information to€¦ · zachary schwartz department of neurology and neurosurgery, mcc ill...
TRANSCRIPT
INFORMATION TO USERS
This manuscript has been reproduced from the microfilm master. UMI films the
text directly from the original or copy submitted. Thus, some thesis and
dissertation copies are in typewriter face, while others may be from any type of
computer printer.
The quality of this reproduction is dependent upon the quality of the copy
submitted. Bmkm or indistinct print, colored or poor quality illustrations and
photographs, print bleedthrough, substandard margins, and improper alignment
can adversely affect reproduction.
In the unlikely event that the author did not send UMI a complete manuscript and
there are missing pages, these will be noted. Also, if unauthorized copyright
material had to be removed, a note will indicate the deletion.
Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning
the original, beginning at the upper left-hand comer and continuing from left to
right in equal sections with small overlaps.
Photographs included in the original manuscript have been reproduced
xerographically in this copy. Higher quality W x 9' black and white photographic
prints are available for any photographs or illustrations appearing in this copy for
an additional charge. Cantad UMI directly to order.
Ball & Howell Information and Learning 300 NoM Zeeb Road, Ann Arbor, MI 481061346 USA
Prenatal activation of the myelin basic protein locus.
Zachary Schwartz Department of Neurology and Neurosurgery, McC ill University, Montreal
November, 1997
A thesis submitted to the Faculty of Graduate Studies and Research in partial fulfilment of the requirements of the degree of Master of Science.
@ Zachary Schwartz, 1997
National Library l*l .,"a& Bibliotheque nationale du Canada
Acquisitions and Acquisitions et Bibliographic Services services bibliographiques
395 Wellington Street 395, rue Wellington OttawaON K1AON4 Ottawa ON K1 A ON4 Canada Canada
The author has granted a non- exclusive licence allowing the National Library of Canada to reproduce, loan, distribute or sell copies of this thesis in microform, paper or electronic formats.
The author retains ownership of the copyright in this thesis. Neither the thesis nor substantial extracts fiom it may be printed or otherwise reproduced without the author's permission.
L'auteur a accorde une Licence non exclusive pennettant a la Bibliotheque nationale du Canada de reproduke, prster, distribuer ou vendre des copies de cette these sous la forme de rnicrofiche/film, de reproduction sur papier ou sur format electronique.
L'auteur conserve la propriete du droit d'auteur qui protege cette these. Ni la these ni des extraits substantiels de celle-ci ne doivent 6tre imprimes ou autrement reproduits sans son autorisation.
ABSTRACT
Cells of the oligodendrocyte lineage go through a complex sequence of
division, migration and differentiation. in transgenic mice in which the first
exon of rnvelin basic protein (MBP) has been
gene, Lac 2 expression emerges adjacent
replaced with the Lac Z reporter
to the putative source of the
oligodendrocyte lineage, after PDGFaR-expressing progenitors have left the
ventricular zone. This suggests transcriptional activity at the MBP locus
begins in oligodendrocytes at the premyelinating stage of development. Low-
level Lac Z expression is also observed in the presumptive grey matter from
embryonic day 12 (E12).
In contrast, transgenic mice bearing Lac Z fused to various lengths of the
MBP promoter suggest that, while capable of driving expression in
oligodendrocytes, the MBP promoter is unexpectedly sensitive to
deregulation from elements adjacent to its chromosomal integration site.
Expression of one construct may identify transcription factors involved in
establishing the oligodendrocyte lineage as early as E9.
RESUME
Les cellules de la lignCe oligodendrocytaire traversent des etapes
complexes de division, migration et de differenciation. Dans des souris
transgeniques ou le premier exon du gene MBP a Pte remplace par le gene
reporter Lac 2, les premieres cellules Lac Z positives sont localisees dam les
regions d'oir Cmergeraient les oligodendrocytes, deux jours aprPs que les
progtniteurs qui expriment PDGFaR ont quitte l'aire ventriculaire. Ces
observations suggerent que le gene MBP est transcrip tionnellement actif dans
les oligodendrocv tes premyelinisants. De plus, une faible expression est aussi
detectee ddas la matiere grise presomptive chez les embryons Ages de 12 jours
(E12).
Par ailleurs, lorsque Lac Z est place sous le contrde de differentes sequences
du promoteur MBP, son expression est detectee non seulement dans les
oligodendrocvtes, mais aussi de facon non specifique. Par contre, une des
constructions utilisees a induit l'expression de Lac Z dans le tube neural di.s
E9, suggerant la presence de facteurs transcriptionnels impliques dans la
Lignee oligodendrocytaire.
ACKNOWLEDGMENTS
What we call birth is the beginning of a difference. . .
- Pythagoras, Ovid's Metnnlorphosrs
With the exception of the generation of knock-in and transgenic mice, the work presented in this thesis is entirely my own.
wish to acknowledge and thank Naima Bachnou for generating MBP-Lac Z knock-in mice; Lorella Garofalo, David Foran and Irene Tetrjakoff for
generating MBP-Lac Z transgenic mice; and Priscila Valera for superb technical guidance. 1 also wish to thank Julie Tremblay and Susan Albrechtson for maintaining the mouse colonies, Danielle Lawrence tor noticing punctate staining in adult mice, and Carl Henrik-Heldin for R7 antibodies.
The work that led to this thesis, and the education that came with it, grew out of Alan Peterson's direction, perspective and the inspiration to "push back the frontiers of science." For this, 1 extend my thanks.
At the time of this writing, Canada has the world's highest incidence of multiple sclerosis. This project was partly funded by a studentship from the Multiple Sclerosis Society of Canada.
Abstract R6sum6 Acknowledgements Table of contents List of tables and figures
. 1
ii iii iv vi
1. INTRODUCTION AND LITERATURE REVIEW 1
Oligodendrocyte origins Evidence for a ventral origin of oligodendrocytes 1.1.1 The R-mAb antibody 1.2.2 Proliferation 1.2.3 The PDGF alpha receptor 1.2.4 The 0 4 antibody Evidence for a widspread source of oligodendrocytes Myelin genes 1.4.1 Mvelin basic protein 1.4.2 Golli-mbp and early expression of myelin-related genes
2. AIMS OF THIS INVESTIGATION 15
2.1 Transcriptional regulation of MBP 2.2 Regulatory elements of the MBP promoter
3. METHODS 21
3.1 Generation of mice 3.1.1 Knock-in allele 3.1.2 MBP-Lac Z transgenes
3.2 Tissue preparation 3.3 Detection of beta-galactosidase enzymatic activity
3.3.1 Histochemical staining of wholemount tissue 3.3.2 His tochemical staining of frozen sections
3.4 Immunohistochemis try
4.1 MBP-Lac Z knock-in allele expression 4.1.1 Knock-in allele expression is early and widespread -U.Z Ventral emergence of large profiles - -
4.1.3 Dorsal punctate staining 4.1.4 Ventral punctate staining 4.1.5 PDGFaR immunostaining
4.2 Prenatal MBP-Lac Z transgene expression 4.2.1 Deregulated transgene expression 4.2.2 Expression driven by the 3.lkb MBP promoter
in the early neural tube
5. DISCUSSION 47
5.1 MBP-Lac Z knock-in allele 47 5.1.1 A sensitive marker of MBP expression 47 5.1.2 The knock-in allele is expressed in oligodendrocytes 47 5.1.3 PDGFaR and the oligodendrocyte lineage 49 5.1.4 Prem yelinating oligodendrocvtes 50
5.2 Knock-in expression in the presun~gtive grey matter 51 53 54 54 55
the ventral
5.2.1 Knock-in expression in neurons? 5.2.2 A wider source of oligodendrocytes? 5.2.3 Adult progenitors
5.3 MBP-Lac Z transgenes 5.3.1 MBP promoter driven expression and
specification of the oligodendrocyte lineage 5.3.2 Deregulated transgene expression 5.3.3 Possible causes of deregulated expression 5.3.4 The MBP enhancer trap
6. SUMMARY
7. REFERENCES
FIGURES
FIGURE 1: SPINAL CORD DEVELOPMENT
FIGURE 2: OLIGODENDROCYTE ORIGINS
FIGURE 3: THE GOLLI-MBP GENE
FIGURE 4: GENERATION OF MBP-LAC Z KNOCK-IN MICE
FIGURE 5: GENERATION OF MBP-LAC Z TRANSGENIC MICE
FIGURE 6: KNOCK-IN EXPRESSlON IN WHOLEMOUNT STAINED CNS
FIGURE 7: LOCATION OF KNOCK-IN AND PDGFaR EXPRESSION
FIGURE 8: KNOCK-IN ALLELE AND PDGFaR EXPRESSION AT El3
FIGURE 9: KNOCK-IN ALLELE AM3 PDGFaR EXPRESSION AT El5
FIGURE 10: DEREGULATED LXPRESSION OF MBP-LAC Z TRANSGENES
FIGURE 11: 3.1KB OF MBP PROMOTER DRIVES EXPRESSION N THE EARLY CNS
TABLES
TABLE 1: DETECTION OF BETA-GAMCTOSIDASE IN MBP-LAC Z MICE
TABLE 2: PRE- AND POSTNATAL DETECTION OF BETA-GALACTOSIDASE
1. INTRODUCTION AND LITERATURE REVIEW
For the adult mammalian nervous system to function normally, its axons
must be insulated with tightly packed myelin. In the central nervous system
(CNS), this myelin is elaborated by oligodendrocytes. To establish and
maintain the appropriate pattern of myelination, the precursors of
oligodendrocytes must go through a complex sequence of division, migration,
differentiation and extension of processes around axons.
The identification of stage-specific markers has been instrumental in
studving the development of the oligodendrocyte lineage. In vitro, the
oligodendrocyte lineage has been classified into four stages: progenitors, pre-
oligodendrocvtes, premyelinating (or immature) oligodendrocvtes and
mvelinating (mature) oligodendrocytes. Progenitors, named 0-2A cells
because they can differentiate into both oligodendrocytes and type 2 astrocytes
(Raff et al, 1983), express the ganglioside GD3 and another ganglioside
recognized by A2B5 antibody. They also express the proteoglycan NG2
(Stallcup and Beasley, 1987) and respond to platelet derived growth factor
(PDGF; for review see Raff, 1989). Mitotic pre-oligodendrocytes continue to
express NG2 and the alpha receptor for PDGF (PDGFaR), and also express the
pro-oligodendroblast antigen (POA; Nishiyama et al, 1996b). Newlv
postmitotic oligodendrocytes, termed premyelinating oligodendrocytes, lose
expression of PDGFaR, NG2 and POA, and begin to express galactocerebroside
(GC). Mature oligodendrocytes express myelin specific proteins like myelin
basic protein (MBP), proteolipid protein (PLP) and rnyelin associated
glycoprotein (Dubois-Dalcq et al, 1986).
However, because of the richness of intercellular interactions that likely
modify an oligodendrocyte's developmental programming, these well-
defined stages identified in vitro do not necessarily correspond to
oligodendrocyte development in vivo. There are many examples of
oligodendrocytes' dependence on signals from other cells in the CNS.
Through the secretion of platelet derived growth factor (PDGF), astrocytes
likely regulate the propagation of 0-2A cells (for review see Raff, 1989).
Through contact mediated survival signals, axons appear to control the
number of oligodendrocytes, which may be overproduced during
development (Barres and Raff, 1993,1994; Burne et al, 1996). At a later stage of
an oligodendrocyte's maturation, axonal signals regulate the initiation and
maintenance of a myelinating phenotype, in addition to regulating the
proportion of myelin proteins produced by oligodendrocytes (Norton and
Cammer, 1984). Since the time course of myelination varies between tracts in
the CNS (Sabri et al, 1974), the timing of myelinogenesis may similarly be
regulated by axonal signals (Matthews and Duncan, 1971; Bjartmar et al, 1994).
Labeling with antibodies and in situ hybridization have provided insight
into the spatial and temporal emergence of oligodendrocyte markers in the
normal context of development. This section will review the basic anatomy
of the developing nervous system, and theories concerning the emergence of
the oligodendrocyte lineage.
1.1 Oligodendrocyte origins
The entire repertoire of CNS neurons, astrocytes and oligodendrocytes
develop from a single layer of neuroepithelial cells (Figure 1). Cells in this
ventricular zone proliferate and migrate away from the central canal, giving
rise to a subventricular zone (mantle layer) and marginal zones. In some
regions, Like the neocortex, the subventricular zone persists throughout life
(Smart, 1961; Privat and Leblond, 1972)- In the forebrain, tritiated thymidine
neural crest \
ventricular zone /
dorsal root,
'notochord
central canal
ventricular zone Am2a
mantle layel (gray matter
marginal la er (white matrar)
- - 3 mus communicans
-dorsal root
-spin01 gan
ventrol root
'soin01 nerve
gl ion
n oto chord ' (deg enerutingl €1 2
Figurn 1 .The spinal cord develops from a single layer of neuroeplhelial cells in the ventricular zone which divide and migrate radially, forming the mantle and marginal layers. (Adapted from The mouse. its reproduction and development". Roberts Rugh. Oxford University Press. 1990.)
and retroviral labeling studies have suggested that this proliferative
subventricular zone is a source of oligodendrocytes, even in mature
mammals (Privat and Leblond, 1972; LeVine and Goldman, 1988).
In other regions of the CNS, such as the optic nerve and spinal cord, the
subventricular zone does not persist. In these regions, proliferation of
oligodendrocy tes or their precursors is not restricted to the ventricular zone.
For example, in the rat spinal cord and optic nerve, past autoradiographic
studies suggested that oligodendrocytes (and astrocy tes) a re generated from
glial precursors which proliferate in situ (Gilmore, 1972; Matthew and
Duncan, 1971; Ling, 1976; Skoff et al, 1976; Meinecke and Webster, 1984; No11
and Miller, 1993).
1.2 Evidence for a ventral origin of oligodendrocytes
7.2.1 The R-rrtrlb arztibudu
In postnatal animals, postmitotic oligodendrocytes can be labeled with the
monoclonal antibodies R-mAb and 01 (Warrington and Pfeiffer, 1992). In the
mouse, Hardy and Friedrich (1996) used these monoclonal antibodies to
identifv the
appeared in
postmitotic,
paramedian
spinal cord,
earliest oligodendrocvtes. The earliest immunoreactive cells
the medulla and cervical spinal cord at E14. These cells were
and in the medulla were restricted to two bands in the
zone, adjacent to the midline. More caudally, in the cervical
postmitotic oligodendrocytes were restricted to the ventral
paramedian zone, between the floorplate and the central canal. At this early
time point, the myelin-specific proteins 2',3'-cyclic nucleotide 3'-
phosphodiesterase (CNP) and MBP could not be detected
immunohistochemically. Two days later, when detectable levels of both
proteins first accumulated, the first signs of myelination were observed in the
paramedian zone. Oligodendrocyte extensions were observed around axons,
and bv electron microscopy, spiraling larnellae of myelin could be seen
ensheathing axons. Not until E18, however, were postmitotic
oligodendrocytes found in the marginal zone of the medulla and spinal cord
- the presumptive white matter. Even by the day of birth, most myelin
sheaths were found in the paramedian zone. Therefore, the first postmitotic
oligodendrocvtes appear near the ventricular zone of the prenatal anterior
spinal cord, two days before mvelina tion (Hardy and Friedrich, 1996).
2 2 . 2 P r d j f i r d i o t ~
Using the thvmidine analogue bromodeoxyuridine (BrdU), Noll and
Miller (2993) examined the fetal rat spinal cord after division of neuron
precursors had ended, but before glial division in the presumptive white
matter had begun. They showed that at this intermediate age (E16.5 to E18.5)
most dividing cells were clustered near the ventricular zone, and restricted to
a discrete ventral region adjacent to the ventricular zone, similar to the
paramedian zone where postmitotic oligodendrocytes first emerge (Hardy and
Friedrich, 1996). By pulse-labeling these cells, they provided evidence that this
ventral population migrates and divides to equally populate the dorsal and
ventral spinal cord. In culture, these BrdU-labeled cells were capable of
differentiating into oligodendrocytes and astrocytes. In agreement with
similar in vitro studies using rat and mouse explants (Warf et al, 1991; Timsit
et al, 1995), dorsal spinal cord cells were capable of producing only very few
glial cells. Taken together, these results suggest the mito tic ventricular
population identified by Noll and Miller represents a source of glial cells
which migrate to the dorsal and ventral presumptive white matter.
1.2.3 Tlzr PDGF nlplzn receptor
More evidence for a restricted origin of the oligodendrocyte lineage came
from Pringle and Richardson (1993), who looked for oligodendrocyte
precursors in the prenatal rat spinal cord using probes for PDGFaR transcripts.
This receptor has been shown to be expressed in vitro by 0-2A cells (Hart et al,
1989; for review see Raff, 1989). It is also expressed in maturing forebrain
oligodendrocy tes (Ellison and devellis, 1994).
Pringle and Richardson (1993) detected PDGFaR transcripts in two
rostrocaudal columns in the ventral ventricular zone, one on either side of
the central canal, suggesting a relationship between these cells and the 0-ZA
oligodendrocyte precursors identified in vitro. At later ages, and in more
anterior levels of the spinal cord (which represent more developmentally
advanced stages), the region of PDGFaR-expressing cells was greater and
extended more laterally. Later still, the first expression in more dorsal regions
was detected, and just before birth, the entire cord was diffusely populated
with an even distribution of PDGFaR-expressing cells. La beling with
antibodies directed against PDGFaR shows an equivalent developmental
pattern (Nishiyama et al, 1996a). Furthermore, this pattern of PDCFaR
expression is conserved in rat, mouse and chick embryos (Pringle et al, 1996).
Presumably because PDGFa is a mitogen for 0-2A cells in vitro (Noble et al,
1988), the authors concluded that this emergence of the PDGF alpha receptor
was the result of cell proliferation and migration, as suggested by BrdU
labeling patterns in the experiments of No11 and Miller (1993). However, the
experiments of Pringle and Richardson did not rule out the possibility of a
wave of PDGFaR expression, unrelated to migration or proliferation. It is
possible that PDGFaR-expressing cells arise from other parts of the ventricular
zone, while only a restricted population express i t before leaving the
ventricular zone.
More evidence linking this PDGFaR-expressing population to the
oligodendrocyte lineage came from a study using the NG2 marker. At
developmental stages where PDGFaR-expressing cells appeared outside of the
ventricular zone, extensive colocalization with the NG2 antigen was
observed, and both PDGFaR and NG2 immunoreactivity fell off as MBP-
positive oligodendrocy tes appeared (Nishiyama et al, 1996a). Double labeling
with MBP antibodies revealed cells only weaklv immunoreactive for both
NG2 and MBP, suggesting that a t least some PDCFaR/NG2-expressing cells
develop into oligodendrocytes, and that cells attenuate PDCFaR/ NG2
expression as they begin to express MBP (Nishiyama et al, 1996a). [n the
~ostnatal medullarv velum, double in situ hvbridization of PDCFaR and MBP L i
similarlv suggest that differentiating oligodendrocvtes
PDCFaR before MBP expression begins (Butt et al, 1997).
lose expression of
The earliest reports of the morphology of putative oligodendrocyte
precursors in the ven tra 1 ventricular zone came from immunos taining
studies in the chick spinal cord. The 0 4 antibody is selective for the pre-
oligodendrocyte marker POA and sulfatide (Bansal et al, 1989, 1992). Using 0 4
a5 a marker of oligodendrocytes, Ono et a1 (1995) detected a population of cells
within the ventral ventricular zone near the floorplate, similar to the
PDGFaR-expressing region described by Pringle and Richardson. These cells
extended apical process to the lining of the central canal, along the lateral edge
of the ventricular zone, or into the grey matter. Ono et a1 also identified a
novel population of 04expressing cells in the ventral mantle layer. These
cells extended processes to the ventral marginal zone, the region which
corresponds to the adult lateral funiculus.
As development proceeded, 0 4 immunoreactivity in the chick spread in a
manner similar to the emergence of PDGFaR in the rat described bv Pringle
and Richardson. That is, 04-immunoreactive cells were found in the ventral
ventricular zone, then in the ventral marginal zone itself, and then in the
dorsal marginal zone. By this stage of development, 0 4 immunoreactivitv in
the spinal cord was restricted to the marginal zones.
Evidence for a more direct link between the PDGFaR- and 04-expressing
populations described above came from studies of Hajihosseini et a1 (1996),
who examined the human spinal cord, where development is more
prolonged than in rodents or chicks. They provided evidence for
colocalization of PDGFaR and 0 4 in cells adjacent to the ventral ventricular
zone. At later stages, 04-immunoreactive cells were found in more lateral
regions, along the midline in more dorsal regions, and eventuallv in
dorsolateral regions of presumptive white matter. More than half of these 04-
immunoreactive ceIls outside sf the ventricular zone could be double labeled
with antibodv to PCNA, a marker of proliferating cells, suggesting that the
cells expressing markers of digodendrocyte development may correspond to
the ventrodorsally migrating cells identified by Noll and Miller (1993).
Thus, labeling studies in the rat, chick, mouse and human developing
spinal cord show that the earliest cells expressing markers of putative
oligodendrocyte precursors are ventrally-restricted (Figure 2 A). This raises
the question of whether this ventrally restricted population represents the
source of all oligodendrocvtes.
LABELING STUDIES
Ventral origin
TRANSPLANTATION STUDIES
Dorsal and ventral origins
- I Embryonic Postnatal Embryonic Postnatal
Figure 2. Labeling studies using markers for proliferative cells, myelin-related genes, growth factor receptors, and antigens suggest that the oligodendrocyte lineage emerges from the ventral ventricular zone (A). Transplantation studies, in contrast, suggest that oligodendorcytes also emerge from dorsal sources (B).
(Adapted from Cameron-Curry and LeDouarin, 1996.)
1.3 Evidence for a widespread source of oligodendrocytes
The ventrodorsal sequence of maturation in the spinal cord does not
necessarily imply a ventral source of precursors. None of the above studies
examining the emergence of oligodendrocyte markers directly show that
these putative precursors migrate. While in vitro evidence suggests that cells
exposing these markers are capable of developing into oligodendrocytes, they
may not represent the sole oligodendrocyte source.
By switching equivalent dorsal or ventral regions of the developing spinal
cord between quails and chicks, Cameron-Currv and Le Douarin (1995)
provided evidence that oligodendrocytes develop from both the ventral and
dorsal neural tube, and that there is both ventrodnrsal and dorsoventral
migration of oligodendrocvtes or their precursors (Figure 2 B). By using quail-
or chick-specific probes, thev were able to differentiate host and graft cells, and
showed that oligodendrocytes in the dorsal spinal cord originate from both
the dorsal and ventral neural tube, as do ventral oligodendrocy tes (Cameron-
Curry and Le Douarin, 1995). These experiments suggest that, although the
earliest oligodendrocyte precursors may arise near the ventral ventricular
zone, these ventral cells may represent only a subpopulation ot the source of
oligodendrocv te precursors.
In addition, by transplanting regions of the prenatal CNS from transgenic
mice into non-transgenic adult mice, Hardy and Friedrich (1996) were able to
track the lineage of differentiated oligodendrocytes. Their results suggest that,
prior to the expression of PDGFaR or 04, cells throughout the rostrocaudal
axis of the CNS are capable of generating oligodendrocytes.
1.4 Myelin genes
[n oligodendrocytes, myelin synthesis is characterized bv high-level
expression of myelin-specific proteins such as CNP, MBP and PLP (Lees and
Brostoff, 1984). In rodents, the majority of myelination occurs postnatally.
High-level expression of MBP and PLP begins perinatally, while CNP appears
slightly earlier (Monge et al, 1986), and transcripts of one of its isoforms are
expressed in oligodendrocvte precursors (Scherer et al, 1994). Although the
stage of differentiation at which mvelin-specific gene expression begins is
unclear, the onset of myelin gene expression follows in a temporally and
spatially restricted pattern. By in situ hybridization, both MBP and PLP
message first accumulate in the medulla, appearing later in the
spinocerebellar, spinal trigeminal and part of the corticospinal tract (Verity
and Carnpagnoni, 1988).
1.4. M~/rlirl b~lsic profritz
[n the mammalian CNS, MBP accounts for one third of the protein in
myelin (Lees and Brostoff, 1984), and is required for the formation of compact
myelin (Readhead et al, 1987). MBP is also thought to be one of the earliest
expressed mvelin proteins in fullv mature oligodendrocytes (Cohen and
Cuarnieri, 1976; Monge et al, 1986), appearing after CNP but immediately
prior to myelin elaboration (Stemberger et al, 1978).
The regulation of MBP expression during myelination in development has
been studied extensively. Classic MBP transcripts are found exclusively in
myelin-forming cells (Trapp et al, 1987; Verity and Campagnoni, 1988). In
transgenic mice, as few as 256 base pairs and as much as 3.1 kb of MBP 5'
flanking sequences are capable of directing transgene expression to
myelinating oligodendrocytes (e.g. Kmura et al, 1989; Foran and Peterson,
1992; Miskimins et all 1992; Gow et all 1992; Goujet-Zalc et all 1993). The first
3.2 kb of MBP 5' flanking sequence have been shown to drive expression of a
Lac Z reporter gene at the time when compact myelin first appears (Foran and
Peterson, 1992).
I.4.Z Golli-mbp and mrly rxprrssio,~ of myrlin-refnted genes
The MBP gene is also part of a larger gene called Golli-mbp. Golli-mbp is a
105 kb transcriptional unit that contains both MBP exons 1 to 7 and four
novel ~lpstrearn Golli-mbp exons (Kitamura et al, 1990; Campagnoni et all
1993). As shown in Figure 3, exon 1A (called Golli-mbp exon 5A) spans the
213 base pairs immediately upstream of the MBP transcription start site
(Campagnoni et all 1993). Thus, sequences contained in the MBP promoter are
transcribed as exons of Golli-rnbp.
In mice, Golli-mbp transcripts containing exon 1A are detected at least as
earlv as El4 (Mathisen et all 1993). In the human spinal cord, several weeks in
advance of myelination, 04-immunoreactive putative oligodendrocyte
precursors also express Colli-mbp or classic MBP transcripts and proteins
(Hajihosseini et al, 1996). In the postnatal mouse brain, Golli-mbp transcripts
were reported to be restricted to white matter, and colocalize with transcripts
of PLP.
However, in addition to embryonic brain, Golli-mbp transcripts have been
detected in spleen and thymus, and transcripts of one Golli-mbp isoform
have been detected in cultures of B and T lymphocytes. More recently, in the
postnatal mouse brain, Golli-mbp transcripts and proteins have been detected
in neuronal populations (Landry et al, 1996). Thus, transcripts containing
MBP exons are not expressed exclusively in oligodendrocytes and Schwann
cells, and are not expressed exclusively during myelination.
7 Golli-mbp exons 1 2 3 4 r' 5 6 7 8 9 10 11
MBP exons 1 2 3 4 5 6 7
Figure 3. The MBP gene is part of a larger gene called Golli-mbp. Transcription start sites of Golli-mbp and MBP are marked as arrows above Golli-mbp exons 1 and Sb, respectively. Exons exclusive to Golli-mbp are marked as dark boxes.
(Figure Courtesy of N. Bachnou.)
Transcripts related to other myelin-specific proteins have also been
detected in the prenatal CNS. In rat and human spinal cord, the discrete
ventral population of PDGFaR- or 04-expressing cells also express CNP (Yu et
a1, 1994; Hajihosseini et al, 1996). In the rat, a different population of cells
adjacent to the floorplate transiently express transcripts of PLP or DM-20, an
alternatively-spliced embryonic isofom of PLP (Yu et al, 1994). In the mouse,
DM-20 transcripts are found earlier than postmitotic oligodendrocytes: in the
midline ot the ventral medulla at E12, and throughout the rostrocaudal axis
of the spinal cord at E l 4 (Timsit e t al, 1995). Further, double labeling in the
brain suggests that oligodendrocytes extinguish their NG2 expression as they
begin to express DM-ZO/PLP (Trapp et al, 1997).
Tnus putative oligodendrocyte precursors - identified in the early spinal
cord bv PDGFaR and 0 4 antigens - aiso express transcripts related to the
mvelin-specific genes CNP, PLP and MBP. This occurs at stages far in advance
uf the accurnula tion of myelin proteins, and raises the question of whether
the pathways that establish the early ventral focus of PDGFaR expression also
act on mvelin-rela ted genes.
2. AIMS OF THIS INVESTIGATION
2.1 Transcriptional regulation of MBP
For several reasons, post-transcriptional processing is likely to modulate
the realization of MBP protein during myelination. Firstly, MBP is unique in
that its mRNA is exported from the cell body to the oligodendrocyte's mvelin
sheath (Trapp et al, 1987; Veritv and Campagnoni, 1988). This export does not
occur at the very earliest stages of MBP expression. This suggests that MBP
mRNA transport is developmentally regulated, and is perhaps associated
with changes in oligodendrocyte morphology as ensheathment of axons
begins. Secondlv, the alternate splicing of MBP exons gives rise to various
MBP isoforms of different molecular weights (de Ferra et al, 1985; Kamholz et
al, 1986). This isoform switching appears to be developmentallv and spatiallv
regulated in mice (Barbarese et al, 1978; Carson et al, 1983), and in humans,
where certain isoforms are more predominant in earlv mvelination and
remyelination than in myelin maintenance (Kamholz et al, 1988; Jordan et al,
2990).
While experiments have been performed in the past to studv the
appearance of myelin-specific transcripts and proteins like EVIBP, less is
known about the transcriptional regulation of these myelin-specific genes. To
determine when individual oligodendrocytes begin to express myelin-specific
genes, I have taken advantage of transgenic mice in which the first exon of
MBP has been replaced with Lac Z by homologous recombination (Bachnou
et al, in preparation; Figure 4). Lac Z is a bacterial gene which is not found in
mammalian cells, and encodes beta-galactosidase protein. Beta-galactosidase
cleaves the chromogenic substrates Bluo-gal and X-gal into insoluble reaction
products, forming a blue precipitate. Only a few molecules of beta-
Figure 4. The generation of the MBP-Lac Z knock-in allele. A targeting vector
containing Lac Z and a neomycin resistance gene (neo) was generated and
electroporated into embryonic stem cells. Normal and homologously
recombined alleles were identified by their band lengths: DNA in which the
vector had recombined at the first exon of MBP (Golli-mbp exons %,c) gave
bands of 2.3 and 11 kb when probed with sequences 3' and 5' of the targeting
sequences.
(Figure courtesv oC N. Bachnou)
galactosidase are necessarv for the histochemical detection of its activity,
providing a sensitive in vivo marker of Lac Z expression (Alam and Cook,
1990).
When Lac 2 is integrated into the mouse genome as a transgene, beta-
galactosidase activity should therefore depend on i ) the activity of
transcriptional machinery acting on MBP regulatory elements, i i ) the
transcriptional efficiencv of the Lac Z reporter gene, iii) the stabilitv and
translational efficiency of Lac Z transcripts, and iv) the stability of beta-
galactosidase protein. The Lac Z gene product is believed to be realized with
uniform efficiency regardless of the cell type in which it is expressed
(Bonnerot and Nicolas, 1988). Barring any interference in the realization of
beta-galactosidase in cells which normally express MBP, this approach should
reveal the spatial and temporal progress of initiation of MBP transcription.
Therefore transgene expression in these mice should be dependent on post-
transcriptional processing of Lac Z, and not the normal post-transcriptional
regulation of oligodendrocvte markers.
2.2 Regulatory elements of the MBP promoter
[n addition to knock-in mice, which should express Lac Z in the context of
the entire complement of MBP's regulatory sequences, transgenic mice
bearing Lac Z driven by 3.1 to 9.6 kb of MBP 5' flanking sequence were also
available (Foran and Peterson, 1992; Garofalo et al, in preparation; Figure 5).
Once I had used knock-in mice to characterize the developmental pattern of
MBP expression at the transcriptional level, I examined these transgenic mice
bearing various truncated MBP promoters in the hopes of mapping MBP's
regulatorv elements. In these mice, Lac Z expression should reveal the net
effect of the limited regulatory elements captured within each construct.
Comparing expression patterns of each transgene with that of the knock-in
allele should have allowed me to determine which, if any, of the constructs
contain the regulatory elements responsible for the developmental
emergence of MBP expression. If any differences were found between the
constructs, this would allow me to map the location of MBP regulatorv
elements.
3.1 Generation of mice
3.1.1 Kwck- in d e l e
To investigate the transcriptional activitv conferred by the complete
repertoire MBP regulatory elements, prenatal beta-ga lactosidase activity was
examined in an MBP "hock-in" preparation: transgenic mice in which the
first exon of MBP had been replaced with Lac Z by homologous
recombination (Bachnou et all in preparation). Briefly, a targeting vector had
been made with the bacterial Lac Z gene and neomycin resistance gene
flanked bv sequences upstream and downstream of MBP exons 1B and IC
(Figure 4). This construct had been electroporated into embryonic stem (ES)
cells from 1291 inbred mice, and ES clones containing the construct had been
selected with the neomycin analogue G418. Of the surviving clones, DNA
was digested with EcorI, run on a gel, and probed with a combination of
sequences inside and outside of the targeting vector. Normal and
homologously recombined (knock-in) alleles were identified by their band
lengths. Cells from one ES clone containing the knock-in allele had been
injected into C57/B16 blastocytes and transplanted into pseudo-pregnant
females. The resulting chimeras were mated with C57/B16 inbred mice.
Offspring in which germline passage of the knock-in allele had been achieved
were identified
different inbred
C3H for two or
by their agouti coat colour and backcrossed to a number of
strains. In this study, embryos used had been backcrossed to
three generations.
3.1.2 MBP-Lnc Z
To determine
that act on MBP
various lengths
transgenes
the spatial and temporal appearance of transcription factors
regulatory elements, mice in which reporter genes driven by
of the mouse MBP promoter were examined a t prenatal
stages. As shown in Figure 5, these constructs included either 3.1, 6.5, 8.0 or 9.6
kb of MBP 5' flanking sequences, including the MBP transcription start site,
iused to Lac Z (Form and Peterson, 1992; Garohlo et al, in preparation). The
Lac Z gene contained a partially attenuated SV4O large T nuclear localization
signal sequence to direct Lac Z message to the nucleus and cytoplasm, and an
SV-LO polvadenvlation signal (Kalderon et al, 1984). Two additional constructs
contained 6.5 kb of MBP 5' flanking sequence and Lac Z fused to the 584 bp
upstream of the first 9.1 kb of MBP 5' flanking sequence. At least two
independent lines bearing each construct were examined.
3.2 Tissue preparation
To examine expression of the knock-in allele, litters backcrossed to C3H
were obtained by mating female C3H mice with male mice hemi- or
homozvgous tor the knock-in allele. To examine early expression of the MBP-
Lac Z transgenes, mice hemizygous and, where available, homozygous tor the
MBP-Lac Z transgene were mated. As controls, litters from non-transgenic
C3H and C57/B6 inbred strains and their F1 hybrids were examined.
The morning of the vaginal p!ug was marked as embryonic day 0 (EO). At
E9, E10, E l l , E12, E13, E15, El7 and E18, pregnant dams were killed by cervical
dislocation. Embryos were dissected free from fetal membranes under ice-cold
0.1 M phosphate buffer (PB). Pups were born on El9 and were sacrificed by
inducing hypothermia. At ages above E l l , mice were transcardially (and
delicatelv!) perfused with approximately 5 rnl of fixative using a 30 G1/2 metal
Precision Glide needle, and then incubated in the same fixative at 4 ' ~ with
gentle agitation, as described below. To allow access to the spinal cord, the
skin overlying the hindbrain and spinal cord was removed, and an incision
was made in the roof of the fourth ventricle.
To identify transgenic and non-transgenic embryos in litters from
hemizygous sires, placentae were collected and frozen before the perfusion
step. Samples were subsequently digested in Proteinase K and the DNA was
extracted with phenol and precipitated with ethanol. For detection of the
transgene by PCR, two Lac Z specific primers flanking a 539 bp sequence were
added to the DNA: Lac 1 (5'GGCTTACGGCGGTGATTTTGG3') and Lac 2
(5'AAAAACAACTGCTGACGCCGC3'). Amplification was performed in a
Perkin Elmer Cetus Thermal Cycler (Norwalk, CT) for 30 cycles. The PCR
reaction mixture was electrophoresed in a 0.8% agarose gel (Boehringer
Mannheim, Laval, QC) and stained with ethidiurn bromide
To prepare tissue for wholemount staining, embrvos were fixed for two
hours in fresh Webster's fixative: 0.5% paraformaldehyde (Fisher Scientific,
Fair Lawn, NJ), 2.5% glutaraldehyde (Mecalab, Montreal, QC) in 0.1 M PB, pH
7.4. At ages older than E l l , the brain and spinal cord of each embryo was
dissected free. To prepare tissue from mice older than E19, mice were
sacrificed by lethal injection with approximately 0.3 ml of Avertin,
transcardially perfused with 5 to 10 mi of ice cold PB and then Webster's
fixative before tissues of interest were collected and fixed as described above.
To prepare tissue for histochemical and immunohistochemical analysis of
adjacent sections, PB containing 2% paraformaldehyde, 0.075 M L-lysine-
monohvdrochloride and 0.01 M sodium periodate was substituted for J
Webster's fixative. After
overnight at 4 ' ~ in 30%
&
four hours of fixation, embryos
sucrose in PB. Spinal cords were
were cryoprotected
dissected out along
with surrounding tissue, and brains were dissected free. At ages over E13,
spinal cords were cut into cervical , thoracic and lumbar pieces with a razor
blade. Tissue was then rinsed in PB, blotted dry and embedded in Tissue-Tek
O.C.T. compound (Miles Inc., Elkhart, IN). Tissue blocks were frozen in
0 0 isopentane at -65 to -80 C and stored at -70 C under isopentane. Cryostat
sections were cut at 12 microns and collected on Snowcoat X-tra coated slides
(Surgipath, Winnipeg).
3.3 Detection of beta-galactosidase enzymatic activity
3.3.1 Histocltrmicnl stairzijly o f i~401ml0~lt~t t isst ie
For w holemount histochemical detection of beta-galactosidase activity,
embrvos m d tissues were rinsed in PB and stained overnight (from 14 to 22
hours) at 37% in PB containing 10 rnM potassium ferricyanide and 10 rnM
potassium ferrocyanide, to which 2 mM MgC12 and 0.4 mg/ml of the
chromogenic substrate Bluo-gal (Bethesda Research Laboratories) had been
freshly added. Bluo-gal is cleaved into a blue precipitate by the beta-
galactosidase enzvme. After post-fixation at room temperature in Webster's
fixative, embrvos and tissue were examined and subsequently embedded in
15% gelatin in PB for sectioning at 50 to 100 microns using a Microcut
vibratome (EM Corp, Chestnut Hill, MA). As negative controls, littermates
identified as non-transgenic by PCR or wholemount staining were also
examined and sectioned.
3.3.2 Histoclzumicnl stninitzg of frozen sections
For histochemical detection of beta-galactosidase activity in frozen sections,
sections were air-dried for at least 20 minutes at room temperature and either
0 stained immediately or stored at -20 C. For staining, PB containing 10 mM
potassium ferricyanide, 10 mM potassium ferrocyanide, and freshly added 2
mM MgC12 and 0.8 mg/ml of the chromogenic substrate X-gal (Bethesda
Research Laboratories) was added to each slide under a coverslip. Sections
0 were incubated overnight at 37 C in a moist container, rinsed in PB and
mounted in glvcerol. Some sections were briefly counterstained with Nuclear
Fast Red (Zvmed, San Fransisco, CA).
For immunohistocl~emistry, frozen sections were immediatelv post-fixed
for 30 minutes in ice-cold PB containing 30% sucrose and 10% formaldehyde.
All subsequent steps were performed at room temperature. After three 5
minute washes in 0.5 M Tris, pH 7.6 containing 0.1% Tr i ton4 100, sections
were blocked for 20 minutes with 0.5 M Tris, 0.190 Triton-X 100 containing 7%
normal goat serum. Sections were incubated overnight in a moist chamber in
100 microlitres of primary antibody. After three more washes, sections were
incubated in bio tinvlated goat anti-rabbit IgG antibodies (Vector Laboratories).
Secondarv antibodv was visualized with a Vectastain kit according to the
manufacturer's directions (Vector Laboratories). The tinal incubation in the
chromogen 3.3'-diaminobenzidine-hydrochloride lasted 10 minutes, and
sections were mounted in glycerol. As a control, primary antibody was
replaced with normal goat serum.
Antibodies were diluted in 0.5 M Tris, 0.1% Triton-X 100 containing 1%
normal goat serum, and were used at the following dilutions: polyclonal
rabbit anti-PDGF, 1:5000; bio tinylated goat anti-rabbit, 1200. The polyclonal
rabbit R7 antibodv was raised against the cytoplasmic portion of the human
PDCF alpha receptor (Eriksson et al, 1992) and was a generous gift of Dr. Carl-
Henrik Heldin (Ludwig Lnstitute for Cancer Research, Uppsala).
4. RESULTS
4.1 MBP-Lac Z knock-in allele expression
4.1.1 MBP-Lac Z knock-in allele expression is early nnd widesprmd
To identify the timing of the onset of expression of the knock-in allele,
wild-type littermates identified by PCR were used to control for any weak
Idbeling that might arise from sources other than the knock-in allele's
expression. Using this approach, no staining was detected at E l0 or E l l . The
earliest stage at which embryos bearing the knock-in allele could be
unequivocallv identified by histochemistry using the Bluo-gal substrate was
E12, four days before the reported detection of MBP protein (Hardy and
Friedrich, 1996). At this early time point, staining was visible with the naked
eve, and appeared as a bilateral pair of rostrocaudal columns in the medulla.
In transverse sections at E12, labeling profiles formed a continuous U shape
lateral and dorsal to the fourth ventricle (Figure 6). At later prenatal stages the
staining in the medulla grew more robust. At E13, staining was visible in the
presumptive grev matter of the developing spinal cord. In agreement with a
general rostrocaudal development of the spinal cord, this staining was
restricted to the cervical spinal cord at E13, but extended to lumbar regions by
E l 5
While not examined in detail, prenatal staining was also observed outside
of the spinal cord. A single stripe along the midline of the forebrain's dorsal
surface stained from El2 to E13. By E l 5 the forebrain staining disappeared. In
the peripheral nervous system, staining was observed in the dorsal root
ganglia and spinal roots beginning at around E15. At all ages examined,
including postnatal stages, no beta-galactosidase activity was detected in the
Figure 6. Bluo-gal histochemistry reveals early expression of the MBP-Lac Z
knock-in allele. A transverse section through the medulla at E l 2 shows the
earliest Bluo-gal staining is not restricted to the ventral midline, where the
first oligodendrocytes are reported to emerge (A). At E13, staining is observed
in the developing grey matter of the cervical (B) and lumbar (C) spinal cord.
spleen or thymus - two tissues which are reported to express Golli-mbp, but
not MEW.
The Bluo-gal substrate can penetrate a few hundred microns into tissue. in
wholemount sections, it appeared to penetrate through the entire cross-
sectional area of the spinal cord: when wholemount-stained spinal cords were
examined in 50 and 100 micron thick vibratome sections, staining was
observed in the presumptive grey matter. Only rare staining profiles were
observed in the presumptive white matter. Staining profiles appeared to be
highlv branching, and no cell bodies were obvious, making i t impossible to
identifv the location of
analvsis was performed
the staining pattern was
4.1.2 Verrtml rnwryrncr
To examine this early
higher resolution, I cut
staining cells. As shown below, when histochemical
on 12 micron-thick sections using the X-gal substrate,
markedly different.
of inrye profifes
and widespread expression of the knock-in allele at a
the spinal cord into 11 micron transverse sections
before performing histochemistry with the X-gal substrate. Using this
approach, two forms of staining were observed: large dark-staining profiles
near the ventricular zone or presumptive white matter; and light, punctate
staining in the presumptive grey matter. Each form of staining emerged in a
distinct pattern.
Large, dark-staining profiles were first observed adjacent to the ventral
ventricular zone (Figure 7) near the region where PDGFaR-expressing cells
first emerge in the neural tube (see below). As described below, they appeared
to migrate ventrallv in two bands adjacent to the midline. h rare sections in
the rostra1 spinal cord at E13, a solitary blue profile could be detected adjacent
to the ventral ventricular zone (Figure 8 A,C). No staining was observed in
Figure 7. Location of MBP-Lac Z knock-in allele m d PDGFaR expression.
Alternate transverse sections of knock-in spinal cords (not shown to scale)
were stained with X-gal or R7, to reveal beta-galactosidase activity or PDGFaR
immunoreactivity, respectively. A: Large X-gal staining profiles emerge
adjacent to the ventral ventricular zone at E l 5 and populate the ventral
white matter by E19, the day of birth. Clusters of punctate staining are
observed in the ventrolateral mantle layer from E l 3 through E17, and dorsal
to the central canal (cc) from E l 5 through E19. Punctate staining is also
observed in the dorsal horns. B: At E13, PDGFaR-immunoreactive profiles
(arrow) are beginning to spread laterally from the ventral ventricular zone,
and diffusely populate the spinal cord bv E15.
A X-Gal staining B R7 lmmunostaining
Figure 8. Adjacent transverse sections of El3 knock-in spinal cord were
stained with X-gal (A,C) or R 7 antibody (B,D), and photographed at low (A,B)
and high power (C,D). At this early age, rare X-gal staining profiles (arrow) are
found adjacent to the ventral ventricular zone, dorsai to the floorplate (C).
PDCFaR-immunoreactivity is restricted to the ventral cord and is beginning
to spread laterally, so that staining is observed both within and immediately
adjacent to the ventricular zone (D). fp: floorplate.
more caudal sections. Two days later, at E15, one or two blue profiles were
found in the same region, adjacent to the ventral ventricular zone (Figure 9
A,C). Bv this stage of development, however, the profiles were much larger,
resembling cell bodies. Furthermore, the profiles were common: they
appeared in about half of the sections and were not restricted to rostral levels
of the spinal cord. A semi-oblique section revealed a discontinuous
rostrocaudal column of profiles. h some sections, profiles were also detected
between the ventricular zone and the ventromedial marginal zone, or within
the ventromedial marginal zone. By E l 7 this pattern had reversed: only rare
profiles were detected adjacent to the ventral ventricular zone, while one or
two profiles were commonly detected adjacent to the midline between the
ventricular zone and ventral marginal zone. In addition, two to three profiles
could be found in the ventromedial or rnediolateral marginal zone. Bv the
day of birth, E19, profiles were restricted to the developing white matter:
numerous profiles had populated the entire ventral and lateral marginal
zones, and in rostral sections, one or two profiles also appeared in the dorsal
marginal zone.
4.1.3 Dorsnl princtnte stairling
A punctate form of staining was also observed, beginning adjacent to the
midline and spreading dorsally and laterally into the dorsal horns. This
punctate staining first appeared adjacent to the ventricular zone at E15, at all
levels of the spinal cord (Figure 7). In some sections two distinctly dense
clusters of punctate staining were detected near the ventricular zone's dorsal
aspect, and in some sections a smaller, second pair of clusters was detected
near it's ventral aspect. Some sections also contained diffuse punctate staining
in the dorsal grey matter, near the dorsal horns. By E l 7 and through to E19,
Figure 9. Adjacent transverse sections of El5 knock-in spinal cord were
stained with X-gal (A,C) or R7 antibody (B,D). At low (C) and high (D) power,
two profiles stained with X-gal are visible adjacent to the ventral ventricular
zone, dorsal to the floorplate. One profile is found in a more ventral
paramedian region. At this age, PDGFaR-imrnunoreactivity is diffusely
spread through the spinal cord (B), and is no longer found in the ventricular
zone (D).
the bilateral clusters of punctate staining dorsal to the ventricular zone were
common, and did not change in size or density. Similarly, the staining in the
dorsal horns became more common and dense bv E17, but appeared stable
through to E19. This dorsal punctate staining generally avoided the dorsal
white matter.
4.1.4 Vmtml plinctnte stairzing
A separate region of punctate staining was also observed from E l 3 to E17,
in regions which likely corresponded to the lumbar and cervical
enlargements. This punctate staining took the form of a dense cluster in the
ventrola teral grey matter, in the region where motoneuron cell bodies are
found. At E l 3 these clusters were observed in sections representing about 600
microns of the rostrocaudal length of the rostra1 spinal cord; as in
wholemount tissue staining was not observed at more caudal levels.
4.2.5 PDGFnR inrm~inostnininy
To directlv compare the emergence of the knock-in allele and other
markers of the oligodendrocyte lineage, transverse sections of knock-in spinal
cords were imrnunostained with antibodies against PDGFaR. Adjacent
sections were histochemically stained with X-gal.
Immunostaining with the R 7 antibody against PDGFaR followed the
expected pattern. At E13, immunostaining revealed a discrete population of
ventricular cells in the ventral region of the spinal cord, near the region
where rare large blue profiles were found (Figure 8 B,D). Some
immunostaining profiles were a short distance from the midline, suggesting
that PDGFaR-expressing cells had begun to detach from the ventricular zone
and migrate laterally. By E15, immunostaining profiles were observed
throughout the ventral and dorsal grey and white matter, in a very slight
ventrodorsal gradient (Figure 9 B,D).
On the day of birth, when the density of PDGFaR immunoreactive cells is
near its highest (Nishiyama et al, 1996a), immunostaining profiles evenly and
diffusely populated the entire cross-sectional area of the spinal cord, as
expected. Using the small central canal as a landmark in adjacent sections, it
was possible to examine the bilateral cluster of X-gal stained cells for
immunoreactivity to PDGFaR. In rare pairs of adjacent sections, one cell
immunoreactive for PDGFaR appeared to colocalize with one of the cells in
the bilateral clusters of X-gal staining. In most pairs of adjacent sections, no
PDGFaR immunoreactive cells could be detected in these X-gal staining
clusters. Although it was difficult to tell conclusively, especiallv in the
marginal zones, large profiles did not appear to colocalize with PDGFaR.
4.2 Prenatal MBP-Lac Z transgene expression
4.2.1 Derqiilatt-li t riz1zsg7ew e.rpressiu)l
Having established the pattern of MBP expression in the developing spinal
cord, I tried to map the regions of the MBP promoter responsible for this early
expression. Mice bearing variously deleted MBP-Lac Z transgenes were
stained wholemount at prenatal stages. Unexpectedlv, Lac Z expression
conferred by the MBP promoter was deregulated during prenatal
development.
Fifteen independently derived lines of MBP-Lac Z transgenic mice
containing various lengths of the MBP promoter were stained for beta-
galactosidase activity. Although all of these lines expressed the transgene in
oligodendrocytes after birth (Foran and Peterson, 1992; Garofalo et al, in
preparation), four of these lines (27'/0), bearing two different constructs,
demonstrated four distinct staining patterns at E l 0 (Figure 10). As shown in
Table 1, one line expressed in the somites and tissue surrounding the neural
tube, one in the myelencephalon and optic recess, one in the floorplate and
somites, and one in the telencephalon, limb buds and urogenital ridge. This
suggests that, in these cases, the prenatal expression of the reporter gene was
uniquely influenced bv cis-acting elements adjacent to the transgene's
integration site.
To determine whether this ectopic transgene expression was restricted to
embryonic development, tissues from wild-type and MBP-Lac Z transgenic
mice were examined at later ages. In addition to brain and spinal cord and
their meninges, the kidney, thymus and spleen were collected and stained
wholemount. In some lines, the ribs, vertebrae and lungs were also collected.
No staining was observed in the thymus, spleen, lungs, ribs or vertebrae.
However, as shown in Table 2, two lines bearing different constructs
displaved robust staining that likely corresponded to their prenatal staining.
Line 17, for example, exhibited staining in the urogenital ridge. The caudal
end of the urogenital ridge gives rise to the kidney. At postnatal day 4, Line 17
was the onlv line to exhibit robust staining on the surface of the kidney.
.-\nother line - Line 9 - exhibited robust staining in the meninges of the
brain and spinal cord at postnatal stages, likely corresponding to its prenatal
staining of the tissue immediately surrounding the neural tube. At both pre-
and postnatal stages, this staining pattem was exclusive to Line 9.
4.22 E.rprrssion dr iwn by the 3.Ikb MBP promoter in the mr ly ne~irnl hrbe
Despite the frequency of ectopic expression of the MBP-Lac Z transgene,
one prenatal expression pattem was common to two lines of transgenic mice
bearing the same construct, suggesting it was mediated by regulatory elements
Figure 10. Deregulated expression of MBP-Lac Z transgenes a t E10. Line 17
expresses in the telencephalon, branchial arches, otic vesicle, limb buds and
telencephalon (A). Line 9 expresses in the somites and tissue surrounding the
neural tube (B). Line 32 expresses in the somites (C) and floorplate of the
neural tube (not visible in wholemount). Lines 17 and 32 (A, C) contain the
same construct. In all three of these lines, the transgene is expressed in
oligodendrocytes after birth.
Table 1. Detection of beta-galactosidase in prenatal MBP-Lac Z mice.
Construct Line OJS 500 bp Prenatal Expression 9.6 kb 32 + + + somites, floorplate 9.6 kb 17 + + + telencephalon, limb buds, urogenital ridge
3'+6,5 kb 16 + + + myelencephalon, optic recess 3'+6.5 kb 9 + + + somites, tissue surrounding neural tube
3.1 kb 80 + + neural tube 3.1 kb 1 + + * neural tube 9.6 kb 24 + +
3'+6.5 kb 19 + + 3'+6.5 kb 10 + + 3' rev +5 kb 7 + + -
8.6 kb 18 + 8.6 kb 11 + - 6.5 kb 5 + - 6.5 kb 2 + 3.1 kb 49 +
* In these two cases, expression pattern was identical in both lines.
MBPpromoted transgenes are susceptible to deregulation at prenatal stages: Of 15 lines expressing the transgene in oligodendrocytes, four (27%) displayed distinct staining patterns at €10. These four lines represent 50% of the lines containlng a 500bp far upstream MBP 5' flanking sequence.
Table 2. Detection of beta-galactosidase in pre- and postnatal MBP-Lac Z transgenic mice.
In at least two lines of transgenic mice, prenatal ectopic expression corresponds to postnatal ectopic expression.
Meninges Kidney Construct Line CNS Pre Post Pre Post Thymus Splwn
9.6 kb 32' + - - - -
C5786 wild type control" - - - - -
First postnatal week " Third postnatal week **' Eight months
contained within the transgene. Two lines of mice bearing the 3.1 kb MBP-Lac
Z construct exhibited staining in regions of the ventral neural tube: in the
midbrain at the mesencephalic flexure, and in a horizon of cells in the
ventral spinal cord (Figure 11). One day earlier, at E9, staining was restricted to
the mesencephalic flexure and a few individual cells in the rostra1 developing
spinal cord. Bv E12, staining was no longer detected.
Therefore, despite appropriate expression in oligodendrocytes, two
constructs containing 6.5 and 9.6 kb of the MBP promoter, were also expressed
ectopicallv. Another construct, containing 3.1 kb of MBP promoter, was
expressed in the early neural tube in an equivalent
mice. None of these expression patterns corresponded
MBP knock-in allele.
pattern in two lines of
to the expression of the
Figure 11. Expression of a Lac Z transgene driven by elements within the first
3.1 kb of the MBP promoter. A: Wholemount stained Line 80 embrvo at E l l .
Line I , which contained the same MBP-Lac Z construct, displaved the same
expression pattern. 8: Sagittal section of the head showing focus of staining in
the neural tube near the mesencephalic flexure (arrowhead). C: Transverse
section through the neural tube at the level of the forelimbs. Staining is
restricted to a ventral horizon (arrow), near the region where putative
o 1 igodend rocy te progenitors will later emerge. tel: telencep halon, ov: optic
vesick.
5. DISCUSSION
5.1 MBP-Lac Z knock-in allele
5.1.1 Kllock-irt niicr prozvde n sensitive nznrkrr oJ MBP r.rpression
Bv examining mice in which the first exon of MBP has been replaced with a
Lac Z reporter gene, I have mapped the emergence of MBP expression in the
prenatal mouse spinal cord. These "knock-in" mice provide a uniquely
sensitive marker of transcriptional activity at the MBP locus. Onlv a few
molecules of Lac Z-encoded beta-galactosidase are necessary for the
conversion ot substrate into a visible blue precipitate (Alam and Cook, 1990)..
Wild-type mice which do not bear the knock-in allele were used as a negative
control for endogenous beta-galactosidase activity, and virtually no staining
was observed in sections of wild type mice.
While the possibility that expression of the MBP-Lac Z knock-in allele is
driven bv Golli-mbp regulatory elements cannot be ruled out, this seems
unlikelv. No beta-galactosidase activity was detected in the spleen or thymus,
which are reported to express Golli-mbp (Campagnoni et al, 1993).
Additionally, while not examined in these studies, Northern blots of mRNA
from adult knock-in mice reveal only authentic Lac Z message - no larger
transcripts that may correspond to transcripts of Colli-mbp exons spliced to
Lac Z were detected (N. Bachnou, unpublished observations).
5.1.2 The knock-in allele is expressed in oligodendrocytes
The emergence of large staining profiles in MBP-Lac Z knock-in mice is
consistent with earlier reports of the appearance of oligodendrocytes and MBP
expression. Before appearing in the white matter, knock-in allele expression
is restricted to a few, large profiles resembling cell bodies in the ventral
paramedian zone, adjacent to the midline. Later in development, similar
profiles rapidlv populate the entire ventral and lateral white matter. The
appearance of profiles in the dorsal white matter is delayed. A similar spatial
and temporal restriction is observed in examinations of prenatal MBP
expression in humans (Hajihosseini et al, 1996) and in the emergence of MBP
protein and postmitotic oligodendrocytes in mice (Hardy and Friedrich, 1996).
Further, expression of the MBP-Lac Z knock-in allele appears to begin in cells
outside of the ventricular zone. Ln the prenatal human spinal cord, MBP
transcripts and protein are also detected adjacent to the ventricular zone, in
cells which can be labeled with 0 4 antibodv (Hajihosseini et al, 1996).
However, a recent study suggests that MBP is expressed bv cells before
leaving the ventricular zone. Peyron et a1 (in press) have detected MBP
transcripts within the ventral ventricular zone of the mouse at El4. While in
MBP-Lac Z knock-in mice, it is possible that a focus o t cells in the ventricular
zone may have expressed the knock-in allele before E15, this seems unlikely.
Rare protiles with beta-galactosidase activity were observed at E13, and were
located outside of the ventricular zone. At this stage, PDGFaR-expressing cells
were beginning to migrate away from the ventricular zone.
One explanation for the results of Peyron et a1 is that their in situ
hybridization does not afford a high enough resolution to determine whether
MBP transcripts are within the ventricular zone or the adjacent mantle layer.
Indeed, Pevron et a1 also reported colocalization of MBP with CNP and dm-20
transcripts, while in situ hybridization in the larger rat spinal cord suggests
that CNP and dm-20 actually define adjacent but non-overlapping
populations within the ventricular zone (Yu et al, 1994).
In the chick, Ono et a1 (1994) have described putative oligodendrocyte
precursors, some of which have cell bodies adjacent to the ventricular zone
and extend apical processes to the central canal. However, it seems unlikelv
that MBP transcripts would be localized in these cellular processes without
also accumulating in the cell body. MBP transcripts are not reported to
localize to oligodendrocyte processes until after the initiation of
rnvelinogenesis, which does not occur in the midline of the spinal cord until
E l 6 (Hardy and Friedrich, 1996).
Another explanation for Peyron et al's detection ot MBP in the ventricular
zone is that their MBP probe might hybridize to transcripts of Golli-mbp. In
the mouse, Goili-mbp transcripts have been detected as early El4 (Mathisen et
'11, 1993), and in vitro, Golli-mbp has been detected in oligodendrocyte
progenitors as earlv as the 0-2A stage (Campagnoni et al, 1993).
5.1.3 PDC FLIR tlnd tfw oliyodm~irocyte h e n y e
Although I have argued that MBP is not expressed by cells in the
ventricular zone, i t is striking that knock-in allele expression is first detected
adjacent to the original ventricular focus of PDGFaR immunoreactivitv. This
expression of the knock-in allele does not appear to begin until putative
oligodendrocvte precursors - defined by PDGFaR irnmunoreactivity - have
spread throughout the spinal cord. This suggests that cells expressing the
knock-in allele do not represent the leading edge of migrating
oligodendrocyte precursors. Rather, similar to neuron precursors, the earliest
cells to leave the ventricular zone may migrate the least, and these profiles
mav mark the first oligodendrocyte precursors to have emerged from the
ventricular zone. Similarly, since glial precursors continue to proliferate
outside of the ventricular zone, these profiles may mark the first daughter
cells left behind as oligodendrocyte precursors continue to migrate through
the presumptive grey matter.
5.1 .-! Prcnl yelinntin y oligodendrocytes
Double in situ studies in the anterior medullary velum of the postnatal rat
have suggested that PDGFaR and MBP are expressed in the same
oligodendrocyte lineage at non-overlapping stages (Butt et all 1997), similar to
prenatal stages (Nishiyama et al, 1996). Morphological analysis suggests the
switch from PDGFaR to MBP expression occurs in oligodendrocytes as they
enter the premyelinating stage of differentiation (Butt et al, 1997).
Given the appropriate spatial appearance of large X-gal staining profiles, it
is likelv that expression of the knock-in allele reflects the earliest transcription
of MBP in newly differentiated oligodendrocytes. These large profiles probablv
represent immature oligodendrocytes which are beginning to enter the
mvelinil ting program of gene expression - the first oligodendrocy tes to reach
the premyelinating stage of development. In rodents, premyelinating
oligodendrocy tes are characterized by a large cell body and starburst
morphology of non-ensheathing processes (Hardy and Friedrich, 1996; Butt et
al, 1997). Labeling with Rip or 0 4 antibodies should reveal whether the first
cells expressing the knock-in allele have this characteristic morphology.
A t the premyelinating stage of development, oligodendrocytes are
postmitotic and non-migratory. In the mouse, the first oligodendrocytes
identified by R-mAb do not incorporate BrdU, suggesting they are either
postmitotic or dividing very slowly (Hardy and Friedrich, 1996). [n MBP-Lac Z
knock-in mice, the number of staining profiles in the paramedian zone
remains stable. This suggests that either the knock-in allele is expressed in a
postmitotic population of cells, or if the cells are dividing, only one daughter
cell continues to express the knock-in allele. It is also possible
are dividing along a roshocaudal axis, so that the number of
in each transverse section remains relatively constant.
that these cells
profiles visible
Although not
examined in detail, this could be tested by measuring whether the number of
sections that contain staining profiles increases from El5 to E17.
There is one inconsistency with the hypothesis that there is transcriptional
activity at the MBP locus in premyelinating oligodendrocytes. X-gal staining
profiles are first observed at El5 in a discontinuous rostrocaudal column of
cells adjacent to the ventricular zone. As development progresses, X-gal
staining profiles near the ventricular zone become more rare, while profiles
in more ventral regions become common. The simplest interpretation of this
pattern is that cells expressing the knock-in allele are migrating ventrally
through the paramedian zone. The interpretation that knock-in expressing
cells are migra torv is inconsistent with their being premyelinating cells.
One explanation is that these staining cells may remain stationary while
the morphology of the spina! cord changes, causing the central canal and
ventricular zone to regress. One could then imagine that the X-gal staining
profiles, detected near the ventricular zone at E15, actually mark the region
that will become the dorsal boundary of the ventromedial white matter by
El7 or E19. One other interpretation is compatible with these results. I t is
possible that, before E19, a non-migratory population of cells transiently
expresses the knock-in allele in a dorsal to ventral wave.
5.2 Knock-in expression in the presumptive grey matter
A second form of staining in the MBP-Lac Z knock-in mice is more
difficult to interpret. This staining, which likely corresponds to low level
expression of the knock-in allele, emerges in a pattern not associated with any
other marker of the oligodendrocyte lineage: it is found in the presumptive
ventrolateral grey matter, and in the paramedian zone, spreading to the
dorsal horns. In Bluo-gal stained spinal cords it takes the form of thin
branching profiles; in X-gal stained frozen sections it takes the form of
punctate staining.
Since the punctate X-gal staining has not been examined at the
~iltrasctructural level, it is unclear whether it marks cell bodies, subcellular
organelles or even cytoplasmic oxidation centres which accumulate insoluble
pigment, as described by Ueno et a1 (1987). It may correspond to low-level
expression of Lac 2, or fusion transcripts containing both Golli-mbp and Lac Z
sequences which are not detected by Northern blot because of their low
abundance.
Although there is evidence that cells of the oligodendrocyte lineage switch
trom PDGFaR to MBP expression as they enter the prernyelinating stage (Butt
et al, 1997), it seems unlikely that the low-level knock-in allele expression
arises from cells in the lineage marked bv PDGFaR. First, the punctate X-gal
staining is condensed in two bilateral clusters at the dorsal ventricular zone,
while PDGFaR immunoreactivity is diffuse and raltdom. Second, unlike the
oligodendrocvtes that switch from PDGFaR to MBP expression in the
postnatal rat (Butt et al, 1997), cells which might be defined by punctate
staining do not appear to immediately enter a premvelinating program: large
profiles are not observed in the dorsal and laterodorsal grey matter until after
birth. Third, as shown in my experiments, PDGFaR expression spreads to the
ventral and then dorsal spinal cord. In contrast, the punctate X-gal staining
appears to spread dorsally trom the dorsal ventricular zone.
It seems more probable that the punctate staining identifies a cell lineage
distinct from the PDGFaR oligodendrocyte precursors. This suggests low-level
expression of the knock-in allele could be a marker of a neuronal population,
or a separate lineage of oligodendrocytes.
5.2.2 &lock-in expression in nelirorrs?
In a previous study, Friedrich et al (1993) observed low-level beta-
galactosidase activity in neurons of one line of mice bearing an MBP-Lac 2
transgene. In the grey matter of the occipital cortex, expression of this
transgene gave rise to discrete granules of X-gal staining near the nuclei of
both myelinated and unmyelinated neurons. Although other published
studies of MBP-promoted transgenes do not report expression in neurons (e.g.
Kimura et al, 1989; Foran and Peterson, 1992; Miskimins et al, 1992; Cow et al,
1992; Coujet-Zalc et all 1993), golli-mbp has been shown to be expressed in
neurons (Landrv et al, 2996).
Two aspects of the punctate staining in MBP-Lac Z knock-in mice suggest
MBP regulatorv elements mav normally drive transcription in neurons. First,
in both the ventral and dorsal spinal cord, punctate staining is prominent in
the presumptive grey matter. Second, in MBP-Lac Z knock-in mice, beginning
at the earliest stages of staining near the ventricular zone, a separate focus of
beta-galactosidase activity is also observed in the ventrolateral presumptive
grey matter. This staining suggests that motoneurons, or cells closely
associated with newly differentiated motoneuron pools, express the MBP-Lac
Z knock-in allele. For example, 0 4 expression may be triggered by signals
from nearby motoneurons (Orentas and Miller, 1996). In the developing chick
spinal cord, where 0 4 labeling emerges in the pattern described for PDGFaR,
0 4 labeling is also observed in a separate pool of cells in the ventral mantle
laver (Ono et all 1995). Retroviral markers have suggested neurons and
oligodendrocytes arise from a common precursor (Williams et al, 1991).
3-22 A nviier source of oligodendrocytes?
The possible dorsal origin of MBP-Lac Z knock-in allele expressing cells is
interesting in the context of transplantation experiments - experiments
which provided evidence for an as yet unidentified dorsal source of
oligodendrocy tes. In contrast to the numerous labeling studies which suggest
that oligodendrocyte precursors populate the spinal cord in a ventrodorsal
gradient, transplantations of chick and quail spinal cords suggest that both
dorsal and ventral halves of the prenatal spinal cord are capable of generating
oligodendrocvtes (Cameron-Curry and Le Douarin 1995). It is not known
whether the pattern of oligodendrocy te development is different in
mammalian and avian CNS, or whether these different interpretations are
merely reflections of the different markers and experiments used to track the
oligodendrocyte lineage. The results presented here are the iirst to report a
dorsal to ventral gradient of a putative oligodendrocvte marker in the
mammalian spinal cord.
5 2 . 3 A h l t proyruitors
The persistence of punctate staining near the ventricular zone at postnatal
stages raises the possibility that an adult pool of spinal cord progenitors
expresses the MBP locus. In the adult mouse spinal cord, earlier studies have
provided evidence for mitotic activity near the central canal (Adrien and
Walker, 1962) which increases during new gliogenesis (Frisen et al, 1995).
Moreover, primary and secondary cell cultures have suggested that the adult
mouse spinal cord contains stem cells capable of differentiating into neurons,
astrocytes and oligodendrocytes (Weiss et al, 1996). In this respect, it would be
interesting to determine whether postnatal cells expressing low levels of the
Lac Z knock-in allele are mitotically active.
5.3 MBP-Lac Z transgenes
5.3.1 M B P promoter driz~en e.rpression arzd thr ventral specificntioiz o f the
ol ip i l rndrocy tr lirzrnge
In contrast to the expression observed in MBP-Lac 2 knock-in mice,
staining in mice bearing variously deleted MBP-Lac Z transgenes did not
appear to correspond to prenatal oligodendrocyte development. Instead, two
lines of mice bearing the same construct (3.1 kb of MBP 5' flanking sequence)
displaved expression in the neural tube at ages before the ventral focus of
PDGFaR is reported to emerge. This transgene was expressed remarkably early
(E9) in a ventral focus of the brain a t the mesencephalic flexure, near the
rhombencephalic isthmus. This region, near the boundary between the
midbrain and hindbrain, is hypothesized to play a role in neural tube
patterning at this time (e.g. Nakamura, 1988; Marin and Puelles, 1994).
Graiting experiments have suggested that a signaling centre directs anterior-
posterior pattern formation in this region, similar to the zone of polarizing
activitv in the developing limb bud. The patterning genes engrailed, Wnt-1
and Fgf8 are reported to be expressed in similar regions of the developing
brain at the time when this MBP-Lac Z transgene is expressed (Davis and
Joyner, 1988; McMahon et al, 1992; Wilkinson et al, 1987; Crossley and Martin,
1995). Therefore, the elements contained within the construct are responsive
to transcription factors that may be part of the signaling pathway controlling
pattern formation.
Additionally, transcription factors capable of responding to elements in
the first 3.1 kb of MBP 5' flanking sequence may be involved in the
determination of the oligodendrocyte lineage. At around the same time that
expression is observed in mice bearing the 3.1 kb MBP-Lac Z transgene, DM-20
e - message is reported to be expressed in the anterior neural tube, immediately
adjacent to the region of MBP-Lac Z transgene expression (Timsit et al, 1992;
1995). Moreover, in the developing spinal cord, the 3.1 kb transgene is
expressed in a ventral horizon until around E12, when PDGFaR is reported to
appear in the ventral ventricular zone.
In mice affected by the Danforth's short tail mutation (Sd), in which the
caudal notochord degenerates, the floorplate does not differentiate (Theiler,
1959), there is a reduction in the number of motoneurons (Bovolenta and
Dodd, 1991), and the focus of PDGFaR expression in the ventricular zone is
absent ( Y u et al, 1994). Moreover, transplantation of notochord near the
developing chick neural tube leads to an ectopic focus of PDGFaR expression
(Yu et a1, 1994), and appears to equally influence 0 4 expression (Orentas and
Miller, 1996). This suggests the notochord is part of the signaling pathway
which establishes the ventral patterning of the neural tube, and subsequently
has a role in establishing the ventral focus of oligodendrocyte progenitors.
In mice bearing the transgene driven by 3.1 kb of MBP 5' flanking
sequence, expression in the brain and in the spinal cord is ventrally restricted.
It would be interesting to examine expression of the 3.1 kb MBP-Lac Z
transgene in Sd mice. If the transgene's expression is dependent on
transcription factors which are established by the notochord's signaling, one
would expect transgene expression to be absent in the caudal neural tube at
E l I.
5 3 . 2 Drregrlin trd trnnsgerze expression
Upon microinjection, the site of a construct's insertion into the genome is
random. Since a construct could insert within an existing gene or near
enough to be influenced by cis-acting positive elements, its expression is not
necessarilv driven by regulatory elements contained within the construct.
Such deregulated transgene expression normally occurs at a low frequency
and is associated with weak and minimal promoters (e.g. Kotharv et al, 1988;
Bonnerot et al, 1990). Two examples of weak promoters are the herpes
simplex virus thymidine kinase (Allen et al, 1988) and the promoter region of
the heat shock protein 68 used by Gossler et a1 (1989), which contains only a
TXTA box and translation initiation codon. In Drosophila, and less often in
mice, such minimal promoters have been exploited as "enhancer traps":
reporter constructs which can be used to identify enhancers or other
regulatory elements adjacent to their integration sites (Kom et al, 1992;
Soininen et al, 1992; Neuhaus et al, 1994).
Therefore, to confirm that Lac Z expression in MBP-Lac Z transgenic mice
is driven by elements within the construct, at least two mice which contain
the same construct at different insertion sites must have the same expression
pattern. In the present studv, all 15 lines of MBP-Lac Z mice expressed Lac Z in
postnatal oligodendrocytes, suggesting that MBP regulatory elements captured
within these constructs acted independently of the constmct's insertion site,
and were sufficient to drive developmentally appropriate expression in the
oligodendrocyte lineage.
That the prenatal expression was equivalent in both lines of mice bearing
the construct regulated by 3.1 kb of MBP 5' flanking sequence suggests that it
contains elements which act independently of its insertion site.
However, four additional lines displayed ectopic transgene expression, in
tissues including the meninges, somites, limb buds, kidney, floorplate and
discrete regions of the forebrain. It is possible that these transgene-expressing
cells are all derivatives of the neural tube or neural crest cells, and might be
using regulatory elements contained within the MBP promoter to drive
transgene expression. However, all constructs displayed distinct expression
patterns. This suggests that non-oligodendrocyte transgene expression was
influenced by cis-acting elements adjacent to the construct's insertion site.
5.3.3 Possible smisrs of tierey~ilnted expression
In some lines, ectopic expression was observed in dissimilar tissues. For
example, expression in line 9 was restricted to the somites and the floorplate
- two disparate cell populations. In this case it is possible the construct
integrated near a single gene normally expressed in different tissues. For
example, both the somites and floorplate have been shown to express the kit-
ligand (Duttlinger et ai, 1993).
In some cases, the same construct may drive different expression patterns
if some copies were modified upon microinjection. Regulatory elements may
have been Lost if some copies of the transgene integrated in a head-to-head
configuration, or a portion of the microinjected DNA was duplicated before
or during integration (Gordon, 1988).
It is striking that ectopic transgene expression was observed in mice
bearing only two constructs (9.6, 3' + 6.5). Both constructs contained a
common 500 bp sequence from the far upstream MBP promoter. In lines of
mice bearing constructs which did not include this 500 bp sequence (3.1, 6.5,
8.6), no ectopic expression was observed. This raises the possibility that
elements within the 500 bp sequence render the construct susceptible to the
influence of cis-acting elements. Indeed, half of the lines of transgenic mice
bearing the 500 bp sequence (four out of eight) displayed ectopic expression.
The MBP 5' flanking sequences used as promoters in the experiments
performed here also contain an exon of the mouse Golli-mbp gene, which is
expressed as early as E l 4 (Mathisen et al, 1993). Although the MBP 5' flanking
sequences and transcription start used in the MBP-Lac Z constructs described
here are downstream of the putative Golli-mbp transcription start site (Figure
3; Kitamura et a1, 1990; Carnpagnoni et al, 1993), the constructs may contain
sequences that prevent silencing of gene expression. They may contain, for
example, a locus control region, or elements involved in histone acetylation,
hvpothesized to increase a DNA region's accessibilitv to transcription factors
(Yang et al, 1996).
3.3.4 7 l r M B P rr l lmcer tmp
In 1993, Hansbrough et a1 described a line of transgenic mice in which a
L x Z reporter gene was ectopically expressed in the developing lung, and
suggested the restricted staining could be exploited i ) as a marker of
differentiation and cell fate, ii) to isolate the cis-acting elements through
sequence similaritv or functional analysis, and iii) to prepare primary cultures
of transgene expressing subpopulations isolated by fluorescence activated cell-
sorting of beta-galactopyranoside labeled cells. The ectopic labeling displayed
in the MBP-Lac Z transgenic lines described here could be similarly exploited
to investigate the development of cell populations in meninges somites, limb
buds, kidney, floorplate and discrete regions of the forebrain.
Despite the possible applications of these MBP-Lac 2 enhancer trap lines,
the long distances at which enhancers can act imposes a limit on the
usefulness of these lines in identifying cis-acting sequences. Using an
enhancerless inactive neo gene as an in vitro enhancer trap, Bharat et al
(1988) identified an enhancer element six kilobases away from the promoter
- distant enough that its identification required extensive deletion analysis.
MBP promoter-driven transgenes are capable of driving appropriate
expression in oligodendrocytes regardless of their integration site. However,
these transgenes are also sensitive to their chromosomal integration site. This
finding limits the MBP promoter's usefulness as a means of targeting gene
expression to myelinating glia, and sets a precedent for all strategies which
attempt to target gene expression to individual cell populations. The
elements that caused ectopic expression did not appear to interfere with the
regulation of the transgene in oligodendrocytes. It cannot be assumed that
elements sufficient to drive developmentally-specific expression in one cell
tvpe will be subject to the same regulation in all cell types.
6, SUMMARY h mice, rats, chicks and humans, studies have localized putative markers
of the early oligodendrocyte lineage to the ventral midline of the spinal cord.
Using knock-in mice in which the first exon of MBP has been replaced with a
Lac Z reporter gene, I have shown that, in the context of MBP's endogenous
regulatory elements, Lac Z is expressed in the pattern predicted for the
emergence of oligodendrocytes. My results suggest that MBP is first
transcribed in cells adjacent to, and not within, the ventral ventricular zone,
immediately lateral to the putative source of the oligodendrocyte lineage. By
comparing the emergence of Lac Z expression with that of PDGFaR, the
earliest putative marker of oligodendrocyte progenitors, I have found
evidence that transcriptional activity at the MBP locus begins once the
precursors of oligodendrocytes have spread throughout the spinal cord.
have also presented evidence for weak prenatal transcription at the MBP
locus beginning at E12. This is revealed in MBP-Lac Z knock-in mice as low-
level beta-galactosidase activity in the developing grey matter. Whether this
activitv corresponds to MBP or Golli-rnbp transcription, and whether it marks
an oligodendrocyte or neuronal lineage is currently unknown. This early
expression raises the possibility that transcriptional activity at the MBP locus
may mark a novel source of oligodendrocytes, neurons, and/or an adult pool
of progenitors.
.At an earlier stage of development (E9 to E12), I have shown that elements
within the first 3.1 kb of MBP 5' flanking sequence can drive expression of Lac
Z in the ventral neural tube. This suggests factors involved in establishing
ventral patterning and /or the oligodendrocyte lineage, are capable of acting
on regulatory sequences in the MBP promoter. Finally, I have shown that, in
addition to driving expression in postnatal oligodendrocytes, extended MBP
3' flanking sequences are also particularly susceptible to deregulation.
7. REFERENCES
Adrien EK Jr and Walker BE (1962). Lncorporation of t h y n i d i n e - ~ ~ by cells in normal and injured mouse spinal cord. J Neuropathol Exp Neurol21:597.
Alarn J and Cook JL (1990). Reporter genes: Application to the study of mammalian gene transcription. Anna1 Biochem 188:245.
Wen ND, Cran DG, Borton SC, Hettle St Reik W and Surani MA (1988). Transgenes as probes for active chromosomal domains in mouse development. Nature 333:852.
Bansal R, Stefansson K and Pfeiffer SE (1992). Proligodendroblast antigen (POA), a developmental antigen expressed by a0007/04-positive oligodendrocyte progenitors prior to the appearance of sulfatide and galactocerebroside. J Neurochem 58:2221.
Bansal R, Warrington AE, Gard AL, Ranscht B and Pfeiffer SE. (1989). Multiple and novel specificities of monoclonal antibodies 01,04 and R-mAb used in the analvsis of oligodendrocyte development. J Neurosci Res 24548.
0arbarke E and Pfeiffer SE (1978). Developmental regulation of myelin basic protein in dispersed cultures. PNAS 78:1953.
Barres BA and Raff MC (1993). Proliferation of oligodendrocyte precursor cells depends on electrical activity in axons. Nature 361258.
Barres 8.4 and Raff MC (1994). Control of oligodendrocyte number in the developing rat optic nerve. Neuron 12:935.
Bharat K, McBumey MW and Hamada H (1988). Functional cloning of mouse chromosomal loci specifically active in embryonal carcinoma stem cells. MCB 8:3Zl.
Bjartmar C, Hildebrand C and Loinder K (1994). Morphological heterogeneity of rat oligodendrocytes: electom microscope studies on serial sections. Glia 11235.
Bomerot C and Nicolas I-F (1988). Application of Lac Z gene fusions to postimplantation development. p.451 in: Guide to techniques in mouse development (eds: Paul Wassarman & Melvin DePamphilis). Academic Press, San Diego.
Bonerot C, Grimber G, Briand P and Nicholas J-F (1990). Patterns of expression of position-dependent integrated transgenes. PNAS USA 876331.
Bovolenta P and Dodd J (1991). Perturbation of neuronal differentiation and axon guidance in the spinal cord of mouse embryos lacking a floor plaate: analysis of Danforth's short tail mutation. Dev 113625.
Burne F , Staple JK and Raff MC (1996). GLial cells are increased proportionally in transgenic optic nerves with increased number of axons. J Neurosci 16:2064.
Butt AM, Hornby F, Ibrahirn M, Kirvell S, Graham A and Berry M (1997). PDGFa Receptor and Myelin Basic Protein mRNAs are not coexpressed by oligodendrocytes in oivo: A double in situ hybridization study in the anterior medullary velum of the neonatal rat. MCN 8:311.
Cameron-Curry P and LeDouarin NM (1995). Oligodendrocyte precursors originate from both the dorsal and the ventral parts of the spinal cord. Neuron 151299.
Campagnoni AT, Pribyl TM, Campagnoni CW, Kampf K, Amur-Umajee Sf Landrv CF, Handley VW, Newman SL, Garbay B and Kitamura K (1993). structbre and developmental regulation of Golli-rnbp, a 10Skilobase gene that encompasses the myelin basic protein gene and is expressed in the oligodendrocyte lineage in the brain. JBC 268:l.
Carson JH, Hielson ML and Barbarese E (1983). Developmental regulation of mvelin basic protein expression in mouse brain. Dev Bio 96:485.
~ o h e k SR and Guamieri M (1976). Immunochemical measurement of myelin basic protein in developing rat brain: an index of myelin smthesis. Dev Bio 49294.
Crossley PH and Martin, GR (1995). The mouse Fgf8 gene encodes a family of polvpeptides and is expressed in regions that direct outgrowth and patterning in (he developing embryo. Development 121:439.
Davis CA and Joyner AL (1988). Expression patterns of the homeobox containing genes En4 and En-2 and the proto-oncogene int-l diverge during mouse development. Genes Dev. 2: 1736.
De Ferra F, Engh H and Hudson L (1985). Alternative splicing accounts for the four forms of MBP. Cell KWX.
Dubois-Dalcq M, Behar T, Hudson L and Lazzarini RA (1986). Emergence of three mvelin proteins in oligodendrocytes cultured without neurons. JCB 102:384.
~ u n n LC, Gluecksohn-Schoenheimer S and Bryson V (1940). A new mutation in the mouse affecting spinal column and urogenital system. J Hered 31:343.
Eriksson A, Ronman C, Emlund A, Claesson-Welsh L and Heldin CH (1992). Ligand-induced homo- and hetero-dimerization of platelet-derived growth factor alpha- and beta-receptors in intact cells. Growth Factors. 6:1.
Foran D and Peterson AC (1992). Myelin acquisition in the central nervous svstem of the mouse revealed by an MBP-Lac Z transgene. J Neurosci 12:4890.
~riedrich VL Jr, Holstein GR, Li X, Gow A, Kelley KA and Lazzarini RA (1993). Intracellular distribution of transgenic bacterial beta-galactosidase in central nervous system neurons and neuroglia. J Neurosci Res 36:88.
Frisen J, Johansson CB, Torok C, Risling M and Lendahl U (1995). Rapid, widespread and long-lasting induction of nestin contributes to the generation of glial scar tissue after CNS injury. J Cell Biol 131:453.
Gilmore, SA (1971). Neuroglial population in the spinal white matter of neonatal and early postnatal rats: An autoradiographic study of numbers of neuroglia and changesa in their proliferative activitv. Anat. Rec. 171:283.
Gordon JW (1988). Production of transgenic mice. p477 in: Guide to techniques in mouse development (eds: Paul Wassarman & Melvin DePamphilis). Academic Press, San Diego.
Gossler A, Joyner AL, Rossant R and Skames WC (1989). Mouse embryonic stem cells and reporter conmstructs to detect developmentally regulated genes. Nature 336~463.
Goujet-Zalc C, Babinet CH, Monge M, Timsit S, Cabon F, Gansmuller A, Miura M, Sanchez M, Poumin S, Mikoshiba K and Zalc 8. (1993). The proximal region of the MBP gene promoter is sufficient to induce oligodendroglial- specific expression in transgenic mice. European J Neurosci 5:624.
Cow A, Friedrich VL and Lazzarini RA (1992). Myelin basic protein gene contains separate enhancers for oligodendrocyte and Schwann cell expression. JCB 1 l9:6O5.
Hajihosseini M, Tham TN and Dubois-Dalcq M (1996). Origin of oligodendrocytes within the human spinal cord. J Neurosci 16:7981.
Hansbrough JR, Fine SM and Gordon JI (1993). A transgenic mouse model for studying the lineage relationships and differentiation program of type II pneumocytes at various stages of lung development. JBC 268:9762.
Hardv RJ and Freidrich VL Jr (1996). Oligodendrocyte progenitors are generated th;oughou t the embryonic mouse brain, but differentiate in restricted foci. Dev IZXO59.
Hart [K, Richardson WD, Heldin C-H, Wesrtermark B and Raff MC (1989). PDGF receptors on cells of the oligodendrocyte-type 2 astrocyte (0-2A) cell lineage. Dev 109:595.
Jordan CA, Friedrich VL, de Ferra F, Weismiller DG, Holmes KV and Dubois- Dalcq M (1990). Differential exon expression in myelin basic protein transcripts during central nervous system remyelination. Cell Mol Neurobio 10:3.
Kalderon D, Roberts BL, Richardson WD and Smith AE (1984). A short amino acid sequence able to specify nuclear location. Cell 39~499.
Kamholz J, de Ferra F, Puckett C and Lazzarini R (1986). Idnetification of three toms of human myelin basic protein by cDNA cloning. PNAS USA 83:4962.
Kamholz J, Toffenetti J and Lazzarini RA (1988). Organization and expression of the human myelin basic protein gene. J Neurosci Res 2152.
Kirnura M, Sato M, Akatsuka A, Nozawa-Kimura S, Takahashi R, Yokoyama M, Nomura T and Katsuki M (1989). Restoration of myelin formation by a single tvpe of myelin basic protein in transgenic shiverer mice. PNAS 86:5661
~ i t amura K, Newman SL, Campagnoni CW, Verdi JM, Mohandas T, Handley VW and Campagnoni AT (1990). Expression of a novel transcript of the myelin basic protein gene. J Neurochem 54:2032
~ o r n k , Schoor M. Neuhaus H, Henseling U, Soininen R, Zachgo J and Gossler A (1992). Enhancer trap integrations in mouse embryonic stem cells give rise to staining patterns in chimeric embryos with a high frequency and detect endogenous genes. Mech Dev 39:95.
Kothary R, Clapoff S, Brown A, Campbell R, Peterson A and Rossant J (1988). A transgene containing Lac Z inserted into the dystonia locus is expressed in the neural tube. Nature 335:435.
Landry CF, Ellison JA, Pribyl TM, Campagnoni C, Kampf K and Campagnoni AT (1996). Myelin basic protein gene expression in neurons: Developmental and regional changes in protein targeting within neuronal nuclei, cell bodies and processes. J Neurosci 162452.
Ling, EA (1976). Study in changes of the proportions and numbers of the various glial types in the spinal cord of neonatal and young adult rats. Acta Anat 96:188.
Lees M and Brostoff S (1984). Proteins of myelin. In: Myelin. P. Morell, ed. Plenum Press, N.Y. pp 197-224.
LeVine SM and Goldman JE (1988). Spatial and temporal patterns of oligodednrocyte differentiation in rat cerebrum and cerebellum. J Comp Neurol 277:441.
Marin F and Puelles L (1994). Patterning of the embryonic avian midbrain and experimental inversions: a polarizing activity from the isthmus. Dev Bio 163:19.
Mathisen PM, Pease S, Garvey J, Hood L and Readhead C (1993). Identification of an embryonic isoform of myelin basic protein that is expressed widely in the mouse embryo. PNAS 90:10125.
Matthews and Duncan (1971). A quantitative study of morphological changes accompanying the initiation and progress of mvelin production in the dorsal funiculus of the rat spinal cord. J Comp ~ e u r o i 1429.
McMahon AP, Jovner AL, Bradley A and McMahon JA (1992). The midbrain- hindbrain ph&otype of wnt-1-/wnt-1- mice results from stepwise deletion of engrailed expressing cells by 9.5 days postcoiturn. Cell 69:581.
Meinecke and Webster (1984). Fine structure of dividing astroglia and oligodendroglia during myeiln formation in the developing mouse spinal cord. J Comp Neurol222A7.
Monge M, Kadiiski D, Jacque CM and Zalc B (1986). Oligodendroglial expression and deposition of four major myelin constituents in the myelin sheath during developmentL an in vivo study. Dev Neurosci 8222.
Nakamura H, Takagi S, Tsuji T, Matsui KA and Fujisawa H (1988). The prosencephalon has the capacity to differentiate into the optic tectum: analvisis by chick-specific antibodies in quail-chick chimeric brains. Dev ~ r o w t h ~ i ' f f . 30:717.
Neuhaus H, Bettenhausen B, Bilinski P, Simon-Chatottes D, Guenet JL and Cossler A (1994) Et12, a novel putative type4 cytokine receptor expressed during mouse embryogenesis at high levels in skin and cells with skeletogenic potential. Dev Bio 166:531.
Nishivama, A, Lin X-H, Giese N, Heldin C-H and Stallcup WB (1996a). Co- localization of NG2 proteoglycan and PDGFa receptor on 02A progenitor cells in the developing rat brain. J Neurosci Res 43:299.
Nishiyama, A, Lin X-H, Giese N, Heldin C-H and Stallcup WB (1996b) Interaction between NG2 proteoglycan and PDGFa receptor on 02A progenitor ceils is required for optimal response to PDGF. J Neurosci Res 43~315.
Noble M, Murray K, Stroobant P, Waterfield MD and Riddle P (1988). Platelet- derived growth factor promotes division and motility and inhibits premature differentiation of the oligodendrocyte/type-2 astrocyte progenitor cell. Nature 333560.
Noll E and Miller RH (1993). Oligodendrocyte precursors originate at the ventral ventricular zone dorsal to the ventral midline region in the embryonic rat spinal cord. Dev 118:563.
Norton WT and Camrner W (1984). Isolation and characterization of myelin. In: Myelin. P. Morrel, ed. Plenum Press, N.Y. pp 147-180.
Orentas DM and Miller RH (1996). The origin of spinal cord oligodendrocytes is dependent on local influences from the notochord. Dev Biol 177:43.
Ono K, Bansal R, Payne J, Rutishauser U and Miller RH (1995). Early development and dispersal of oligodendrocyte precursors in the embryonic chick spinal cord. Dev 121:1743.
Peyron F, Timsit S, Thomas J-L, Kagawa T, Ikenaka K and Zalc B (1997). Fate of the oligodendorcyte lineage during embryonic and postnatal development of the jimpy mutant and of transgenic mice overexpressing PLP. J Neurosci Res (in press).
Pringle NP and Richardson WD (1993). A singularity of PDGF alpha-receptor expression in the dorsoventral axis of the neural tube may define the origin of the oligodenrocyte lineage. Dev. 1 l7:SE.
Pringle NP, Y u W-P, Guthrie S, Roelink H, Lumsden A, Peterson AC and Richardson WD (1996). Determination of neuroepithelial cell fate: Indcution of the oligodendrocyte lineage by ventral midline cells and sonic hedgehog. Dev Bio 277:30.
Privat A and Leblond CP (1972). The subependymal layer and neighbouring region in the brain of voung rats. J Comp Neurol 142:277.
Raff MC, Miller RH and ~ o b l e M (1983). A glial progenitor cell that develops in vitro into an astrocyte or an oligodendrocyte depending on culture medium. Nature 303:390.
Raff MC (1989). Glial cell diversification in the rat optic nerve. Science 3243:1450. Readhead C, Popko 0, Takahashi N, Shine HD, Suavedra RA, Sidman RL and
Hood L (1987). Cell 43:703. Rugh, R (1990). The mouse, its re[production and development. Oxford
Univers i t~ Press., Oxford. Sabri MI, Bone AH and Davidson AN (1974). Turnover of myelin and other
structural proteins in the developiong rat brain. Biochem. 1. 142:499. Scherer SS, Braun PE, Grinspan J, Collarini E, Wang D-Y, and Karnholz J (1994).
Differential regulation of the 2',3'-cyclic nucleo tide 3' phosphodiesterase gene during oligodendrocyte development. Neuron 12:1363.
Smart I (1961). The subependymal layer of the mouse and its cell production as shown by radioautography after tritiated thymidine injection. J Comp Neurol 116:325.
Skoff W, Price DL and Stocks A (1976). Electron microscopic autoradiographic studies of gliogenesis in rat optic nerve. J Comp Neurol. 169:291.
Soininen R, Schoor M, Henseling U, Tepe C, Kisters-Woike B, Rossant J and Gossler A (1992). the mouse enhancer trap locus 1: a novel mammalian gene related to drosophila and yeast transcriptional regulator genes. Mech Dev 39:lll.
Stallcup WB and Beasley L (1987). Bipotential glial precursor cells of the optic nerve express the NG2 proteoglycan. J Neurosci 72737.
Stemberger NH, Itoyama Y, Kies MW and Webster HdeF (1978). Myelin basic protein demonstrated immunocytochemically in oligodendroglia prior to myelin sheath formation. PNAS 752521.
Sturrock, R (1981). Gliogenesis in the prenatal rabbit spinal cord. ] Anatomy l32:77l.
Theiler, K (1959). Anatomy and development of the truncate (boneless) mutation in the mouse. Am J h a t 104:319.
Trapp BD, Nishiyama A, Cheng D and Macklin W (1997). Differentiation and deathn of premyelinating oligodendrocytes in developing rodent brain. JCB 132459.
Trapp B (1987). Spatial segregation of mRNA encoding myelin-specific proteins. PNAS 847773.
Ueno K, Hiramoto Y, Hayashi S and Kondoh H (1987). Introduction and expression of recombinant beta-galactosidase genes in cleavage stage mouse embryos. Dev Growth Differ 30:61.
Veritv AN and Campagnoni AT (1988). Regional expression of myelin basic p;otein genes in the developing mouse brain: in situ hybridization studies. J Neurosci Res 21:238.
Warf BC, Fok-Seang J and Miller RH (1991). Evidence for the ventral origin of oligodendrocyte precursors in the rat spinal cord. J Neurosci 11:2477.
Warrington AE and Pfeiffer SE (1992). Proliferation and differentia tion of O4+ oligodednrocytes in postnatal rat cerebellum: analysis in unfixed tissue slices using anti-glycolipid antibodies. J Neurosci Res 33:338.
Weiss S, Dunne C, Hewson J, Wohl C, Wheatley M, Peterson AC and Reynolds BA (1996). Multipotent CNS stem cells are present in the adult mammalian spinal cord and ventricular neuroaxis. J Neurosci 16:7599.
Wilkinson DG, Bailes JA and McMahon AP (1987). Expression of the proto- oncogene int-1 is restricted to specific neural cells in the developing mouse embryo. Cell 50:79.
Williams 8 0 , Read J and Price J (1991). The generation of neurons and oligodendrocytes from a common precursor. Neuron 7:685.
Yang X-J, Ogryzko W, Nishikawa J-i, Howard B and Nakatani Y (1996). A p300/CBP-associated factor that competes with the adenoviral oncoprotein ElA, Nature 382:319.
Yu W-P, Collarini EJ, Pringie NP and Richardson WD (1994). Embryonic expression of myelin genes: Evidence for a focal source of oligodendrocyte precursors in the ventricular zone of the neural tube. Neuron 12:1353.
Zeller NK, Hunkeler MJ, Campagnoni AT, Sprague J and Lazzarini RA (1984). Characterization of mouse rnyelin basic protein messenger RNAs with a rnyelin basic protein cDNA clone. PNAS 81:18.