S1

Supporting Information

In Situ Genetically Cascaded Amplification for Imaging RNA Subcellular Locations

Kewei Ren, Rigumula Wu, Aruni P.K.K. Karunanayake Mudiyanselage, Qikun Yu, Bin Zhao, Yiwen Xie, Yousef Bagheri, Qian Tian, and Mingxu You*

Department of Chemistry, University of Massachusetts, Amherst, Massachusetts 01003, USA

* Correspondence: mingxuyou@umass.edu

This file includes:

Materials and Methods

Table S1 – S2

Figure S1 – S12

S2

Materials and Methods

Reagents and apparatus. DNA oligonucleotides used in this work were synthesized and purified by Integrated DNA Technologies (Coralville, IA) and W. M. Keck Oligonucleotide Synthesis Facility (Yale University School of Medicine). The detailed sequences have been listed in Table S1. PCR products were cleaned using a QIAquick PCR purification kit (Qiagen, Germantown, MD). All the RNA structures were designed and optimized using the Mfold and NUPACK online software. All the RNAs for in vitro experiments were transcribed using a HiScribe™ T7 high-yield RNA synthesis kit (New England Biolabs, Ipswich, MA) and purified with G-25 columns. All chemicals were of analytical grade and obtained from Sigma or Fisher Scientific unless otherwise noted. All the concentrations of nucleic acids were measured with a NanoDrop One UV-Vis spectrophotometer. The gel electrophoresis was performed on a Bio-Rad electrophoresis analyzer (Bio-Rad, Hercules, CA) and imaged on a Bio-Rad Gel Doc EZ imager. Real-time reverse transcription polymerase chain reaction (RT-PCR) was performed on a Bio-Rad C1000 Touch Thermal Cycler system. All the in vitro fluorescence measurements were conducted with a PTI fluorimeter (Horiba, New Jersey, NJ).

Fluorescence assay. H1 and H2 RNA hairpins were separately pre-heated at 95°C for 3 min and then slowly cooled down to 25°C at the rate of -3°C/min. Fluorescence assays and hybridization chain reactions were conducted in a buffer consisting of 20 mM HEPES, 100 mM KCl and 10 mM MgCl2 at pH=7.5. For the buffer condition optimization experiments, we used a phosphate-buffered saline (PBS, pH=7.5) consisting of 8.72 mM Na2HPO4, 1.41 mM KH2PO4, 100 mM KCl and 10 mM MgCl2, and a HEPES buffer (pH=7.5) consisting of 20 mM HEPES, 10 mM MgCl2 and 100 mM KCl. For our in vitro test, 250 nM H1 or H2 hairpins were always used, and the fluorescence was measured after 4 h incubation. Fluorescence measurements were performed with excitation at 480 nm and emission spectra were collected in the range of 495–530 nm. The slit width was set to be 2 nm for both excitation and emission.

Vector construction. For bacterial cell imaging, both H1 and H2 hairpins were cloned into a pETDuet vector. The vector was first digested with NdeI and PacI restriction enzymes (New England Biolabs). After 1% agarose gel purification, the digested vector was ligated with a similarly digested H1 insert using T4 DNA ligase (New England Biolabs). The ligated product was transform into BL21 (DE3)* cells (New England Biolabs) and selected based on ampicillin resistance. Then, both pETDuet vectors with or without H1 insert were digested with SgrAl and SacII restriction enzymes (New England Biolabs), and a similarly digested H2 was cloned into these vectors following a similar procedure. The initiator, SgrS-targeting molecular beacon, and bglF-targeting molecular beacon was cloned, respectively, into a pCDFDuet vector. BsrGI and BglII restriction enzymes (New England Biolabs) were used for the digestion. After T4 DNA ligation, the product was transformed into BL21 (DE3)* cells and selected based on streptomycin resistance. All the plasmids were isolated using a GeneJET Plasmid Miniprep Kit (Thermo Fisher Scientific) and confirmed by Sanger sequencing by Eurofins Genomics.

S3

For mammalian cell imaging, all the inserts were cloned into an AIO-Puro vector. H1 and H2 hairpins were digested with BbsI-HF and BsaI-HFv2 restriction enzymes (New England Biolabs), respectively. Other initiator and molecular beacon strands were digested with Agel-HF and SnaBI restriction enzymes (New England Biolabs).

Cellular imaging and data analysis. RNA imaging in bacterial cells was performed according to a previously established protocol.1 Briefly, the BL21 (DE3)* cells expressing the corresponding sensor constructs were grown in LB media at 37°C until the optical density at 600 nm (OD600) reaches 0.4, and then 1 mM isopropyl-β-ᴅ-thiogalactoside (IPTG) was added for a 2 h induction. For the cellular imaging of SgrS, cells were induced by IPTG for 1.5 h and then treated with glucose (1 g/L or 20 g/L) for an additional 30 min before imaging. After IPTG induction, the cells were adhered to poly-L-lysine-pretreated glass bottom dish for 45 min and incubated at room temperature for 3 h. Then 200 μM DFHBI-1T and 10 μg/mL 4’,6-diamidino-2-phenylindole (DAPI) were added at room temperature for a 30 min incubation before imaging. RNA imaging in mammalian cells was performed according to a previously reported protocol.2 Human cervix carcinoma HeLa cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% FBS, streptomycin (100 μg/mL), and penicillin (100 U/mL) at 37°C in a humidified incubator containing 5% CO2. HeLa cells were seeded in a glass bottom dish for 24 h and then transfected, respectively, with AIO-Puro plasmids encoding H1/H2, H1/H2/initiator, H1/H2/control, H1/H2/survivin-targeting molecular beacon, or H1/H2/control survivin molecular beacon using a Lipofectamine® 3000 transfection reagent (Thermo Fisher Scientific). 24 h after transfection, the cells were washed twice with Dulbecco’s phosphate-buffered saline (DPBS) and incubated in DPBS containing 40 μM DFHBI-1T and 10 μg/mL DAPI for 30 min before imaging. For the survivin mRNA inhibition experiment, HeLa cells were seeded and incubated in a glass bottom dish for 24 h, and then 200 μL medium containing 5 nM YM155 was added. After incubation for a total of 48 h, the cells were washed with PBS and transfected with the plasmids for imaging.

All the fluorescence images were collected with a NiS-Elements AR software using a Yokogawa spinning disk confocal on a Nikon Eclipse-TI inverted microscope. Broccoli and RNA sensors were excited with a 488 nm laser using a 60× or 100× oil immersion objective for imaging bacterial cells or using a 40× oil immersion objective for imaging mammalian cells. DAPI fluorescence was excited with a 405 nm laser. Image analysis was performed with a NiS-Elements AR Analysis software. Data analysis and fitting was done using an Origin software.

RT-qPCR quantification of the SgrS RNA concentrations in cells. The BL21 (DE3)* cells were grown in LB media at 37°C until OD600 reaching 0.4, and then 1 mM IPTG was added for a 1.5 h incubation. Afterwards, glucose of different concentrations (0, 1 g/L and 20 g/L) were added and incubated for 30 min. The total cellular RNAs were then extracted using a standard TRIzol RNA extraction kit (Thermol Fisher Scientific) according to the manufacturer’s protocol. All the RNA samples were treated with RNase-free DNase I (New England Biolabs) at 37°C for 30 min, followed by heat inactivation at 75°C for 10 min after adding 5 mM EDTA. Then the RNA samples were reverse-transcribed into complementary DNAs using a ProtoScript® II cDNA

S4

synthesis kit (New England Biolabs). The qRT-PCR analysis was performed with a Bio-Rad C1000 Touch Thermal Cycler and a Power SYBR™ Green PCR Master Mix (Applied Biosystems™, Thermo Fisher Scientific) according to the manufacturer’s instructions.

The qPCR was performed by holding at 95°C for 10 min, followed by 40 cycles of incubation at 95°C for 15 s and 57°C for 1 min. A standard curve for SgrS quantification was obtained using in vitro transcribed RNAs. Standard RNA samples were synthesized by in vitro transcribing linear DNA template and then running through the same procedure as the total cellular RNAs extraction, including lysozyme treatment, RNA extraction, DNase treatment and cDNA synthesis. A standard curve was generated from qPCR results using serially diluted cDNA as the templates. The sequences of primers used in this experiment were as follows, SgrS forward primer: 5’-AGCGAAGTTGTGCTGGTTGCG-3’ SgrS reverse primer: 5’-ACACCAATACTCAGTCACACATGATGCAG-3’.

S5

Table S1. Sequences of RNA hairpins and initiators used in this project. The Broccoli aptamer sequences were shown in italic. The sequences of blocked Broccoli fragments in the stem region were underlined. The stem sequences of H1/H2 hairpins were shown in blue. The added sequences in the loop region of D3–D5 were shown in gray. The sequences that will form the HCR chains in the final products were bolded.

H1:GGAGAGACGGUCGGGUCCAGAGUAGAUAUCGAUGAGGACUGUAAUGCACACUUAACGGCAUUACAGUCCUCAUUCUCUGUCGAGUAGAGUGUGGGCUCUUUU

H2:GGAGAGACGGUCGGGUCCAGAGCAUUACAGUCCUCAUCGAUAUCUACAUGAGGACUGUAAUGCCGUUAAGUGUUAUCUGUCGAGUAGAGUGUGGGCUCUUUU

D1

Initiator: GCAUUACAGUCCUCAUCGAUAUCUAC

H1:GGAGAGACGGUCGGGUCCAAGUAGAAGCCAAUGAGGACUGUAAUGCACACUGAACGGCAUUACAGUCCUCAUAUGUCGAGUAGAGUGUGGGCUCUUUU

H2:GGAGAGACGGUCGGGUCCAAGCAUUACAGUCCUCAUUGGCUUCUACAUGAGGACUGUAAUGCCGUUCAGUGUAUGUCGAGUAGAGUGUGGGCUCUUUU

D2

Initiator: GCAUUACAGUCCUCAUUGGCUUCUAC

H1:GGAGAGACGGUCGGGUCCAAUGAAGCAGUAUAUGAGGACUGUAAUCAUACUCUAACGGCUGAUUACAGUCCUCAUUGUCGAGUAGAGUGUGGGCUCUUUU

H2:GGAGAGACGGUCGGGUCCAGCUGAUUACAGUCCUCAUAUACUGCUUCGAGGACUGUAAUCAGCCGUUAGAGUAGCUGUCGAGUAGAGUGUGGGCUCUUUU

D3

Initiator: UGAUUACAGUCCUCAUAUACUGCUUC

H1:GGAGAGACGGUCGGGUCCAAUGAGAAGCAGUAUAUGAGGACUGUAAUCAUACUGGAACUGCUUUGAUUACAGUCCUCAUUGUCGAGUAGAGUGUGGGCUCUUUU

H2:GGAGAGACGGUCGGGUCCAGCUUUGAUUACAGUCCUCAUAUACUGCUUCGGACUGUAAUCAAAGCAGUUCCAGUAAAGCUGUCGAGUAGAGUGUGGGCUCUUUU

D4

Initiator: UGAUUACAGUCCUCAUAUACUGCUUC

H1:GGAGAGACGGUCGGGUCCAAUGAGAAGCAGUAUAUGAGGACUGUAAUCACCUACUGGAACUGCUUGGUGAUUACAGUCCUCAUUGUCGAGUAGAGUGUGGGCUCUUUU

H2:GGAGAGACGGUCGGGUCCAGCUUGGUGAUUACAGUCCUCAUAUACUGCUUCGGACUGUAAUCACCAAGCAGUUCCAGUAAAGCUGUCGAGUAGAGUGUGGGCUCUUUU

Initiator: GGUGAUUACAGUCCUCAUAUACUGCUUC

D5

Control: GGAGACUAGACUACUGAUUUAGUCGUAG

S6

Table S2. Sequences of the molecular beacons and their targets used in this project. The stem sequences of the molecular beacons were shown in blue.

SgrSMB-7BS (7B) GGUGAUUACAGUCCUCAUAUACUGCUUCACACCAAUACUCAGUCACACAUCCGAAGCAG

SgrSMB-8BS (8B) GGUGAUUACAGUCCUCAUAUACUGCUUCACACCAAUACUCAGUCACACAUCCGAAGCAGU

SgrSMB-10BS (10B) GGUGAUUACAGUCCUCAUAUACUGCUUCACACCAAUACUCAGUCACACAUCCGAAGCAGUAU

SgrS target GGAUGUGUGACUGAGUAUUGGUGU

bglFMB GGUGAUUACAGUCCUCAUAUACUGCUUCATGUUAUCUGCGCCCCCGACUCCUGAAGCAG

bglF target AGGAGUCGGGGGCGCAGAUAACAU

survivinMB (SMB) GGUGAUUACAGUCCUCAUAUACUGCUUCGUUCUUGAAUGUAGAGAUGCGGUGGAAGCAG

C-survivinMB (C-SMB)

GGUGAUUACAGUCCUCAUAUACUGCUUCUCUACAACGUGACUAGAAGUGCAUGAAGCAG

survivin target CACCGCAUCUCUACAUUCAAGAAC

S7

Figure S1. Optimization of the H1/H2 hairpins in the INSIGHT system. (a) Different designs of the H1 hairpin. The corresponding H2 hairpins were designed based on the same length of stem base pairs as in the H1 hairpin. The black box, red dashed box and purple dashed box highlighted the modified regions in D2–D5 as compared with D1. (b–f) The fluorescence responses of the design (b) D1, (c) D2, (d) D3, (e) D4, and (f) D5. The corresponding fluorescence was measured after 4 h incubation in a solution containing 0 or 50 nM initiator RNA (I), 250 nM H1 and H2 (or Broccoli), and 5.0 µM DFHBI-1T. Shown are mean and SEM values of three independent replicates.

S8

Figure S2. Fluorescence analysis of the autonomous reassembly of the split Broccoli. Fluorescence intensities of 250 nM Split Broccoli (Sp1 or Sp2) and Split Broccoli mixture (Sp1/Sp2) were measured in HEPES buffer with 5.0 µM DFHBI-1T. Shown are mean and SEM values of three independent replicates.

Figure S3. In vitro optimization of the INSIGHT system. (a) Effect of different buffer conditions on the hybridization chain reaction efficiency. The corresponding fluorescence was measured after 4 h incubation at 22°C in solutions containing 10 mM Mg2+, 0 (H1/H2) or 20 nM initiator RNA (H1/H2/Initiator), 250 nM H1 and H2 (or Broccoli), and 5.0 µM DFHBI-1T. (b) Effect of Mg2+ concentrations on the hybridization chain reaction efficiency as measured in HEPES buffer at 22°C. (c) Effect of reaction time on the fluorescence response as measured at 22°C in HEPES buffer containing 10 mM Mg2+. (d) Effect of reaction time on the fluorescence response as measured at 37°C. Shown are mean and SEM values of three independent replicates.

S9

Figure S4. Calibration curve of the RNA concentration-dependent fluorescence signal of Broccoli. The corresponding fluorescence was measured under the same experimental condition as that in Figure 2b. The horizontal line indicated the fluorescence intensity for estimating the limit of detection. Shown are mean and SEM values of three independent replicates.

Figure S5. 10% Native polyacrylamide gel analysis of the RNA assembly in INSIGHT. Lane (1) RNA ladder (unit, nucleotides), (2) H1, (3) H2, (4) mixture of H1 and H2, (5–9) mixture of H1, H2 with 0.5-, 0.2-, 0.1-, 0.05-, and 0.02-fold concentration of initiator RNA. Each mixture was pre-incubated for 4 h at 22°C in HEPES buffer containing 10 mM Mg2+, and 250 nM H1 and H2.

S10

Figure S6. Confocal fluorescence imaging of BL21 (DE3)* cells expressing pETDuet-H1/H2 (H1/H2), pETDuet-H1/H2 and pCDFDuet-initiator (H1/H2/I), or pETDuet-Broccoli (Broccoli) at different time point (1–4 h) after a 2 h IPTG induction. 200 µM DFHBI-1T was added 30 min before imaging. Scale bar, 10 µm.

S11

Figure S7. Confocal fluorescence imaging of BL21 (DE3)* cells expressing pETDuet-H1/H2 and pCDFDuet-Initiator (H1/H2/I) or pETDuet-Broccoli (Broccoli). After 2 h IPTG induction, these cells were incubated with different concentrations of glucose (0, 1 g/L, 20 g/L) for 30 min. 200 µM DFHBI-1T was added 30 min before imaging. Scale bar, 10 µm.

S12

Figure S8. Standard curve for RT-PCR-based quantification of cellular SgrS concentrations. The curve was generated from a series of dilutions of in vitro synthesized SgrS standards. A linear relationship (R2= 0.999) was observed between the log10 value of SgrS amounts and the cycle threshold (Ct). Shown are mean and SEM values of three independent replicates.

Figure S9. Detection of bglF mRNA with INSIGHT. The corresponding fluorescence was measured after 4 h incubation in HEPES buffer containing 0 (blank) or 20 nM bglF mRNA (or initiator), 250 nM H1 and H2 (or Broccoli), 250 nM bglF-targeting molecular beacon (bglFMB), and 5.0 µM DFHBI-1T. Shown are mean and SEM values of three independent replicates.

S13

Figure S10. Pearson correlation coefficient (PCC) was determined between the cellular Broccoli fluorescence and the DAPI fluorescence in the experiments as shown in Figure 5. Shown are mean and SEM values from ten individual cells.

Figure S11. (a) Confocal fluorescence imaging of HeLa cells expressing AIO-Puro-H1/H2 (H1/H2), AIO-Puro-H1/H2/control initiator (H1/H2/C-I), AIO-Puro-H1/H2/initiator (H1/H2/I) or AIO-Puro-Broccoli (Broccoli). Then 40 µM DFHBI-1T was added 30 min before imaging. Scale bars, 10 µm. (b) Mean cellular fluorescence intensities in the experiments as shown in panel (a). Shown are mean and SEM values from ten individual cells.

S14

Figure S12. Confocal fluorescence imaging of HeLa cells at 24 h after Lipofectamine® 3000-based transfection. Images were taken in the presence of 40 μM DFHBI-1T. 5 nM YM155 (inhibitor) was added to inhibit the generation of survivin mRNA. Scale bar, 20 µm.

References

1. Strack, R. L.; Song, W.; Jaffrey, S. R. Using Spinach-based Sensors for Fluorescence Imaging of Intracellular Metabolites and Proteins in Living Bacteria. Nat. Protoc. 2014, 9 (1), 146-155.

2. Litke, J. L.; Jaffrey, S. R. Highly Efficient Expression of Circular RNA Aptamers in Cells Using Autocatalytic Transcripts. Nat. Biotechnol. 2019, 37 (6), 667-675.