the trend of member-ship expansion for the next year. “It’s important to keep having new blood come into the fl otilla so that 7-16 stays vibrant.” Hershman adds, “The About Boating Safely courses seem to be our number one recruiting tool.”

On February 20, Bunny Johnson, Flotilla Staff Offi cer and Division 7 Staff Offi cer –Information Ser-vices, received her ninth Sustained Service Award. Bunny and husband, Amos Johnson, are new transfers to Flotilla 7-16. (Amos Johnson is, coincidentally, the Immediate Past Division Commander.) Bunny joined the Auxiliary in 1996, is crew qualifi ed, and was the Staff Offi cer –Information Services when AUXDATA fi rst came online. She also served as Flotilla Vice Commander of Flotilla 79 in 2011.

By February, the Program Visitor team completed 92 visits. Our goal this year is 600 visits. In January the Vessel Examination team completed 235 vessel exams for the year. The Vessel Examination team’s goal for this year is 500 ves-sels. Kathy Clatworthy be-came 7-16’s twelfth vessel examiner. She received her certifi cation in February.

Right: “New members” (transfers), Amos and Bun-ny Johnson, at the District Conference. Amos Johnson is the Immediate Past Divi-sion Commander 7 while Bunny was the Staff Of-fi cer –Information Services when AUXDATA fi rst came online. Photo by D. Riley

Volume XXXVI Issue 1 Winter 2013 VoVVoVollululumememe XXXXXXXXXXXXVIVIVIVI IIIIssssssssueueueue 1111 WWWWWinininininteteteteerrrrr 2020202020131313131 PPPPPagagaga eee 191919

In 2012, Jim Newman and the Auxiliary vessel Laylow, participated in two Coast Guard Comprehensive Law Enforcement and Readiness (CLEAR) training events with cutter crews at Sector St. Petersburg. The images in this photo essay are of the Laylow working with the staff of the USCGC Nantucket. The Auxiliary vessel acted as ‘bad guy’ (hence, no uniforms for Auxiliary crew) and was boarded by a Coast Guard boarding team from the Nantucket.

On the day of the scheduled training, Newman left Gulfport for Sector St. Petersburg in the wee hours of the morning. The tide was very low and the Laylow picked up a ghost crab trap (a trap with no marker) in the middle of the channel. Newman and his crew had to return the quarter of a mile back to his home dock and cancel orders. He then put on a wet suit; dived under the boat and cut the wire mesh trap off the prop, changed his clothes, and reopened the orders. Despite the delay and pea-soup fog that morning, the Laylow and its crew still made it to sector on time for the training...and delivered the cupcakes made by spouse and Auxiliary member, Becky McCoy (a/k/a “The Admiral”), to the young guardsmen!

Submitted by James Newman, VCDR 7 (and member of Flotilla 7-16 Gulfport)

In 20LawThe AuxGua

On tthe min thdockpropLaylspou

Sub


Auxiliary Provides Safety Zone for the 2013 Annual Frogman Swim. By D. Riley, Photos by George Papabeis

Like many things in life, the Tampa Bay annual Frog-man Swim came about almost serendipitously. First, Sam Farnan, a senior at St. Petersburg Catholic High School who dreamt of being a SEAL, and Terry To-malin, the outdoors-fi tness editor for the St. Petersburg Times, got together with some friends from Clearwater Beach Safety and started making the annual crossing. Tampa Bay Watch, one of Florida’s leading environ-mental advocacy groups, heard about the swim and in the spring of 1997-1999, staged organized races along the same route.

Retired Navy Commander Dan O’Shea, a former SEAL, had mentored Farnan since he was 10-years-old. O’Shea had the idea to turn the swim into a fun-

draiser for Lt. Dan Cnossen, a SEAL offi cer who had recently been wounded in Afghanistan. O’Shea enlisted the help of Lt. Mark Lampman, an active duty SEAL, and together the four organized the fi rst Tampa Bay Frogman Swim in 2010. Conditions were harsh – the water temperature hovered in the high 50s – but nearly 40 swimmers managed to make it across the bay and raise thousands of dollars in individual pledges for the injured SEAL and his family.

Today, the Frogman Swim is a 5K Open Water Swim and fundraiser in support of the Navy SEAL Founda-tion. The course runs from Gandy Beach in St. Peters-burg to Picnic Island in Tampa. The goal of the annual

Continued on page 20


Frogman Swim is to build national awareness of the Naval Special Warfare community and to become a key fundraiser of the Navy SEAL Foundation by building a premier annual event that challenges athletes with weather conditions similar to SEAL training. They have issued the challenge, “Come swim with the Navy SEALs and help us to ‘never leave a man behind’.” (Read more about the Frogman Swim at: http://www.tampabayfrogman.com/ (Click on the Tampa Bay Frog-man Swim logo on previous page for a quick link to their web page.)

The safety of swimmers is of paramount importance. While the event coordinators provide kayaks to trail the swimmer as well as power vessels along the route, the Coast Guard Auxiliary maintains a safety zone to pre-vent swimmers or kayaks being run over by recreation-al boaters. During the 2013 event held on Jan. 13, 2013, the Endurance, was one such vessel. The crew of the Endurance consisted of Joe Lamb, coxswain from Flo-tilla 79; boat crewmembers Roger Sneden and George Papabeis from Flotilla 74; and Bob Easterday, member of Flotilla 79.


Right: TAMPA BAY, Fla.--Coxswain Joe Lamb prepares to retrieve a fl oating camera from the bow of the Coast Guard Auxiliary vessel Endurance at the end of the Fourth annual Frogman Swim held Jan. 13, 2013. The crew of the Endur-ance consisted of Joe Lamb, coxswain, from Flotilla 79; boat crewmembers Roger Sneden and George Papabeis, members of Flotilla 74; and Bob Easterday, mem-ber of Flotilla 79.

All photos by George Papabeis.

Below: A kayak escort keeps a close eye on his designated swimmer during the 2013 Fourth annual Frogman Swim. The fi ve kilometer endurance swim is conducted every year to build national aware-ness of the Naval Special Warfare community and acts as a fundraiser for the Navy Seal Foundation.


Bunny Johnson, Staff Offi cer –Information Services

Flotilla 72 held a boot camp for new members on Feb 6, 2013. Clifford Holensworth, Flotilla Staff Offi cer-Information Services, presented a program for new members on “how to access and fi ll out commonly used forms”, namely, the 7029 and 7030 forms. Over 35 members attended. Flotillas 75 and 7-16 report all data entered; Flotilla 74 is having some issues with up-dating 7028 form. This has been reported to District.

Ronald Matz, Staff Offi cer –Materials

Received update on ANSC items of interest and for-warded to All Division 7 fl otillas.

David Langdon, Staff Offi cer –Member Train-ing

Member Training initiatives are published throughout this issue.

Clifford Martin, Staff Offi cer –Operations

Division 7 conducted 24 Patrols in January, 13 of which were security patrols. Also included was one qualifying examination mission, which up-graded two

Staff ReportsGene Keller, Staff Offi cer-Communications

In February We had a successful radio operator train-ing at Flotilla 72 with over 30 members in attendance. The Division will be taking over radio guards for Auxil-iary patrols, including security patrols in the future. See photos and a brief article about our most recent Tele-communications Operator Training in this issue.

Robin Conn, Staff Offi cer –Communication Services

Flotilla 72 delivered a presentation to members on the use of social media to promote interest in their Boating Skills and Seamanship program and to reach out to their members. Gene Keller, Flotilla Commander, discussed the use of Social Media and Standards of Ethical Con-duct by Auxiliary members when it comes to Facebook, Twitter and other social media sites.

Flotilla 72 sent out their fi rst “Safe Boating Update” email to about 1,600 email addresses in the fl otilla data-base. Conn is exploring the email program to see if this would be useful to Division 7 and other fl otillas

Communication Services and Operations are working out a procedure to send password protected mission info in emails to Sector. Examples would include the Rapid Deployment Roster and Monthly Patrol Sched-ule forms.

(Reported by Terry Hickox, ASO-CS)

TAMPA, Fla.--Linda Barnard, Tele-communications Operator from Flotilla 72, and Len Chiacchia , Telecommunications Operator from Flotilla 74 provide radio guard during Gasparilla on January 26, 2013. Photo by John Sanchez, Auxiliary Telecom-munications Operator from Flotilla 74, who also staffed Tampa Radio One for the boat parade.


crewmen to coxswain and recertifi ed one coxswain.

On January 24, a coxswain brief was conducted for cox-swains and crew that participating in 2013 Gasparilla. The event included facilities from this division as well as from Divisions 8 and 11. The Gasparilla event went well this year with no major problems. Martin thanks all involved who participated.

Tim Teahan, Staff Offi cer –Public Affairs

Prepared and sent news release about Auxiliary Vessel Safety Check Blitz on Sat. and Sun. Jan. 19-20 at Gan-dy Boat Ramp to help prepare boaters participating in the 2013 Gasparilla Pirate Invasion on January 26. We had three radio interviews promoting the event.

Worked with Sector St. Pete Public Affairs Detach-ment and Response Department to plan and deliver a very successful news conference on Friday Jan. 25 promoting boating safety and vessel checks. Participat-ing agencies included the United States Coast Guard, Auxiliary, Florida Wildlife Commission, Tampa Police Department. and Hillsborough County Sheriff’s Offi ce. The Auxiliary provided a boat as background, along with other agency boat.

Prepared and sent news release promoting Division- wide Boating Skills and Seamanship and About Boat-ing Safely courses. Now doing follow-up.

Planned Auxiliary involvement in Tampa Boat Show at Tropicana Field March 8-10.

Worked with Staff Offi cer–Human Resources and Flo-tilla 79 command staff to plan and deliver a New Mem-ber Boot Camp on Saturday, Feb. 23 at Flotilla 79. Fif-teen new and/or prospective membvers attended.

Staff Reports

V Directorate Workshops

Workshops for either Program Visitors or Ves-sel Examiners are not mandatory in 2013 but are encouraged to keep our members up to

date in the PV and VE areas. Training mate-rials for 2013 may be downloaded at: http://

wow.uscgaux.info/content.php?unit=V-DEPT&category=WORKSHOPS or you can also order the V-Directorate Training CD: ANSC No.

2001 A.

Vessel Examiner and Program Visitor Workshops 2013

The following are parts of the 2013 Vessel Exam-iner Workshop / Program Visitor Workshop and require Microsoft PowerPoint:

• 2013 VE/PV Workshop Module 1 - Intro-duction (PowerPoint 941KB)

• 2013 VE Workshop Module 2 - VSC Best Practices (PowerPoint 1,213KB)

• 2013 VE Workshop Module 3 - OPFAC (PowerPoint 2,632KB)

• 2013 VE Workshop Module 4 - Paddle-Craft (PowerPoint 4,223KB)

• 2013 PV Workshop Module 5 - Visitations (PowerPoint 5,095KB)

• 2013 VE/PV Instructor Guide - Instructor Guide (MS Word 46KB)

• 2013 VE/PV Workshops - Single Down-load All Files (ZIP File 10,706KB)


Staff Reports

Tropicana Field, St. Petersburg, Fla.

Some weekends are a testament to the dedication and commitment of our members to the Auxiliary, and the weekend of March 8, 9, and 10 defi nitely counted as one! With so many major activities going on simultane-ously, one might expect participation at one or more to lag, but each of these events turned out quite success-fully.

First, there was the Team Coordination Training held on Saturday, March 9 at Flotilla 79. Over sixty active duty and Auxiliary members attended which included trainees, Instructors and other assistants. Also at fl otilla 79 as the Information Services Workshop conducted

by Bunny Johnson. On the other side of the bay, Marla Short conducted he Human Resources Workshop.

If that were not enough, the Tampa Bay Boat Show was going on at Tropicana Field in St. Petersburg Mar. 8-10, 2013. Promoted as “the boating sales event of the sea-son”, this three-day event attracts hundreds of boaters and is a great opportunity to expose them to our boating safety message. The event was organized by Tim Teah-an, Staff Offi cer-Public Affairs, who coincidentally, was also in Tampa for the Team Coordination Training- and, we hear, put in an appearance at the HR Workshop.

Tampa Bay Boat Show a Huge Success.

Right: ST. PETERSBURG, Fla.--James Newman, Division Vice Commander and Peter Lore, both from Flotilla 7-16 and Bob Martellucci, Flotilla 75, share boating safety information with mem-bers of the public attending the Tampa Bay Boat Show at Tropicana Field, Mar. 8-10 in St. Petersburg. Photo by Franco Ripple, Flotilla 72

Left: Franco Ripple, Flotilla 72; Bob Martellucci, Flotilla 75; Rebecca Mc-Coy, James Newman and Peter Lore, all from Flotilla 7-16, pose for a photo at the Tampa bay Boat Show. Coast Guard Auxiliary photograph

Volume XXXV Issue 2 Winter 2012

2013 West Marine Vessel Safety Check Discount Coupons

Staff Reports

Great News, the West Marine Vessel Safety Check discount coupon will be continuing in

2013. While this is not an endorsement of West Marine, they do provide a great service to the

boater.

As in the past, the coupon is only for safety items to pass the Vessel Safety Check. West

Marine requires the boater to present a copy of the coupon and the 7012 or 7012A to receive the

discount.

The coupons can be printed by the Vessel Ex-aminers from the Adobe Acrobat fi le found at:

http://bdept.cgaux.org/wp/wp-content/up-loads/2013/02/westmarine_color.pdf

Information Services Work-shop and Update

Bunny Johnson, Staff Offi cer –Information Ser-vices

Bunny Johnson, Staff Offi cer-Information Services, held a four-hour Information Services Workshop on Saturday, Mar. 9, 2013. Many topics were covered and all Information Services missions were entered. With the current changes to the form 7028, changes can be entered immediately into AUXDATA.

All Flotilla members are asked to update their 7028 forms (login to Auxiliary Directory at https://auxof-fi cer.cgaux.org/, search your name, then select your record to update the “Skills Bank Details” at the bottom of the web form 7028).

The Offi cers from each Flotilla are having diffi culty getting people to report hours on 7029. This will be mentioned at next Flotilla meetings and hopefully in publications. The 7029 form is so simple to use and if kept as a favorite, can be updated very easily. Please stress this to all the Division Offi cers and Flotilla Com-manders and Vices. Countless hours were not reported last year, COUNTLESS being the opportune word here, because that is a loss for all the Division. All of us fall under the same set of rules and the hours are to be re-ported monthly; this is a mission directive. If you have not reported this year, your Information Services offi cer may still accept your hours, so submit them.

An Information Services meeting with Flotilla Com-manders and Vices was discussed and a date will be forthcoming.

Clifford Holensworth has accepted the job as Assistant -Information Services (ASO-IS).

Len Chiacchia, Flotilla Staff Offi cer-Information Ser-vices Flotilla 74, has developed some great training tools for member training, and organizing steps for new members in clear and precise language. I will send up the chain. Great work on his part.(Note: Len Chiacchia's tools were shared by Mike Shea, Division Commander, with other members on March 12, 2013. Ask, if you would like to receive copies.


Telecommunications Operator Training

““““RRRRRRRRRRRRRRadddddddddiiiiiiiooooooo ccccccooooooommmmmmmmmmmmmmmmmuuuunnnniiiicccccaaaaatttttionnssss iiiinnnn tttthhhhee UUUUUUUUUUUUUUSSSSSSSSSSSSS CCCCCCCCCCCCooooastttttttttt GGGGGGGGGuuuuuuuuuuaaaaaaarrrrrrrrrddddddddddddd AAAAAAAAAAAAAuuuuuxxxxxiiiiiiiiiiilliarrrryyyy have unn-ddddeeeeeergonnnnneeee eeeeeeeexxxxtttttttttttttteeeeeeeeeeeeeennnnnnnnnnnnnssssssssiiiiiiiivvvvvvvvee chhhhhhhaaaannnnnnngggggggggggggggggeeeees in recent yyyyyyyyyyyyeeeeeeeeeeeeaaaaaarrrrssss,,,, aaaaaaannnnnnnnnnnndddddddd cccoooooooonnnnnnnnnnnnnnnnnttttttttttttttttttiiiiiiiiiiiiiinnnnnnnnnnnnnuuuuuuuuuuuuuuuuueeeeeeeee tttooooooooo eeeeeeeevvvvvvvvvvoooolve. The aaaaaaaaaaaadddddddddddddddvvvvvvvvvvveeeeeeeeennnnnnnnnnnnttttttt aaaaaannndddd uuussssseeee ooooffffffffff nnnnnnnnnnnneeeeeeeewwwwwwwwwwwwwww ttttttttttttteeeeeeeeeeeeeeeeecccccccccccccchhhhhhhhhhhhhhhhhnnnnoooollllooooggggiiiieeeessss,,, tttttttthhhhhhhhheeeeee iimmmmppppllllleeeeemmmmmeeeeennnnntttttttaaaaattttiiiiooooonnnnn ooooofffff RRRRRRRRReeeeessccuuuue 22111,, ttthhhee iiiimmmmmmmmpllllllleemmmmmmmeeeeeeeennnnnnntttttttaaaaaaaattttttttiiiiiioooooonnnnn oooooooooofffff GGGGMDSSSS ((GGllobbal MMMMMMMMMMMMMMMMaaaaaaarrrrrrriiiiiiittttttttiiiiiiimmmmmmmmmeeeeeeee DDDDDDDDiiiiiiisssssstttttttrrrreeeess and Saffety Sys-tttteeeemmmmmmmmmmmmmmmm))))))),,,,,,,, aaaaaaaaaannnnnnndddddddd nnnnnnneeeeeeewwwww rrrooolllleeeessss ffffffor tttthhhhe Auxiliary ppppppppppppppoooooooooooosssssssssssttttttttttttttttt 9999999///////1111111111111111,,, hhhhhhhhhhaaaaaaaavvvvvvvvvveeeeeeeee ddddddddddddddrrrrrrrrrrrriiiiiiiiivvvvvvvvvvvvveeeeeeeeennnnnnnnnn mmmmmmmmmany of these cccccccchhhhhhhhhhhhhhhhhhaaaaaaaaaaaaannnnnnnnnnnngggggggggggggeeeeeeeeeeeesssssss.... In many areas of the country AAAuuuuuuuxxxxxxxxxxiiiiiilllliiiiaarry commmmmmmmuuuuuuunnnnnnnnnnniiiiiiiiiiiiccccccccccaaaaaaaaaatttttttttoooooooooooorrrrrrrrrrrrrrs are func-ttiiiioooooonnnnnnnnniiiiiiiinnnnnnnnnnggggggggggg aaaaaaass WWWWWWWWWWWWaaaaaaaatttttttttttccccccccccchhhhstanders from their fififififififififi xxxxxeeeeddddd oooooooooorrrrrrrrrrrrrrr mmmmmmmmmmmmmmmmoooooooooooooobbbbbbbbiiiilllleeee AAAAAAAAuuuuuuuuuuuxiliary stations, ei-ttthhhhhheeerrr aaaaaaaaaasssssssssss aaaaaaaaaaaaaa rrrrrrrrreeeeeeggggggggggguuuuuuuuuuuuullllllllllllaaarrrr sssshhhhhhhiiiiiiiift activity or as ad hhhhoc ccccoooommmmmmmmuuuuuuuuuunnnnnnnnnnnnnniiiiiiiicaaatttorrrrrrrrrrrrs. When function-iiiinnnnggggggg iiiinnnn tttthhhhiiiissss mmaaaannnnnnnnneeeeeeerrrrrrrrrrrr, these Auxiliarists arrreeeeeeeeeee ttthhhhee vvvvvvvoooooooiiice ooooooffffff tttthhhhhhheeeeeee Coast Guard to the bbooaaaaaaatttttttiiiiiiinnnnnggggggg ppppuuuubbbbbblllllliiiiccc....””””

Frromom ttttthehehehehe IIIIInntn roduction to Auxiliary Tele-commmmmununununnicicicici ataa ions Qualifi cation Standard


2013 Division 7 Telecommunications Operator Training

Program Participants

Students

Jack Satterfi eldRick SmithMark JaquaJack LohmanDavid PerilloSuzanne HooperTony HooperValerie FernandesWilliam ZinnerKathryn ClatworthyDean HoskinJim Nelson Gordon HornbyHeleyde ApontePhilip FronceAlexander RigbyJohn McloughlinMike MassiminiAllan PinkertonGlen LeroyGorden KendrickT.D ParrishT. Devlin Mentors

Oscar KramerJohn SanchezMarvin BaylesTim TeahanStan ClarkRick shortDavid LangdonGene KellerDavid Rockwell

For the second consecutive year, Gene Keller, from Flotilla 72, pre-sented the Auxiliary Telecommunications Operator Training program. When he assumed the offi ce of Staff Offi cer-Communications, he noted the number of members who held only the Radio Watchstander qualifi cation- or no radio communication skills at all, and organized the fi rst Auxiliary Telecommunications Operator Member Training program to remedy the situation. Keller invited members from all Di-vision 7 fl otillas to attend and encouraged qualifi ed members to assist as Instructors and Mentors.

On Saturday, Feb. 16 all of the course material was presented. The following Saturday, Feb. 23, the students were certifi ed after com-pleting all of the tasks outlined in the Auxiliary Telecommunications Operator Qualifi cations Standard. This program is quickly becoming a Division 7 “staple”, much as our annual Boat Crew Training Pro-gram.

Right: Tim Teahan, Flotilla 79

and David Rockwell, Flotilla 72 go over a

PowerPoint presenta-tion for the Telecom-

munications Operator Training program.

All photos by T. Dev-ilin Parrish, Flotilla 79

Students in the Telecommunications Operator Training Pro-gram study the course material.


On Mar. 2, 2013, between the hours of 10 a.m. and 3 p.m., hundreds of Tam-

pa Bay residents “experienced a day in the life of local Coast Guard members” when Coast Guard Sector St. Petersburg held its annual Open House and invited the public to witness aerial and on the water demon-strations and tour its vessels. The day of events was sponsored in part by the Tampa Bay Navy League and supported by the United States Coast Guard Auxiliary in-cluding members of Division 7.

From Captain Dickinson: “I want to thank all of you who had a hand in making our second annual Sector St. Petersburg Open House a huge success! ... All of the in-volved units showcased their units, their assets, and their operations with pride, giving tours, conducting demonstrations, answering questions, and providing infor-mation about the Coast Guard to nearly 900 visitors….

“We would not have been able to put on this event without the tremendous support from our Auxiliary shipmates. Nearly 60 Auxiliarists worked for weeks to coordi-nate safety and security for the event, and they stood their posts throughout the base, exhibiting great pride and professional-ism. Keeping the event safe for the public and our personnel was my highest priority, and we opened our doors for over 5 hours without a single incident. Well done! I also appreciate the determination and dedica-tion of our auxiliary facilities that were out on the water all day, maintaining a secure perimeter to allow the demonstrations to be conducted safely….”

May the photographs on these pages con-vey in images what we fail to commit through text.

Sector St. Petersburg Open HousePhotos

Top left: Visitors checking out an HH 65 C Dolphin from Air Station Miami. Top right: Darren Hart with CAPT. Dickinson, Commander, Sector St. Petersburg. Photos provided by Darren Hart

Above: Miss Marla comes alongside a Coast Guard Re-sponse Boat-Medium during the Open House at Sector. Photo by Valerie Fernandes

Photos in collage: HH 65 C Dolphin by Valerie Fernandes Miss Marla smoke demonstration by George Papabeis USCGC Joshua Apply by george Papabeis ; Dean Hoskin, Flotilla 72 by George Papabeis, Allure from Flotilla 72 by Valerie Fernandes. Background: Deck of the USCGC Joshua Appleby shot from above by Val Fernandes


No Camera?Take Out that Smartphone!By D. Riley

What do camera phones have to do with to well-known organizations and pub-lications like Digital Photography

School, Outdoor Photographer, New York Institute of Photography, and National Geo-graphic? These institutions publish photographs taken with camera phones and print articles on how to improve photography using camera phones.

National Geographic, known the world over for its stunning photography states, “In capable hands, a camera phone—the most widely used kind of camera in history—can produce compelling images”. They even publish tips for how to take pictures with a camera phone and have pub-lished an entire book on the subject.

Whether you use an iPhone or An-droid, smartphones now take pictures up to eight megapixels, but just like a regular camera, the fi nal image is considerable less that size. This is be-cause a JPG is a compressed image, and because the image size is depen-dent upon the amount of detail cap-tured by the camera. Some third-party photo applications also affect the size of the photograph. The best way to get good, detailed pictures is to check the phone’s photo application and adjust the settings. Change the output resolu-tion to full resolution-or the largest size available.

How the photo is shared also affects the image size. With an iPhone, you can send photos via email or multimedia message (MMS). (MMS is not available with fi rst gen-eration iPhones.) When you send photos through MMS, you cannot choose the size; your iPhone automatically resizes and optimizes your photo. For this reaon, shar-ing/sending photos via email is preferred.

Whether you use an iPhone or an Android, when you share an image using email, some email programs au-tomatically resize images as well. Some email services like Gmail and Yahoo do not automatically resize im-ages. (By the way, storage on cell phones is limited, so to be sure that you have enough room on your camera,

move your photos to a PC often.)

Just like with a regular camera, three of the most important considerations when taking

photos with a camera phone are focus, lighting, and composition.

• Focus: Don’t move when taking thephoto. Experiment with how best to hold the phone when taking pictures. Because camera phone sizes and the size of hands differ vastly-

and because people are both left and right handed, there is no “right” way to hold the phone. What is important is that you are able to hold the camera still while tapping

the shutter button.

• Lighting determines how much detail the camera captures. Camera phones have built-in fl ashes, which work best at close range but produce limited light. Unlike with a camera, one cannot increase the ISO to in-crease sensitivity to light, so it is best to make sure that the available light is suffi cient.

• Composition is often the most neglected aspect of picture taking. Hint: when shooting a person or group of people, do not place faces in the center focus ring. Depending upon distance, the center focus ring should be lower- somewhere between your

subject’s upper arms and belt lines. This eliminates the ‘dead’ space over your subject’s heads. Also, apply the rule of thirds. A good article about the rule of thirds and how to use it is available on the Digital Photography School website.

The important thing is to take that photograph! Photo editing programs can adjust lighting and composition. Focus on just getting the photo… and have fun!

National Geographic on Photo Gallery: How to Take Cam-era Phone pictures: http://photography.nationalgeographic.com/photography/photo-tips/camera-phone-photos/

Digital Photography School on Rule of Thirds: http://digi-tal-photography-school.com/rule-of-thirds

mo

Justmos

pa

•dpwlocts

•nHocdb


Story on page 32

Big Bend Power Station’s

Manatee Viewing Center

Education Center

Manatee Observation Deck.

Coastal Habitat TrailButterfl yGarden


Big Bend Power Station’s Manatee Viewing CenterText and photos by D. Riley

APOLLO BEACH, Fla.--Tampa Electric’s Big Bend Power Station is a familiar sight to Auxiliary members who conduct security patrols in Tampa Bay. The plant is a well-guarded security zone, and from the water, one sees only the stacks and scrubbers, the docks where the barges bring in the coal, the coal unloading facility, and the mounds of limestone that will be converted into gypsum during the combustion process. In short, the only view most Auxiliarists ever have of the power plant is the industrial side, but there is another side to the Big Bend Power plant that is best reached by land.

By land, one still sees the stacks and scrubbers, but what cannot be missed are the buildings housing the gift shop and education center. Boardwalks and decks connect the buildings to the observation deck from which the manatees are viewed. There is a picnic shelter, rest rooms, and the South Shore Café . There is also a butterfl y garden, a 900-foot tidal fl at walkway, and a habitat trail which passes through three distinctly different types of coastal ecosystems.

In the winter months, when the water temperatures drop below 68 degrees, the manatees fl ock to the warm water discharge canal beside the power plant. This has always drawn people curious to see these magnifi cent crea-tures, and in 1986, Tampa Electric Company opened the Manatee Viewing Center. Today, Big Bend’s discharge canal is a state and federally desig-nated manatee sanctuary that provides critical protection from the cold and allows visitors to watch these unique, gentle animals. The center is continu-ally being improved not only to provide the public a more enjoyable ex-

Big Bend Power Station, Apollo Beach, Fla. -- The only view that most Auxiliarists ever have of the power plant is from the water. (Wikimedia Commons image. Permission granted to copy, distribute, and/or modify this document under the terms of the GNU Free Documentation License.)

perience viewing the manatees, but also to offer increased environmen-tal education about Florida coastal areas. Since its opening nearly thirty years ago, over two million visitors have passed through the Manatee Viewing Center.

Come see Tampa Electric’s Big Bend Power Station and the Mana-tee Viewing Center from the “other” side and learn about Florida’s coast-al environment. Best of all, parking and admittance are free.

Tampa ElectricBig Bend Power Plant

Manatee Viewing Center Address: 6990 Dickman Rd.

Apollo Beach, FL 33572Phone: (813) 228-4289

Hours: 10 a.m. to 5 p.m. daily

Open: Nov. 1 through April 15 (closed Thanksgiving, at 3 p.m. Christmas Eve, Christmas Day,

and Easter)

Admission: FreeParking: Free

Use the interactive Manatee Viewing Center Web cam West:

http://tampaelectric.com/com-pany/mvc/webcamwest/


The “other” side of Big Ben Power StationTop: Boardwalks connect the Gift Shop and Education Center to the Manatee Observation Decks.

Right: The observation decks are fi lled with visitors ev-ery day that the Manatee Viewing Center is open to the public.

Below: One of the three coastal habitats through which the trail passes is a “saltern” or salt fl at, characterized by low growing vegetation.


PRIVACY ACT STATEMENT

The Privacy Act of 1974 protects names, addresses, telephone/fax numbers and e-mail addresses of Auxiliary members which may appear in this or other USCGAUX publications. As a matter of policy, information described above is not made available to the general public or outside groups without that member’s express and/or written consent. When such information appears, its privacy shall be safeguarded and the information will be clearly labeled. Publication of this in-formation by the general public and/or outside groups is prohibited by the Privacy Act.

Top left: ST. PETERSBURG, Fla.--A young visitor sits in the captain’s chair of the Coast Guard Cutter Joshua Appleby during the 2013 Sector St. Pe-tersburg open house. Photo by George Papabeis

Top right: Tampa waterfront. Josh Dargoltz from Flotilla 79 is a frequent camera phone user. See article on page 30.

Right: The Coast Guard Cutter Alligator passes the privateer sail ship Lynx during the 2013 Gas-parilla Pirate invasion. Photo by George Papabeis.

Parting Shots...

intercom spring 2013

Documents

flotilla commander gene

flotilla commander paul

coast guard stations

tampa bay

riley volume

ve ve assistant glenn

op op assistant conrad

liaison program