A

psmo

tRo©

K

1

tdmiLoAtan

i

f

0d

Journal of Ethnopharmacology 108 (2006) 398–406

Immunomodulatory activity of Semecarpus anacardium extractin mononuclear cells of normal individuals and

rheumatoid arthritis patients

Divya Singh, Amita Aggarwal, Amrita Mathias, Sita Naik ∗Department of Immunology, Sanjay Gandhi Post-Graduate Institute of Medical Sciences,

Raebareli Road, Lucknow 226 014, India

Received 6 April 2006; accepted 26 May 2006Available online 2 June 2006

bstract

Semecarpus anacardium (SA) Linn. (family Anacardiaceae), is a plant well-known for its medicinal value in Ayurveda. The nut extracts of thislant have been traditionally used as antihelminthic, anti-fungal, anti-carcinogenic and in the treatment of nervous debilities and arthritis. In thistudy we have evaluated crude ethanolic extract of SA nuts for its anti-inflammatory activities in vitro using peripheral blood and synovial fluidononuclear cells of healthy individuals and rheumatoid arthritis (RA) patients. SA extract inhibited the spontaneous and LPS induced production

f proinflammatory cytokines IL-1� and IL-12p40 but had no effect on TNF-� and IL-6 production, both at protein and mRNA level.

The crude extract also suppressed LPS induced nuclear translocation of transcription factors, NF-�B and AP-1; the inhibition of NF-�B was

hrough the inhibition of I�B� phosphorylation. The extract also suppressed LPS activated nitric oxide production in mouse macrophage cell line,AW 264.7. Our results for the first time show that SA extract can inhibit proinflammatory cytokine production and demonstrate its mechanismf action.

2006 Elsevier Ireland Ltd. All rights reserved.

itric o

a2flke2b2w(mm

eywords: Anti-arthritic; Natural plant products; Transcription factors; I�B; N

. Introduction

An increasing number of people are adopting alternative sys-ems of medicine owing to the irreversible effects of modernrugs and therapies. Use of medicinal plant products for treat-ent of various acute and chronic diseases is gaining increasing

mportance around the globe. Semecarpus anacardium (SA)inn. (family Anacardiaceae), commonly called as Sanjivanir Bhalltak, is well-known for its anti-arthritic properties inyurveda, the ancient system of Indian medicine. Traditionally,

he fruits of this plant are used as carminative, tonic, aphrodisiac,ntihelminthic and in the treatment of asthma, leucoderma and

ervous debilities.

Semecarpus anacardium has been shown to possess anti-nflammatory activity. It decreased the paw edema in developing

∗ Corresponding author. Tel.: +91 522 2668800/266700;ax: +91 522 2668017/2668078.

E-mail address: sitanaik@sgpgi.ac.in (S. Naik).

(

uvWcTa

378-8741/$ – see front matter © 2006 Elsevier Ireland Ltd. All rights reserved.oi:10.1016/j.jep.2006.05.028

xide

nd established adjuvant induced arthritis (Ramprasath et al.,004). The pharmacological active principles of this plant areavonoids. The ethyl acetate extract contains a biflavonoidnown as tetrahydroamentoflavone (THA) that inhibited thenzyme cyclooxygenase-2 (COX-2) (Selvam and Jachak,004). The nut oil from Semecarpus anacardium was shown toe cytotoxic to human leukaemic cell lines (Chakraborty et al.,004). The alcoholic extract of dry nuts had anti-fungal activityhile of nut shells were shown to prevent lipid peroxidation

Tripathi and Singh, 2001; Sharma et al., 2002). The nutilk extract is effective in restoring the fragility of lysosomalembranes in aflatoxin-induced hepatocellular carcinoma

Premalatha and Sachdanandam, 2000).So far there has been no systematic study on the immunomod-

latory activity of this plant. In this report we have studied initro the mechanism of action of crude ethanolic extract of SA.

e demonstrate the specific activity of SA on proinflammatory

ytokines in vitro via suppression of the transcription factors.he extract needs to be further purified for its active constituentsnd investigated in depth for exploitation as a drug.

ophar

2

2

yc3Aaw

2

fiAC(kerti

2

2

b(bp3frwsStCryM(m

2

acict1s(mapnCcugr

2

NmBFaacoUauido

2

pwc

TP

T

TIIIG

F

D. Singh et al. / Journal of Ethn

. Materials and methods

.1. Study subjects

The study population included 10 healthy adults (age 24–55ears) who had no evidence of any disease at the time of sampleollection and 10 rheumatoid arthritis patients (aged between2 and 60 years) in whom the diagnosis fulfilled the revisedCR criteria. Heparinized (10 IU/ml) venous blood from normaldults and venous blood and synovial fluid from the patientsere withdrawn during the same sitting.

.2. Preparation of ethanolic crude extract

Freshly collected Semecarpus anacardium nuts were identi-ed, dried in shade and powdered at the Department of Medicine,yurveda College, Banaras Hindu University, Varanasi, India.rude extract of 1 g/ml was prepared in endotoxin free ethanol

95%) (Sigma, St. Louis, MO, USA). Briefly, the suspension wasept on a shaker for 16 h (overnight) at 37 ◦C and the alcoholxtract was aspirated and stored. This process of extraction wasepeated four times and the combined alcohol extract was cen-rifuged at 1000 rpm for 10 min. The supernatant was collectedn aliquots and stored at −20 ◦C till used.

.3. Experimental protocol

.3.1. Cell cultureMononuclear cells were isolated from heparinized venous

lood and synovial fluid (SF) by density sedimentation methodBoyum et al., 1988). Briefly, blood/SF was diluted in phosphateuffered saline (PBS), pH 7.2 and layered carefully on lympho-rep (Pel-freez clinical systems, LLC, Norway) at a ratio of:1 and centrifuged at 1800 rpm for 30 min. Cells in the inter-ace layer were carefully separated, washed with PBS thrice andesuspended in RPMI 1640 (Gibco BRL, India) supplementedith 25 mM HEPES, 2 mM L-glutamine, penicillin (100 U/ml),

treptomycin (100 �g/ml) and 10% heat inactivated Fetal Bovineerum (FBS) (Sigma, St. Louis, MO, USA). Cell concentra-

ion was adjusted as per the requirement of the experiment.ell viability after 18 h was assessed by mitochondria-dependent

eduction of a yellow tetrazolium dye 3-[4,5-dimethylthiazol-2-

l]-2, 5-diphenyltetrazolium bromide (MTT) (Sigma, St. Louis,O, USA) to insoluble purple formazan by dehydrogenases

Mosmann, 1982) at the end of 18 h culture. Doses that showedore than 90% cell viability were used in the experiments.

gu

d

able 1rimer sequences and their expected product size

arget Primers sequences (5′–3′)

NF-� F: GAGTGACAAGCCTGTAGCCCATGTTGTAGCA; R: GCAATGAL-1� F: CAGAGAGTCCTGTGCTGAAT; R: GTAGGAGAGGTCAGAGAGL-6 F: GAACTCCTTCTCCACAAGCG; R: GAATCCAGATTGGAAGCAL12p40 F: GGCCCAGAGCAAGATGTGTCACCA; R: TCTCCAGGGGCATCAPDH F: GAAGGTGAAGGTCGGAGTC; R: GAAGATGGTGATGGGATTT

: forward; R: reverse.

macology 108 (2006) 398–406 399

.3.2. Cytokine ELISACells were treated with LPS (10 ng/ml) in presence and

bsence of different doses (1.0, 0.5 and 0.2 mg/ml) of Seme-arpus anacardium crude ethanolic extract. The culture wasncubated for 18 h at 37 ◦C, 5% CO2 and supernatants andells were harvested for ELISA and RNA extraction, respec-ively. Proinflammatory cytokines TNF-�, IL-1�, IL-6 and IL-2p40 in the culture supernatants were estimated by commercialandwich ELISA according to the manufacturer’s instructionPharmingen, San Diego, CA). Briefly, plates were coated withonoclonal capture antibody by overnight incubation at 4 ◦C

nd blocked with 10% FBS (Sigma, St. Louis, MO, USA) inhosphate buffered saline (PBS) for 1 h. Samples and recombi-ant standards were added to the plates and incubated for 2 h.ytokines were detected by addition of horseradish peroxidase-onjugated streptavidin labeled antibodies. Color was developedsing tetramethylbenzidine (TMB) (BD Biosciences, Pharmin-en, San Diego, CA, US) for 15 min and absorbance wasecorded at 450 nm.

.3.3. Nitric oxide (NO) estimationMouse macrophage cells, RAW 264.7, obtained from

ational Centre for Cell Science, Pune, India, were used to esti-ate NO production in lipopolysaccharide (LPS) treated cells.riefly, cells were cultured in DMEM supplemented with 10%CS and plated in 96-well culture plates and incubated at 37 ◦Cnd 5% CO2. At the end of 48 h, 100 �l of the medium wasspirated out and replenished with equal volume of mediumontaining varying doses of the extract in presence or absencef LPS (0.5 �g/ml) of E. coli 005:B5 (Sigma, St. Louis, MO,SA). The culture was incubated for a further 24 h at 37 ◦C

nd 5% CO2 and NO production in supernatant was measuredsing Griess reagent. Absorbance at 570 nm was determinedn a microtiter plate reader (Tarsons, India). Quantitation wasone against standard curve generated using known quantitiesf sodium nitrite.

.3.4. RT-PCRTotal RNA was isolated using TRIzol reagent (Sigma) as

er manufacturer’s instruction. One microgram of total RNAas reverse transcribed to cDNA and PCR was performed for

ytokines TNF-�, IL-1�, IL-6, IL-12p40 and housekeeping

ene, GAPDH (Glyceraldehyde 3-phosphate Dehydrogenase)sing gene specific primers (Table 1).

A 25 �l PCR reaction buffer containing MgCl2 (10X),eoxynucleotide (10 mM each), Taq DNA polymerase (1 U),

Annealingtemperature (◦C)

Productsize (bp)

TCCCAAAGTAGACCTGCCCAGACT 66 444GC 66 234TCC 58 316CGGATACCAA 65 144C 60 225

4 ophar

oadeub

2

c(vaaf

•

•

catid

F(es

00 D. Singh et al. / Journal of Ethn

ligonucleotide primers (25 pM each) and 3 �l of cDNA wasmplified for 35 cycles with the following cycling conditions:enaturation at 94 ◦C for 15 s; annealing for 30 s (Table 1) andxtension at 72 ◦C for 45 s. Ten microliters of the PCR prod-cts were resolved on 1.5% agarose gel stained with ethidiumromide.

.3.5. Electrophoretic Mobility Shift Assay (EMSA)PBMC were plated in six-well tissue culture plates at a

oncentration of 1 × 106 cells/ml and stimulated with LPS10 ng/ml) for 2 h at 37 ◦C in 5% CO2 in presence or absence of

arying dilutions of SA extract. Nuclear extracts were preparednd EMSA was performed as described previously (Pandey etl., 2005). The oligonucleotide probe sequence of transcriptionactors used in this study is:

2

(

ig. 1. Effect of Semecarpus anacardium extract on spontaneous and LPS activated cn = 10). (A) TNF-�, (B) IL-1�, (C) IL-6 and (D) IL-12p40. M: 100 bp DNA ladder;xtract (1 mg/ml). Cells were treated with 1 mg/ml dose of crude Semecarpus anacarupernatants was measured by ELISA (ns: not significant). GAPDH shown as housek

macology 108 (2006) 398–406

NF-�B: 5′-AGT TGA GGG GAC TTT CCC AGG C-3′; 3′-TCA ACT CCC CTC AAA GGG TCC G-5′.AP-1: 5′-CGC TTG ATG AGT ACG CCG GAA-3′; 3′-GCGAAC TAC TCA GTC GGC CTT-5′.

DNA-protein complex was resolved from free oligonu-leotide on 7.5% polyacrylamide gel run in EMSA buffer (1X)t constant 150 V. After the dye front reached to the bottom ofhe gel, it was wrapped in a cling film and exposed to X-ray filmn cassette with intensifying screen at −70 ◦C for 12–36 h andeveloped.

.3.6. Western blotting for phosphorylated IκBα

PBMC were cultured in six-well tissue culture plates4 × 106 cells/well), washed twice in ice cold PBS and pelleted.

ytokine production at protein and mRNA level in PBMC of healthy individualslane 1: control; lane 2: LPS (10 ng/ml); lane 3: extract (1 mg/ml) + LPS; lane 4:dium extract with or without LPS (10 ng/ml) for 18 h. Presence of cytokines ineeping gene.

ophar

CEpd

a(b0waMjP(

2

fwwpi

3

3

F(Cm

D. Singh et al. / Journal of Ethn

ells were lysed in ice cold lysis buffer (1 M HEPES, 0.5 MDTA, pH 8.0, 0.1 M EGTA, 2 M KCl, 0.1 M DTT, cocktail ofrotease inhibitors). Protein concentration in the samples wasetermined by Bradford’s assay (Bio-Rad, CA).

Protein samples (25 �g) were resolved on 10% SDS poly-crylamide gels and transferred to nitrocellulose membraneSchleicher & Schuell, Keene, NH). After blocking the mem-rane in 5% dry skim milk in TBST (0.1 M Tris–HCl, pH 7.4,.9% NaCl, 0.1% Tween-20) for 1 h it was washed and incubatedith human PCNA (1:1000, SIGMA, USA) or phospho-I�B

ntibodies (1:1000, Promega, Madison, US) overnight at 4 ◦C.

embrane was further incubated with goat anti-rabbit IgG con-

ugated to horseradish peroxidase secondary antibody (1:1000,romega, Madison, US). Chemiluminescence detection systemRoche diagnostics) was used to detect the protein bands.

ah

1

ig. 2. Effect of Semecarpus anacardium extract on spontaneous and LPS activated cyB) IL-1�, (C) IL-6 and (D) IL-12p40. M: 100 bp DNA ladder; lane 1: control; laneells were treated with 1 mg/ml dose of crude Semecarpus anacardium extract witheasured by ELISA (ns: not significant). GAPDH shown as housekeeping gene.

macology 108 (2006) 398–406 401

.3.7. Statistical analysisComparison of untreated and extract treated groups was per-

ormed using non-parametric, Wilcoxon Signed Ranks test. Dataas analyzed using statistical software SPSS 9.0. Student’s t-testas employed for comparing unstimulated with stimulated NOroduction in RAW 264.7 cells. Results were considered signif-cant at p-value < 0.05.

. Results

.1. Effect of Semecarpus anacardium extract on LPSctivated and spontaneous cytokine production in PBMC of

ealthy individuals

SA extract suppressed spontaneous and LPS induced IL-� and IL-12p40 production; the extract had no effect

tokine production at protein and mRNA level in RA PBMC (n = 10). (A) TNF-�,2: LPS (10 ng/ml); lane 3: extract (1 mg/ml) + LPS; lane 4: extract (1 mg/ml).or without LPS (10 ng/ml) for 18 h. Presence of cytokines in supernatants was

4 ophar

odm(

3ao

aP6ses

3th

Pciin

3t

F(Cm

02 D. Singh et al. / Journal of Ethn

n spontaneous and LPS activated TNF-� and IL-6 pro-uction. SA also showed suppressed IL-1� and IL-12p40RNA expression but not TNF-� and IL-6 mRNA expression

Fig. 1).

.2. Effect of Semecarpus anacardium extract on LPSctivated and spontaneous cytokines in PBMC and SFMCf RA patients

The spontaneous and LPS activated production of IL-1�nd IL-12p40 was significantly inhibited by SA extract in RABMC and SFMC. The extract had no effect on TNF-� and IL-

production (Figs. 2 and 3A–D). The extract also suppressed

pontaneous and LPS activated IL-1� and IL-12p40 mRNAxpression without effect on TNF-� and IL-6 mRNA expres-ion (Figs. 2 and 3A–D).

S

a

ig. 3. Effect of Semecarpus anacardium extract on spontaneous and LPS activated cyB) IL-1� (C) IL-6 and (D) IL-12p40. M: 100 bp DNA ladder; lane 1: control; laneells were treated with 1 mg/ml dose of crude Semecarpus anacardium extract witheasured by ELISA (ns: not significant). GAPDH shown as housekeeping gene.

macology 108 (2006) 398–406

.3. Effect of Semecarpus anacardium extract onranscription factors NF-κB and AP-1 in PBMC of normalealthy individuals

A basal level of NF-�B and AP-1 was detectable in normalBMC (Fig. 4, lane 1) which showed an increase in LPS inducedells (Fig. 4, lane 2). SA extract at concentration 1 mg/ml, inhib-ted the translocation of NF-�B and AP-1 transcription factorsn LPS stimulated PBMC (Fig. 4, lane 3) while extract alone hado effect on unstimulated NF-�B and AP-1 (Fig. 4, lane 4).

.4. Effect of Semecarpus anacardium extract onranscription factor NF-κB and AP-1 in RA PBMC and RA

FMC

LPS stimulation increased nuclear translocation of NF-�Bnd AP-1 in RA PBMC and SFMC (Fig. 5A and B, lane 2)

tokine production at protein and mRNA level in RA SFMC (n = 10). (A) TNF-�2: LPS (10 ng/ml); lane 3: extract (1 mg/ml) + LPS; lane 4: extract (1 mg/ml).or without LPS (10 ng/ml) for 18 h. Presence of cytokines in supernatants was

D. Singh et al. / Journal of Ethnopharmacology 108 (2006) 398–406 403

F F-�Bc (1 mg

a1no

3a

w1b

3o

oe

4

tonbto

Lt

ttbHb(atnlcesap

uecsCIoI(�ai

ig. 4. Effect of Semecarpus anacardium extract on transcription factors (A) Nontrol; lane 2: LPS (10 ng/ml); lane 3: extract (1 mg/ml) + LPS; lane 5: extract

s compared to the spontaneous levels (Fig. 5A and B, lane). SA extract at the dose of 1 mg/ml inhibited LPS activateduclear translocation (Fig. 5A and B, lane 3) but had no effectn unstimulated cells (Fig. 5A and B, lane 4).

.5. Effect of Semecarpus anacardium extract on LPSctivated phophorylation of IκB

Activation of cells with LPS caused phoshorylation of I�Bhich was maximum at 30 and 60 min. In the presence ofmg/ml dose of SA extract, phosphorylation was inhibited atoth 30 and 60 min (Fig. 6).

.6. Effect of Semecarpus anacardium extract on nitricxide production in RAW 264.7 cells

SA at 1.0 and 0.5 mg/ml doses showed significant suppressionf NO production (p < 0.05). However, the 0.2 mg/ml dose of thextract had no effect on NO production (Fig. 7).

. Discussion

In this paper we report for the first time the immunomodula-ory activity of crude ethanolic extract of SA seeds on productionf pro-inflammatory cytokines. This extract inhibited sponta-eous and LPS stimulated production of IL-1� and IL-12p40y peripheral blood and synovial fluid mononuclear cells. Fur-hermore, the suppressive activity was supported by inhibition

f transcription factors, NF-�B and AP-1.

The suppressive activity of SA was preferentially seen onPS activated and spontaneous IL-1� and IL-12p40 produc-

ion. This effect was at the transcriptional level, since the mRNA

ah1t

and (B) AP-1 in PBMC from healthy individuals. C: cold competition; lane 1:/ml). The result is representative of three independent experiments.

ranscript data supported the findings seen at protein level. LPS,he classical TLR4 ligand, activates MAP kinase family mem-ers, primarily in cells of the monocytes lineage (Sweet andume, 1996). LPS activation leads to the induction of a num-er of transcription factors such as NF-�B, AP-1, Sp1, CEBP�also known as NF-IL6), Spi-1, IFN regulatory factors (IRF)nd their subsequent nuclear translocation. Transcription fac-ors, NF-�B and AP-1 act as ultimate switch for induction of aumber of inflammatory genes including those for matrix metal-oproteinases (MMPs), inducible nitric oxide synthase (iNOS),yclooxygenase-2 (Cox-2) which are involved in the pathogen-sis of rheumatoid arthritis (Barnes and Karin, 1997). In thistudy, SA extract inhibited nuclear translocation of both NF-�Bnd AP-1. We could also demonstrate inhibition of LPS activatedhosphorylation of I�B�.

However, NF-�B and AP-1 also form part of the regulatorynit of IL-6 and TNF-�, which surprisingly were not suppressedither at protein or the transcript level by SA. There has beenonsiderable interest in the differential activity of the NF-�Bubunits. Although a cooperative role of NF-�B, AP-1 andEBP� is essential for regulation of TNF-�, IL-1�, IL-6 and

L-12p40 gene expression, it has been shown that interactionf C/EBP� with the p65 and p50 Rel family members at theL-6 promoter region preferentially regulates IL-6 productionMatsusaka et al., 1993; Ray and Ray, 1995). Regulation of TNF-

gene expression by NF-�B is independent of C/EBP� (Liu etl., 2000). The upstream kinases, especially p38 MAPKs arenvolved in LPS induced biosynthesis of TNF-�, IL-1�, IL-6

nd GM-CSF (Lee and Young, 1996; Bayaert et al., 1996). Itas been shown that regulation of IL-1� and IL-12p40 and IL-2p35 but not TNF-� and IL-6 is through MKK3 kinase that inurn activates p38 MAPK (Lu et al., 1990). Thus, the differen-

404 D. Singh et al. / Journal of Ethnopharmacology 108 (2006) 398–406

F -�B al l). Th

tmfttfNfrsbsi

mstpps

mstmgenes for collagenase-3 (MMP13) is increased in IL-1� stimu-lated synoviocytes through activation of p50 dimers while p65and p50 both play a crucial role in IL-6 production (Tak and

ig. 5. Effect of Semecarpus anacardium extract on transcription factor (A) NFane 2: LPS (10 ng/ml); lane 3: extract (1 mg/ml) + LPS; lane 5: extract (1 mg/m

ial effect of SA on TNF-� and IL-6 versus IL-1 and IL-12p40aybe related to differential activity of the extract on the dif-

erent NF-�B homo/hetero dimers. Also, the data suggests thathere maybe inhibition of p38 MAPK via MKK3. Additionally,he transcription factor Spi-1 (also known as PU.1) is criticalor the activation of IL-1� core promoter and cooperates withF-IL6 (Marecki et al., 2001). Binding site for this transcription

actor along with others is also present in the IL-12p40 promoteregion (Vandenbroek et al., 2004). It is also possible that suppres-ion of IL-1� and IL-12p40 but not of IL-6 by SA extract mighte due to inhibition of Spi-1. A detailed study of the upstreamignaling pathways and the transcription factors may give morensight to the mechanisms of action of the extract.

The suppressive activity of SA extract demonstrable in nor-al mononuclear cells was also seen where peripheral blood and

ynovial mononuclear cells of RA patients were used. Rheuma-

oid arthritis is marked by chronic synovitis and abundance ofroinflammatory cytokines, TNF-�, IL-1�, IL-6 and IL-12p40,roduced primarily by stimulated monocytes, macrophages andynovial lining cells (Feldmann et al., 1996). This inflammatory

Flwar

nd (B) AP-1 in RA PBMC and RA SFMC. C: cold competition; lane 1: control;e result is representative of three independent experiments.

ilieu is also responsible for the cartilage and bone damageeen in this disease (Goldring, 2003). NF-�B has been showno be activated in the inflamed synovium of patients and in ani-

al models of the disease (Marok et al., 1996). Expression of

ig. 6. Effect of Semecarpus anacardium extract on LPS induced phosphory-ation of I�B. Cells pre-treated with Semecarpus anacardium (1 mg/ml) for 1 here incubated with LPS for indicated time points. Cytoplasmic extracts were

ssayed for phospho-I�B�. PCNA shown as loading control. The result is rep-esentative of three independent experiments.

D. Singh et al. / Journal of Ethnophar

Fig. 7. Effect on LPS activated NO production in RAW 264.7 cells (n = 3). CellswDa

Fwi

oRi(Rei

m(foactdti2htcb

cpdtsad

A

S

csV

R

A

B

B

B

B

C

F

G

G

K

L

L

L

M

M

M

M

P

ere treated with the extract in presence or absence of LPS (0.5 �g/ml) for 18 h.ata is expressed as mean ± S.D. of three independent experiments. All p values

re in comparison to LPS stimulated cultures (*p < 0.05).

irestein, 2001). The suppression of IL-1� and IL-12p40 alongith NF-�B and AP-1, therefore, suggests that SA may have

mportant constituents that will have benefits for this disease.We have also shown the SA suppressed LPS activated nitric

xide production by the extract in mouse macrophage-like cell,AW 264.7. This is not surprising since nitric oxide production

s regulated by iNOS gene that has promoter regions for NF-�BXie et al., 1994). NO also plays a role in the pathogenesis ofA (Abramson et al., 2001) and therefore, its suppression by SAxtract adds an additional advantage for its anti-disease activityn RA.

The aim of therapy in RA is to down regulate the inflam-atory cascade. Disease-modifying antirheumatic drugs

DMARDs) such as gold compounds, methotrexate, sul-asalazine, hydroxychloroquine and cyclosporine, either alone,r in combination have been the mainstay of therapy (Goldblattnd Isenberg, 2005). All of these act by down modulating thisascade to variable degrees, but also have limitations in theirherapeutic success. Hence, fresh efforts have been towardseveloping biological agents especially those targeted againsthe cytokine cascade. A number of these such as the TNF-�nhibitors such as Infliximab, Etanercept (Shahnan and Clair,002) and IL-1� inhibitor, Anakinra (Bresnihan et al., 1998)ave been highly successful. However, the prohibitive cost ofhese drugs and the need for long-term therapy which is asso-iated with high frequency side effects makes it imperative thatetter and more acceptable drugs are made available.

There is an increasing interest in herbal medications espe-ially for chronic diseases like RA (Setty and Sigal, 2005). Thelant described in this paper, Semecarpus anacardium, is wellocumented in traditional Ayurveda system of medicine for thereatment of arthritis (Kirtikar and Basu, 1956). Our demon-tration of activity of its ethanolic extract at the cellular levels a potent anti-inflammatory agent gives an important lead foretailed studies that can exploit its active ingredients.

cknowledgements

DS is a Senior Research Fellow supported by Council ofcientific and Industrial Research, New Delhi, India. The SA

P

macology 108 (2006) 398–406 405

rude nut powder was gifted by Dr. R.H. Singh, Retd. Profes-or of Medicine, Ayurveda Institute, Banaras Hindu University,aranasi, India.

eferences

bramson, S.B., Amin, A.R., Clancy, R.M., Attur, M., 2001. The role of nitricoxide in tissue destruction. Best Practical Research in Clinical Rheumatol-ogy 15, 831–845.

arnes, P.J., Karin, M., 1997. Nuclear Factor-�B-A pivotal transcription factorin chronic inflammatory diseases. New England Journal of Medicine 336,1066–1107.

ayaert, R., Ceunda, A., Berghe, W.V., Plaisance, S., Lee, J.C., Haegeman, G.,Cohen, P., Fier, W., 1996. The p38/RK mitogen activated protein kinase path-way regulates interleukin-6 synthesis in response to tumor necrosis factor.EMBO Journal 15, 1914–1923.

oyum, A., Helgestad, J., Lovhang, D., 1988. Thymidine dependent effect ofgranulocytes derived inhibitor on granulocyte-macrophage progenitor cells(GMCSF). European Journal of Haematology 40, 119–125.

resnihan, B., Alvaro-Gracia, J.M., Cobby, M., Doherty, M., Domljan, Z.,Emery, P., Nuki, G., Pavelka, K., Rau, R., Rozman, B., Watt, I., Williams,B., Aitchison, R., McCabe, D., Musikic, P., 1998. Treatment of rheumatoidarthritis with recombinant human interleukin-1 receptor antagonist. Arthritisand Rheumatism 41, 2196–2204.

hakraborty, S., Roy, M., Taraphdar, A.K., Bhattacharya, A.K., 2004. Cyto-toxic effect of root extract of Tiliacora racemosa and oil of Semecarpusanacardium nut in human tumor cells. Phytotherapy Research 18, 595–600.

eldmann, M., Brennan, F.M., Maini, R.N., 1996. Role of cytokines in rheuma-toid arthritis. Annual Review of Immunology 14, 397–440.

oldblatt, F., Isenberg, D.A., 2005. New therapies for rheumatoid arthritis. Clin-ical and Experimental Immunology 140, 195–204.

oldring, S.R., 2003. Pathogenesis of bone and cartilage destruction in rheuma-toid arthritis. Rheumatology 42, 11–16.

irtikar, K.R., Basu, B.D., 1956. Indian Medicinal Plants, vol. III, 2nd ed. LalitMohan Basu, Allahabad, India, p. 2045.

ee, J.C., Young, P.R., 1996. Role of CSBP/p38/RK stress response kinase inLPS and cytokine signaling mechanisms. Journal of Leukocyte Biology 59,152–157.

iu, H., Sidiropoulos, P., Song, G., Pagliari, J.L., Birrer, M.J., Stein, B., Anrather,J., Pope, R.M., 2000. TNF-� gene expression in macrophages: regulationby NF-�B is independent of c-jun or C/EBP�. Journal of Immunology 164,4277–4285.

u, H.T., Yang, D.D., Wysk, M., Gatti, E., Mellman, I., Davis, R.J., Flavell,R.A., 1990. Defective IL-12 production in mitogen activated protein (MAP)kinase kinase 3 (Mkk3)-deficient mice. EMBO Journal 18, 1845–1857.

arecki, S., Reindeau, C.J., Liang, M.D., Fenton, M.J., 2001. PU.1 and multipleIFN regulatory factor proteins synergize to mediate transcriptional activationof the human IL-1� gene. Journal of Immunology 166, 6829–6838.

arok, R., Winyard, P.G., Coumbe, A., Kus, M.L., Gaffney, K., Blades, S.,Mapp, P.I., Morris, C.J., Blake, D.R., Kaltschmidt, C., Baeuerle, P.A.,1996. Activation of the transcription factor nuclear factor-kappaB in humaninflamed synovial tissue. Arthritis and Rheumatism 39, 583–591.

atsusaka, T., Fujikawa, K., Nishio, Y., Mukaida, N., Matsushima, K., Kishi-moto, T., Akira, S., 1993. Transcription factors NF-IL6 and NF-�B syner-gistically activate transcription of the inflammatory cytokines, interleukin6 and interleukin 8. Proceedings of the National Academy of Sciences 90,10193–10197.

osmann, T., 1982. Rapid colorimetric assay for cellular growth and survival:application to proliferation and cytotoxicity assays. Journal of Immunolog-ical Methods 65, 55.

andey, R., Maurya, R., Singh, G., Sathiamoorthy, B., Naik, S., 2005. Immuno-suppressive properties of flavonoids isolated from Boerhaavia diffusa Linn.

International Immunnopharmacology 5, 541–553.

remalatha, B., Sachdanandam, P., 2000. Stablization of lysosomal membraneand cell membrane glycoprotein profile by Semecarpus anacardium linn.Nut milk extract in experimental hepatocellular carcinoma. PhytotherapyResearch 14, 352–355.

4 ophar

R

R

S

S

S

S

S

T

T

V

06 D. Singh et al. / Journal of Ethn

amprasath, V.R., Shanthi, P., Sachdanandam, P., 2004. Anti-inflammatoryeffect of Semecarpus anacardium LINN. nut extract in acute and chronicinflammatory conditions. Biological and Pharmaceutical Bulletin 27,2028–2031.

ay, A., Ray, B.K., 1995. Lipopolysaccharide-mediated induction of the bovineinterleukin-6 gene in monocytes requires both NF-kappa B and C/EBP bind-ing sites. DNA Cell Biology 14, 795–802.

elvam, C., Jachak, S.M., 2004. A cyclooxygenase (COX) inhibitory biflavonoidfrom the seeds of Semecarpus anacardium. Journal of Ethnopharmacology95, 209–212.

etty, A.R., Sigal, L.H., 2005. Herbal medications commonly used in the practiceof rheumatology: mechanisms of action, efficacy and side effects. Seminarsin arthritis and Rheumatism 34, 773–784.

hahnan, J.C., Clair, W.S., 2002. Tumor necrosis factor-� blockade: a noveltherapy for rheumatoid arthritis. Clinical Immunology 103, 231–242.

X

macology 108 (2006) 398–406

harma, K., Shukla, S.D., Mehta, P., Bhatnagar, M., 2002. Fungistatic activity ofSemecarpus anacardium LINN. nut extract. Indian Journal of ExperimentalBiology 40, 314–318.

weet, M.J., Hume, D.A., 1996. Endotoxin signal transduction in macrophages.Journal of Leukocyte Biology 60, 8–26.

ak, P.P., Firestein, G.S., 2001. NF-�B: a key role in inflammatory disease.Journal of Clinical Investigation 107, 7–11.

ripathi, Y.B., Singh, A.V., 2001. Effect of Semecarpus anacardium nuts onlipid peroxidation. Indian Journal of Experimental Biology 39, 798–801.

andenbroek, K., Alloza, I., Gadina, M., Matthys, P., 2004. Inhibitibg cytokines

of the interleukin-12 family: recent advances and challenges. Journal ofPharmacy and Pharmacology 56, 145–160.

ie, Q., Kashiwabara, Y., Nathan, C., 1994. Role of transcription factor NF-�B/Rel in induction of nitric oxide synthase. Journal of Biological Chemistry269, 4705–4708.