SPECIAL FOCUS

Influence of Three-Dimensional Hyaluronic AcidMicroenvironments on Mesenchymal

Stem Cell Chondrogenesis

Cindy Chung, B.S., and Jason A. Burdick, Ph.D.

Mesenchymal stem cells (MSCs) are multipotent progenitor cells whose plasticity and self-renewal capacity havegenerated significant interest for applications in tissue engineering. The objective of this study was to investigateMSC chondrogenesis in photo-cross-linked hyaluronic acid (HA) hydrogels. Because HA is a native component ofcartilage, and MSCs may interact with HA via cell surface receptors, these hydrogels could influence stem celldifferentiation. In vitro and in vivo cultures of MSC-laden HA hydrogels permitted chondrogenesis, measured bythe early gene expression and production of cartilage-specific matrix proteins. For in vivo culture, MSCs wereencapsulated with and without transforming growth factor beta-3 (TGF-b3) or pre-cultured for 2 weeks inchondrogenic medium before implantation. Up-regulation of type II collagen, aggrecan, and sox 9 was observedfor all groups over MSCs at the time of encapsulation, and the addition of TGF-b3 futher enhanced the expressionof these genes. To assess the influence of scaffold chemistry on chondrogenesis, HA hydrogels were comparedwith relatively inert poly(ethylene glycol) (PEG) hydrogels and showed enhanced expression of cartilage-specificmarkers. Differences between HA and PEG hydrogels in vivo were most noticeable for MSCs and polymer alone,indicating that hydrogel chemistry influences the commitment of MSCs to undergo chondrogenesis (e.g., *43-foldup-regulation of type II collagen of MSCs in HA over PEG hydrogels). Although this study investigated only earlymarkers of tissue regeneration, these results emphasize the importance of material cues in MSC differentiationmicroenvironments, potentially through interactions between scaffold materials and cell surface receptors.

Introduction

Mesenchymal stem cells (MSCs) are multipotentprogenitor cells that have the ability to self-replicate

and differentiate down multiple cell lineages when given theappropriate environmental cues.1 Although Friedenstein andcolleagues2 first identified them in bone marrow in the 1970s,MSCs have since been isolated from various adult tissuesand differentiated into several cell types, including osteo-blasts, chondrocytes, and adipocytes.1,3–5 With their plasti-city and self-renewal capacity, these cells have generatedsignificant interest for applications in cell-replacementtherapies and tissue regeneration.

MSCs have garnered interest as an alternative cell sourcefor cartilage tissue engineering, because they can be isolatedfrom adults via a bone marrow biopsy. To induce chondro-genic differentiation, MSCs are typically grown in pelletculture in the presence of transforming growth factor betas(TGF-bs),6–10 and differentiation is monitored according tothe production of cartilaginous matrix proteins such as sul-fated glycosaminoglycans (GAGs) and type II collagen. In

recent years, natural and synthetic biomaterials have beenused to create niches or microenvironments to control stemcell behavior and differentiation toward cartilage forma-tion.11,12 These biomaterials serve as three-dimensional (3D)scaffolds capable of enhancing and templating tissue for-mation through cell morphology and organization, inter-cellular interactions, mechanical forces, and the delivery ofbioactive molecules.11,13

One molecule of particular interest is hyaluronic acid(HA), which is found natively in cartilage tissue. HA, a linearpolysaccharide of alternating D-glucuronic acid and N-acetyl-D-glucosamine, functions as a core molecule for the binding ofkeratin sulfate and chondroitin sulfate in forming aggrecan.14

Hyaluronidases found in the body degrade it enzymatically,as do oxidative mechanisms to yield oligosaccharides andglucuronic acid. This natural polymer plays a role in cartilagehomeostasis; is involved in cellular processes such as cellproliferation, morphogenesis, inflammation, and wound re-pair;15–17 and can interact with cell surface receptors for HA18

(e.g., CD44, CD54, and CD168). HA can be modified throughits carboxyl and hydroxyl groups and subsequently cross-

Department of Bioengineering, University of Pennsylvania, Philadelphia, Pennsylvania.

TISSUE ENGINEERING: Part AVolume 15, Number 2, 2009ª Mary Ann Liebert, Inc.DOI: 10.1089=ten.tea.2008.0067

243

linked into hydrogels or made hydrophobic and processedinto macroporous scaffolds. These modification strategies in-clude esterfication,19,20 methacrylation,21,22 and cross-linkingwith divinyl sulfone23,24 or dialdehyde.25

Researchers have developed HA-based scaffolds in theform of hydrogels,26–30 sponges,31 and meshes.32 These scaf-folds are biocompatible and can serve as delivery vehiclesfor cells and bioactive molecules. Chondrocytes and MSCshave been successfully encapsulated in HA and HA com-posite hydrogels.22,26,33 Liu et al. showed that MSC-ladenHA–gelatin hydrogels were able to produce elastic, firm,translucent cartilage with zonal architecture in rabbit osteo-chondral defects.26 Sponges and non-woven meshes made ofhydrophobic HA ester derivatives (Hyaff-7 and -11) seededwith MSCs and chondrocytes have been shown to support achondrocyte phenotype and the production of cartilaginousextracellular matrix (ECM) proteins.31,32,34,35 In the clinicalsetting, Hyalograft-C, a tissue-engineered graft composed ofHyaff-11 scaffolds seeded with autologous chondrocytes, hasbeen used to treat cartilage lesions in patients. Results from2- to 5-year follow-ups showed better repair of cartilage le-sions in 91.5% of patients than predicted by pre-operativeassessments, and the repaired cartilage was hyaline-like inappearance.20 Recently, a thiolated HA derivative was suc-cessfully electrospun into a nano-fibrous mesh with the po-tential to more closely mimic the size-scale of native ECM.36

For this study, we used photo-cross-linked HA hydrogelsto investigate the chondrogenesis of MSCs in HA micro-environments. Previously, we optimized a methacrylatedHA (MeHA) hydrogel system for the encapsulation ofchondrocytes and characterized cytocompatibility, pheno-type retention, and neocartilage formation within these hy-drogels using auricular and articular chondrocytes.30,33,37,38

However, inherent limitations to the use of chondrocytes(e.g., low cell yields and a tendency to dedifferentiate whenexpanded in vitro) have motivated the use of MSCs as analternative cell source. MSCs are easily expanded in vitrowithout loss of differentiation potential and express CD44,39

one of the primary receptors for HA. Thus, we hypothesizedthat photo-cross-linked MeHA hydrogels could provide afavorable niche for MSC chondrogenesis.

Materials and Methods

CD44 staining and flow cytometry

To determine the presence of CD44 receptors, human MSCs(Lonza Walkersville, Inc., Walkersville, MD; donor: 33-year-old man, original passage number 2) were cultured in two di-mensions on glass coverslips and fixed in Accustain (Sigma) forimmunofluorescent staining. Briefly, the cells were blockedwith 5% fetal bovine serum (FBS), stained with primary anti-body anti-CD44 clone A3D8 (4mg=mL, Sigma) for 2 h, incu-bated with secondary antibody anti-mouse immunoglobulinG (IgG; whole molecule) F(ab’)2 fragment-fluorescein iso-thiocyanate (1:50 dilution) for 15 min, and counterstained with4’,6-diamidino-2-phenylindole (2 mg=mL) for nuclei visuali-zation. In addition, MSCs were labeled with phycoerythrin(PE)-conjugated CD44 (0.25 mg=mL, eBioscience, San Diego,CA) monoclonal antibody for 1 h on ice and analyzed usingflow cytometry (Guava EasyCyte 3.10, Guava Technologies,Hayward, CA).

Macromer syntheses

MeHA was synthesized as previously reported.21 Briefly,methacrylic anhydride (Sigma, St. Louis, MO) was added toa solution of 1 wt% HA (MW¼ 64 kDa, Lifecore, Chaska,MN) in deionized water, adjusted to a pH of 8 with 5 NNaOH, and reacted on ice for 24 h. The macromer solutionwas purified via dialysis (MW cutoff 6–8 k) against deio-nized water for a minimum of 48 h with repeated changes ofwater. The final product was obtained using lyophilizationand stored at �208C in powder form before use. Poly(ethylene glycol)-diacrylate (PEGDA) was synthesized aspreviously reported.40 Briefly, triethylamine (1.5 molar ex-cess) was added to PEG-4600 (Sigma) dissolved in methylenechloride. Acryloyl chloride (1.5 molar excess) was addeddrop-wise under nitrogen and reacted on ice for 6 h, followedby reaction at room temperature for 30 h. The product wasprecipitated in ethyl ether, filtered, dried in a vacuum oven,re-dissolved in deionized water, dialyzed for 3 days, lyo-philized, and stored at �208C in powder form before use.The macromers were characterized using 1H nuclear mag-netic resonance (Bruker Advance 360 MHz, Bruker, Billerica,MA). Macromers were sterilized using a germicidal lamp in alaminar flow hood for 30 min and dissolved in a sterile so-lution of phosphate buffered saline (PBS) containing 0.05 wt%2-methyl-1-[4-(hydroxyethoxy)phenyl]-2-methyl-1-propanone(Irgacure 2959, I2959, Ciba, Basel, Switzerland) for poly-merization. Hydrogels were polymerized by injecting themacromer solution into a mold or between glass slides andexposing to ultraviolet light (Eiko, *1.9 mW=cm2, Topbulb,East Chicago, IN) for 10 min.

Mechanical characterization

Acellular hydrogels (n¼ 5) approximately 7 mm in diame-ter and 1 mm thick were tested in unconfined compressionusing a Dynamic Mechanical Analyzer Q800 (DMAQ800,TA Instruments, New Castle, DE) in a PBS bath. Hydrogelswere compressed at a rate of 10%=min until failure or untilthey reached 70% of their initial thickness. The modulus wasdetermined as the slope of the stress-versus-strain culture atlow strains (<20%). The elastic modulus of PEG hydrogelswas matched to 2wt% MeHA hydrogels by varying themacromer concentration (5–10 wt%).

MSC photo-encapsulation and culture

Human MSCs were expanded for four additional passagesin growth medium consisting of alpha minimum essentialmedium with 16.7% FBS and 1% penicillin=streptomycin.MSCs (20�106 cells=mL) were photo-encapsulated in hydro-gels by suspension in 2 wt% MeHA or 5.5 wt% PEG solutionswith or without 200 ng=mL TGF-b3 (R&D Systems, Minnea-polis, MN). The cell–macromer solutions were pipetted intosterile molds (50 mL volume) and polymerized using ultra-violet light (Eiko, *1.9 mW=cm2, Topbulb, East Chicago, IN)for 10 min. Because of the polymerization technique, allgrowth factor is encapsulated within the hydrogel, resultingin a concentration of 10 ng TGF-b3=50mL gel.

To evaluate chondrogenesis, MSC-laden MeHA hydrogelswere cultured in vitro in growth medium or Dulbecco’smodified Eagle medium supplemented with 1% penicillin=

244 CHUNG AND BURDICK

streptomycin, 1% insulin-transferrin-seleniumþuniversalculture supplement, 1 mM sodium pyruvate, 40 mg=mL L-proline, 100 nM dexamethasone, 50 mg=mL ascorbic acid 2-phosphate, and 10 ng=mL TGF-b3 (chondrogenic medium).For in vivo culture, MSCs were encapsulated in MeHA hy-drogels with (HAþT3) and without (HA-MSCs) TGF-b3 andimplanted in nude mice or cultured in vitro in chondrogenicmedia for 2 weeks before implantation (HA-C). Nude micewere anesthetized with isoflurane, a 2-cm midline incisionwas made on the dorsum of each mouse, and five subcu-taneous pockets were made using blunt dissection. Oneconstruct was placed in each pocket, and the wound wasclosed using sterile stainless steel skin clips. Constructs werecultured in vivo for 2 weeks. National Institutes of Healthguidelines for the care and use of laboratory animals wereobserved.41 For scaffold comparison, MSCs were encapsu-lated in PEG hydrogels and cultured in vitro and in vivo inthe same manner as the MeHA hydrogels.

Viability

The viability of MSCs in the MeHA and PEG hydro-gels was assessed using a live=dead cytotoxicity kit(Molecular Probes, Eugene, OR) and a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (ATCC,Manassas, VA). Live=dead images were taken 1 and 24 h afterencapsulation. Mitochondrial activity (n¼ 3) was assessedafter 7 and 14 days of in vitro culture. Briefly, 100mL of MTTreagent was added to 1 mL of medium and incubated for 4 h.Samples were then removed from the medium, homogenizedin the detergent solution using a tissue grinder, incubated for4 h, and read at an absorbance of 570 nm in a Synergy HT(Bio-Tek Instruments, Winooski, VT) spectrophotometer.

Gene expression analysis

Samples (n¼ 4) were homogenized in Trizol Reagent (In-vitrogen, Carlsbad, CA) using a tissue grinder, and RNA wasextracted according to the manufacturer’s instructions. RNAconcentration was determined using an ND-1000 spectro-photometer (Nanodrop Technologies, Wilmington, DE). Onemicrogram of RNA from each sample was reverse tran-

scribed into cDNA using reverse transcriptase (SuperscriptII, Invitrogen, Carlsbad, CA) and oligoDT (Invitro-gen, Carlsbad, CA). Polymerase chain reaction (PCR) wasperformed on an Applied Biosystems 7300 real-time PCRsystem using a 25-mL reaction volume for TaqMan (5’-nuclease) and sybr green reactions. Primers and probesspecific for glyceraldehyde 3-phosphate dehydrogenase(GAPDH), type I and type II collagen, aggrecan, sox 9, andhyaluronidases (Hyal) 1, 2, and 3 are listed in Table 1.GAPDH was used as the housekeeping gene. Relative geneexpression was calculated using the DDCT method, wherefold difference was calculated using the expression 2-DDCt.

Histological analysis

For histological analysis, constructs were fixed in 10%formalin for 24 h, embedded in paraffin, and processed usingstandard histological procedures. The histological sections(7mm thick) were stained for aggrecan and collagen dis-tributions using the Vectastain ABC kit (Vector Labs, Bur-lingame, CA) and the DAB Substrate kit for peroxidase(Vector Labs). Sections were predigested in 0.5 mg=mLhyaluronidase for 30 min at 378C and incubated in 0.5 Nacetic acid for 4 h at 48C to swell the samples before over-night incubation with primary antibodies at dilutions of1:100, 1:200, and 1:3 for chondroitin sulfate (mouse mono-clonal anti-chondroitin sulfate, Sigma) and type I (mousemonoclonal anti-collagen type 1, Sigma) and type II collagenantibodies (mouse monoclonal anti-collagen type II, Devel-opmental Studies Hybridoma Bank, Iowa City, IA), respec-tively. Non-immune controls underwent the same procedurewithout primary antibody incubation.

TGF-b3 release

TGF-b3 (10 ng=50mL gel) was encapsulated in acellularMeHA hydrogels, and release of the growth factor wasmonitored via diffusion in PBS alone or in the presence ofhyaluronidase (500 U=mL) at 378C on an orbital shaker. PBSand hyaluronidase solutions were changed every other day,and aliquots were stored at �208C until analysis with a TGF-b3 enzyme-linked immuno-adsorbent assay (R&D Systems,Minneapolis, MN).

Table 1. Human Quantitative Polymerase Chain Reaction Primers and Probes

Gene Forward Primer Reverse Primer Probe

Glyceraldehyde3-phosphatedehydrogenase

AGGGCTGCTTTTAACTCTGGTAAA

GAATTTGCCATGGGTGGAAT CCTCAACTACATGGTTTAC

Type I Collagen AGGACAAGAGGCATGTCTGGTT GGACATCAGGCGCAGGAA TTCCAGTTCGAGTATGGCType II Collagen GGCAATAGCAGGTTCACGTACA CGATAACAGTCTTGCCCCACTT CTGCACGAAACATACAggrecan TCGAGGACAGCGAGGCC TCGAGGGTGTAGCGTGTAGAGA ATGGAACACGATGCC

TTTCACCACGASox 9 AAGCTCTGGAGACTT

CTGAACGAGCCCGTTCTTCACCGACTT

HYAL1 AAAATACAAGAACCAAGGAATCATGTC

CGGAGCACAGGGCTTGACT

HYAL2 GGCGCAGCTGGTGTCATC CCGTGTCAGGTAATCTTTGAGGTAHYAL3 GCCTCACACACCGGAGATCT GCTGCACTCACACCAATGGA

HYAL, hyaluronidase.

HYALURONIC ACID MICROENVIRONMENTS FOR MSC CHONDROGENESIS 245

Statistical analysis

All values are reported as means� standard errors of themean. The Student t-test and Wilcoxon sum-rank test wereused to determine significant differences between groups,with p< 0.05.

Results

For this study, we investigated the chondrogenesis ofMSCs in photo-cross-linked HA hydrogels. The chondro-genic differentiation of MSCs in HA hydrogels was mon-itored in vitro and in vivo; increases in the gene expression

and production of cartilaginous matrix proteins were used asmarkers for chondrogenesis, as well as limited expressionand production of type I collagen. In addition, benefits ofpotential cell–HA scaffold interactions were explored usingshort-term culture comparisons with a relatively inert PEGhydrogel system that would provide minimal direct inter-actions with encapsulated cells.

MSC interactions with HA

The potential for interactions between MSCs and HA wasfirst assessed using immunofluorescent staining and flow

FIG. 1. CD44 expression by mesenchymal stem cells (MSCs) and MSC viability in methacrylated hyaluronic acid (MeHA)hydrogels. Immunofluorescence staining of CD44 (green) with nuclear counterstain (blue) of MSCs cultured in two di-mensions on glass coverslips (scale bar¼ 100 mm) (A), flow cytometry staining for CD44 (yellow) compared with unstained(black) population of MSCs before encapsulation (B), and live (green)=dead (red) image of MSCs encapsulated in MeHAhydrogel 6 h after photopolymerization (scale bar¼ 200 mm) (C). Color images available online at www.liebertonline.com=ten.

FIG. 2. Mesenchymal stem cell (MSC) chondrogenesis in methacrylated hyaluronic acid hydrogels in vitro. Relative geneexpression of type I (A) and type II (B) collagen, sox 9 (C), and aggrecan (D) for MSCs encapsulated in hydrogels cultured ingrowth (white) and chondrogenic (black) media. Glyceraldehyde 3-phosphate dehydrogenase was used as the housekeepinggene, and expression was normalized to cells at the time of encapsulation (indicated by the dashed line). Gene expression ofMSCs cultured in chondrogenic media was significantly different than that of MSCs cultured in growth medium ( p< 0.05) forall genes at all time points.

246 CHUNG AND BURDICK

cytometry (Fig. 1A, B) for CD44. This HA receptor waspresent on 99.6% of the cell population and stained uni-formly on MSCs cultured in two dimensions. Additionally,MSCs cultured in two dimensions expressed multiple iso-forms of hyaluronidases (e.g., Hyal 1, Hyal 2, Hyal 3) (resultsnot shown). When photo-encapsulated in 3D HA hydrogels,nearly all of the MSCs remained viable (>98%) as indicatedby live=dead staining 6 h after encapsulation (Fig. 1C).

MSC chondrogenesis

Chondrogenic differentiation was induced in vitro with theaddition of TGF-b3 to cultures of MSCs in HA hydrogels.Comparisons between MSC-laden HA hydrogels cultured ingrowth and chondrogenic media (þTGF-b3) showed sig-nificant differences in gene expression at 3, 7, and 14 days ofculture (Fig. 2). Specifically, greater up-regulation of sox 9,type II collagen, and aggrecan was observed for constructscultured in chondrogenic medium than cultures in growthmedium at all time points. Except for aggrecan at day 3,greater up-regulation of the chondrogenic genes (type IIcollagen, aggrecan, sox 9) was observed in hydrogels cul-tured in chondrogenic media over the gene expression ofMSCs at the time of encapsulation. Significant differences in

hyaluronidase expression were also observed based on cul-ture medium for hyal 2 and 3 (Fig. 3) at several time points.In addition, type I collagen was more down-regulated ingrowth and chondrogenic media than expression at the timeof encapsulation. Histologically, greater deposition of type IIcollagen and chondroitin sulfate (CS) was observed for MSC-laden HA hydrogels cultured in chondrogenic medium (Fig.4), where intense pericellular staining was observed after 14days of culture. The cells remained rounded in all gels, andno obvious spatial variations were observed between theperimeter and the center of the gels. Light staining for CS inhydrogels cultured in growth medium and light staining fortype I collagen in hydrogels cultured in chondrogenic med-ium was also observed.

When cultured in vivo, MSCs in all groups (HA-MSC,HAþT3, HA-C) exhibited greater expression of all genes ofinterest (Fig. 5) than cells at the time of encapsulation after 14days of implantation. Without growth factors present, therewere approximately 3000, 18, and 13 times more type IIcollagen, aggrecan, and sox 9 gene expression, respectively.The HAþT3 group (with TGF-b3) and the HA-C group(with 2 weeks of pre-culture in chondrogenic media) ex-hibited approximately 17.5 and 2370 times more type IIcollagen and 3.7 and 4.6 times more aggrecan, respectively,

FIG. 3. Hyaluronidase (Hyal) expression of mesenchymal stem cell (MSC)-laden methacrylated hyaluronic acid hydrogelsin vitro. Relative gene expression of Hyals for MSCs encapsulated in hydrogels cultured in growth (white) and chondrogenic(black) media. Glyceraldehyde 3-phosphate dehydrogenase was used as the housekeeping gene, and expression was nor-malized to cells at the time of encapsulation (indicated by the dashed line). *Significant differences ( p< 0.05) betweenhydrogels cultured in growth and chondrogenic medium.

FIG. 4. Immunohistochemistry of mesenchymal stem cell (MSC)-laden methacrylated hyaluronic acid hydrogels in vitro.Representative stains for type I and II collagen and chondroitin sulfate for MSC-laden hydrogels cultured in growth andchondrogenic media for 14 days in vitro. Scale bar¼ 100mm. Color images available online at www.liebertonline.com=ten.

HYALURONIC ACID MICROENVIRONMENTS FOR MSC CHONDROGENESIS 247

FIG. 5. Mesenchymal stem cell (MSC)-laden methacrylated hyaluronic acid (HA) hydrogels in vivo. Relative gene ex-pression for type I and type II collagen, aggrecan, sox 9 (A), and hyaluronidases (B) for MSCs encapsulated in hydrogelscultured 2 weeks in vivo. Glyceraldehyde 3-phosphate dehydrogenase was used as the housekeeping gene, and expressionwas normalized to cells at the time of encapsulation (indicated by the dashed line). The groups included the hydrogel alone(HA-MSC, black), hydrogels with transforming growth factor beta-3 co-encapsulated with cells (HAþT3, white), and hy-drogels pre-cultured in chondrogenic medium for 2 weeks (HA-C, shaded). All groups were significantly different ( p< 0.05)for type I and II collagen, whereas HA-MSC was significantly different from HAþT3 and HA-C for aggrecan. In addition,HAþT3 was significantly different from HA-C for hyaluronidase 2 and 3 and sox 9.

FIG. 6. Immunohistochemistry of mesenchymal stem cell (MSC)-laden methacrylated hyaluronic acid (HA) hydrogelsin vivo. Representative stains for type I and II collagen and chondroitin sulfate for hydrogel alone (HA-MSC), hydrogels withtransforming growth factor beta-3 co-encapsulated with cells (HAþT3), and hydrogels pre-cultured in chondrogenicmedium for 2 weeks (HA-C) groups after 3 week culture in vivo. Scale bar¼ 100 mm. Color images available online atwww.liebertonline.com=ten.

248 CHUNG AND BURDICK

than the HA-MSC group. Also, positive staining for type IIcollagen and CS, indicating chondrogenesis, was observedfor all groups, with the greatest amount of staining observedfor the HA-C group, which had an additional 2 weeks of pre-culture in vitro (Fig. 6). In addition, a separate in vitro as-sessment of TGF-b3 release for the HAþT3 group indicatedthat more than 75% of loaded TGF-b3 remained in the hy-drogels after 2 weeks and that the addition of exogenoushyaluronidase could trigger release (data not shown). Bio-activity of TGF-b3 was not specifically assessed in this studybeyond evidence of chondrogenesis within the hydrogelwith the incorporation of TGF-b3.

Comparison between HA and PEG hydrogels

To explore potential cell–HA scaffold interactions, HA hy-drogel cultures were compared with a relatively inert PEGhydrogel in short-term in vitro and in vivo cultures. First, theelastic modulus of PEG hydrogels was matched to 2 wt%MeHA hydrogels by altering the PEGDA macromer con-

centration. A 5.5 wt% PEG formulation with a modulus of13.3� 1.0 kPa was found to be comparable (i.e., no statisticaldifferences between moduli) with the 2 wt% MeHA hydrogels(13.0� 1.4 kPa) and was used for all comparison studies tominimize mechanical influences on cellular differentiation(Fig. 7A). In addition, live=dead staining and an MTT assay(Fig. 7B, C) demonstrated that viable MSCs were successfullyencapsulated in both hydrogel systems and that there were nostatistical differences in cell viability between hydrogel types.

With in vitro and in vivo cultures, the gene expression ofencapsulated MSCs differed depending on the hydrogelchemistry. With in vitro culture, type II collagen expressionby MSCs in MeHA hydrogels was up-regulated approxi-mately 7.3 and 6.6 times more than PEG counterparts after 7and 14 days, respectively (Fig. 8). Aggrecan was also up-regulated in MeHA hydrogels (*1.5 and *1.2 times after 7and 14 days, respectively), although to a lesser extent. Thesedifferences were also observed in immunohistochemicalstaining, with more-intense type II collagen and CS stainingin MeHA than PEG hydrogels (Fig. 9).

FIG. 7. Methacrylated hyaluronic acid (HA) compared with polyethylene glycol (PEG). Modulus of acellular HA and PEGhydrogels (A), live (green)=dead (red) images of mesenchymal stem cell–laden hydrogels at 1 and 24 h after polymerization;scale bar¼ 200 mm (B), relative mitochondrial activity for HA (black) and PEG (white) hydrogels after 7 and 14 days of in vitroculture (C). There were no statistical differences in hydrogel moduli and viability between the HA and PEG groups. Colorimages available online at www.liebertonline.com=ten.

FIG. 8. Methacrylated hyaluronic acid (HA) compared with polyethylene glycol (PEG) in vitro. Relative gene expression oftype I and type II collagen, sox 9, and aggrecan (A) and hyaluronidases (B) for mesenchymal stem cells encapsulated in HAhydrogels cultured in vitro in chondrogenic media for 7 (white) and 14 days (black). Glyceraldehyde 3-phosphate dehy-drogenase was used as the housekeeping gene, and expression was normalized to PEG counterparts (indicated by the dashedline). *Significant differences ( p< 0.05) between HA and PEG hydrogels.

HYALURONIC ACID MICROENVIRONMENTS FOR MSC CHONDROGENESIS 249

For in vivo culture, differences between MeHA and PEGhydrogels were most noticeable for MSCs plus scaffoldalone, with type II collagen and aggrecan up-regulated ap-proximately 43 and 6 times more, respectively, for MSCs inMeHA hydrogels than PEG hydrogels (Fig. 10). These dif-ferences between MeHA and PEG decreased to approxi-mately 11.5 and 4.1 times with the addition of TGF-b3directly encapsulated within the hydrogel and became neg-ligible (*0.7 and *1.5 times) with two weeks of pre-culturein chondrogenic media in vitro. Hyaluronidase expressionalso differed, with the expression of enzymes more down-regulated in vitro but more up-regulated in vivo for HAþT3and HA-C groups than for their PEG counterparts.

Discussion

Recently, MSCs have been explored as an alternative cellsource for cartilage regeneration and repair because of theirchondrogenic potential and their ease of isolation from sour-ces such as bone marrow without damage to native cartilagetissue. To this end, 3D scaffolds have been developed to createmicroenvironments for stem cells in which numerous factors,including material chemistry, functionalization with biologi-cal cues, interactions with surrounding cells, and mechanicalproperties,11 play a role in directing stem cell differentiation,in addition to soluble cues. In our laboratory, we investigatedthe use of a photo-cross-linked HA hydrogel to provide a

FIG. 9. Immunohistochemistry of mesenchymal stem cell (MSC)-laden methacrylated hyaluronic acid (HA) and poly-ethylene glycol (PEG) hydrogels in vitro. Representative stains for type I and II collagen and chondroitin sulfate for MSC-laden HA and PEG hydrogels cultured in chondrogenic medium for 14 days in vitro. Scale bar¼ 200 mm. Color imagesavailable online at www.liebertonline.com=ten.

FIG. 10. Methacrylated hyaluronic acid (HA) compared with polyethylene glycol (PEG) in vivo. Relative gene expression fortype I and II collagen, aggrecan, sox 9 (A), and hyaluronidases (B) of mesenchymal stem cells (MSCs) in hydrogel alone (HA-MSC, black), hydrogels with transforming growth factor beta-3 co-encapsulated with cells (HAþT3, white), and hydrogelspre-cultured in chondrogenic medium for 2 weeks (HA-C, shaded) groups cultured in vivo for 2 weeks. Glyceraldehyde3-phosphate dehydrogenase was used as the housekeeping gene, and expression was normalized to PEG counterparts(indicated by the dashed line). *Significant differences ( p< 0.05) between HA and PEG hydrogels.

250 CHUNG AND BURDICK

favorable niche for MSC chondrogenesis in vitro and in vivo byproviding cell interactive cues with a naturally found poly-saccharide.

One of the advantages of using a HA-based scaffold is thepotential for cell–scaffold interactions via cell surface re-ceptors, which could direct cell behaviors and assist in stemcell differentiation. Previous studies have shown that exo-genous HA added to culture medium elicits a chondrogeniceffect on equine MSCs grown in pellet culture,42 which maybe explained by the interaction between HA and HS CD44receptor. CD44 is a cell-surface receptor that binds to HA,providing a means to retain and anchor proteoglycan ag-gregates to the plasma membrane of a cell. In addition, in-timate association with the underlying cytoskeleton permitsCD44 to initiate intracellular signaling,42,43 allowing it tosense changes in the ECM environment and signal a cellularresponse. This receptor is of particular interest because it isessential for the maintenance of cartilage homeostasis44 andplays a role in the catabolism of HA via phagocytosis.45 Po-sitive expression of CD44 on MSCs was verified using im-munofluorescent staining and flow cytometry. In addition,the expression of hyaluronidases was observed in MSCs,indicating the potential to remodel the MeHA hydrogel.Hyaluronidases are enzymes that cleave the b-1,4-glycosidicbonds between glucuronic acid and N-acetylglucosamine,46

which can affect cell differentiation and matrix catabolism.Each enzyme isoform plays a specific role in cleaving HAinto discrete fragment sizes that regulate different cellularprocesses.47–49

The high viability of MSCs after photo-encapsulation inMeHA hydrogels demonstrated that these hydrogels couldbe successfully used as cell delivery vehicles. In addition,photopolymerization, with its numerous advantages for aclinical setting, served as an easy means to encapsulate cellsuniformly in a 3D hydrogel matrix. MSC chondrogenesis inMeHA hydrogels was induced in vitro by culture in chon-drogenic medium containing TGF-b3, which has been shownto induce chondrogenesis in a variety of scaffolds, includingalginate beads, agarose, and poly(DL-lactic-co-glycolic acid)-collagen hybrid meshes.50–52 Accordingly, the culture ofMSC-laden MeHA hydrogels in chondrogenic medium re-sulted in the up-regulation of type II collagen and aggrecan,which are typical markers for chondrogenic differentia-tion, and sox 9, a transcription factor that is required forsuccessive steps in chondrogenesis. This up-regulation ofcartilaginous protein expression was also reflected in im-munohistochemical staining, which showed intense pericel-lular staining of type II collagen and CS after only 2 weeks ofculture. Culture in growth medium also resulted in moredown-regulation of type I collagen and slightly greater up-regulation of type II collagen than the cells at the time ofencapsulation, suggesting that the scaffold alone could pro-mote chondrogenesis. Likewise, this was also observedthrough the immunohistochemical staining of CS. This couldbe due to the morphology of the cells in the hydrogels(rounded in 3D vs spread in 2D culture) and interactionswith the hydrogel. There were no spatial variations in ECMelaboration, indicating that growth factor transport throughthe hydrogels was not inhibited. Differences in hyalur-onidase expression were observed and may be due in part tomedium components, where serum can also contain HA.Similar gene expression observed on day 7 for hyal 3 does

not follow the observed trends, but the cause of this anomalyis unclear.

In vivo, MSC chondrogenesis was explored with andwithout TGF-b3, which was delivered without a carrier viadirect encapsulation within the hydrogel. Because each hy-drogel is exposed to 10 ng of TGF-b3 during in vitro culture, aconcentration of 10 ng of TGF-b3 per hydrogel was chosen forin vivo encapsulation. The assessment of TGF-b3 release fromMeHA hydrogels in vitro indicated that there was growthfactor remaining in the hydrogels after 14 days, unless theaddition of exogenous hyaluronidase triggered release. Thus,we hypothesized that TGF-b3 could be retained within thehydrogel to induce chondrogenic differentiation when im-planted. Gene expression analysis after 2 weeks of in vivoculture reflected increases in type II collagen, aggrecan, andsox 9, as was found in vitro, for all groups. These results in-dicate that the MeHA hydrogel as a cell delivery vehiclealone supports some MSC chondrogenesis, which the addi-tion of TGF-b3 then further enhances. The single dose of en-capsulated TGF-b3 was capable of altering gene expressionduring short-term in vivo culture. In addition, data showedthat the pre-programming of MSCs toward chondrogenesiswith 2 weeks of pre-culture in vitro was also sufficient tomaintain chondrogenesis in short-term in vivo culture. Thiswas also reflected in the immunohistochemical staining oftype II collagen and CS, as seen in Figure 6. Furthermore,increases in hyaluronidase expression in vivo may reflectpotential cell-dictated remodeling of the MeHA hydrogel.Differences between HA-C and the other in vivo groups (HA-MSC and HAþT3) seen in the gene expression and im-munohistochemistry data can also be attributed, in part, to the2 weeks of additional culture time.

To better evaluate the effect of scaffold material on MSCchondrogenesis, MeHA hydrogels were compared with a re-latively inert PEG hydrogel system. PEG hydrogels were usedas comparative controls because of their resistance to proteinadsorption and minimal interaction with cells. To eliminatethe influence of other parameters on MSC differentiation, themechanical properties of the hydrogels were correlated. Al-though the macromers have different structures (diacrylatefor PEG and an acrylated chain for HA) and molecularweights, the modulus is proportional to the hydrogel cross-linking density and should reflect the mechanical stressessensed by the cells and also reflect the diffusion rate of growthfactors to the cells. In addition, the 2 wt% MeHA hydrogel hasnot been optimized for MSC differentiation and was chosenbased on our previous work with chondrocytes. Thus, there isample opportunity for further optimization of the hydrogelthrough tunable properties (e.g., mechanics and degradation),which can influence chondrogenesis.

In vitro cultures reflected significant differences in geneexpression for type II collagen and hyaluronidases betweenthe hydrogels (i.e., greater expression in HA than in PEGhydrogels). Accordingly, the up-regulation in gene expres-sion translated to greater type II collagen and CS depositionwithin the HA hydrogels. For in vivo culture, differencesbetween HA and PEG hydrogels were most noticeable forMSCs and polymer alone, indicating that hydrogel chemistryalone can greatly influence the commitment of MSCs toundergo chondrogenesis. However, these differences de-creased with the addition of TGF-b3, suggesting that thehydrogel chemistry may play a less prominent role when

HYALURONIC ACID MICROENVIRONMENTS FOR MSC CHONDROGENESIS 251

chondrogenic growth factors are present. Furthermore, oncechondro-induced, MSC gene expression for chondrogenicmarkers between polymers was comparable in vivo. Withpericellular deposition after 2 weeks of in vitro culture, MSCsmay begin interacting more with newly deposited matrixthan with the surrounding scaffold material; thus, differ-ences as a result of polymer choice may be minimized whencompared in longer in vivo cultures.

Others have successfully used PEG hydrogels for cartilagetissue engineering with chondrocytes53 and stem cells,54,55

and the inertness of the hydrogels may be advantageous formany applications because they can be modified specificallyto control interactions. Additionally, PEG hydrogels havebeen further designed to incorporate degradable moieties,bioactive molecules, and adhesive functionality to controloverall matrix distribution and cell interactions.12,56,59 Also,HA has been used to direct embryonic stem cell differentia-tion in hydrogels as the major matrix component60 or inter-mixed with PEG hydrogels.54,61 HA, as a natural polymer, isable to provide specific biological interactions and physiolo-gical degradation by enzymes, whereas PEG, as a syntheticpolymer, has the benefits of being reproducible and havingeasily controllable physical properties. Blends of cross-linkedHA and PEG have resulted in concentration-dependentphysical properties (e.g., swelling, degradation, and me-chanics),27,62 whereas the addition of soluble HA encapsu-lated in PEGDA hydrogels has been shown to independentlyinduce chondrogenesis in goat MSCs.54 This work indicatesthat the cell type is important in the cellular response and thatthe method of exposure (e.g., bound versus soluble) is alsoimportant.

In conclusion, we have shown that MSCs undergo chon-drogenesis in photo-cross-linked HA hydrogels in vitro andin vivo in short-term culture. Gene expression also showedthat scaffold choice affects the expression of cartilaginousmatrix proteins, where favorable cell–scaffold interactions canassist in chondrogenic differentiation. Additionally, TGF-b3can be delivered within HA hydrogels and can alter geneexpression of encapsulated MSCs. The next step in assessingthe use of MSCs as a cell source for cartilage regeneration inHA hydrogels is the completion of long-term studies to assessthe quality and function of the matrix formed by MSCs with arange of methods for the delivery of TGF-b3.

Acknowledgments

Support for this research was provided through NIHGrant K22 DE-015761 and a National Science FoundationGraduate Research Fellowship (CC). The authors would alsolike to acknowledge Jamie L. Ifkovits for her help in syn-thesizing the PEGDA macromer and 1H NMR characteriza-tion and Cheng-Hung Chou for his help in performing theTGF-b3 release experiment.

References

1. Pittenger, M.F., Mackay, A.M., Beck, S.C., Jaiswal, R.K.,Douglas, R., Mosca, J.D., Moorman, M.A., Simonetti, D.W.,Craig, S., and Marshak, D.R. Multilineage potential of adulthuman mesenchymal stem cells. Science 284, 143, 1999.

2. Friedenstein, A.J., Gorskaja, J.F., and Kulagina, N.N. Fibro-blast precursors in normal and irradiated mouse hemato-poietic organs. Exp Hematol 4, 267, 1976.

3. Alhadlaq, A., and Mao, J.J. Mesenchymal stem cells: isola-tion and therapeutics. Stem Cells Dev 13, 436, 2004.

4. Zuk, P.A., Zhu, M., Ashjian, P., De Ugarte, D.A., Huang, J.I.,Mizuno, H., Alfonso, Z.C., Fraser, J.K., Benhaim, P., andHedrick, M.H. Human adipose tissue is a source of multi-potent stem cells. Mol Biol Cell 13, 4279, 2002.

5. Ashton, B.A., Allen, T.D., Howlett, C.R., Eaglesom, C.C.,Hattori, A., and Owen, M. Formation of bone and cartilageby marrow stromal cells in diffusion chambers in vivo. ClinOrthop Relat Res 294, 1980.

6. Barry, F.P. Biology and clinical applications of mesenchymalstem cells. Birth Defects Res C Embryo Today 69, 250, 2003.

7. Johnstone, B., Hering, T.M., Caplan, A.I., Goldberg, V.M.,and Yoo, J.U. In vitro chondrogenesis of bone marrow-derived mesenchymal progenitor cells. Exp Cell Res 238,

265, 1998.8. Mackay, A.M., Beck, S.C., Murphy, J.M., Barry, F.P., Chi-

chester, C.O., and Pittenger, M.F. Chondrogenic differ-entiation of cultured human mesenchymal stem cells frommarrow. Tissue Eng 4, 415, 1998.

9. Sekiya, I., Vuoristo, J.T., Larson, B.L., and Prockop, D.J.In vitro cartilage formation by human adult stem cells frombone marrow stroma defines the sequence of cellular andmolecular events during chondrogenesis. Proc Natl Acad SciU S A 99, 4397, 2002.

10. Yoo, J.U., Barthel, T.S., Nishimura, K., Solchaga, L., Caplan,A.I., Goldberg, V.M., and Johnstone, B. The chondrogenicpotential of human bone-marrow-derived mesenchymalprogenitor cells. J Bone Joint Surg Am 80, 1745, 1998.

11. Dawson, E., Mapili, G., Erickson, K., Taqvi, S., and Roy, K.Biomaterials for stem cell differentiation. Adv Drug DelivRev 60, 215, 2008.

12. Varghese, S., Hwang, N.S., Canver, A.C., Theprungsirikul,P., Lin, D.W., and Elisseeff, J. Chondroitin sulfate based ni-ches for chondrogenic differentiation of mesenchymal stemcells. Matrix Biol 27, 12, 2008.

13. Chung, C., and Burdick, J.A. Engineering cartilage tissue.Adv Drug Deliv Rev 60, 243, 2008.

14. Morgelin, M., Heinegard, D., Engel, J., and Paulsson, M. Thecartilage proteoglycan aggregate: assembly through com-bined protein-carbohydrate and protein-protein interactions.Biophys Chem 50, 113, 1994.

15. Chen, W.Y., and Abatangelo, G. Functions of hyaluronan inwound repair. Wound Repair Regen 7, 79, 1999.

16. Knudson, C.B., and Knudson, W. Hyaluronan-binding pro-teins in development, tissue homeostasis, and disease.FASEB J 7, 1233, 1993.

17. Laurent, T.C., and Fraser, J.R. Hyaluronan. FASEB J 6, 2397,1992.

18. Menzel, E.J., and Farr, C. Hyaluronidase and its substratehyaluronan: biochemistry, biological activities and ther-apeutic uses. Cancer Lett 131, 3, 1998.

19. Grigolo, B., Roseti, L., Fiorini, M., Fini, M., Giavaresi, G.,Aldini, N.N., Giardino, R., and Facchini, A. Transplantationof chondrocytes seeded on a hyaluronan derivative (hyaff-11) into cartilage defects in rabbits. Biomaterials 22, 2417,2001.

20. Marcacci, M., Berruto, M., Brocchetta, D., Delcogliano, A.,Ghinelli, D., Gobbi, A., Kon, E., Pederzini, L., Rosa, D.,Sacchetti, G.L., Stefani, G., and Zanasi, S. Articular cartilageengineering with Hyalograft (R) C - 3-year clinical results.Clin Orthop Relat Res 96, 2005.

21. Smeds, K.A., Pfister-Serres, A., Miki, D., Dastgheib, K.,Inoue, M., Hatchell, D.L., and Grinstaff, M.W. Photo-

252 CHUNG AND BURDICK

crosslinkable polysaccharides for in situ hydrogel formation.J Biomed Mater Res 54, 115, 2001.

22. Nettles, D.L., Vail, T.P., Morgan, M.T., Grinstaff, M.W., andSetton, L.A. Photocrosslinkable hyaluronan as a scaffold forarticular cartilage repair. Ann Biomed Eng 32, 391, 2004.

23. Ramamurthi, A., and Vesely, I. Ultraviolet light-inducedmodification of crosslinked hyaluronan gels. J Biomed MaterRes A 66, 317, 2003.

24. Hahn, S.K., Jelacic, S., Maier, R.V., Stayton, P.S., and Hoff-man, A.S. Anti-inflammatory drug delivery from hyaluronicacid hydrogels. J Biomater Sci Polym Ed 15, 1111, 2004.

25. Luo, Y., Kirker, K.R., and Prestwich, G.D. Cross-linkedhyaluronic acid hydrogel films: new biomaterials for drugdelivery. J Control Release 69, 169, 2000.

26. Liu, Y.C., Shu, X.Z., and Prestwich, G.D. Osteochondraldefect repair with autologous bone marrow-derived me-senchymal stem cells in an injectable, in situ, cross-linkedsynthetic extracellular matrix. Tissue Eng 12, 3405, 2006.

27. Park, Y.D., Tirelli, N., and Hubbell, J.A. Photopolymerizedhyaluronic acid-based hydrogels and interpenetrating net-works. Biomaterials 24, 893, 2003.

28. Shu, X.Z., Liu, Y., Luo, Y., Roberts, M.C., and Prestwich,G.D. Disulfide cross-linked hyaluronan hydrogels. Bioma-cromolecules 3, 1304, 2002.

29. Baier Leach, J., Bivens, K.A., Patrick, C.W., Jr., and Schmidt,C.E. Photocrosslinked hyaluronic acid hydrogels: natural,biodegradable tissue engineering scaffolds. BiotechnolBioeng 82, 578, 2003.

30. Burdick, J.A., Chung, C., Jia, X.Q., Randolph, M.A., andLanger, R. Controlled degradation and mechanical behaviorof photopolymerized hyaluronic acid networks. Biomacro-molecules 6, 386, 2005.

31. Solchaga, L.A., Dennis, J.E., Goldberg, V.M., and Caplan,A.I. Hyaluronic acid-based polymers as cell carriers for tis-sue-engineered repair of bone and cartilage. J Orthop Res 17,

205, 1999.32. Brun, P., Abatangelo, G., Radice, M., Zacchi, V., Guidolin,

D., Gordini, D.D., and Cortivo, R. Chondrocyte aggrega-tion and reorganization into three-dimensional scaffolds.J Biomed Mater Res 46, 337, 1999.

33. Chung, C., Mesa, J., Randolph, M.A., Yaremchuk, M., andBurdick, J.A. Influence of gel properties on neocartilageformation by auricular chondrocytes photoencapsulated inhyaluronic acid networks. J Biomed Mater Res A 77, 518,2006.

34. Aigner, J., Tegeler, J., Hutzler, P., Campoccia, D., Pavesio,A., Hammer, C., Kastenbauer, E., and Naumann, A. Carti-lage tissue engineering with novel nonwoven structuredbiomaterial based on hyaluronic acid benzyl ester. J BiomedMater Res 42, 172, 1998.

35. Fraser, S.A., Crawford, A., Frazer, A., Dickinson, S., Hol-lander, A.P., Brook, I.M., and Hatton, P.V. Localization oftype VI collagen in tissue-engineered cartilage on polymerscaffolds. Tissue Eng 12, 569, 2006.

36. Ji, Y., Ghosh, K., Shu, X.Z., Li, B., Sokolov, J.C., Prestwich,G.D., Clark, R.A., and Rafailovich, M.H. Electrospun three-dimensional hyaluronic acid nanofibrous scaffolds. Bioma-terials 27, 3782, 2006.

37. Chung, C., Mesa, J., Miller, G.J., Randolph, M.A., Gill, T.J.,and Burdick, J.A. Effects of auricular chondrocyte expansionon neocartilage formation in photocrosslinked hyaluronicacid networks. Tissue Eng 12, 2665, 2006.

38. Chung, C., Erickson, I.E., Mauck, R.L., and Burdick, J.A.Differential behavior of auricular and articular chondrocytes

in hyaluronic acid hydrogels. Tissue Eng 2008 Apr 12 [Epubahead of print].

39. Zhu, H., Mitsuhashi, N., Klein, A., Barsky, L.W., Weinberg,K., Barr, M.L., Demetriou, A., and Wu, G.D. The role ofthe hyaluronan receptor CD44 in mesenchymal stem cellmigration in the extracellular matrix. Stem Cells 24, 928,2006.

40. Burdick, J.A., and Anseth, K.S. Photoencapsulation of os-teoblasts in injectable RGD-modified PEG hydrogels forbone tissue engineering. Biomaterials 23, 4315, 2002.

41. National Institutes of Health. Guidelines for the care and useof laboratory animals. NIH Publication 85-23 rev. 1985.

42. Hegewald, A.A., Ringe, J., Bartel, J., Kruger, I., Notter, M.,Barnewitz, D., Kaps, C., and Sittinger, M. Hyaluronic acidand autologous synovial fluid induce chondrogenic differ-entiation of equine mesenchymal stem cells: a preliminarystudy. Tissue Cell 36, 431, 2004.

43. Jiang, H., Peterson, R.S., Wang, W., Bartnik, E., Knudson,C.B., and Knudson, W. A requirement for the CD44 cyto-plasmic domain for hyaluronan binding, pericellular matrixassembly, and receptor-mediated endocytosis in COS-7 cells.J Biol Chem 277, 10531, 2002.

44. Knudson, W., and Loeser, R.F. CD44 and integrin matrixreceptors participate in cartilage homeostasis. Cell Mol LifeSci 59, 36, 2002.

45. Vachon, E., Martin, R., Plumb, J., Kwok, V., Vandivier, R.W.,Glogauer, M., Kapus, A., Wang, X., Chow, C.W., Grinstein,S., and Downey, G.P. CD44 is a phagocytic receptor. Blood107, 4149, 2006.

46. Chow, G., Knudson, C.B., and Knudson, W. Expression andcellular localization of human hyaluronidase-2 in articularchondrocytes and cultured cell lines. Osteoarthritis Cartilage14, 849, 2006.

47. Frost, G.I., Csoka, A.B., Wong, T., and Stern, R. Purification,cloning, and expression of human plasma hyaluronidase.Biochem Biophys Res Commun 236, 10, 1997.

48. Lepperdinger, G., Strobl, B., and Kreil, G. HYAL2, a humangene expressed in many cells, encodes a lysosomal hyalur-onidase with a novel type of specificity. J Biol Chem 273,

22466, 1998.49. Flannery, C.R., Little, C.B., Hughes, C.E., and Caterson, B.

Expression and activity of articular cartilage hyaluronidases.Biochem Biophys Res Commun 251, 824, 1998.

50. Chen, G., Liu, D., Tadokoro, M., Hirochika, R., Ohgushi, H.,Tanaka, J., and Tateishi, T. Chondrogenic differentiation ofhuman mesenchymal stem cells cultured in a cobweb-likebiodegradable scaffold. Biochem Biophys Res Commun 322,

50, 2004.51. Huang, C.Y., Reuben, P.M., D’Ippolito, G., Schiller, P.C., and

Cheung, H.S. Chondrogenesis of human bone marrow-derived mesenchymal stem cells in agarose culture. AnatRec A Discov Mol Cell Evol Biol 278, 428, 2004.

52. Mehlhorn, A.T., Schmal, H., Kaiser, S., Lepski, G., Finken-zeller, G., Stark, G.B., and Sudkamp, N.P. Mesenchymalstem cells maintain TGF-beta-mediated chondrogenic phe-notype in alginate bead culture. Tissue Eng 12, 1393, 2006.

53. Elisseeff, J., McIntosh, W., Anseth, K., Riley, S., Ragan, P.,and Langer, R. Photoencapsulation of chondrocytes inpoly(ethylene oxide)-based semi-interpenetrating networks.J Biomed Mater Res 51, 164, 2000.

54. Sharma, B., Williams, C.G., Khan, M., Manson, P., andElisseeff, J.H. In vivo chondrogenesis of mesenchymal stemcells in a photopolymerized hydrogel. Plast Reconstr Surg119, 112, 2007.

HYALURONIC ACID MICROENVIRONMENTS FOR MSC CHONDROGENESIS 253

55. Williams, C.G., Kim, T.K., Taboas, A., Malik, A., Manson,P., and Elisseeff, J. In vitro chondrogenesis of bonemarrow-derived mesenchymal stem cells in a photopolym-erizing hydrogel. Tissue Eng 9, 679, 2003.

56. Bryant, S.J., and Anseth, K.S. Controlling the spatial distri-bution of ECM components in degradable PEG hydrogelsfor tissue engineering cartilage. J Biomed Mater Res A 64,

70, 2003.57. Bryant, S.J., Arthur, J.A., and Anseth, K.S. Incorporation of

tissue-specific molecules alters chondrocyte metabolism andgene expression in photocrosslinked hydrogels. Acta Bio-mater 1, 243, 2005.

58. Rice, M.A., and Anseth, K.S. Controlling cartilaginous ma-trix evolution in hydrogels with degradation triggered byexogenous addition of an enzyme. Tissue Eng 13, 683, 2007.

59. Salinas, C.N., Cole, B.B., Kasko, A.M., and Anseth, K.S.Chondrogenic differentiation potential of human mesen-chymal stem cells photoencapsulated within poly(ethyleneglycol)-arginine-glycine-aspartic acid-serine thiol-methacrylatemixed-mode networks. Tissue Eng 13, 1025, 2007.

60. Gerecht, S., Burdick, J.A., Ferreira, L.S., Townsend, S.A.,Langer, R., and Vunjak-Novakovic, G. Hyaluronic acid hy-

drogel for controlled self-renewal and differentiation ofhuman embryonic stem cells. Proc Natl Acad Sci U S A 104,

11298, 2007.61. Hwang, N.S., Varghese, S., and Elisseeff, J. Controlled

differentiation of stem cells. Adv Drug Deliv Rev 60, 199,2008.

62. Kirker, K.R., and Prestwich, G.D. Physical properties ofglycosaminoglycan hydrogels. J Polym Sci B Polym Phys 42,

4344, 2004.

Address reprint requests to:Jason A. Burdick, Ph.D.

University of PennsylvaniaDepartment of Bioengineering

240 Skirkanich Hall, 210 S. 33rd St.Philadelphia, PA 19104

E-mail: burdick2@seas.upenn.edu

Received: January 30, 2008Accepted: March 19, 2008

Online Publication Date: July 3, 2008

254 CHUNG AND BURDICK

This article has been cited by:

1. Jessica E. Frith, Andrew R. Cameron, Donna J. Menzies, Peter Ghosh, Darryl L. Whitehead, Stan Gronthos, Andrew C.W.Zannettino, Justin J. Cooper-White. 2013. An injectable hydrogel incorporating mesenchymal precursor cells and pentosanpolysulphate for intervertebral disc regeneration. Biomaterials . [CrossRef]

2. Henning Madry, Ana Rey-Rico, Jagadeesh K. Venkatesan, Brian Johnstone, Magali Cucchiarini. Transforming Growth FactorBeta-Releasing Scaffolds for Cartilage Tissue Engineering. Tissue Engineering Part B: Reviews, ahead of print. [Abstract] [FullText HTML] [Full Text PDF] [Full Text PDF with Links]

3. Wouter J.F.M. Jurgens, Robert Jan Kroeze, Behrouz Zandieh-Doulabi, Annemieke van Dijk, Greetje A.P. Renders, Theo H.Smit, Florine J. van Milligen, Marco J.P.F. Ritt, Marco N. Helder. 2013. One-Step Surgical Procedure for the Treatment ofOsteochondral Defects with Adipose-Derived Stem Cells in a Caprine Knee Defect: A Pilot Study. BioResearch Open Access 2:4,315-325. [Abstract] [Full Text HTML] [Full Text PDF] [Full Text PDF with Links] [Supplemental Material]

4. Ferdous Khan, Sheikh Rafi AhmadBiomimetic Polysaccharides and Derivatives for Cartilage Tissue Regeneration 1-22. [CrossRef]5. Prof. Henning Madry, Dr. Ana Rey Rico, Dr. Jagadeesh K. Venkatesan, Dr. Brian Johnstone, Prof. Magali Cucchiarini. TGF-

β-releasing scaffolds for cartilage tissue engineering. Tissue Engineering Part B: Reviews 0:ja. . [Abstract] [Full Text PDF] [FullText PDF with Links]

6. Iris L. Kim, Sudhir Khetan, Brendon M. Baker, Christopher S. Chen, Jason A. Burdick. 2013. Fibrous hyaluronic acid hydrogelsthat direct MSC chondrogenesis through mechanical and adhesive cues. Biomaterials 34:22, 5571-5580. [CrossRef]

7. Marianna Peroglio, David Eglin, Lorin M. Benneker, Mauro Alini, Sibylle Grad. 2013. Thermoreversible hyaluronan-basedhydrogel supports in vitro and ex vivo disc-like differentiation of human mesenchymal stem cells. The Spine Journal . [CrossRef]

8. L. Bian, M. Guvendiren, R. L. Mauck, J. A. Burdick. 2013. Hydrogels that mimic developmentally relevant matrix and N-cadherininteractions enhance MSC chondrogenesis. Proceedings of the National Academy of Sciences 110:25, 10117-10122. [CrossRef]

9. Mark Ahearne, Daniel J Kelly. 2013. A comparison of fibrin, agarose and gellan gum hydrogels as carriers of stem cells and growthfactor delivery microspheres for cartilage regeneration. Biomedical Materials 8:3, 035004. [CrossRef]

10. Chih-Ling Chou, Alexander L. Rivera, Takao Sakai, Arnold I. Caplan, Victor M. Goldberg, Jean F. Welter, Harihara Baskaran.2013. Micrometer Scale Guidance of Mesenchymal Stem Cells to Form Structurally Oriented Cartilage Extracellular Matrix.Tissue Engineering Part A 19:9-10, 1081-1090. [Abstract] [Full Text HTML] [Full Text PDF] [Full Text PDF with Links]

11. Deborah Blanchard, Rachel Auzély-VeltyAssociating Biopolymer Systems and Hyaluronate Biomaterials 235-278. [CrossRef]12. Chien-Hsi Chen, Shoei-Shen Wang, Erika IH Wei, Ting-Yu Chu, Patrick CH Hsieh. 2013. Hyaluronan Enhances Bone Marrow

Cell Therapy for Myocardial Repair After Infarction. Molecular Therapy 21:3, 670-679. [CrossRef]13. Murat Guvendiren, Jason A Burdick. 2013. Engineering synthetic hydrogel microenvironments to instruct stem cells. Current

Opinion in Biotechnology . [CrossRef]14. Sarah E. Bulman, Valerie Barron, Cynthia M. Coleman, Frank Barry. 2013. Enhancing the Mesenchymal Stem Cell Therapeutic

Response: Cell Localization and Support for Cartilage Repair. Tissue Engineering Part B: Reviews 19:1, 58-68. [Abstract] [FullText HTML] [Full Text PDF] [Full Text PDF with Links]

15. Liming Bian, Chieh Hou, Elena Tous, Reena Rai, Robert L. Mauck, Jason A. Burdick. 2013. The influence of hyaluronic acidhydrogel crosslinking density and macromolecular diffusivity on human MSC chondrogenesis and hypertrophy. Biomaterials 34:2,413-421. [CrossRef]

16. Glenn D. Prestwich, Sarah AtzetEngineered Natural Materials 195-209. [CrossRef]17. Shimon A. Unterman, Matthew Gibson, Janice H. Lee, Joshua Crist, Thanissara Chansakul, Elaine C. Yang, Jennifer H. Elisseeff.

2012. Hyaluronic Acid-Binding Scaffold for Articular Cartilage Repair. Tissue Engineering Part A 18:23-24, 2497-2506. [Abstract][Full Text HTML] [Full Text PDF] [Full Text PDF with Links] [Supplemental Material]

18. Cindy Chung, Kyle J. Lampe, Sarah C. Heilshorn. 2012. Tetrakis(hydroxymethyl) Phosphonium Chloride as a Covalent Cross-Linking Agent for Cell Encapsulation within Protein-Based Hydrogels. Biomacromolecules 121126154823003. [CrossRef]

19. Ameya Phadke, Shyni VargheseSynthetic Biomaterials and Stem Cells for Connective Tissue Engineering 1-18. [CrossRef]20. Talar Tokatlian, Cynthia Cam, Shayne N. Siegman, Yuguo Lei, Tatiana Segura. 2012. Design and characterization of microporous

hyaluronic acid hydrogels for in vitro gene transfer to mMSCs. Acta Biomaterialia 8:11, 3921-3931. [CrossRef]21. Hee Hun Yoon, Suk Ho Bhang, Jung-Youn Shin, Jaehoon Shin, Byung-Soo Kim. 2012. Enhanced Cartilage Formation via

Three-Dimensional Cell Engineering of Human Adipose-Derived Stem Cells. Tissue Engineering Part A 18:19-20, 1949-1956.[Abstract] [Full Text HTML] [Full Text PDF] [Full Text PDF with Links]

22. Yan Guo, Tun Yuan, Zhanwen Xiao, Pingping Tang, Yumei Xiao, Yujiang Fan, Xingdong Zhang. 2012. Hydrogels of collagen/chondroitin sulfate/hyaluronan interpenetrating polymer network for cartilage tissue engineering. Journal of Materials Science:Materials in Medicine 23:9, 2267-2279. [CrossRef]

23. Isaac E. Erickson, Sydney R. Kestle, Kilief H. Zellars, Megan J. Farrell, Minwook Kim, Jason A. Burdick, Robert L. Mauck.2012. High mesenchymal stem cell seeding densities in hyaluronic acid hydrogels produce engineered cartilage with native tissueproperties. Acta Biomaterialia 8:8, 3027-3034. [CrossRef]

24. Amos Matsiko, Tanya J. Levingstone, Fergal J. O’Brien, John P. Gleeson. 2012. Addition of hyaluronic acid improves cellularinfiltration and promotes early-stage chondrogenesis in a collagen-based scaffold for cartilage tissue engineering. Journal of theMechanical Behavior of Biomedical Materials 11, 41-52. [CrossRef]

25. Minwook Kim, Isaac E. Erickson, Marwa Choudhury, Nancy Pleshko, Robert L. Mauck. 2012. Transient exposure to TGF-3improves the functional chondrogenesis of MSC-laden hyaluronic acid hydrogels. Journal of the Mechanical Behavior of BiomedicalMaterials 11, 92-101. [CrossRef]

26. Wei Seong Toh, Teck Chuan Lim, Motoichi Kurisawa, Myron Spector. 2012. Modulation of mesenchymal stem cellchondrogenesis in a tunable hyaluronic acid hydrogel microenvironment. Biomaterials 33:15, 3835-3845. [CrossRef]

27. Liming Bian, David Y. Zhai, Emily C. Zhang, Robert L. Mauck, Jason A. Burdick. 2012. Dynamic Compressive Loading EnhancesCartilage Matrix Synthesis and Distribution and Suppresses Hypertrophy in hMSC-Laden Hyaluronic Acid Hydrogels. TissueEngineering Part A 18:7-8, 715-724. [Abstract] [Full Text HTML] [Full Text PDF] [Full Text PDF with Links]

28. Isaac E Erickson, Sydney R Kestle, Kilief H Zellars, George R Dodge, Jason A Burdick, Robert L Mauck. 2012. Improved cartilagerepair via in vitro pre-maturation of MSC-seeded hyaluronic acid hydrogels. Biomedical Materials 7:2, 024110. [CrossRef]

29. Ross A. Marklein, Danielle E. Soranno, Jason A. Burdick. 2012. Magnitude and presentation of mechanical signals influenceadult stem cell behavior in 3-dimensional macroporous hydrogels. Soft Matter . [CrossRef]

30. Bin Duan, Laura A. Hockaday, Kevin H. Kang, Jonathan T. Butcher. 2012. 3D Bioprinting of heterogeneous aortic valve conduitswith alginate/gelatin hydrogels. Journal of Biomedical Materials Research Part A n/a-n/a. [CrossRef]

31. Michele M. Nava, Manuela T. Raimondi, Riccardo Pietrabissa. 2012. Controlling Self-Renewal and Differentiation of Stem Cellsvia Mechanical Cues. Journal of Biomedicine and Biotechnology 2012, 1-12. [CrossRef]

32. Chitrangada Acharya, Adetola Adesida, Paul Zajac, Marcus Mumme, Jens Riesle, Ivan Martin, Andrea Barbero. 2012. Enhancedchondrocyte proliferation and mesenchymal stromal cells chondrogenesis in coculture pellets mediate improved cartilageformation. Journal of Cellular Physiology 227:1, 88-97. [CrossRef]

33. Drew Kuraitis, Céline Giordano, Marc Ruel, Antonio Musarò, Erik J. Suuronen. 2012. Exploiting extracellular matrix-stem cellinteractions: A review of natural materials for therapeutic muscle regeneration. Biomaterials 33:2, 428-443. [CrossRef]

34. Wanwisa Suwannaloet, Wiroon Laupattarakasem, Peerapol Sukon, Siriwan Ong-Chai, Pisamai Laupattarakasem. 2012. CombinedEffect of Subchondral Drilling and Hyaluronic Acid with/without Diacerein in Full-Thickness Articular Cartilage Lesion inRabbits. The Scientific World Journal 2012, 1-9. [CrossRef]

35. Murat Guvendiren, Hoang D. Lu, Jason A. Burdick. 2012. Shear-thinning hydrogels for biomedical applications. Soft Matter. [CrossRef]

36. M. Guvendiren, B. Purcell, J.A. BurdickPhotopolymerizable Systems 413-438. [CrossRef]37. Emily R. Aurand, Kyle J. Lampe, Kimberly B. Bjugstad. 2011. Defining and designing polymers and hydrogels for neural tissue

engineering. Neuroscience Research . [CrossRef]38. Song P. Seto, Maria E. Casas, Johnna S. Temenoff. 2011. Differentiation of mesenchymal stem cells in heparin-containing

hydrogels via coculture with osteoblasts. Cell and Tissue Research . [CrossRef]39. Zhixiang Tong, Shilpa Sant, Ali Khademhosseini, Xinqiao Jia. 2011. Controlling the Fibroblastic Differentiation of Mesenchymal

Stem Cells Via the Combination of Fibrous Scaffolds and Connective Tissue Growth Factor. Tissue Engineering Part A 17:21-22,2773-2785. [Abstract] [Full Text HTML] [Full Text PDF] [Full Text PDF with Links] [Supplemental Material]

40. Han-Tsung Liao, Chien-Tzung Chen, Jyh-Ping Chen. 2011. Osteogenic Differentiation and Ectopic Bone Formation of CanineBone Marrow-Derived Mesenchymal Stem Cells in Injectable Thermo-Responsive Polymer Hydrogel. Tissue Engineering PartC: Methods 17:11, 1139-1149. [Abstract] [Full Text HTML] [Full Text PDF] [Full Text PDF with Links]

41. Adelola Oseni, Claire Crowley, Mark Lowdell, Martin Birchall, Peter E. Butler, Alexander M. Seifalian. 2011. Advancing nasalreconstructive surgery: the application of tissue engineering technology. Journal of Tissue Engineering and Regenerative Medicinen/a-n/a. [CrossRef]

42. Guo-Shiang Huang, Lien-Guo Dai, Betty L. Yen, Shan-hui Hsu. 2011. Spheroid formation of mesenchymal stem cells onchitosan and chitosan-hyaluronan membranes. Biomaterials 32:29, 6929-6945. [CrossRef]

43. Iris L. Kim, Robert L. Mauck, Jason A. Burdick. 2011. Hydrogel design for cartilage tissue engineering: A case study withhyaluronic acid. Biomaterials . [CrossRef]

44. Liming Bian, David Y. Zhai, Elena Tous, Reena Rai, Robert L. Mauck, Jason A. Burdick. 2011. Enhanced MSC chondrogenesisfollowing delivery of TGF-β3 from alginate microspheres within hyaluronic acid hydrogels in vitro and in vivo. Biomaterials32:27, 6425-6434. [CrossRef]

45. Jianwen Xu, Tera M. Filion, Fioleda Prifti, Jie Song. 2011. Cytocompatible Poly(ethylene glycol)-co-polycarbonate HydrogelsCross-Linked by Copper-Free, Strain-Promoted Click Chemistry. Chemistry - An Asian Journal n/a-n/a. [CrossRef]

46. Shiva Gojgini, Talar Tokatlian, Tatiana Segura. 2011. Utilizing Cell–Matrix Interactions To Modulate Gene Transfer to StemCells Inside Hyaluronic Acid Hydrogels. Molecular Pharmaceutics 110824135034001. [CrossRef]

47. Young-Seok Jung, Kun Na. 2011. Protein Delivery System based on Various Polysaccharides. Journal of Pharmaceutical Investigation41:4, 197-204. [CrossRef]

48. Kara L. Spiller, Suzanne A. Maher, Anthony M. Lowman. 2011. Hydrogels for the Repair of Articular Cartilage Defects. TissueEngineering Part B: Reviews 17:4, 281-299. [Abstract] [Full Text HTML] [Full Text PDF] [Full Text PDF with Links]

49. Xian Xu, Amit K. Jha, Randall L. Duncan, Xinqiao Jia. 2011. Heparin-decorated, hyaluronic acid-based hydrogel particles forthe controlled release of bone morphogenetic protein 2. Acta Biomaterialia 7:8, 3050-3059. [CrossRef]

50. A. T. Hillel, S. Unterman, Z. Nahas, B. Reid, J. M. Coburn, J. Axelman, J. J. Chae, Q. Guo, R. Trow, A. Thomas, Z. Hou, S.Lichtsteiner, D. Sutton, C. Matheson, P. Walker, N. David, S. Mori, J. M. Taube, J. H. Elisseeff. 2011. Photoactivated CompositeBiomaterial for Soft Tissue Restoration in Rodents and in Humans. Science Translational Medicine 3:93, 93ra67-93ra67.[CrossRef]

51. Hee Seok Yang, Wan-Geun La, Suk Ho Bhang, Hak-Jun Kim, Gun-Il Im, Haeshin Lee, Jung-Ho Park, Byung-Soo Kim. 2011.Hyaline Cartilage Regeneration by Combined Therapy of Microfracture and Long-Term Bone Morphogenetic Protein-2 Delivery.Tissue Engineering Part A 17:13-14, 1809-1818. [Abstract] [Full Text HTML] [Full Text PDF] [Full Text PDF with Links]

52. Cai-Xia He, Ni Li, Yu-Lan Hu, Xiu-Mei Zhu, Hai-Jie Li, Min Han, Pei-Hong Miao, Zhong-Jie Hu, Gang Wang, Wen-Quan Liang, Yasuhiko Tabata, Jian-Qing Gao. 2011. Effective Gene Delivery to Mesenchymal Stem Cells Based on the ReverseTransfection and Three-Dimensional Cell Culture System. Pharmaceutical Research 28:7, 1577-1590. [CrossRef]

53. Virginia Pensabene, Silvia Taccola, Leonardo Ricotti, Gianni Ciofani, Arianna Menciassi, Francesca Perut, Manuela Salerno, PaoloDario, Nicola Baldini. 2011. Flexible polymeric ultrathin film for mesenchymal stem cell differentiation. Acta Biomaterialia 7:7,2883-2891. [CrossRef]

54. Suk Ho Bhang, Jeong-Yi Jeon, Wan-Geun La, Jun Yeup Seong, Jin Wook Hwang, Seong Eon Ryu, Byung-Soo Kim. 2011.Enhanced chondrogenic marker expression of human mesenchymal stem cells by interaction with both TGF-β3 and hyaluronicacid. Biotechnology and Applied Biochemistry 58:4, 271-276. [CrossRef]

55. Shimon A. Unterman, Norman A. Marcus, Jennifer H. ElisseeffInjectable Polymers 631-664. [CrossRef]56. Anne-Marie Freyria, Frédéric Mallein-Gerin. 2011. Chondrocytes or adult stem cells for cartilage repair: The indisputable role

of growth factors. Injury . [CrossRef]57. Justine J. Roberts, Garret D. Nicodemus, Suzanne Giunta, Stephanie J. Bryant. 2011. Incorporation of biomimetic matrix

molecules in PEG hydrogels enhances matrix deposition and reduces load-induced loss of chondrocyte-secreted matrix. Journalof Biomedical Materials Research Part A 97A:3, 281-291. [CrossRef]

58. Chau-Zen Wang, Mei-Ling Ho, Wen-Cheng Chen, Chien-Chih Chiu, Yung-Li Hung, Chih-Kuang Wang, Shun-Cheng Wu.2011. Characterization and enhancement of chondrogenesis in porous hyaluronic acid-modified scaffolds made of PLGA(75/25)blended with PEI-grafted PLGA(50/50). Materials Science and Engineering: C . [CrossRef]

59. Sun-Young Choh, Daisy Cross, Chun Wang. 2011. Facile Synthesis and Characterization of Disulfide-Cross-Linked HyaluronicAcid Hydrogels for Protein Delivery and Cell Encapsulation. Biomacromolecules 12:4, 1126-1136. [CrossRef]

60. Liming Bian, David Y. Zhai, Robert L. Mauck, Jason A. Burdick. 2011. Coculture of Human Mesenchymal Stem Cells andArticular Chondrocytes Reduces Hypertrophy and Enhances Functional Properties of Engineered Cartilage. Tissue EngineeringPart A 17:7-8, 1137-1145. [Abstract] [Full Text HTML] [Full Text PDF] [Full Text PDF with Links]

61. Jason A. Burdick, Glenn D. Prestwich. 2011. Hyaluronic Acid Hydrogels for Biomedical Applications. Advanced Materials 23:12,H41-H56. [CrossRef]

62. Isaac E. Erickson, Steven C. Veen, Swarnali Sengupta, Sydney R. Kestle, Robert L. Mauck. 2011. Cartilage Matrix Formation byBovine Mesenchymal Stem Cells in Three-dimensional Culture Is Age-dependent. Clinical Orthopaedics and Related Research®. [CrossRef]

63. Ingrida Majore, Pierre Moretti, Frank Stahl, Ralf Hass, Cornelia Kasper. 2011. Growth and Differentiation Properties ofMesenchymal Stromal Cell Populations Derived from Whole Human Umbilical Cord. Stem Cell Reviews and Reports 7:1, 17-31.[CrossRef]

64. Rachael A. Oldinski, Timothy T. Ruckh, Mark P. Staiger, Ketul C. Popat, Susan P. James. 2011. Dynamic mechanical analysisand biomineralization of hyaluronan–polyethylene copolymers for potential use in osteochondral defect repair. Acta Biomaterialia7:3, 1184-1191. [CrossRef]

65. H.G. Sundararaghavan, J.A. BurdickCell Encapsulation 115-130. [CrossRef]66. Glenn D. Prestwich, Tammer Ghaly, Philip Brudnicki, Brian Ratliff, Michael S. GoligorskyBioartificial Stem Cell Niches:

Engineering a Regenerative Microenvironment 245-256. [CrossRef]67. J.-W. Kuo, G.D. PrestwichHyaluronic Acid 239-259. [CrossRef]68. Darren M. Brey, Nuzhat A. Motlekar, Scott L. Diamond, Robert L. Mauck, Jonathon P. Garino, Jason A. Burdick. 2011. High-

throughput screening of a small molecule library for promoters and inhibitors of mesenchymal stem cell osteogenic differentiation.Biotechnology and Bioengineering 108:1, 163-174. [CrossRef]

69. Yuguo Lei, Shiva Gojgini, Jonathan Lam, Tatiana Segura. 2011. The spreading, migration and proliferation of mousemesenchymal stem cells cultured inside hyaluronic acid hydrogels. Biomaterials 32:1, 39-47. [CrossRef]

70. R. CONDIE, G. D. PRESTWICHDesigning clinically useful substitutes for the extracellular matrix 3-23. [CrossRef]71. Sudhir Khetan, Jason A. Burdick. 2010. Patterning network structure to spatially control cellular remodeling and stem cell fate

within 3-dimensional hydrogels. Biomaterials 31:32, 8228-8234. [CrossRef]72. Michael D. Weir, Hockin H.K. Xu. 2010. Human bone marrow stem cell-encapsulating calcium phosphate scaffolds for bone

repair. Acta Biomaterialia 6:10, 4118-4126. [CrossRef]73. Alice H. Huang, Ashley Stein, Robert L. Mauck. 2010. Evaluation of the Complex Transcriptional Topography of Mesenchymal

Stem Cell Chondrogenesis for Cartilage Tissue Engineering. Tissue Engineering Part A 16:9, 2699-2708. [Abstract] [Full TextHTML] [Full Text PDF] [Full Text PDF with Links] [Supplemental Material]

74. Murat Guvendiren, Jason A. Burdick. 2010. The control of stem cell morphology and differentiation by hydrogel surface wrinkles.Biomaterials 31:25, 6511-6518. [CrossRef]

75. Aleksander Skardal, Jianxing Zhang, Lindsi McCoard, Xiaoyu Xu, Siam Oottamasathien, Glenn D. Prestwich. 2010.Photocrosslinkable Hyaluronan-Gelatin Hydrogels for Two-Step Bioprinting. Tissue Engineering Part A 16:8, 2675-2685.[Abstract] [Full Text HTML] [Full Text PDF] [Full Text PDF with Links]

76. X. Guo, J. Liao, H. Park, A. Saraf, R.M. Raphael, Y. Tabata, F.K. Kasper, A.G. Mikos. 2010. Effects of TGF-β3 and precultureperiod of osteogenic cells on the chondrogenic differentiation of rabbit marrow mesenchymal stem cells encapsulated in a bilayeredhydrogel composite. Acta Biomaterialia 6:8, 2920-2931. [CrossRef]

77. R. Jin, L.S. Moreira Teixeira, A. Krouwels, P.J. Dijkstra, C.A. van Blitterswijk, M. Karperien, J. Feijen. 2010. Synthesis andcharacterization of hyaluronic acid–poly(ethylene glycol) hydrogels via Michael addition: An injectable biomaterial for cartilagerepair. Acta Biomaterialia 6:6, 1968-1977. [CrossRef]

78. Alexandra J.E. Farran, Sean S. Teller, Amit K. Jha, Tong Jiao, Rohan A. Hule, Rodney J. Clifton, Darrin P. Pochan, Randall L.Duncan, Xinqiao Jia. 2010. Effects of Matrix Composition, Microstructure, and Viscoelasticity on the Behaviors of Vocal FoldFibroblasts Cultured in Three-Dimensional Hydrogel Networks. Tissue Engineering Part A 16:4, 1247-1261. [Abstract] [FullText HTML] [Full Text PDF] [Full Text PDF with Links] [Supplemental Material]

79. R. Jin, L.S. Moreira Teixeira, P.J. Dijkstra, C.A. van Blitterswijk, M. Karperien, J. Feijen. 2010. Enzymatically-crosslinkedinjectable hydrogels based on biomimetic dextran–hyaluronic acid conjugates for cartilage tissue engineering. Biomaterials 31:11,3103-3113. [CrossRef]

80. Paul W. Kopesky, Eric J. Vanderploeg, John S. Sandy, Bodo Kurz, Alan J. Grodzinsky. 2010. Self-Assembling Peptide HydrogelsModulate In Vitro Chondrogenesis of Bovine Bone Marrow Stromal Cells. Tissue Engineering Part A 16:2, 465-477. [Abstract][Full Text HTML] [Full Text PDF] [Full Text PDF with Links]

81. Ming-Chia Yang, Nai-Hsin Chi, Nai-Kuan Chou, Yi-You Huang, Tze-Wen Chung, Yu-Lin Chang, Hwa-Chang Liu, Ming-JiumShieh, Shoei-Shen Wang. 2010. The influence of rat mesenchymal stem cell CD44 surface markers on cell growth, fibronectinexpression, and cardiomyogenic differentiation on silk fibroin – Hyaluronic acid cardiac patches. Biomaterials 31:5, 854-862.[CrossRef]

82. Ross A. Marklein, Jason A. Burdick. 2010. Controlling Stem Cell Fate with Material Design. Advanced Materials 22:2, 175-189.[CrossRef]

83. Sang Yang Lee, Toshiyuki Nakagawa, A. Hari Reddi. 2010. Mesenchymal Progenitor Cells Derived from Synovium andInfrapatellar Fat Pad as a Source for Superficial Zone Cartilage Tissue Engineering: Analysis of Superficial Zone Protein/LubricinExpression. Tissue Engineering Part A 16:1, 317-325. [Abstract] [Full Text HTML] [Full Text PDF] [Full Text PDF with Links]

84. Ross A. Marklein, Jason A. Burdick. 2010. Spatially controlled hydrogel mechanics to modulate stem cell interactions. Soft Matter6:1, 136. [CrossRef]

85. Anirudha Singh, Jennifer Elisseeff. 2010. Biomaterials for stem cell differentiation. Journal of Materials Chemistry 20:40, 8832.[CrossRef]

86. Alice H. Huang, Megan J. Farrell, Robert L. Mauck. 2010. Mechanics and mechanobiology of mesenchymal stem cell-basedengineered cartilage. Journal of Biomechanics 43:1, 128-136. [CrossRef]

87. Shao Qiong Liu, Richie Tay, Majad Khan, Pui Lai Rachel Ee, James L. Hedrick, Yi Yan Yang. 2010. Synthetic hydrogels forcontrolled stem cell differentiation. Soft Matter 6:1, 67. [CrossRef]

88. Amit K. Jha, Manisha S. Malik, Mary C. Farach-Carson, Randall L. Duncan, Xinqiao Jia. 2010. Hierarchically structured,hyaluronic acid-based hydrogel matrices via the covalent integration of microgels into macroscopic networks. Soft Matter 6:20,5045. [CrossRef]

89. I.E. Erickson, A.H. Huang, S. Sengupta, S. Kestle, J.A. Burdick, R.L. Mauck. 2009. Macromer density influences mesenchymalstem cell chondrogenesis and maturation in photocrosslinked hyaluronic acid hydrogels. Osteoarthritis and Cartilage 17:12,1639-1648. [CrossRef]

90. Cindy Chung, Michael Beecham, Robert L. Mauck, Jason A. Burdick. 2009. The influence of degradation characteristics ofhyaluronic acid hydrogels on in vitro neocartilage formation by mesenchymal stem cells. Biomaterials 30:26, 4287-4296. [CrossRef]

91. Giorgio Terenghi, Mikael Wiberg, Paul J. KinghamChapter 21 Use of Stem Cells for Improving Nerve Regeneration 87, 393-403.[CrossRef]