identification of cell surface markers from...

Identification of cell surface markers

from multidimensional microarray data

utilizing spherical Self Organizing Maps

March 2016

Yuh Sugii

The Graduate School of Natural Science and Technology

(Doctor’s Course)

OKAYAMA UNIVERSITY

ABBREVIATIONS

BSA: bovine serum albumin

DMEM: Dulbecco’s modified Eagle’s medium

EGFR: epithelial growth factor receptor

FBS: fetal bovine serum

FITC: fluorescein isothiocyanate

GPI: glycosylphosphatidylinositol

HEPES: 4-(2-HydroxyEthyl)-1-Piperazineethanesulfonic acid

IP: ideal point

MEM: minimum essential medium

PBS: phosphate-buffered saline

PCR: polymerase chain reaction

qPCR: quantitative RT-PCR

RFI: relative fluorescent intensity

RPMI: Roswell Park Memorial Institute

RT-PCR: reverse transcription polymerase chain reaction

SDS: sodium dodecyl sulfate

SSC: standard saline citrate

sSOM: spherical Self-Organizing Map

Table of contents

GENERAL INTRODUCTION -------------------------------------------------- 1

CHAPTERⅠ ------------------------------------------------------------------------ 2

Identification of cell surface markers on glioma cells

Abstract -------------------------------------------------------------------------------------------- 3

Introduction -------------------------------------------------------------------------------------- 4

Materials and Methods ------------------------------------------------------------------------ 5

Cell lines and culturing ---------------------------------------------------------------------- 5

RNA preparation ------------------------------------------------------------------------------ 5

Reverse transcription and qPCR ----------------------------------------------------------- 6

DNA microarray ------------------------------------------------------------------------------ 7

sSOM analysis --------------------------------------------------------------------------------- 7

Immunostaining ------------------------------------------------------------------------------- 8

Results and Discussion ------------------------------------------------------------------------- 9

Design of microarray for cell surface proteins ----------------------------------- 9

Cell surface markers commonly expressed in glioma -------------------------------- 10

Gene expression profiles on sphere surfaces ------------------------------------------- 11

Mining genes commonly expressed in glioma cell lines

but not in brain tissues --------------------------------------------------------------------- 13

Evaluation of genes commonly expressed in glioma cell lines --------------------- 15

Conclusion --------------------------------------------------------------------------------------- 20

References ---------------------------------------------------------------------------------------- 20

CHAPTERⅡ ----------------------------------------------------------------------- 25

A spherical self-organizing map clustering of

human breast cancer cell lines

Abstract ------------------------------------------------------------------------------------------- 25

Introduction ------------------------------------------------------------------------------------- 26

Materials and Methods ----------------------------------------------------------------------- 27

Cell lines and cell culture ------------------------------------------------------------------- 27

Preparation of total RNA and cDNA synthesis ---------------------------------------- 27

Microarray analysis -------------------------------------------------------------------------- 28

Data filtering in breast cancer cell -------------------------------------------------------- 29

sSOM analysis of gene expression ------------------------------------------------------- 29

Results and discussion ------------------------------------------------------------------------ 30

sSOM clustering of human breast cancer cell lines ----------------------------------- 30

Conclusions -------------------------------------------------------------------------------------- 34

References ---------------------------------------------------------------------------------------- 35

ACKNOWLEDGEMENTS ----------------------------------------------------------------- 39

APPENDIX ----------------------------------------------------------------------------------------- 40

1

GENERAL INTRODUCTION

The technology of high throughput screening is nowadays widely

available in life science especially in the fields of molecular diagnosis and

drug discovery. This is due to the establishment of microarray procedure,

which deals with huge number of genes at one time. Cluster analysis is

usually performed on the results of DNA microarray experiments. However,

the routine procedure of data mining dealing with the huge number of

signal information obtained from microarray is not fixed yet. We can find

various way of clustering in hierarchical and non-hierarchical methods,

which are applied for the analyses. The most popular ones appear

non-hierarchical clustering such as k-means (MacQueen, 1965),

partitioning around medoids (Kaufman and Rousseeuw, 1990) and cluster

affinity search technique (Ben-Dor et al., 1999). We have employed

spherical self-organizing map (sSOM), which is also a non-hierarchical

clustering, to cluster genes by gene expression profiles of cells and tissues

(Tuoya et al., 2008).

Analyzing various types of carcinoma cells and normal tissues, we could

find interesting cell surface molecules, which should serve as the molecular

markers. This procedure, which we are demonstrating, is rather new to the

data analyses of gene clustering from the gene expression profiles obtained

from DNA microarray technique. Flexible arrangement of the data obtained

allows us to cluster cells and tissues as well as genes to find definitely

fantastic direction of further advancement of study. In the future this

2

procedure should be extremely helpful in the field of drug discovery as

well as those of molecular biology and oncology.

References

Ben-Dor A, Shamir R, Yakhini Z. Clustering gene expression patterns. J

Comput Biol; 1999:6(3-4)281-297.

Kaufman L, Rousseeuw PJ. Finding Groups in Data: An Introduction to

Cluster Analysis. John Wiley & Sons; 1990;ISBN:978-0-471-73578-6,

New York.

MacQueen J. Some Methods for Classification and Analysis of

Multivariate Observations. In: Proceedings of the 5th Berkeley Symposium

on Mathematical Statistics and Probability; 1965:281-297.

Tuoya, Sugii Y, Satoh H, Yu D, Matsuura Y, Tokutaka H, Seno M.

Spherical self-organizing map as a helpful tool to identify category-specific

cell surface markers. Biochem Biophys Res Commun; 2008:

376(2)414-418.

3

CHAPTERⅠ

Identification of cell surface markers on glioma cells

Abstract

To identify cell-specific markers, we designed a DNA microarray

platform with oligonucleotide probes for human membrane-anchored

proteins. Human glioma cell lines were analyzed using microarray and

compared with normal and fetal brain tissues. For the microarray analysis,

we employed a spherical self-organizing map, which is a clustering method

suitable for the conversion of multidimensional data into two-dimensional

data and displays the relationship on a spherical surface. Based on the gene

expression profile, the cell surface characteristics were successfully

mirrored onto the spherical surface, thereby distinguishing normal brain

tissue from the disease model based on the strength of gene expression. The

clustered glioma-specific genes were further analyzed by polymerase chain

reaction procedure and immunocytochemical staining of glioma cells. Our

platform and the following procedure were successfully demonstrated to

categorize the genes coding for cell surface proteins that are specific to

glioma cells. Our assessment demonstrates that a spherical self-organizing

map is a valuable tool for distinguishing cell surface markers and can be

employed in marker discovery studies for the treatment of cancer.

4

Introduction

Currently, the high-throughput screening technology is widely available in

the field of life science, especially in relation to molecular diagnosis and

drug discovery. The versatility of the microarray technology enables the

simultaneous analysis of a large number of genes at any given time. Cluster

analysis is usually performed on the results of DNA microarray

experiments. However, the routine procedure of data mining dealing with

huge number of signals obtained from microarray has not yet been

optimized.

Various methods of hierarchical and non-hierarchical clustering have been

employed in previous analyses. The most popular methods include

non-hierarchical clustering such as k-means (MacQueen 1965), partitioning

around medoids (Kaufman et al. 1990), and the cluster affinity search

technique (Ben-Dor et al. 1999).

We have employed a spherical self-organizing map (sSOM), which is also

a non-hierarchical clustering method, to cluster genes by the gene

expression profiles of cells and tissues (Ritter. 1999; Kihato et al. 2008;

Tuoya et al. 2005, 2008; Abou-Sharieha et al. 2009; Sugii et al. 2011). In

this study, we attempted to identify human glioma-specific cell surface

markers by analyzing nine glioma-derived cell lines and compared normal

adult and fetal brain tissues. Because the information relating to marker

proteins on cells are extremely useful in identifying and targeting cells

specifically, a sophisticated and conventional procedure to identify cell

specific surface markers is highly desirable.

5

Our procedure proposed here is rather new and innovative in the analysis

of data from gene clustering of the expression profiles obtained from the

DNA microarray technique.

Materials and Methods

Cell lines and culturing. We employed nine glioma cell lines for this

study: A172, Gli36, U251MG, U373MG, GI-1, KG1C, T98G, CCFSTTG1,

and TM31. A172, Gli36, U251MG, U373MG, GI-1, and KG1C cells were

cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented

with 10% fetal bovine serum (FBS), containing 4 mM L-glutamine, 100

U/mL penicillin, and 100 μg/mL streptomycin. T98G and CCFSTTG1 cells

were cultured in RPMI 1640 with 10% FBS, containing 2 mM L-glutamine,

100 U/mL penicillin, and 100 μg/mL streptomycin. TM31 cells were

cultured in minimum essential medium (MEM) with 10% FBS, 2 mM

L-glutamine, 100 U/mL penicillin, and 100 μg/μL streptomycin. All cell

lines were maintained at 37°C in a 5% CO2-humidified incubator.

RNA preparation. Total RNA was prepared from the cells using an

RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions.

RNAs were essentially treated with DNase I to remove genomic DNA. To

synthesize cDNA for DNA microarray analysis, 20 μg of total RNA was

reverse-transcribed using SuperScript II (Invitrogen) with an oligo dT18

and dNTP-containing amino alkylated dUTP (0.4 mM, Ambion).

6

Commercially obtained total RNA derived from normal adult and fetal

brain (Stratagene) was compared as control throughout this study.

Reverse transcription and qPCR. Using 2 µl of diluted cDNA

(corresponding to 0.1 µg of original total RNA), RT-PCR was performed

with the primers listed in Table 1. The PCR profiles were 94°C for 5

minutes for initial denaturation followed by 95°C for 30 seconds, 55°C for

30 seconds, and 72°C for 30 seconds, followed by 72°C for 7 minutes final

elongation. The cycling conditions were different and were carried out as

follows: 25 cycles (for ID 287 and 1,286 and GAPDH), 28 cycles (for ID 2,

45 259, 314 339, 998, and 1,012), and 30 cycles (for the remaining

candidates and epithelial growth factor receptor [EGFR]). For CD44s,

caveolin-1, and GAPDH, quantitative RT-PCR (qRT-PCR) was performed

using a LightCycler DX400 (Roche) with SYBR Green Realtime PCR

Master Mix (Toyobo). The PCR profile was 40 cycles of 95°C for 10

seconds, 60°C for 10 seconds, and 72°C for 25 seconds.

Table 1: Primer sets for RT-PCR and quantitative PCR

Gene ID Forward (5’-3’) Reverse (5’-3’)ID 2 (AGPAT2) TGTACTGCGCGCTGTGCTTC ACCTGCACTGTGACTGTTCCTGID45 (ADORA2B) CTTTGGCATCGGATTGACTC CCACTCTTGACATCTGCTTGID259 (CAV1) CTCGGAGGGACATCTCTACACCGTT GCAAGTTGATGCGGACATTGCTGAID287 (CD44s) AACCGTGATGGCACCCGCTATG TGGCCTCTCCGTTGAGTCCACTTID314 (TXNDC14) GTGCGGCGACTTTCACGATG GGGTGATGTGCTCACTTTGTACCID339 (CMTM6) GTGTACAGCCCCACTACGGA GCTCAGGCACCACAATGCAGID428 (CNIH) GCGGCCTTCTGCTACATGCT CAGATTCCACAGGCTACTCTTGGACID910 (LEPROTL1) TCTTACAACGGGCATTGTCG CTTGACCAGTAATAGAGCCGID998 (M11S1) GCAGAACACTGGATTTCCACGTAG GGCTCAAGATGACGCTTAGGACAID1012 (MET) ACAGCTGAATCTGCAACTCC CTCTTGCATCGTAGCGAACTID1282 (PTPRS) GCCCTATATTGCAGCTCGCTT GAGAGCTTGAGGCTGTCGTTID1286 (PLP2) CATAGCGGCAATCCTCTACCTG AACCTAGGGCCTGGACTCTGID1389 (RECK) GTGTGCTTCTGTCAAGTGTC AACCAGCAGTCCTGAATGTCEGFR TCCCTCAGCCACCCATATGTAC GTCTCGGGCCATTTTGGAGAATTCGAPDH CCCTTCATTGACCTCAACTAC CCACCTTCTTGATGTCATCAT

7

DNA microarray. We originally designed the DNA microarray, which

focused on cell membrane-bound proteins to identify cell surface markers

specific to the cells (Tuoya et al. 2008; Abou-Sharieha et al. 2009; Sugii et

al. 2011). It was designed to contain 1,795 oligonucleotide probes

corresponding to human genes. To avoid the effect of alternative splicing,

the coding sequence for the membrane-bound region or glycosyl-

phosphatidylinositol (GPI) anchor-modified region was focused to design

the oligonucleotide probes. The probes were conjugated on the slide glass

coated with diamond-like carbon, as previously described (Tuoya et al.

2005; Sugii et al. 2011). The Cy3-labeled cDNA synthesized above was

hybridized to the cell surface marker DNA microarray and then scanned

with a FLA8000 scanner (Fuji Film, Japan). Intensity for each spot of the

array was captured by GenePix® Pro5.1 image analysis software (Axon

Instrument).

sSOM analysis. For the initial screening of the genes, the obtained

intensity of each spot from the microarray analysis of duplicates was

evaluated by the following criteria:

|A − G| − V > 0,

where A denotes the gene expression level in normal brain tissue in adult or

fetus, G denotes the average expression level of each gene from the nine

glioma cell lines, and V denotes the standard deviation of each expressed

gene among the nine glioma cell lines. The genes that were not expressed

above zero were considered insignificant and filtered out. The values were

8

then plotted on to the sSOM software “Blossom” obtained from SOM,

Japan Co. Ltd.

To find genes whose expression was significantly upregulated in glioma

cell lines, we applied the following formula:

G − V > 0,

where G denotes the average of the difference between each expressed

gene from the nine glioma (Gi) cell lines and gene expression level in adult

or fetal brain (N); V denotes the standard deviation of (Gi − N).

The SOM algorithm was previously described by Tokutaka et al. (1999)

and Okita et al. (2004).

Immunostaining. Glioma cells grown on 18 mm cover slips were washed

with phosphate-buffered saline (PBS) twice, prior to fixation with 4%

paraformaldehyde for 10 minutes. The fixed samples were incubated with

blocking solution (PBS containing 10% FBS, 1% bovine serum albumin

[BSA], and 0.02% NaN3), followed by incubation with anti-CD44 mouse

monoclonal antibody (Cell signaling Technology, diluted 1:100 in PBS

containing 1% BSA) at 4°C overnight or with anti-caveolin-1 rabbit

polyclonal antibody (Cell Signaling Technology, diluted 1:200) at room

temperature for one hour. After incubation, the samples were washed with

PBS three times and then incubated with Alexa-488 conjugated secondary

antibody (Life Technologies) at a dilution of 1:300 for 30 minutes. After

washing three times with PBS, the samples were mounted, and fluorescent

images were captured using LSM 510 Meta (Zeiss).

9

Results and Discussion

Design of microarray for cell surface proteins. We designed 1,795

oligonucleotide probes for human cDNA-coding transmembrane proteins

and GPI-anchored proteins, which are located on the cell surface (Fig. 1A).

Each probe was synthesized based on the nucleotide sequence coding for

the transmembrane region or the region containing amino acid residues

attached to GPI as a 60-mer modified with NH2 at the 5′-end. The

duplicated probes were covalently conjugated to the activated surface of

diamond-like carbon-coated slide glass, as previously described (Tuoya et

al. 2005; Sugii et al. 2011).

Figure 1A: Typical protein types integrated

or anchored on cellular membrane.

Transmembrane type has at least one

region spanning the lipid bilayer. GPI-

anchored type has a hydrophobic C-

terminal tail (red) in the precursor form,

and a processed C-terminal (brown) is

attached to GPI and retained on the cell

surface. Figure 1B: Expression of EGFR in

the nine glioma cell lines and adult and

fetal brain tissues. Evaluation was

performed by reverse transcription PCR.

10

Cell surface markers commonly expressed in gliomas. We analyzed

nine cell lines, A172, Gli36, U251MG, U373MG, GI-1, T98G, CCFSTTG1,

TM31, and KG1C, which were derived from human glioma. It is well

known that EGFR overexpression in tumor samples of low-grade glioma

(Andersson et al. 2004) and anaplastic astrocytoma (Wrensch et al. 2006)

has been associated with poor prognosis. As shown in Figure 1B, EGFR

was overexpressed in all cell lines evaluated in this study. However, EGFR

is also clearly expressed in normal brain tissues, suggesting that EGFR is

still not a good marker to distinguish glioma from normal cells. To screen

for candidate markers specific and common to gliomas, total RNA from

nine glioma cell lines and brains from adult and fetus was analyzed on our

DNA microarray.

Figure 2: Extraction of focused genes

with feature. Each gene was plotted

by nine glioma cell lines vs normal

adult brain (A) and vs fetal brain (B)

according to │A - G│ in horizontal

axis and V in vertical axis. The

border is lined by V =│A - G│. The

area around where │A - G│- V > 0 is

circled with red.

11

The genes were plotted in the two dimensions of V and |A − G| in Figure 2.

Because the genes, which had good differences in intensity between glioma

and brain tissues and had very low V between gliomas, were considered

helpful in characterizing glioma cells, the genes were selected for further

spherical sSOM analysis. As a result, 1,174 and 179 genes were selected

for the analyses of normal adult brain and fetal brain tissues, respectively.

Gene expression profiles on sphere surfaces. The expression profiles

were shown on each sphere surface for the selected genes (Fig. 3). The

longitude and latitude were fixed in all sphere surfaces so that the profiles

could be distinguished at a glance. Gene expression profiles were compared

as two sets between normal adult brain vs glioma, and fetal brain vs glioma.

From the intensity of the gene expression plotted on the sSOM, it appears

that the pattern of expression profiles were considerably different between

the two comparisons. When compared with normal adult brain, the profiles

of glioma appear very similar to one another while there was no significant

gene expression visible in the normal adult brain on the same side of the

sphere. Fetal brain had the same expression profile on the same side.

However, the pattern was different from the patterns of the glioma cell

lines, which were again quite similar. When we compared the glioma cell

panels alone, shown in Figure 3A and 3B, the heat map characteristics were

entirely different between each other, based on the comparison with adult

or fetal brain. The heat map characteristics shown in Figure 3 clearly

emphasize that there is similarity in the expression patterns within the

12

Figure 3: Gene expression profiles of nine glioma cell lines and brain

tissues presented on sphere surfaces. Profiles of intensity of each gene

were plotted on the sphere surface with the longitude and latitude fixed at

the same positions. Nine glioma cell lines vs normal adult brain (A) and vs

fetal brain (B). Intensity of the spot is depicted in red, yellow, white, blue,

and dark blue as very high, high, medium, low, and very low, respectively.

glioma cell lines compared with those within adult or fetal brain. sSOM

was able to show the glioma-specific characteristics irrespective of the

different stages of the normal adult or fetal brain. Thus, some genes were

specifically and commonly expressed in gliomas, as suggested by the red

part of the profiles of glioma cell lines, which were localized in almost the

same part of the sphere surfaces.

13

Mining genes commonly expressed in glioma cell lines but not in

brain tissues. Although it was possible to select the genes of interest from

the aforementioned procedure, we further considered the extraction of the

genes to be focused by overlaying the profiles in one sSOM (Fig. 4A).

As the ideal point (IP), the virtual gene that was expressed in all glioma

cell lines at the highest level, but not expressed in brain tissues, were

inserted in the dataset for reference. Based on these calculations, we

generated the gene expression profiles against the adult brain and fetal

brain separately compared with glioma. In Figure 4A, both of the gene

expression profiles were shown on the same side of the sphere surface with

IP at the center. The genes located close to IP are interpreted as the genes

expressed in all glioma cell lines but not in brain tissues. The dark part of

the sphere surface translates to the distances apart from each other so that

the dotted lines were able to clearly show the border of clusters. The genes

evident in Figure 4A are listed in Table 2.

14

Figure 4A: Mining genes up-

regulated in gliomas by sSOM.

Each number denotes the gene’s

identity. IP denotes the ideal point,

where the expression in every

glioma is maximum but zero

expression in brain tissue. The

points close to the IP could be

nominated as the best candidates of

the glioma marker. Dark areas

(with broken lines) show the

borders of each cluster of genes.

Numbers in red, yellow, and blue

represent close, good, and little

relationship with IP, respectively,

as the results of RT-PCR. Figure

4B: Evaluation of the expression of

genes selected through sSOM

procedure. Genes in groups I and II are the genes for which numbers are

shown in red and yellow, respectively. Evaluation was performed by reverse

transcription PCR using agarose gel. The experiment was repeated three

times and same results were obtained.

Table 2: List of genes localized close to the ideal point in sSOM

Gene ID Gene Name

2 1-acylglycerol-3-phosphate O-acyltransferase 2 (AGPAT2)

45 adenosine A2b receptor (ADORA2B)

259 caveolin-1, caveolae protein, 22kD (CAV1)

287 CD44 antigen (homing function and Indian blood group system)

15

314 CGI-31 protein (TXNDC14)

339 Chemokine-like factor super family member 6 (CMTM6)

428 cornichon-like (CNIH)

910 leptin receptor overlapping transcript-like 1(LEPROTL1)

998 membrane component, chromosome 11, surface marker 1 (M11S1)

1012 met proto-oncogene (MET)

1282 protein tyrosine phosphatase, receptor type, S (PTPRS)

1286 proteolipid protein 2 (colonic epithelium-enriched) (PLP2)

1389 reversion-inducing-cysteine-rich protein with kazal motifs (RECK)

Evaluation of genes commonly expressed in glioma cell lines. Nineteen

genes are shown in Figure 4A. The expression of these genes was evaluated

by reverse transcription PCR (Fig. 4B), and CD44 and caveolin-1 were

investigated by qRT-PCR (Fig. 5). In Figure 4B, 13 genes showed a good

relationship with glioma-specific expression. Genes expressed in all glioma

cell lines were denoted as group I. Genes in group II were not expressed in

few of the glioma cell lines. The genes in group I were shown in red, and

those in group II were shown in yellow (Fig. 4A). The remaining six genes

shown in blue could not be confirmed as being positively expressed in

glioma. Based on these observations, the genes located close to IP were

16

depicted in red, whereas the genes depicted in blue were located distant

from IP (Fig. 4A).

A

B

Figure 5: Gene expression levels of CD44 (A) and caveolin-1 (B). The relative

expression levels of each cell line were confirmed by quantitative PCR. The

graph shows the average levels of cell lines compared to adult brain.

17

This suggests that sSOM clustering almost correlated with the results of

gene expression results confirmed by PCR. In Figure 4A, the 13 genes

depicted in red and yellow has been tabulated in Table 2. Not only are there

well-known genes but genes, whose function is not yet clear, are also listed.

Because hyaluronic acid is abundant in the brain tissue, CD44 (hyaluronic

acid receptor) might be a good marker of glioma among the listed genes.

CD44 is known to have various forms resulting from alternative splicing

(Kaaijk et al. 1995; Eibl et al. 1995) so that the variant form of CD44 in

glioma cell lines was assessed by reverse transcription PCR (Fig. 6). As a

result, the standard CD44 (CD44s) form was found to be dominantly

expressed in the cell lines. Moreover, CD44 directly/indirectly contributes

to antioxidant status, drug resistance, and migration in cancer cells

(Tamada et al. 2012; Chetty et al. 2012). The high expression levels of

CD44 in glioma correlate with malignancy and prognosis (Yoshida et al.

2012; Wei et al. 2010) because CD44 is not only associated with astrocytes

but also with cancer stem cells (Pietras et al. 2014; Sugihara et al. 2012).

18

Figure 6: Evaluation of the variable forms of CD44 in glioma cell lines. CD44

is known to be variable due to the alternative splicing. Primers were

designed to amplify the variable region. RT-PCR was performed and the

fragment of 500 bp, which corresponds to the shortest form, was only

amplified in each glioma cell line. M; size marker.

Translation of the gene of interest is considered the most crucial point in

tumor marker discovery. The gene should transcribe and eventually be

translated into protein because protein expression is an absolute

requirement for the invasion, migration, and various signaling aspects of

cancer cells. For the confirmation of protein expression in the cells, CD44

and caveolin-1 in the genes of group I were the best candidates, which

cross-reacted with antibodies that could easily detect proteins; these two

proteins were evaluated by immunostaining (Fig. 7A and 7B). Both

antibodies against CD44 and caveolin-1 showed clear staining in all nine

glioma cell lines. Because this staining was not observed by the secondary

antibody, there was no nonspecific binding by the secondary antibody. We

concluded that the proteins were present on the cellular membrane because

of the observation of staining on cell connections.

19

Figure 7A: Immunostaining

of glioma cells with anti-

CD44 antibody. Nine

glioma cell lines were

stained with anti-CD44

antibody followed by the

secondary antibody labeled

with FITC. The secondary

antibody did not show any

background staining. The

observation was performed

by confocal microscopy at a

magnification of ×64.

Figure 7B: Immunostaining

of glioma cells with anti-

caveolin-1 antibody. Nine

glioma cell lines were

stained with anti-caveolin-

1 antibody followed by the

secondary antibody labeled

with FITC. The secondary

antibody did not show any

background staining. The

observation was performed

by confocal microscopy at a

magnification of ×64. The

experiment was repeated

three times and same

results were obtained.

20

Conclusion

sSOM coupled with DNA microarray analysis has been successfully

demonstrated to show gene expression profiles. Through this procedure, the

identification of specific genes is possible for the nomination of cell surface

markers, such as CD44 that are specific to glioma.

References

Abou-Sharieha S, Sugii Y, Tuoya, Yu D, Chen L, Tokutaka H, Seno M.

Identification of TM9SF2 as a candidate of the cell surface marker

common to breast carcinoma cells. Clin Oncol Cancer Res; 2009:6(1)1-9,

ISSN: 1674-5361.

Andersson U, Guo D, Malmer B, Bergenheim AT, Brännström T, Hedman

H, Henriksson R. Epidermal growth factor receptor family (EGFR,

ErbB2-4) in gliomas and meningiomas. Acta Neuropathol; 2004:

108(2)135-142.

Ben-Dor A, Shamir R, Yakhini Z. Clustering gene expression patterns. J

Comput Biol; 1999:6(3-4)281-297.

Chetty C, Vanamala SK, Gondi CS, Dinh DH, Gujrati M, Rao JS. MMP-9

induces CD44 cleavage and CD44 mediated cell migration in glioblastoma

xenograft cells. Cell Signal; 2012:24(2)549-559.

21

Eibl RH, Pietsch T, Moll J, Skroch-Angel P, Heider KH, von Ammon K,

Wiestler OD, Ponta H, Kleihues P, Herrlich P. Expression of variant CD44

epitopes in human astrocytic brain tumors. J Neurooncol; 1995:

26(3)165-170.

Kaaijk P, Troost D, Morsink F, Keehnen RM, Leenstra S, Bosch DA, Pals

ST. Expression of CD44 splice variants in human primary brain tumors. J

Neurooncol; 1995:26(3)185-190.

Kaufman L, Rousseeuw PJ. Finding Groups in Data: An Introduction to

Cluster Analysis. John Wiley & Sons; 1990;ISBN:978-0-471-73578-6,

New York.

Kihato PK, Tokutaka T, Ohkita M, Fujimura K, Kotani K, Kurozawa Y,

Maniwa Y. Spherical and torus SOM approaches to metabolic syndrome

evaluation. Volume 4985 of the series Lecture Notes in Computer Science.

2008. pp 274-284.

MacQueen J. Some Methods for Classification and Analysis of

Multivariate Observations. In: Proceedings of the 5th Berkeley Symposium

on Mathematical Statistics and Probability; 1965:281-297.

Okita M, Tokutaka H, Yoshihara K, Oyabu M. Comparison of spectrum

cluster analysis with PCA and spherical SOM and related issues not

22

amenable to PCA. Advances in Self-Organizing Maps and Learning Vector

Quantization; Volume 295 of the series Advances in Intelligent Systems

and Computing. 2004. pp 239-248.

Pietras A, Katz AM, Ekström EJ, Wee B, Halliday JJ, Pitter KL, Werbeck

JL, Amankulor NM, Huse JT, Holland EC. Osteopontin-CD44 signaling in

the glioma perivascular niche enhances cancer stem cell phenotypes and

promotes aggressive tumor growth. Cell Stem Cell; 2014:14(3)357-369.

Ritter H. Self-organizing maps in non-euclidean spaces. Kohonen Maps.

Oja E, Kaski S (Eds); Amsterdam: Elsevier: 1999. 97-109.

DOI:10.1016/B978-044450270-4/50007-3

Sugihara E, Saya H. Complexity of cancer stem cells. Int. J. Cancer;

2012:132(6)1249-1259.

Sugii Y, Kudoh T, Otani T, Ikeda M, Tokutaka H, Seno M. Clustering

Genes, Tissues, Cells and Bioactive Chemicals by Sphere SOM. Self

Organizing Maps-applications and novel algorithm design edited by JI

Mwasiagi Published by InTech; 2011:pp.371-386. DOI: 10.5772/13926

Tamada M, Nagano O, Tateyama S, Ohmura M, Yae T, Ishimoto T,

Sugihara E, Onishi N, Yamamoto T, Yanagawa H, Suematsu M, Saya H.

Modulation of glucose metabolism by CD44 contributes to antioxidant

23

status and drug resistance in cancer cells. Cancer Res; 2012:

72(6):1438-1448.

Tokutaka H, Yoshihara K, Fujimura K, Iwamoto K, Obu-Cann K.

Application of self-organizing maps (SOM) to auger electron spectroscopy

(AES). Surface and Interface Analysis; 1999:27(8)783-788.

Tuoya, Hirayama K, Nagaoka T, Yu D, Fukuda T, Tada H, Yamada H,

Seno M. Identification of cell surface marker candidates on SV-T2 cells

using DNA microarray on DLC-coated glass. Biochem Biophys Res

Commun; 2005:334(1)263-268.

Tuoya, Sugii Y, Satoh H, Yu D, Matsuura Y, Tokutaka H, Seno M.

Spherical self-organizing map as a helpful tool to identify category-specific

cell surface markers. Biochem Biophys Res Commun; 2008:

376(2)414-418.

Wei KC, Huang CY, Chen PY, Feng LY, Wu TW, Chen SM, Tsai HC, Lu

YJ, Tsang NM, Tseng CK, Pai PC, Shin JW. Evaluation of the prognostic

value of CD44 in glioblastoma multiforme. Anticancer Res; 2010:

30(1):253-259.

Wrensch M, Wiencke JK, Wiemels J, Miike R, Patoka J, Moghadassi M,

McMillan A, Kelsey KT, Aldape K, Lamborn KR, Parsa AT, Sison JD,

24

Prados MD. Serum IgE, tumor epidermal growth factor receptor expression,

and inherited polymorphisms associated with glioma survival. Cancer Res;

2006:66(8)4531-4541.

Yoshida T, Matsuda Y, Naito Z, Ishiwata T. CD44 in human glioma

correlates with histopathological grade and cell migration. Pathol Int;

2012:62(7):463-470.

25

CHAPTERⅡ

A spherical self-organizing map clustering of

human breast cancer cell lines

Abstract

We have been clustering genes by gene expression of profiles of cells and

tissues using spherical self-organizing map (sSOM). Especially, the

screening of genes specific to carcinoma cells has been challenged.

Working on various types of carcinoma cells such as neuroblastomas,

gliomas and breast cancers, we could find interesting cell surface molecules,

which should serve as the molecular target of therapy. This procedure,

which we are demonstrating, is rather new to the data analyses of gene

clustering from the gene expression profiles obtained from DNA

microarray technique. Flexible arrangement of the data obtained allows us

to cluster cells and tissues as well as genes to find definitely fantastic

direction of further advancement of study. In the future we would like to

extend this procedure to apply to the field of drug discovery as well as that

of molecular biology and oncology.

26

Introduction

Due to the rapid progress of molecular biology, many kinds of high

throughput procedures have become available during the decades. As the

results, accumulation of data is extensively growing and growing in the

field of biological science. For example, we can find databases of DNA

sequences, protein sequences and 3D-structure of proteins together with

various annotations at their web sites. Gene expression profiles obtained

through DNA microarray techniques are also accumulating. Although this

kind of data is also freely available at the websites, further data mining is

still being required to understand the data obtained. Only when the data

mining is performed in a satisfactory and successful manner, we should

come to a novel finding or acquire new knowledge. We propose here in this

chapter the application of sSOM to depict comprehensive patterns of gene

expression at a glance to distinguish cells or tissues clustering genes by

their expression levels. It will be extremely easy to pick up some genes

characteristic to the cells or tissues of interest resulting in finding or

proposing new biomarkers. We have employed spherical self-organizing

map (sSOM), which is also a non-hierarchical clustering, to cluster genes

by gene expression profiles of cells and tissues (Tuoya et al.,2008).

Analyzing various types of carcinoma cells and normal tissues, we could

find interesting cell surface molecules, which should serve as the molecular

markers. This procedure, which we are demonstrating, is rather new to the

data analyses of gene clustering from the gene expression profiles obtained

from DNA microarray technique.

27

Flexible arrangement of the data obtained allows us to cluster cells and

tissues as well as genes to find definitely fantastic direction of further

advancement of study.

Materials and Methods

Cell lines and cell culture. Human breast cancer derived cell lines

Hs-578T, MCF-7, MDA-MB-134, MDA-MB-231, SK-BR-3, T-47D and

ZR-75-1 were obtained from American Type Culture Collection (ATCC,

VA). Hs-578T cells were cultured in DMEM containing 10 % fetal bovine

serum (FBS), 10 µg/mL insulin and 2 mM L-glutamine. MCF-7 cells were

cultured in MEM containing 10 % FBS, 10 μg/mL insulin and 2 mM

L-glutamine. MDA-MB-134 cells were cultured in Leibovitz-15 containing

10 % FBS, 2 mM L-glutamine buffered with 10 mM HEPES.

MDAMB-231 cells were cultured in DMEM containing 10 % FBS and 2

mM L-glutamine. SK-BR-3 cells were cultured in RPMI 1640 containing

20 % FBS and 2 mM L-glutamine. T-47D cells cultured in RPMI 1640

containing 10 % FBS, 2 mM L-glutamine, 10 μg/mL insulin and 30 ng/mL

EGF. ZR-75-1 cells were cultured in RPMI 1640 containing 10 % FBS. All

cells were maintained at 37 ˚C in a humidified 5 % CO2 atmosphere except

MDA-MB-134 cells, which were maintained in 100 % air.

Preparation of total RNA and cDNA synthesis. Total RNA was

extracted from the cells used in this study. Cells were harvested at a

confluence of 80% for preparation using RNeasy Mini kits (Qiagen),

28

following the manufacturer’s instructions. Total RNA from human normal

breast was purchased from Stratagene (CA). RNA integrity and purity were

assessed by OD260/280 measurements and by the ratio of 28S and 18S

rRNA with Experion system (BioRad Labs, VA). The total RNA was

further treated with DNase and purified. The integrity of template RNA

was assessed by OD260/280 measurements. Twenty micrograms of total

RNA was used to synthesize cDNA in the presence of aminoalkyl-dUTP.

To monitor the efficiency of cDNA synthesis and hybridization control

RNAs were added in the reaction as describe previously (Tuoya et al.,

2008; Abou-Sharieha et al. 2009). Cy3-labeled cDNAs were prepared by

indirect labeling method adapted from the Brown Web site

(http://cmgm.stanford.edu/pbrown/protocols).

Microarray analysis. We originally proposed DNA microarray, which

focused cell membrane-bound proteins to identify cell surface marker

specific to the cells (Tuoya et al., 2008; Abou-Sharieha et al. 2009).

Microarray was designed to contain 1,795 oligonucleotide probes

corresponding to human genes. These genes were limited to those coding

membrane-bound proteins so as to cover cell surface proteins. To avoid the

effect of alternative splicing, the coding sequence for the membrane-bound

region or GPI-anchor modified region was focused to design the

oligonucleotide probes. The probes were conjugated on the slide glass

coated with diamond-like carbon as described previously (Tuoya et al.,

2005). The Cy3-labeled cDNA synthesized above was hybridized to the

29

cell surface marker DNA microarray in 5x SSC/0.5 % SDS solution at

55 °C for 15 h. After washing, arrays were scanned on a FLA8000 scanner

(Fuji Film, Japan). Intensity for each spot of the array was captured by

GenePix® Pro5.1 image analysis software (Axon Instrument). The

fluorescent intensity of each spot referred as ‘‘relative fluorescent intensity

(RFI)’’, which represented the expression level of each gene. Gene

expression levels were compared to one another by RFI value to identify

differentially expressed genes.

Data filtering in breast cancer cell. In order to eliminate genes that did

not change significantly between cancer cell lines and normal tissue, each

gene was given a score S by a formula:

S = N − C − VC

where N, C and VC denote the expression level of the gene in normal breast,

the average of the expression levels of the gene in the seven cancer cell

lines and the standard deviation of the gene expression level in the seven

cancer cell lines, respectively. Genes were eliminated from further

consideration when S<0 or S=0, since only the genes with a score greater

than a threshold (i.e., zero) are deemed potentially significant (Tuoya et al.,

2008).

sSOM analysis of gene expression. The expression levels of each gene

were normalized among the breast cancer cell lines and normal breast

tissue. First, the maximal RFI value of each gene was taken as 1, the

30

minimum RFI was taken as 0 and other RFI values were linearly calculated

into the values between 0 and 1. Secondly the average expression levels of

each gene were calculated and each average was divided by the maximal

average value. The resultant values were further multiplied to each

normalized value calculated above. The normalized data were clustered and

displayed by sSOM software Cluster Blossom (Ver. 1.0.2, SOM Japan

Co-Ltd., http://www.somj.com/). The training of Cluster Blossom was

performed 50 times. Other parameters were automatically set by the

software. Then the dendrograms were drawn from the final map after

training by group average method with a glyph value 1.0.

Results and discussion

sSOM clustering of human breast cancer cell lines. We performed

DNA microarray gene expression analysis in order to screen genes

commonly and specifically expressed in the seven cell lines derived from

breast cancer when compared to normal breast. As the result of data

filtering, 840 genes were found to suffice the criteria described in “Data

filtering in breast cancer cell”. The expression levels of these genes were

then normalized and clustered by sSOM. The gene expression profiles were

visualized on the sphere surface map and the dendrogram indicating

themselves classified by the origin of the cells (Fig. 1). It is interesting to

note that Hs-578T and MDA-MB-231 cells, which are derived from

basal-like breast cancer known to have poor prognosis, are clustered in the

same group (Ray et al., 2010). T-47D, ZR-75-1, MCF-7 and MDA-MB-

31

134 cells, which are derived from luminal breast cancer, are well known to

have good prognosis. Since SK-BR-3 cells are Her2 positive, which is an

efficient target for the cancer therapy, and derived from breast cancer of

medium level of prognosis. Thus, the gene expression profiles were

successfully visualized by the sSOM clustering, suggesting the clusters of

prognosis. From the patterns, cells derived from luminal breast cancer

appear to be clustered into three groups of “close to normal”, “medium”

and “poorer”. Namely, it might be possible to diagnose SK-BR-3 cells as

“close to normal” while MDA-MB-134 as poorer than the other luminal

derived cells.

In order to find genes highly expressed in all the seven cancer cell lines,

sSOM was performed with an assumptive gene inserted into the dataset of

the 840 genes. The assumptive gene stood for an ideal point (IP), which

was supposed to be expressed in all the breast cancer cell lines analyzed in

this study but not in the normal breast tissue, so that the genes clustered

close to IP should be potential diagnostic markers of breast cancer. In the

result of sSOM clustering, IP was mapped in the red part of the pattern in

all the seven cancer cell lines (Fig. 1) but blue in normal breast tissue.

Since this mapped position of IP is consistent with the assumption, the

genes close to IP should be selected as candidates of cancer-specific genes

on the sSOM. Each spot on the surface of sSOM contains a group of

clustered genes (Fig. 2). The spots mapped close to IP are shown in Fig. 2

and the candidate genes clustered in each spot are listed in Table 1. It is

noteworthy that ErbB3 and ROBO2 have been nominated as potential

32

diagnostic markers here and some reports are found describing their

relationships with breast cancers (Lemoine et al., 1992; Gasparini, 1994;

Quinn et al. 1994 Travis et al., 1996; Naidu et al., 1998; Fogel et al., 1999;

Holbro et al., 2003; Barnes et al., 2005; Schabath et al., 2006; Shiau et al.

2008). MUC1 is also known as a diagnostic marker in various cancers

including breast cancers (Singh et al., 2008). Considering the results that

contain these potential candidates, the other genes listed in Table 1 could

be a potential candidate for the diagnostic marker of breast cancers still

unknown.

Figure 1: The gene expression profiles analyzed by sSOM for cancer derived cell lines

and normal breast. The normalized data set was clustered and visualized by Cluster

Blossom. Each position of genes is fixed on the global surface. The colors indicate the

expression level for each gene. Red, high; yellow, slightly high; white, median; light

blue, slightly low; deep blue, low. See text for the names of cell lines and diagnostic

levels. The alignment of cells is the result of sSOM clustering, which was drawn by

dendrogram.

33

Table 1: Candidate genes for the potential diagnostic marker for breast cancer as picked

up from genes commonly expressed in all the cancer derived cells studied in this paper

Figure 2: The locations of ideal point IP (white spot) clustered by sSOM. This global

surface is the same with those in Fig. 1 without colors. Each gray spot on the surface of

sSOM contains a group of clustered genes, which were depicted with the gene numbers

in red. The genes clustered close to IP are summarized in Table 1

34

Conclusions

In order to characterize cells, gene expression profiling is one of the most

popular procedures nowadays. Through these procedures, identification of

cell surface markers specific to some cells is a key for diagnosing and

molecular targeting. DNA microarray is a high-throughput technology

believed to be a powerful tool to find genes differentially expressed in the

cells or tissues. Although it can provide critically important and useful

information even from one experiment, the amount of data is usually too

large to be handled. Therefore, highly sophisticated software is expected to

support to transform the multidimensional datasets into simple dimensions

or glyphs. For example, visual cues such as shape and color, which make it

comprehensive for researchers to recognize and analyze the patterns hidden

in the datasets. Here we successfully demonstrated cell surface marker

analyses using our DNA microarray coupled with novel sSOM clustering

procedure. The cell surface markers, which are common and specific to

cancer derived cells, are proposed in this study and further assessment is

now underway.

Thus, we conclude sSOM is a powerful tool for data mining, knowledge

discovery and visualization of multidimensional data.

35

References

Abou-Sharieha, S; Sugii, Y; Tuoya; Yu, D; Chen, L; Tokutaka, H & Seno,

M. (2009) Identifi cation of TM9SF2 as a candidate of the cell surface

marker common to breast carcinoma cells. Clin. Oncol. Cancer Res. 6(1),

1-9, ISSN: 1674-5361.

Barnes, N.L.; Khavari, S.; Boland, G.P.; Cramer, A.; Knox, W.F. &

Bundred, N.J. (2005) Absence of HER4 expression predicts recurrence of

ductal carcinoma in situ of the breast. Clin. Cancer Res. 11(6), 2163-2168,

ISSN: 1078-0432.

Ben-Dor, A.; Shamir, R. & Yahkini, Z. (1999) Clustering gene expression

patterns. Journal of Computational Biology, 6(3/4) 281-297, ISSN:

1557-8666.

Fogel, M.; Friederichs, J.; Zeller,Y.; Husar, M.;, Smirnov, A.; Roitman, L.;

Altevogt, P. & Sthoeger, Z.M. (1999) CD24 is a marker for human breast

carcinoma. Cancer Lett. 143(1), 87-94, ISSN: 0304-3835.

Gasparini, G.; Gullick, W.J.; Maluta, S.; Dalla Palma, P.; Caffo, O.;

Leonardi, E.; Boracchi, P.; Pozza, F.; Lemoine, N.R.; & Bevilacqua, P.

(1994) C-erbB-3 and c-erbB-2 protein expression in node-negative breast

carcinoma-an immunocytochemical study. Eur J Cancer, 30A(1), 16-22,

ISSN: 0014-2964.

36

Holbro, T.; Civenni, G.; Hynes, N.E. (2003) The ErbB receptors and their

role in cancer progression. Exp Cell Res. 284(1), 99-110, ISSN:

0014-4827.

Kaufman, L. & Rousseeuw, P.J. (1990) Finding Groups in Data: An

Introduction to Cluster Analysis. John Wiley & Sons, ISBN:

978-0-471-73578-6, New York.

Lemoine, N.R.; Barnes, D.M.; Hollywood, D.P.; Hughes, C.M.;Smith, P.;

Dublin, E.; Prigent, S.A.; Gullick, W.J.;& Hurst HC. (1992) Expression of

the ERBB3 gene product in breast cancer. Br J Cancer 66(6), 1116-1121,

ISSN 0007-0920.

MacQueen, J. (1965) Some methods for classification and analysis of

multivariate observations. In: Proceedings of the 5th Berkeley Symposium

on Mathematical Statistics and Probability, pages 281-297.

Naidu, R.; Yadav, M.; Nair, S. & Kutty, M.K.(1998) Expression of c-erbB3

protein in primary breast carcinomas. Br J Cancer. 78(10), 1385-1390,

ISSN 0007-0920.

Quinn, C.M.; Ostrowski, J.L.; Lane, S.A.; Loney, D.P.; Teasdale, J.,

Benson, F.A. (1994) CerbB- 3 protein expression in human breast cancer:

37

comparison with other tumor variables and survival. Histopathology, 25(3),

247-252, ISSN 0309-0167.

Ray, P.S.; Wang, J.; Qu, Y.; Sim, M.S., Shamonki, J; Bagaria, S.P.; Ye, X.;

Liu, B.; Elashoff, D.; Hoon, D.S.; Walter, M.A.; Martens, J.W.; Richardson,

A.L.; Giuliano, A.E.& Cui, X. (2010) FOXC1 is a potential prognostic

biomarker with functional significance in basal-like breast cancer. Cancer

Res., 70(10), 3870-3786, ISSN 0008-5472.

Schabath, H.; Runz, S.; Joumaa, S. & Altevogt, P. (2006) CD24 affects

CXCR4 function in pre- B lymphocytes and breast carcinoma cells. J Cell

Sci., 119(Pt2), 314-325, ISSN: 0021-9533.

Shiau, C.E.; Lwigale, P.Y.; Das, R.M.; Wilson, S.A.& Bronner-Fraser M.

(2008) Robo2-Slit1 dependent cell-cell interactions mediate assembly of

the trigeminal ganglion. Nat. Neurosci., 11(3), 269-276, ISSN: 1097-6256.

Singh, A.P.; Senapati, S.; Ponnusamy, M.P.;, Jain, M.; Lele, S.M.; Davis,

J.S.; Remmenga, S.&Batra SK. (2008) Clinical potential of mucins in

diagnosis, prognosis, and therapy of ovarian cancer. Lancet Oncol. 9(11),

1076-1085, ISSN: 1470-2045.

Travis, A.; Pinder, S.E.; Robertson, J.F.; Bell, J.A.; Wencyk, P.; Gullick,

W.J.; Nicholson, R.I.; Poller, D.N.; Blamey, R.W.; Elston, C.W. & Ellis,

38

I.O. (1996) C-erbB-3 in human breast carcinoma: expression and relation

to prognosis and established prognostic indicators. Br J Cancer 74(2),

229-233, ISSN 0007-0920.

Tuoya; Hirayama, K; Nagaoka, T; Yu, D; Fukuda, T; Tada, H; Yamada, H.

& Seno M. (2005) Identification of cell surface marker candidates on

SV-T2 cells using DNA microarray on DLC-coated glass. Biochem.

Biophys. Res. Commun. 334(1), 263-268, ISSN: 0006-291X.

Tuoya; Sugii, Y.; Satoh, H.; Yu, D.; Matsuura, Y.; Tokutaka, H. & Seno,

M. (2008) Spherical self-organizing map as a helpful tool to identify

category-specific cell surface markers. Biochem Biophys Res Commun.

376(2), 414-418, ISSN: 0006-291X.

39

ACKNOWLEDGEMENTS

I would like to express my sincere appreciation to my supervisor,

Professor M. Seno, Graduate School of Natural Science and Technology,

Okayama University, for his continuing guidance and suggestions helped

me in all the time of research and manuscript writing.

I greatly appreciate Dr. T. Kasai and Dr. A. Vaidyanath, Graduate School

of Natural Science and Technology, Okayama University, for their valuable

guidance, helpful discussion and warm encouragement.

It is my pleasure to acknowledge all my current and previous colleagues

of Nanobiotechnology Laboratory.

40

APPENDIX

List of human genes.

Oligo

No.

GenBank

Accession No.

Gene Name

1 NM_006411 1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha)

2 NM_006412 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta)

3 NM_020132 1-acylglycerol-3-phosphate O-acyltransferase 3

4 NM_022147 28kD interferon responsive protein

5 NM_000524 5-hydroxytryptamine (serotonin) receptor 1A

6 NM_000863 5-hydroxytryptamine (serotonin) receptor 1B

7 NM_000864 5-hydroxytryptamine (serotonin) receptor 1D

8 NM_000865 5-hydroxytryptamine (serotonin) receptor 1E

9 L05597 5-hydroxytryptamine (serotonin) receptor 1F

10 M86841 5-hydroxytryptamine (serotonin) receptor 2A

11 NM_000867 5-hydroxytryptamine (serotonin) receptor 2B

12 NM_000868 5-hydroxytryptamine (serotonin) receptor 2C

13 BT007204 5-hydroxytryptamine (Serotonin) receptor 3A

14 Y12505 5-hydroxytryptamine (serotonin) receptor 4

15 X81411 5-hydroxytryptamine (serotonin) receptor 5A

16 NM_000871 5-hydroxytryptamine (serotonin) receptor 6

17 L21195 5-hydroxytryptamine (serotonin) receptor 7 (adenylate cyclase-coupled)

18 NM_002526 5'-nucleotidase, ecto (CD73)

19 NM_002390 a disintegrin and metalloproteinase domain 11

20 NM_003474 a disintegrin and metalloproteinase domain 12 (meltrin alpha)

21 NM_003815 a disintegrin and metalloproteinase domain 15 (metargidin)

22 NM_003183 a disintegrin and metalloproteinase domain 17 (tumor necrosis factor, alpha, converting enzyme)


24 NM_023038 a disintegrin and metalloproteinase domain 19 (meltrin beta)

25 NM_001464 a disintegrin and metalloproteinase domain 2 (fertilin beta)








33 AB055891 A disintegrin and metalloproteinase domain 33

34 AF215824 A disintegrin and metalloproteinase domain 7


36 U41766 a disintegrin and metalloproteinase domain 9 (meltrin gamma)

37 NM_003693 acetyl LDL receptor; SREC=scavenger receptor expressed by endothelial cells

38 NM_000020 activin A receptor type II-like 1

39 NM_001105 activin A receptor, type I

40 NM_004302 activin A receptor, type IB

41 NM_001616 activin A receptor, type II

42 NM_001106 activin A receptor, type IIB

43 S56143 adenosine A1 receptor

44 X68486 adenosine A2a receptor

45 NM_000676 adenosine A2b receptor

46 X76981 adenosine A3 receptor

47 L05500 adenylate cyclase 1 (brain)

48 X74210 adenylate cyclase 2 (brain)

49 NM_004036 adenylate cyclase 3

50 D25538 adenylate cyclase 7

51 NM_001115 adenylate cyclase 8 (brain)

52 NM_001116 adenylate cyclase 9

53 NM_001118 adenylate cyclase activating polypeptide 1 (pituitary) receptor type I

54 AF497516 Adenylate cyclase, type IV

55 AF497517 Adenylate cyclase, type V [Fragment]

56 AF250226 Adenylate cyclase, type VI

57 NM_006566 adhesion glycoprotein

58 NM_001179 ADP-ribosyltransferase 3

59 NM_000680 adrenergic, alpha-1A-, receptor

60 NM_000679 adrenergic, alpha-1B-, receptor

61 NM_000678 adrenergic, alpha-1D-, receptor

41

62 AF284095 adrenergic, alpha-2A-, receptor

63 NM_000682 adrenergic, alpha-2B-, receptor

64 NM_000683 adrenergic, alpha-2C-, receptor

65 NM_000684 adrenergic, beta-1-, receptor

66 M15169 adrenergic, beta-2-, receptor, surface

67 NM_000025 adrenergic, beta-3-, receptor

68 NM_007264 adrenomedullin receptor

69 M91211 advanced glycosylation end product-specific receptor

70 NM_004262 airway trypsin-like protease

71 NM_001150 alanyl (membrane) aminopeptidase (aminopeptidase N, aminopeptidase M, microsomal aminopeptidase, CD13, p150)

72 NM_001631 alkaline phosphatase, intestinal

73 NM_000478 alkaline phosphatase, liver/bone/kidney

74 NM_001632 alkaline phosphatase, placental (Regan isozyme)

75 NM_031313 alkaline phosphatase, placental-like 2

76 U08895 Alpha-sarcoglycan

77 AH006302 Alpha-tectorin

78 NM_001094 amiloride-sensitive cation channel 1, neuronal (degenerin)

79 NM_001095 amiloride-sensitive cation channel 2, neuronal

80 NM_004769 amiloride-sensitive cation channel 3, testis

81 NM_003734 amine oxidase, copper containing 3 (vascular adhesion protein 1)

82 NM_030943 amnionless protein

83 M30704 amphiregulin (schwannoma-derived growth factor)

84 U62540 anaplastic lymphoma kinase (Ki-1)

85 NM_016108 androgen induced protein

86 A00914 angiotensin I converting enzyme (peptidyl-dipeptidase A) 1

87 NM_004835 angiotensin receptor 1

88 NM_000686 angiotensin receptor 2

89 NM_005161 angiotensin receptor-like 1

90 J04144 Angiotensin-converting enzyme, somatic isoform [Precursor]

91 NM_019847 ankylosis, progressive homolog

92 NM_007332 ankyrin-like with transmembrane domains 1

93 NM_002414 antigen identified by monoclonal antibodies 12E7, F21 and O13

94 NM_005944 antigen identified by monoclonal antibody MRC OX-2

95 NM_020547 anti-Mullerian hormone receptor, type II

96 NM_000385 aquaporin 1 (channel-forming integral protein, 28kD)

97 NM_000486 aquaporin 2 (collecting duct)

98 NM_004925 aquaporin 3

99 U34846 aquaporin 4




103 AB008775 aquaporin 9

104 AB066105 Aquaporin-10



107 NM_001629 arachidonate 5-lipoxygenase-activating protein

108 NM_000706 arginine vasopressin receptor 1A

109 NM_000707 arginine vasopressin receptor 1B

110 NM_000054 arginine vasopressin receptor 2 (nephrogenic diabetes insipidus)

111 NM_001671 asialoglycoprotein receptor 1

112 NM_001181 asialoglycoprotein receptor 2

113 AB006627 astrotactin

114 AB028944 ATPase class I type 11A

115 AB023173 ATPase class I type 11B

116 AJ580093 ATPase class I type 11C

117 AB032963 ATPase class I type 8B member 2

118 BC035162 ATPase class I type 8B member 3

119 AB075819 ATPase class I type 8B member 4

120 AB014511 ATPase class II type 9A

121 NM_012069 ATPase, (Na+)/K+ transporting, beta 4 polypeptide

122 NM_016529 ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2

123 NM_001682 ATPase, Ca++ transporting, plasma membrane 1

124 L20977 ATPase, Ca++ transporting, plasma membrane 2

125 U57971 ATPase, Ca++ transporting, plasma membrane 3

126 NM_001684 ATPase, Ca++ transporting, plasma membrane 4

127 NM_005603 ATPase, Class I, type 8B, member 1

128 NM_024490 ATPase, Class V, type 10C

129 NM_012463 ATPase, H+ transporting, lysosomal V0 subunit a isoform 2

130 NM_000704 ATPase, H+/K+ exchanging, alpha polypeptide

131 NM_000705 ATPase, H+/K+ exchanging, beta polypeptide

132 NM_001676 ATPase, H+/K+ transporting, nongastric, alpha polypeptide

133 D00099 ATPase, Na+/K+ transporting, alpha 1 polypeptide

134 NM_000702 ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide

42

135 NM_001677 ATPase, Na+/K+ transporting, beta 1 polypeptide

136 NM_001678 ATPase, Na+/K+ transporting, beta 2 polypeptide

137 U51478 ATPase, Na+/K+ transporting, beta 3 polypeptide

138 NM_005502 ATP-binding cassette, sub-family A (ABC1), member 1



141 AY219711 ATP-binding cassette, sub-family A, member 12

142 AH010490 ATP-binding cassette, sub-family A, member 2

143 NM_000927 ATP-binding cassette, sub-family B (MDR/TAP), member 1



146 NM_004996 ATP-binding cassette, sub-family C (CFTR/MRP), member 1

147 U63970 ATP-binding cassette, sub-family C (CFTR/MRP), member 2






153 AF076622 ATP-binding cassette, sub-family C, member 6

154 NM_004827 ATP-binding cassette, sub-family G (WHITE), member 2

155 NM_022169 ATP-binding cassette, sub-family G (WHITE), member 4

156 NM_022436 ATP-binding cassette, sub-family G (WHITE), member 5 (sterolin 1)

157 NM_022437 ATP-binding cassette, sub-family G (WHITE), member 8 (sterolin 2)

158 NM_012070 attractin

159 L35233 autocrine motility factor receptor

160 M76125 AXL receptor tyrosine kinase

161 NM_014143 B7-H1 protein

162 L20471 basigin (OK blood group)

163 NM_001188 BCL2-antagonist/killer 1

164 U17077 BENE protein

165 NM_001729 betacellulin

166 NM_012104 beta-site APP-cleaving enzyme

167 AF312827 Beta-tectorin

168 NM_002589 BH-protocadherin (brain-heart)

169 NM_016564 BM88 antigen

170 NM_001727 bombesin-like receptor 3

171 NM_004334 bone marrow stromal cell antigen 1

172 NM_004335 bone marrow stromal cell antigen 2

173 NM_000710 bradykinin receptor B1

174 NM_000623 bradykinin receptor B2

175 NM_015379 brain protein I3

176 NM_001702 brain-specific angiogenesis inhibitor 1



179 NM_001716 Burkitt lymphoma receptor 1, GTP binding protein

180 U90543 Butyrophilin subfamily 2 member A1

181 AL021917 Butyrophilin subfamily 2 member A3

182 NM_001732 butyrophilin, subfamily 1, member A1





187 NM_006707 butyrophilin-like 3

188 AY358523 Butyrophilin-like protein 8 [Precursor]

189 AY358358 Butyrophilin-like protein 9 [Precursor]

190 Z13009 cadherin 1, type 1, E-cadherin (epithelial)

191 NM_006727 cadherin 10, type 2 (T2-cadherin)

192 NM_001797 cadherin 11, type 2, OB-cadherin (osteoblast)

193 L34057 cadherin 12, type 2 (N-cadherin 2)

194 L34058 cadherin 13, H-cadherin (heart)

195 NM_004933 cadherin 15, M-cadherin (myotubule)

196 NM_004062 cadherin 16, KSP-cadherin

197 NM_004063 cadherin 17, LI cadherin (liver-intestine)

198 NM_004934 cadherin 18, type 2


200 M34064 cadherin 2, type 1, N-cadherin (neuronal)


202 X63629 cadherin 3, type 1, P-cadherin (placental)

203 L34059 cadherin 4, type 1, R-cadherin (retinal)

204 X79981 cadherin 5, type 2, VE-cadherin (vascular epithelium)

205 D31784 cadherin 6, type 2, K-cadherin (fetal kidney)

206 AB035301 cadherin 7, type 2

207 L34060 cadherin 8, type 2

43

208 NM_016279 cadherin 9, type 2 (T1-cadherin)

209 NM_022124 cadherin related 23

210 NM_014246 cadherin, EGF LAG seven-pass G-type receptor 1 (flamingo homolog)

211 D87469 cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog)

212 AB011536 cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog)

213 AL031687 Cadherin-22 [Precursor]

214 AY260901 Cadherin-24 [Precursor]

215 NM_021810 cadherin-like 26

216 L00587 calcitonin receptor

217 NM_005795 calcitonin receptor-like

218 NM_000721 calcium channel, voltage-dependent, alpha 1E subunit

219 NM_005183 calcium channel, voltage-dependent, alpha 1F subunit

220 AF029228 calcium channel, voltage-dependent, alpha 1G subunit

221 NM_021098 calcium channel, voltage-dependent, alpha 1H subunit

222 NM_021096 calcium channel, voltage-dependent, alpha 1I subunit

223 NM_000722 calcium channel, voltage-dependent, alpha 2/delta subunit 1

224 NM_000727 calcium channel, voltage-dependent, gamma subunit 1







231 M94172 calcium channel, voltage-dependent, L type, alpha 1B subunit

232 NM_000719 calcium channel, voltage-dependent, L type, alpha 1C subunit

233 NM_000720 calcium channel, voltage-dependent, L type, alpha 1D subunit

234 NM_000069 calcium channel, voltage-dependent, L type, alpha 1S subunit

235 NM_000068 calcium channel, voltage-dependent, P/Q type, alpha 1A subunit

236 NM_001745 calcium modulating ligand

237 NM_000388 calcium-sensing receptor (hypocalciuric hypercalcemia 1, severe neonatal hyperparathyroidism)

238 NM_015722 calcyon; D1 dopamine receptor-interacting protein

239 NM_024734 calponin like transmembrane domain protein

240 NM_014944 calsyntenin 1

241 NM_022131 calsyntenin 2

242 AJ277460 Calsyntenin-3

243 NM_020994 cancer/testis antigen 2

244 NM_001840 cannabinoid receptor 1 (brain)

245 NM_001841 cannabinoid receptor 2 (macrophage)

246 NM_000717 carbonic anhydrase IV

247 NM_001218 carbonic anhydrase XII

248 NM_012113 carbonic anhydrase XIV

249 U65090 carboxypeptidase D

250 NM_001874 carboxypeptidase M

251 J03858 Carcinoembryonic antigen-related cell adhesion molecule 1

252 NM_001815 carcinoembryonic antigen-related cell adhesion molecule 3


254 NM_002483 carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen)



257 M65212 catechol-O-methyltransferase

258 NM_020246 cation-chloride cotransporter-interacting protein

259 NM_001753 caveolin 1, caveolae protein, 22kD

260 U32114 caveolin 2

261 NM_001234 caveolin 3

262 NM_000591 CD14 antigen


264 M21097 CD19 antigen

265 M28825 CD1A antigen, a polypeptide

266 NM_001764 CD1B antigen, b polypeptide

267 NM_001765 CD1C antigen, c polypeptide

268 NM_001766 CD1D antigen, d polypeptide

269 X14975 CD1E antigen,

270 NM_001767 CD2 antigen (p50), sheep red blood cell receptor


272 NM_014257 CD209 antigen-like


274 NM_013230 CD24 antigen (small cell lung carcinoma cluster 4 antigen)

275 NM_006139 CD28 antigen (Tp44)

276 M23197 CD33 antigen (gp67)


278 M24795 CD36 antigen (collagen type I receptor, thrombospondin receptor)

279 NM_005505 CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 1


44

281 NM_001775 CD38 antigen (p45)

282 NM_000732 CD3D antigen, delta polypeptide (TiT3 complex)

283 NM_000733 CD3E antigen, epsilon polypeptide (TiT3 complex)

284 NM_000073 CD3G antigen, gamma polypeptide (TiT3 complex)

285 NM_000734 CD3Z antigen, zeta polypeptide (TiT3 complex)

286 M12807 CD4 antigen (p55)

287 M59040 CD44 antigen (homing function and Indian blood group system)

288 NM_001777 CD47 antigen (Rh-related antigen, integrin-associated signal transducer)

289 NM_001778 CD48 antigen (B-cell membrane protein)

290 X04391 CD5 antigen (p56-62)


292 NM_001779 CD58 antigen, (lymphocyte function-associated antigen 3)

293 M34671 CD59 antigen p18-20 (antigen identified by monoclonal antibodies 16.3A5, EJ16, EJ30, EL32 and G344)


295 NM_001781 CD69 antigen (p60, early T-cell activation antigen)

296 NM_006137 CD7 antigen (p41)


298 K01144 CD74 antigen (invariant polypeptide of major histocompatibility complex, class II antigen-associated)

299 NM_001783 CD79A antigen (immunoglobulin-associated alpha)

300 M89957 CD79B antigen (immunoglobulin-associated beta)

301 NM_001768 CD8 antigen, alpha polypeptide (p32)

302 NM_004931 CD8 antigen, beta polypeptide 1 (p37)

303 NM_005191 CD80 antigen (CD28 antigen ligand 1, B7-1 antigen)

304 NM_004356 CD81 antigen (target of antiproliferative antibody 1)

305 NM_004233 CD83 antigen (activated B lymphocytes, immunoglobulin superfamily)

306 L25259 CD86 antigen (CD28 antigen ligand 2, B7-2 antigen)

307 M38690 CD9 antigen (p24)


309 NM_001803 CDW52 antigen (CAMPATH-1 antigen)

310 AF002246 cell adhesion molecule with homology to L1CAM (close homolog of L1)

311 NM_016056 CGI-119 protein






317 NM_005283 chemokine (C motif) XC receptor 1

318 D10925 chemokine (C-C motif) receptor 1

319 U03882 chemokine (C-C motif) receptor 2

320 NM_001837 chemokine (C-C motif) receptor 3







327 NM_016557 chemokine (C-C motif) receptor-like 1

328 NM_003965 chemokine (C-C motif) receptor-like 2

329 NM_001337 chemokine (C-X3-C) receptor 1

330 NM_022059 chemokine (C-X-C motif) ligand 16

331 D10924 chemokine (C-X-C motif), receptor 4 (fusin)

332 NM_001296 chemokine binding protein 2

333 NM_016326 chemokine-like factor 1

334 AY174118 Chemokine-like factor super family member 1

335 AF479260 Chemokine-like factor super family member 2







342 NM_004072 chemokine-like receptor 1

343 NM_000083 chloride channel 1, skeletal muscle (Thomsen disease, autosomal dominant)

344 NM_004366 chloride channel 2


346 X91906 chloride channel 5 (nephrolithiasis 2, X-linked, Dent disease)


348 Z67743 chloride channel 7

349 NM_004070 chloride channel Ka

350 NM_000085 chloride channel Kb

351 NM_000730 cholecystokinin A receptor

352 NM_000731 cholecystokinin B receptor

353 NM_000738 cholinergic receptor, muscarinic 1

45





358 NM_000079 cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle)

359 NM_020402 cholinergic receptor, nicotinic, alpha polypeptide 10

360 NM_000742 cholinergic receptor, nicotinic, alpha polypeptide 2 (neuronal)




364 U62435 cholinergic receptor, nicotinic, alpha polypeptide 6



367 NM_000747 cholinergic receptor, nicotinic, beta polypeptide 1 (muscle)

368 X53179 cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal)

369 NM_000749 cholinergic receptor, nicotinic, beta polypeptide 3

370 U62439 cholinergic receptor, nicotinic, beta polypeptide 4

371 NM_000751 cholinergic receptor, nicotinic, delta polypeptide

372 NM_000080 cholinergic receptor, nicotinic, epsilon polypeptide

373 NM_005199 cholinergic receptor, nicotinic, gamma polypeptide

374 NM_021948 chondroitin sulfate proteoglycan BEHAB/brevican

375 NM_007015 chondromodulin I precursor

376 NM_004843 class I cytokine receptor

377 NM_021101 claudin 1

378 NM_006984 claudin 10

379 NM_012129 claudin 12

380 NM_012130 claudin 14

381 NM_014343 claudin 15

382 NM_006580 claudin 16

383 NM_012131 claudin 17

384 NM_016369 claudin 18

385 NM_020384 claudin 2

386 NM_001306 claudin 3

387 NM_001305 claudin 4

388 NM_003277 claudin 5 (transmembrane protein deleted in velocardiofacial syndrome)

389 NM_021195 claudin 6

390 NM_012132 claudin 8

391 NM_020982 claudin 9

392 AK096063 Claudin-19

393 AL139101 Claudin-20

394 AK098064 Claudin-22

395 BC016047 Claudin-23

396 AJ011497 Claudin-7

397 NM_001294 cleft lip and palate associated transmembrane protein 1

398 NM_006343 c-mer proto-oncogene tyrosine kinase

399 NM_006678 CMRF35 leukocyte immunoglobulin-like receptor

400 NM_001992 coagulation factor II (thrombin) receptor

401 NM_005242 coagulation factor II (thrombin) receptor-like 1



404 NM_001993 coagulation factor III (thromboplastin, tissue factor)

405 NM_000494 collagen, type XVII, alpha 1

406 X03663 colony stimulating factor 1 receptor, formerly McDonough feline sarcoma viral (v-fms) oncogene homolog

407 NM_006140 colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)

408 NM_000395 colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)

409 NM_000760 colony stimulating factor 3 receptor (granulocyte)

410 Y00816 complement component (3b/4b) receptor 1, including Knops blood group system

411 NM_001877 complement component (3d/Epstein Barr virus) receptor 2

412 NM_012072 complement component 1, q subcomponent, receptor 1

413 NM_004054 complement component 3a receptor 1

414 M62505 complement component 5 receptor 1 (C5a ligand)

415 NM_000587 complement component 7

416 NM_000562 complement component 8, alpha polypeptide

417 NM_000066 complement component 8, beta polypeptide

418 NM_001737 complement component 9

419 NM_030772 connexin 59

420 NM_020660 connexin-36

421 AF014643 connexin46.6

422 X68274 contactin 2 (axonal)

423 NM_014361 contactin 5

424 NM_014461 contactin 6

425 NM_003632 contactin associated protein 1

426 NM_014141 contactin associated protein-like 2

46

427 NM_006587 corin

428 NM_005776 cornichon-like

429 NM_004382 corticotropin releasing hormone receptor 1

430 NM_001883 corticotropin releasing hormone receptor 2

431 NM_001338 coxsackie virus and adenovirus receptor

432 AAE34907 criptin growth factor

433 AF312769 Cryptic

434 NM_022663 CTAGE-1 protein

435 NM_022570 C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 12

436 NM_005127 C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 2 (activation-induced)




440 AY573061 C-type lectin domain family 14 member

441 AY365135 C-type lectin superfamily member 10

442 AK096429 C-type lectin superfamily member 13

443 AF325459 C-type lectin superfamily member 7

444 AY297446 C-type lectin superfamily member 8

445 NM_000087 cyclic nucleotide gated channel alpha 1

446 S76067 cyclic nucleotide gated channel alpha 2

447 NM_001298 cyclic nucleotide gated channel alpha 3

448 NM_019098 cyclic nucleotide gated channel beta 3

449 NM_020377 cysteinyl leukotriene CysLT2 receptor; cDNA: PSEC0146 from clone PLACE1006979

450 NM_006639 cysteinyl leukotriene receptor 1

451 M28668 cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)

452 NM_000397 cytochrome b-245, beta polypeptide (chronic granulomatous disease)

453 U06715 cytochrome b-561

454 NM_022148 cytokine receptor-like factor 2

455 AF414120 Cytotoxic T-lymphocyte protein 4 [Precursor]

456 NM_032936 DC32

457 NM_030788 DC-specific transmembrane protein

458 M30142 decay accelerating factor for complement (CD55, Cromer blood group system)

459 D15057 defender against cell death 1

460 NM_000793 deiodinase, iodothyronine, type II

461 X76132 deleted in colorectal carcinoma

462 NM_005618 delta-like 1

463 U15979 delta-like 1 homolog



466 NM_014058 DESC1 protein

467 NM_003647 diacylglycerol kinase, epsilon (64kD)

468 NM_005137 DiGeorge syndrome critical region gene 2

469 NM_001936 dipeptidylpeptidase VI

470 M60278 diphtheria toxin receptor (heparin-binding epidermal growth factor-like growth factor)

471 X74979 discoidin domain receptor family, member 1

472 NM_006182 discoidin domain receptor family, member 2

473 AK095973 Discoidin, CUB and LCCL domain containing protein 1 [Precursor]

474 AF387547 Discoidin, CUB and LCCL domain containing protein 2 [Precursor]

475 NM_017626 DnaJ (Hsp40) homolog, subfamily B, member 12

476 NM_021071 Dombrock blood group

477 NM_000794 dopamine receptor D1

478 M29066 dopamine receptor D2




482 AF023449 Down syndrome cell adhesion molecule

483 NM_016430 Down syndrome critical region gene 5

484 U01839 Duffy blood group

485 NM_030779 Eag-related gene member 2

486 M55267 ecotropic viral integration site 2A

487 AF060999 Ectodysplasin A

488 NM_021783 ectodysplasin A2 isoform receptor

489 NM_001776 ectonucleoside triphosphate diphosphohydrolase 1

490 AF144748 Ectonucleoside triphosphate diphosphohydrolase 2

491 NM_001248 ectonucleoside triphosphate diphosphohydrolase 3

492 NM_006209 ectonucleotide pyrophosphatase/phosphodiesterase 2 (autotaxin)

493 AF005632 Ectonucleotide pyrophosphatase/phosphodiesterase 3

494 NM_001974 egf-like module containing, mucin-like, hormone receptor-like sequence 1

495 NM_013447 egf-like module containing, mucin-like, hormone receptor-like sequence 2

496 NM_032571 EGF-like module-containing mucin-like receptor EMR3

497 NM_022159 EGF-TM7-latrophilin-related protein

498 NM_000118 endoglin (Osler-Rendu-Weber syndrome 1)

499 NM_016242 endomucin-2

47

500 NM_003775 endothelial differentiation, G-protein-coupled receptor 6

501 NM_001401 endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 2

502 AF011466 endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 4

503 NM_012152 endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 7

504 NM_001400 endothelial differentiation, sphingolipid G-protein-coupled receptor, 1




508 NM_001397 endothelin converting enzyme 1

509 NM_014693 endothelin converting enzyme 2

510 NM_004826 endothelin converting enzyme-like 1

511 L06622 endothelin receptor type A

512 L06623 endothelin receptor type B

513 NM_004767 endothelin type b receptor-like protein 2

514 M18391 EphA1

515 M59371 EphA2

516 NM_005233 EphA3

517 NM_004438 EphA4

518 X95425 EphA5

519 NM_004440 EphA7

520 NM_020526 EphA8

521 L40636 EphB1

522 L41939 EphB2

523 NM_004443 EphB3

524 NM_004444 EphB4

525 NM_004445 EphB6

526 M57730 ephrin-A1

527 AJ007292 Ephrin-A2

528 NM_004952 ephrin-A3

529 NM_005227 ephrin-A4

530 U26403 ephrin-A5

531 U09304 ephrin-B1

532 L38734 ephrin-B2

533 U57001 Ephrin-B3

534 NM_001963 epidermal growth factor (beta-urogastrone)

535 X00588 epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog)

536 NM_001980 epimorphin

537 NM_001432 epiregulin

538 NM_005764 epithelial protein up-regulated in carcinoma, membrane associated protein 17

539 NM_005797 epithelial V-like antigen 1

540 NM_004951 Epstein-Barr virus induced gene 2 (lymphocyte-specific G protein-coupled receptor)

541 NM_021819 ERGL protein; ERGIC-53-like protein

542 NM_016158 erythrocyte transmembrane protein

543 M60459 erythropoietin receptor

544 NM_022034 estrogen regulated gene 1

545 NM_005245 FAT tumor suppressor homolog 1

546 AB011535 FAT tumor suppressor homolog 2

547 NM_002000 Fc fragment of IgA, receptor for

548 NM_002001 Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide

549 NM_004106 Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide

550 NM_002002 Fc fragment of IgE, low affinity II, receptor for (CD23A)

551 M63830 Fc fragment of IgG, high affinity Ia, receptor for (CD64)

552 NM_004001 Fc fragment of IgG, low affinity IIb, receptor for (CD32)

553 M24854 Fc fragment of IgG, low affinity IIIa, receptor for (CD16)

554 NM_004107 Fc fragment of IgG, receptor, transporter, alpha

555 NM_004460 fibroblast activation protein, alpha

556 X66945 fibroblast growth factor receptor 1 (fms-related tyrosine kinase 2, Pfeiffer syndrome)

557 NM_000141 fibroblast growth factor receptor 2

558 M58051 fibroblast growth factor receptor 3 (achondroplasia, thanatophoric dwarfism)

559 L03840 fibroblast growth factor receptor 4

560 NM_013280 fibronectin leucine rich transmembrane protein 1



563 NM_014053 FLVCR protein

564 X51602 fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)

565 U02687 fms-related tyrosine kinase 3

566 U04806 fms-related tyrosine kinase 3 ligand

567 NM_002020 fms-related tyrosine kinase 4

568 M99487 folate hydrolase (prostate-specific membrane antigen) 1

569 NM_000802 folate receptor 1 (adult)

570 J02876 folate receptor 2 (fetal)

571 M95489 follicle stimulating hormone receptor

572 NM_002029 formyl peptide receptor 1

48

573 NM_001462 formyl peptide receptor-like 1

574 NM_002030 formyl peptide receptor-like 2

575 NM_003505 frizzled homolog 1


577 L37882 frizzled homolog 2








585 NM_005031 FXYD domain containing ion transport regulator 1 (phospholemman)

586 AF241236 FXYD domain-containing ion transport regulator 2

587 NM_005971 FXYD domain-containing ion transport regulator 3

588 AI829935 FXYD domain-containing ion transport regulator 4

589 NM_014164 FXYD domain-containing ion transport regulator 5

590 BT006717 FXYD domain-containing ion transport regulator 6

591 BC018619 FXYD domain-containing ion transport regulator 7

592 AL353804 FXYD domain-containing ion transport regulator 8

593 NM_024513 FYVE and coiled-coil domain containing 1

594 NM_006564 G protein-coupled receptor STRL33

595 NM_007369 G protein-coupled receptor RE2

596 NM_005279 G protein-coupled receptor 1








604 L42324 G protein-coupled receptor 18


606 U13667 G protein-coupled receptor 2













619 NM_005302 G protein-coupled receptor 37 (endothelin receptor type B-like)


621 AF034633 G protein-coupled receptor 39

























49













658 M64749 G protein-coupled receptor RDC1 homolog

659 NM_016568 G protein-coupled receptor SALPR; somatostatin and angiotensin-like peptide receptor

660 NM_032503 G protein-coupled receptor slt

661 NM_016235 G protein-coupled receptor, family C, group 1, member B

662 NM_018653 G protein-coupled receptor, family C, group 5, member C

663 NM_018654 G protein-coupled receptor, family C, group 5, member D

664 L34339 galanin receptor 1

665 NM_003857 galanin receptor 2

666 NM_003614 galanin receptor 3

667 NM_000806 gamma-aminobutyric acid (GABA) A receptor, alpha 1






673 NM_000813 gamma-aminobutyric acid (GABA) A receptor, beta 2

674 NM_000814 gamma-aminobutyric acid (GABA) A receptor, beta 3

675 NM_000815 gamma-aminobutyric acid (GABA) A receptor, delta

676 U66661 gamma-aminobutyric acid (GABA) A receptor, epsilon

677 X15376 gamma-aminobutyric acid (GABA) A receptor, gamma 2

678 S82769 gamma-aminobutyric acid (GABA) A receptor, gamma 3

679 U95367 gamma-aminobutyric acid (GABA) A receptor, pi

680 NM_001471 gamma-aminobutyric acid (GABA) B receptor, 1

681 NM_002042 gamma-aminobutyric acid (GABA) receptor, rho 1

682 NM_002043 gamma-aminobutyric acid (GABA) receptor, rho 2

683 NM_018558 gamma-aminobutyric acid (GABA) receptor, theta

684 NM_005265 gamma-glutamyltransferase 1

685 NM_004121 gamma-glutamyltransferase-like activity 1

686 BC034709 Gap junction beta-4 protein (Connexin 30.3)

687 AF503615 Gap junction epsilon-1 protein (Connexin 31.3)

688 NM_000165 gap junction protein, alpha 1, 43kD (connexin 43)

689 AF075290 gap junction protein, alpha 3, 46kD (connexin 46)





694 NM_000166 gap junction protein, beta 1, 32kD (connexin 32, Charcot-Marie-Tooth neuropathy, X-linked)

695 NM_004004 gap junction protein, beta 2, 26kD (connexin 26)

696 AJ004856 gap junction protein, beta 3, 31kD (connexin 31)

697 AF099731 gap junction protein, beta 5 (connexin 31.1)

698 NM_006783 gap junction protein, beta 6 (connexin 30)

699 NM_000164 gastric inhibitory polypeptide receptor

700 NM_005314 gastrin-releasing peptide receptor

701 NM_001495 GDNF family receptor alpha 2



704 NM_003943 genethonin 1

705 NM_000160 glucagon receptor

706 NM_002062 glucagon-like peptide 1 receptor

707 NM_004246 glucagon-like peptide 2 receptor

708 NM_000828 glutamate receptor, ionotrophic, AMPA 3

709 NM_000829 glutamate receptor, ionotrophic, AMPA 4

710 NM_000827 glutamate receptor, ionotropic, AMPA 1

711 L20814 glutamate receptor, ionotropic, AMPA 2

712 NM_001510 glutamate receptor, ionotropic, delta 2

713 NM_000830 glutamate receptor, ionotropic, kainate 1

714 U16126 glutamate receptor, ionotropic, kainate 2



717 NM_000832 glutamate receptor, ionotropic, N-methyl D-aspartate 1

718 NM_000833 glutamate receptor, ionotropic, N-methyl D-aspartate 2A

50

719 U90278 glutamate receptor, ionotropic, N-methyl D-aspartate 2B

720 NM_000836 glutamate receptor, ionotropic, N-methyl D-aspartate 2D

721 U31215 glutamate receptor, metabotropic 1

722 NM_000839 glutamate receptor, metabotropic 2







729 NM_001977 glutamyl aminopeptidase (aminopeptidase A)

730 NM_000171 glycine receptor, alpha 1 (startle disease/hyperekplexia, stiff man syndrome)

731 NM_002063 glycine receptor, alpha 2

732 NM_006529 glycine receptor, alpha 3

733 U33267 glycine receptor, beta

734 NM_002099 glycophorin A (includes MN blood group)

735 NM_002100 glycophorin B (includes Ss blood group)

736 NM_002101 glycophorin C (Gerbich blood group)

737 NM_002102 glycophorin E

738 NM_002510 glycoprotein (transmembrane) nmb

739 NM_001502 glycoprotein 2 (zymogen granule membrane)

740 NM_005512 glycoprotein A repetitions predominant

741 NM_005814 glycoprotein A33 (transmembrane)

742 NM_000173 glycoprotein Ib (platelet), alpha polypeptide

743 NM_000407 glycoprotein Ib (platelet), beta polypeptide

744 NM_000174 glycoprotein IX (platelet)

745 U45956 glycoprotein M6A

746 U45955 glycoprotein M6B

747 NM_004488 glycoprotein V (platelet)

748 NM_004868 glycoprotein, synaptic 2

749 NM_002081 glypican 1

750 BC027972 glypican 2





755 NM_018434 goliath protein

756 NM_000406 gonadotropin-releasing hormone receptor

757 NM_002066 GPI anchored molecule like protein

758 L13698 growth arrest-specific 1

759 NM_000163 growth hormone receptor

760 NM_000823 growth hormone releasing hormone receptor

761 NM_004122 growth hormone secretagogue receptor

762 NM_004963 guanylate cyclase 2C (heat stable enterotoxin receptor)

763 M92432 guanylate cyclase 2D, membrane (retina-specific)

764 L37378 guanylate cyclase 2F, retinal

765 NM_000410 hemochromatosis

766 NM_014799 hephaestin

767 NM_002151 hepsin (transmembrane protease, serine 1)

768 NM_021624 histamine H4 receptor

769 NM_000861 histamine receptor H1

770 NM_007232 histamine receptor H3

771 U07161 HLA class I histocompatibility antigen, A-1 alpha chain

772 M26429 HLA class I histocompatibility antigen, Cw-1 alpha chain

773 M27487 HLA class II histocompatibility antigen, DP alpha chain

774 K00409 HLA class II histocompatibility antigen, SB beta chain [Fragment]

775 NM_006979 HLA class II region expressed gene KE4

776 NM_021160 HLA-B associated transcript 5

777 NM_002127 HLA-G histocompatibility antigen, class I, G

778 NM_018057 homolog of rat orphan transporter v7-3

779 NM_016097 HSPC039 protein

780 NM_020199 HTGN29 protein

781 NM_001523 hyaluronan synthase 1

782 NM_005328 hyaluronan synthase 2

783 U86409 hyaluronan synthase 3

784 U09577 hyaluronoglucosaminidase 2

785 NM_002153 hydroxysteroid (17-beta) dehydrogenase 2

786 NM_016371 hydroxysteroid (17-beta) dehydrogenase 7

787 AF064876 hyperpolarization activated cyclic nucleotide-gated potassium channel 1

788 AJ012582 hyperpolarization activated cyclic nucleotide-gated potassium channel 2

789 NM_005477 hyperpolarization activated cyclic nucleotide-gated potassium channel 4

790 NM_001525 hypocretin (orexin) receptor 1

791 NM_001526 hypocretin (orexin) receptor 2

51

792 NM_019028 hypothetical protein similar to ankyrin repeat-containing priotein AKR1

793 NM_013332 hypoxia-inducible protein 2

794 NM_012092 inducible T-cell co-stimulator

795 M10051 insulin receptor

796 J05046 insulin receptor-related receptor

797 X04434 insulin-like growth factor 1 receptor

798 NM_002219 integral membrane protein 1

799 NM_004867 integral membrane protein 2A

800 NM_021999 integral membrane protein 2B

801 NM_030926 integral membrane protein 3

802 X68742 integrin, alpha 1

803 NM_003637 integrin, alpha 10


805 X17033 integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)

806 NM_000419 integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41B)

807 NM_002204 integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)

808 L12002 integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)

809 X06256 integrin, alpha 5 (fibronectin receptor, alpha polypeptide)

810 X53586 integrin, alpha 6


812 D25303 integrin, alpha 9

813 L25851 integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)

814 NM_002209 integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)

815 J04145 integrin, alpha M (complement component receptor 3, alpha; also known as CD11b)

816 NM_002210 integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51)

817 NM_000887 integrin, alpha X (antigen CD11C (p150), alpha polypeptide)

818 X07979 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)

819 NM_000211 integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1)

820 J02703 integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)

821 NM_000213 integrin, beta 4

822 J05633 integrin, beta 5

823 M35198 integrin, beta 6



826 NM_017625 intelectin

827 NM_000201 intercellular adhesion molecule 1 (CD54), human rhinovirus receptor

828 NM_002162 intercellular adhesion molecule 3

829 NM_001544 intercellular adhesion molecule 4, Landsteiner-Wiener blood group

830 NM_003259 intercellular adhesion molecule 5, telencephalin

831 J03171 interferon (alpha, beta and omega) receptor 1

832 X77722 interferon (alpha, beta and omega) receptor 2

833 J03143 interferon gamma receptor 1

834 U05875 interferon gamma receptor 2 (interferon gamma transducer 1)

835 J04164 interferon induced transmembrane protein 1 (9-27)

836 NM_021034 interferon induced transmembrane protein 3 (1-8U)

837 NM_005532 interferon, alpha-inducible protein 27

838 AF029213 interleukin 1 receptor accessory protein

839 NM_014271 interleukin 1 receptor accessory protein-like 1

840 NM_017416 interleukin 1 receptor accessory protein-like 2

841 NM_000877 interleukin 1 receptor, type I

842 X59770 interleukin 1 receptor, type II

843 NM_003856 interleukin 1 receptor-like 1

844 NM_003854 interleukin 1 receptor-like 2

845 NM_000628 interleukin 10 receptor, beta

846 NM_004512 interleukin 11 receptor, alpha

847 NM_001559 interleukin 12 receptor, beta 2

848 NM_001560 interleukin 13 receptor, alpha 1

849 U70981 interleukin 13 receptor, alpha 2

850 NM_014339 interleukin 17 receptor

851 NM_018725 interleukin 17B receptor

852 NM_003855 interleukin 18 receptor 1

853 NM_003853 interleukin 18 receptor accessory protein


855 M26062 interleukin 2 receptor, beta

856 D11086 interleukin 2 receptor, gamma (severe combined immunodeficiency)



859 M74782 interleukin 3 receptor, alpha (low affinity)


861 X61177 interleukin 5 receptor, alpha

862 M20566 interleukin 6 receptor

863 NM_002184 interleukin 6 signal transducer (gp130, oncostatin M receptor)

864 M29696 interleukin 7 receptor

52

865 M68932 interleukin 8 receptor, alpha

866 NM_001557 interleukin 8 receptor, beta


868 NM_000214 jagged 1 (Alagille syndrome)

869 AF003521 jagged 2

870 NM_007213 JM4 protein

871 NM_006694 jumping translocation breakpoint

872 NM_016946 junctional adhesion molecule 1



875 NM_002231 kangai 1 (suppression of tumorigenicity 6, prostate; CD82 antigen (R2 leukocyte antigen)

876 NM_021083 Kell blood group precursor (McLeod phenotype)

877 NM_015236 KIAA0768 protein



880 NM_020665 kidney-specific membrane protein

881 NM_013289 killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1

882 NM_006737 killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2

883 NM_014514 killer cell immunoglobulin-like receptor, three domains, short cytoplasmic tail, 1

884 NM_014218 killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 1




888 NM_014512 killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 1





893 NM_002259 killer cell lectin-like receptor subfamily C, member 1




897 NM_002262 killer cell lectin-like receptor subfamily D, member 1

898 NM_016523 killer cell lectin-like receptor subfamily F, member 1

899 NM_018240 kin of IRRE like

900 L04947 kinase insert domain receptor (a type III receptor tyrosine kinase)

901 M59964 KIT ligand

902 NM_032045 kringle-containing transmembrane protein; kringle-coding gene marking the eye and the nose

903 M74387 L1 cell adhesion molecule (hydrocephalus, stenosis of aqueduct of Sylvius 1)

904 NM_002299 lactase

905 NM_031211 LAT1-3TM protein

906 NM_012302 latrophilin

907 NM_014921 lectomedin-2

908 L04193 lens intrinsic membrane protein 2 (19kD)

909 U43168 leptin receptor

910 NM_015344 leptin receptor overlapping transcript-like 1

911 NM_018103 leucine-rich repeat-containing 5

912 NM_021634 leucine-rich repeat-containing G protein-coupled receptor 7

913 AF190501 Leucine-rich repeat-containing G-protein coupled receptor 6

914 NM_005575 leucyl/cystinyl aminopeptidase

915 NM_002310 leukemia inhibitory factor receptor

916 NM_006863 leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1

917 NM_006866 leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2

918 NM_006669 leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1





923 X60702 leukocyte tyrosine kinase

924 NM_000752 leukotriene b4 receptor (chemokine receptor-like 1)

925 NM_000897 leukotriene C4 synthase

926 NM_012306 lifeguard

927 NM_002338 limbic system-associated membrane protein

928 AF036905 linker for activation of T cells

929 M35533 lipopolysaccharide binding protein

930 NM_000237 lipoprotein lipase

931 NM_012319 LIV-1 protein, estrogen regulated

932 NM_000527 low density lipoprotein receptor (familial hypercholesterolemia)

933 NM_002333 low density lipoprotein receptor-related protein 3

934 AB011540 low density lipoprotein receptor-related protein 4

935 NM_002335 low density lipoprotein receptor-related protein 5

936 NM_004631 low density lipoprotein receptor-related protein 8, apolipoprotein e receptor

937 X13916 low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor)

53

938 NM_018557 low density lipoprotein-related protein 1B (deleted in tumors)

939 U04441 low density lipoprotein-related protein 2

940 AY358399 Low-density lipoprotein receptor-related protein 10

941 AK027641 Low-density lipoprotein receptor-related protein 11

942 AF074264 Low-density lipoprotein receptor-related protein 6

943 NM_007011 lung alpha/beta hydrolase 2

944 NM_000233 luteinizing hormone/choriogonadotropin receptor

945 NM_005581 Lutheran blood group (Auberger b antigen included)

946 NM_003695 lymphocyte antigen 6 complex, locus D

947 NM_002346 lymphocyte antigen 6 complex, locus E

948 NM_002347 lymphocyte antigen 6 complex, locus H

949 D83597 lymphocyte antigen 64 homolog, radioprotective 105kD

950 NM_002349 lymphocyte antigen 75

951 L42621 lymphocyte antigen 9

952 NM_004829 lymphocyte antigen 94 homolog, activating NK-receptor; NK-p46,

953 NM_004828 lymphocyte antigen 95 (activating NK-receptor; NK-p44)

954 NM_002286 lymphocyte-activation gene 3

955 L11015 lymphotoxin beta (TNF superfamily, member 3)

956 NM_002342 lymphotoxin beta receptor (TNFR superfamily, member 3)

957 NM_020133 lysophosphatidic acid acyltransferase-delta

958 D14696 lysosomal-associated protein transmembrane 4 alpha

959 NM_006344 macrophage lectin 2 (calcium dependent)

960 NM_006770 macrophage receptor with collagenous structure

961 NM_002445 macrophage scavenger receptor 1

962 X70040 macrophage stimulating 1 receptor (c-met-related tyrosine kinase)

963 NM_002116 major histocompatibility complex, class I, A

964 NM_005514 major histocompatibility complex, class I, B

965 M11886 major histocompatibility complex, class I, C

966 NM_005516 major histocompatibility complex, class I, E

967 NM_002119 major histocompatibility complex, class II, DO alpha

968 NM_002120 major histocompatibility complex, class II, DO beta

969 K01171 major histocompatibility complex, class II, DR alpha

970 NM_002124 major histocompatibility complex, class II, DR beta 1

971 NM_012064 major intrinsic protein of lens fiber

972 M15800 mal, T-cell differentiation protein

973 NM_004668 maltase-glucoamylase (alpha-glucosidase)

974 NM_002438 mannose receptor, C type 1

975 NM_004870 mannose-P-dolichol utilization defect 1

976 NM_022077 mannosidase, beta A, lysosomal-like

977 M13150 MAS1 oncogene

978 S78653 mas-related G protein-coupled MRG

979 AY255572 Mas-related G-protein coupled receptor member E [Fragment]

980 BC016964 Mas-related G-protein coupled receptor member F

981 AY255583 Mas-related G-protein coupled receptor member G [Fragment]

982 NM_004995 matrix metalloproteinase 14 (membrane-inserted)

983 Z48482 matrix metalloproteinase 15 (membrane-inserted)

984 D50477 matrix metalloproteinase 16 (membrane-inserted)

985 X89576 matrix metalloproteinase 17 (membrane-inserted)

986 NM_006690 matrix metalloproteinase 24 (membrane-inserted)

987 NM_022468 matrix metalloproteinase 25

988 NM_015166 megalencephalic leukoencephalopathy with subcortical cysts 1

989 NM_005511 melan-A

990 NM_002386 melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor)

991 NM_000529 melanocortin 2 receptor (adrenocorticotropic hormone)

992 NM_019888 melanocortin 3 receptor



995 M28882 melanoma cell adhesion molecule

996 U14108 melatonin receptor 1A

997 NM_005959 melatonin receptor 1B

998 NM_005898 membrane component, chromosome 11, surface marker 1

999 NM_000902 membrane metallo-endopeptidase (neutral endopeptidase, enkephalinase, CALLA, CD10)

1000 AF313620 Membrane progestin receptor alpha

1001 AY424283 Membrane progestin receptor gamma

1002 NM_015884 membrane-bound transcription factor protease, site 2

1003 NM_000139 membrane-spanning 4-domains, subfamily A, member 1

1004 X12530 membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor for; beta polypeptide)



1007 NM_022349 membrane-spanning 4-domains, subfamily A, member 6A


1009 NM_031457 membrane-spanning 4-domains, subfamily A, member 8B

1010 NM_005588 meprin A, alpha (PABA peptide hydrolase)

54

1011 NM_005925 meprin A, beta

1012 J02958 met proto-oncogene (hepatocyte growth factor receptor)

1013 NM_005927 microfibrillar-associated protein 3

1014 NM_032046 mosaic serine protease

1015 NM_002456 mucin 1, transmembrane

1016 NM_017648 mucin 13, epithelial transmembrane

1017 AF258676 Mucin and cadherin-like protein

1018 NM_018298 mucolipin-3

1019 NM_007164 mucosal vascular addressin cell adhesion molecule 1

1020 NM_005592 muscle, skeletal, receptor tyrosine kinase

1021 M29273 myelin associated glycoprotein

1022 U64564 myelin oligodendrocyte glycoprotein

1023 NM_000530 myelin protein zero (Charcot-Marie-Tooth neuropathy 1B)

1024 L08246 myeloid cell leukemia sequence 1 (BCL2-related)

1025 NM_005373 myeloproliferative leukemia virus oncogene

1026 NM_005468 N-acetylated alpha-linked acidic dipeptidase-like; ILEAL DIPEPTIDYLPEPTIDASE

1027 NM_007052 NADPH oxidase 1

1028 NM_022143 NAG14 protein

1029 NM_000906 natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A)

1030 NM_000907 natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide receptor B)

1031 NM_000908 natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)

1032 NM_005601 natural killer cell group 7 sequence

1033 NM_016382 natural killer cell receptor 2B4

1034 NM_007053 natural killer cell receptor, immunoglobulin superfamily member

1035 NM_013436 NCK-associated protein 1

1036 NM_002499 neogenin homolog 1

1037 NM_004646 nephrosis 1, congenital, Finnish type (nephrin)

1038 NM_014625 nephrosis 2, idiopathic, steroid-resistant (podocin)

1039 NM_002507 nerve growth factor receptor (TNFR superfamily, member 16)

1040 NM_014917 netrin G1f

1041 AB058760 Netrin G2

1042 AK131380 Netrin receptor UNC5A

1043 AB096256 Netrin receptor UNC5B

1044 AB055056 Netrin receptor UNC5D

1045 X16841 neural cell adhesion molecule 1

1046 NM_004540 neural cell adhesion molecule 2

1047 NM_015392 neural proliferation, differentiation and control, 1

1048 NM_004883 neuregulin 2

1049 NM_004801 Neurexin 1-alpha

1050 AF064842 Neurexin 1-beta


1052 AC044790 Neurexin 2-beta


1054 AF123462 Neurexin 3-beta

1055 NM_014932 neuroligin 1

1056 NM_018977 neuroligin 3

1057 M73482 neuromedin B receptor

1058 NM_020167 neuromedin U receptor 2

1059 NM_005010 neuronal cell adhesion molecule

1060 NM_014293 neuronal pentraxin receptor

1061 NM_014379 neuronal potassium channel alpha subunit

1062 NM_022146 neuropeptide FF 1; RFamide-related peptide receptor

1063 M88461 neuropeptide Y receptor Y1

1064 NM_000910 neuropeptide Y receptor Y2

1065 NM_006174 neuropeptide Y receptor Y5

1066 NM_006173 neuropeptide Y receptor Y6 (psuedogene)

1067 NM_003873 neuropilin 1

1068 NM_003872 neuropilin 2

1069 NM_002531 neurotensin receptor 1 (high affinity)

1070 NM_012344 neurotensin receptor 2

1071 NM_016522 neurotrimin

1072 U12140 neurotrophic tyrosine kinase, receptor, type 2

1073 U05012 neurotrophic tyrosine kinase, receptor, type 3

1074 AY247409 NFAT activation molecule 1

1075 U72661 ninjurin 1

1076 NM_016533 ninjurin 2

1077 NM_000435 Notch homolog 3

1078 NM_014037 NTT5 protein

1079 NM_002538 occludin

1080 NM_000273 ocular albinism 1 (Nettleship-Falls)

1081 NM_031945 oculospanin

1082 NM_014565 olfactory receptor, family 1, subfamily A, member 1


55

1084 NM_002548 olfactory receptor, family 1, subfamily D, member 2


1086 NM_003554 olfactory receptor, family 1, subfamily E, member 2

1087 NM_012360 olfactory receptor, family 1, subfamily F, member 1

1088 NM_003555 olfactory receptor, family 1, subfamily G, member 1

1089 NM_013941 olfactory receptor, family 10, subfamily C, member 1

1090 NM_013940 olfactory receptor, family 10, subfamily H, member 1



1093 NM_012351 olfactory receptor, family 10, subfamily J, member 1




1097 NM_033057 olfactory receptor, family 2, subfamily B, member 2


1099 NM_012369 olfactory receptor, family 2, subfamily F, member 1


1101 NM_030905 olfactory receptor, family 2, subfamily J, member 2

1102 NM_019897 olfactory receptor, family 2, subfamily S, member 2

1103 NM_030903 olfactory receptor, family 2, subfamily W, member 1




1107 NM_006637 olfactory receptor, family 5, subfamily I, member 1

1108 NM_030876 olfactory receptor, family 5, subfamily V, member 1



1111 NM_030774 olfactory receptor, family 51, subfamily E, member 2





1116 NM_002544 oligodendrocyte myelin glycoprotein

1117 X77130 opiate receptor-like 1

1118 L34774 opioid binding protein/cell adhesion molecule-like

1119 NM_000911 opioid receptor, delta 1

1120 NM_000912 opioid receptor, kappa 1

1121 L25119 opioid receptor, mu 1

1122 NM_020061 opsin 1 (cone pigments), long-wave-sensitive (color blindness, protan)

1123 NM_000513 opsin 1 (cone pigments), medium-wave-sensitive (color blindness, deutan)

1124 NM_001708 opsin 1 (cone pigments), short-wave-sensitive (color blindness, tritan)

1125 NM_033282 opsin 4 (melanopsin)

1126 NM_030958 organic anion transporter polypeptide-related protein 4

1127 NM_020372 organic cation transporter

1128 AF533891 Osteopetrosis associated transmembrane protein 1

1129 NM_004802 otoferlin

1130 NM_015945 ovarian cancer overexpressed 1

1131 NM_002543 oxidised low density lipoprotein (lectin-like) receptor 1

1132 NM_000916 oxytocin receptor

1133 NM_005972 pancreatic polypeptide receptor 1

1134 NM_005705 pan-hematopoietic expression

1135 NM_000316 parathyroid hormone receptor 1

1136 NM_005048 parathyroid hormone receptor 2

1137 U43148 patched homolog

1138 NM_003738 patched homolog 2

1139 NM_000919 peptidylglycine alpha-amidating monooxygenase

1140 D11428 peripheral myelin protein 22

1141 U82970 phosphate regulating gene with homologies to endopeptidases on the X chromosome

1142 NM_003711 phosphatidic acid phosphatase type 2A

1143 NM_003712 phosphatidic acid phosphatase type 2C

1144 NM_004204 phosphatidylinositol glycan, class Q

1145 NM_014754 phosphatidylserine synthase 1

1146 NM_030783 phosphatidylserine synthase 2

1147 NM_002667 phospholamban

1148 NM_021105 phospholipid scramblase 1




1152 NM_007024 PL6 protein

1153 M83246 plasminogen activator, urokinase receptor

1154 NM_015993 plasmolipin

1155 NM_013308 platelet activating receptor homolog

1156 NM_000442 platelet/endothelial cell adhesion molecule (CD31 antigen)

56

1157 D10202 platelet-activating factor receptor

1158 M21574 platelet-derived growth factor receptor, alpha polypeptide

1159 M21616 platelet-derived growth factor receptor, beta polypeptide

1160 NM_002673 plexin B1

1161 NM_005397 podocalyxin-like

1162 NM_006505 poliovirus receptor

1163 AF060231 poliovirus receptor-related 1 (herpesvirus entry mediator C; nectin)

1164 NM_002856 poliovirus receptor-related 2 (herpesvirus entry mediator B)

1165 NM_006071 polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like

1166 U24497 polycystic kidney disease 1 (autosomal dominant)

1167 NM_000297 polycystic kidney disease 2 (autosomal dominant)

1168 S62403 Polymeric-immunoglobulin receptor

1169 NM_022135 popeye protein 2

1170 NM_033272 potassium channel subunit HERG-3

1171 NM_002245 potassium channel, subfamily K, member 1 (TWIK-1)

1172 NM_021161 potassium channel, subfamily K, member 10 (TREK-2)

1173 NM_022055 potassium channel, subfamily K, member 12


1175 NM_022358 potassium channel, subfamily K, member 15 (TASK-5)


1177 AF004711 potassium channel, subfamily K, member 2 (TREK-1)



1180 NM_004823 potassium channel, subfamily K, member 6 (TWIK-2)



1183 U69883 potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1

1184 NM_021614 potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2



1187 NM_002244 potassium inwardly-rectifying channel, subfamily J, inhibitor 1

1188 U12541 potassium inwardly-rectifying channel, subfamily J, member 1

1189 NM_002241 potassium inwardly-rectifying channel, subfamily J, member 10

1190 D50582 potassium inwardly-rectifying channel, subfamily J, member 11

1191 L36069 potassium inwardly-rectifying channel, subfamily J, member 12

1192 AJ006128 potassium inwardly-rectifying channel, subfamily J, member 13









1201 D50312 potassium inwardly-rectifying channel, subfamily J, member 8


1203 NM_016611 potassium inwardly-rectifying channel, subfamily K, member 4

1204 NM_014407 potassium large conductance calcium-activated channel, subfamily M beta member 3

1205 NM_002247 potassium large conductance calcium-activated channel, subfamily M, alpha member 1

1206 U25138 potassium large conductance calcium-activated channel, subfamily M, beta member 1

1207 NM_005832 potassium large conductance calcium-activated channel, subfamily M, beta member 2

1208 NM_014505 potassium large conductance calcium-activated channel, subfamily M, beta member 4

1209 NM_002251 potassium voltage-gated channel, delayed-rectifier, subfamily S, member 1

1210 NM_002252 potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3

1211 NM_000219 potassium voltage-gated channel, Isk-related family, member 1

1212 NM_012282 potassium voltage-gated channel, Isk-related family, member 1-like



1215 NM_000218 potassium voltage-gated channel, KQT-like subfamily, member 1

1216 Y15065 potassium voltage-gated channel, KQT-like subfamily, member 2




1220 NM_004975 potassium voltage-gated channel, Shab-related subfamily, member 1

1221 NM_004770 potassium voltage-gated channel, Shab-related subfamily, member 2

1222 L02750 potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)

1223 NM_005549 potassium voltage-gated channel, shaker-related subfamily, member 10

1224 L02752 potassium voltage-gated channel, shaker-related subfamily, member 2






57

1230 NM_004979 potassium voltage-gated channel, Shal-related subfamily, member 1

1231 AJ010969 potassium voltage-gated channel, Shal-related subfamily, member 2

1232 NM_004980 potassium voltage-gated channel, Shal-related subfamily, member 3

1233 NM_004976 potassium voltage-gated channel, Shaw-related subfamily, member 1



1236 NM_002236 potassium voltage-gated channel, subfamily F, member 1

1237 NM_002237 potassium voltage-gated channel, subfamily G, member 1

1238 NM_012283 potassium voltage-gated channel, subfamily G, member 2

1239 NM_002238 potassium voltage-gated channel, subfamily H (eag-related), member 1



1242 NM_022152 PP1201 protein

1243 NM_000311 prion protein (p27-30) (Creutzfeld-Jakob disease, Gerstmann-Strausler-Scheinker syndrome, fatal familial insomnia)

1244 NM_012409 prion protein 2 (dublet)

1245 NM_014373 Probable G-protein coupled receptor 160

1246 NM_006320 progesterone receptor membrane component 2

1247 NM_005018 programmed cell death 1

1248 NM_025239 programmed death ligand 2

1249 NM_000949 prolactin receptor

1250 NM_000950 proline-rich Gla (G-carboxyglutamic acid) polypeptide 1

1251 NM_000951 proline-rich Gla (G-carboxyglutamic acid) polypeptide 2

1252 AF027208 prominin-like 1

1253 NM_000955 prostaglandin E receptor 1 (subtype EP1), 42kD

1254 NM_000956 prostaglandin E receptor 2 (subtype EP2), 53kD

1255 S69200 prostaglandin E receptor 3 (subtype EP3)

1256 L25124 prostaglandin E receptor 4 (subtype EP4)

1257 AF010316 prostaglandin E synthase

1258 NM_000959 prostaglandin F receptor (FP)

1259 NM_000960 prostaglandin I2 (prostacyclin) receptor (IP)

1260 NM_005672 prostate stem cell antigen

1261 NM_006799 protease, serine, 21 (testisin)

1262 NM_002772 protease, serine, 7 (enterokinase)

1263 NM_002773 protease, serine, 8 (prostasin)

1264 NM_006404 protein C receptor, endothelial (EPCR)

1265 NM_019848 Protein P3

1266 NM_002711 protein phosphatase 1, regulatory (inhibitor) subunit 3A

1267 NM_004648 protein tyrosine phosphatase, non-receptor type substrate 1

1268 NM_002836 protein tyrosine phosphatase, receptor type, A

1269 NM_002837 protein tyrosine phosphatase, receptor type, B

1270 Y00638 protein tyrosine phosphatase, receptor type, C

1271 NM_002839 protein tyrosine phosphatase, receptor type, D

1272 NM_006504 protein tyrosine phosphatase, receptor type, E

1273 Y00815 protein tyrosine phosphatase, receptor type, F

1274 L09247 protein tyrosine phosphatase, receptor type, G

1275 D15049 protein tyrosine phosphatase, receptor type, H

1276 NM_002843 protein tyrosine phosphatase, receptor type, J

1277 NM_002844 protein tyrosine phosphatase, receptor type, K

1278 NM_002845 protein tyrosine phosphatase, receptor type, M

1279 U66702 protein tyrosine phosphatase, receptor type, N polypeptide 2

1280 NM_002848 protein tyrosine phosphatase, receptor type, O

1281 NM_002849 protein tyrosine phosphatase, receptor type, R

1282 NM_002850 protein tyrosine phosphatase, receptor type, S

1283 AB006621 protein tyrosine phosphatase, receptor type, T

1284 NM_005704 protein tyrosine phosphatase, receptor type, U

1285 M93426 protein tyrosine phosphatase, receptor-type, Z polypeptide 1

1286 NM_002668 proteolipid protein 2 (colonic epithelium-enriched)

1287 M17085 proteolipid protein1 (Pelizaeus-Merzbacher disease, spastic paraplegia 2, uncomplicated)

1288 NM_002587 protocadherin 1 (cadherin-like 1)

1289 AB037821 Protocadherin 10

1290 AY029205 Protocadherin 15

1291 NM_014459 protocadherin 17




1295 R38168 protocadherin 9

1296 NM_018900 protocadherin alpha 1







58







1309 NM_018898 protocadherin alpha subfamily C, 1

1310 NM_018899 protocadherin alpha subfamily C, 2

1311 NM_013340 protocadherin beta 1















1326 NM_018912 protocadherin gamma subfamily A, 1












1338 NM_018922 protocadherin gamma subfamily B, 1






1344 NM_002588 protocadherin gamma subfamily C, 3



1347 NM_017675 protocadherin LKC

1348 X12949 Proto-oncogene tyrosine-protein kinase receptor ret

1349 NM_016145 PTD008 protein

1350 NM_014051 PTD011 protein

1351 U33635 PTK7 protein tyrosine kinase 7

1352 AF000546 purinergic receptor (family A group 5)

1353 X83688 purinergic receptor P2X, ligand-gated ion channel, 1

1354 NM_012226 purinergic receptor P2X, ligand-gated ion channel, 2

1355 Y07683 purinergic receptor P2X, ligand-gated ion channel, 3





1360 NM_022788 Purinergic receptor P2Y, G protein-coupled, 12

1361 NM_002563 purinergic receptor P2Y, G-protein coupled, 1



1364 NM_018674 putative acid-sensing ion channel

1365 NM_022089 putative ATPase

1366 NM_020389 putative capacitative calcium channel

1367 D10923 putative chemokine receptor; GTP-binding protein

1368 NM_007223 putative G protein coupled receptor

1369 M76676 putative leukocyte platelet-activating factor receptor

1370 NM_003967 putative neurotransmitter receptor

1371 AF000545 Putative P2Y purinoceptor 10

1372 NM_032553 Putative P2Y purinoceptor FKSG79

1373 NM_003876 putative receptor protein

1374 NM_006858 putative T1/ST2 receptor binding protein

1375 NM_012342 putative transmembrane protein

59

1376 NM_002565 pyrimidinergic receptor P2Y, G-protein coupled, 4

1377 NM_004154 pyrimidinergic receptor P2Y, G-protein coupled, 6

1378 NM_005855 receptor (calcitonin) activity modifying protein 1



1381 NM_004560 receptor tyrosine kinase-like orphan receptor 2

1382 NM_018092 reserved

1383 NM_023004 reticulon 4 receptor

1384 NM_000322 retinal degeneration, slow (retinitis pigmentosa 7)

1385 NM_002921 retinal G protein coupled receptor

1386 NM_000327 retinal outer segment membrane protein 1

1387 NM_006583 retinal pigment epithelium-derived rhodopsin homolog

1388 NM_002888 retinoic acid receptor responder (tazarotene induced) 1

1389 NM_021111 reversion-inducing-cysteine-rich protein with kazal motifs

1390 AL136826 RGM domain family member A

1391 BC067736 RGM domain family member B

1392 AY372521 RGM domain family member C

1393 NM_016124 Rhesus blood group, D antigen

1394 NM_000324 Rhesus blood group-associated glycoprotein

1395 NM_000539 rhodopsin (opsin 2, rod pigment) (retinitis pigmentosa 4, autosomal dominant)

1396 NM_003961 rhomboid, veinlet-like 1

1397 AF040990 Roundabout homolog 1

1398 AY509035 Roundabout homolog 3

1399 AF040991 roundabout, axon guidance receptor, homolog 2

1400 NM_000540 ryanodine receptor 1 (skeletal)

1401 NM_001035 ryanodine receptor 2 (cardiac)

1402 NM_001036 ryanodine receptor 3

1403 NM_002958 RYK receptor-like tyrosine kinase

1404 U01160 sarcoma amplified sequence

1405 AB052951 Scavenger receptor class F member 2

1406 NM_003004 secreted and transmembrane 1

1407 NM_002980 secretin receptor

1408 NM_004866 secretory carrier membrane protein 1



1411 NM_021115 seizure related 6 homolog (mouse)-like

1412 M30640 selectin E (endothelial adhesion molecule 1)

1413 NM_000655 selectin L (lymphocyte adhesion molecule 1)

1414 NM_003005 selectin P (granule membrane protein 140kD, antigen CD62)

1415 NM_003006 selectin P ligand

1416 NM_003612 sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A

1417 NM_006378 sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D

1418 NM_004263 sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F

1419 NM_020796 sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A

1420 NM_020241 sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B

1421 NM_030913 sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C

1422 U78095 serine protease inhibitor, Kunitz type, 2

1423 NM_016372 seven transmembrane domain orphan receptor

1424 NM_006326 seven transmembrane domain protein

1425 NM_016551 seven transmembrane protein TM7SF3

1426 NM_019839 seven transmembrane receptor BLTR2; leukotriene B4 receptor BLT2

1427 NM_017514 SEX gene

1428 NM_004753 short-chain dehydrogenase/reductase 1

1429 AF310233 Sialic acid binding Ig-like lectin 10

1430 NM_003830 sialic acid binding Ig-like lectin 5




1434 AF282256 Sialic acid binding Ig-like lectin-like 1

1435 NM_023068 sialoadhesin

1436 J04536 sialophorin (gpL115, leukosialin, CD43)

1437 NM_003037 signaling lymphocytic activation molecule

1438 NM_006065 signal-regulatory protein beta 1

1439 NM_018556 signal-regulatory protein beta 2

1440 NM_006928 silver homolog

1441 NM_012449 six transmembrane epithelial antigen of the prostate

1442 AJ306388 SLAM family member 6

1443 AF291815 SLAM family member 7

1444 AF146761 SLAM family member 8

1445 NM_020123 SM-11044 binding protein

1446 NM_002996 small inducible cytokine subfamily D (Cys-X3-Cys), member 1 (fractalkine, neurotactin)

1447 U84401 smoothened homolog

1448 NM_001038 sodium channel, nonvoltage-gated 1 alpha

60

1449 NM_002978 sodium channel, nonvoltage-gated 1, delta

1450 NM_001039 sodium channel, nonvoltage-gated 1, gamma

1451 NM_001037 sodium channel, voltage-gated, type I, beta polypeptide

1452 NM_021007 sodium channel, voltage-gated, type II, alpha 2 polypeptide

1453 NM_004588 sodium channel, voltage-gated, type II, beta polypeptide

1454 NM_002977 sodium channel, voltage-gated, type IX, alpha polypeptide

1455 M77235 sodium channel, voltage-gated, type V, alpha polypeptide (long (electrocardiographic) QT syndrome 3)

1456 NM_002976 sodium channel, voltage-gated, type VI, alpha polypeptide

1457 NM_006514 sodium channel, voltage-gated, type X, alpha polypeptide

1458 NM_014139 sodium channel, voltage-gated, type XII, alpha polypeptide

1459 NM_013356 solute carrier 16 (monocarboxylic acid transporters), member 8

1460 NM_004171 solute carrier family 1 (glial high affinity glutamate transporter), member 2

1461 NM_004172 solute carrier family 1 (glial high affinity glutamate transporter), member 3

1462 L14595 solute carrier family 1 (glutamate/neutral amino acid transporter), member 4

1463 NM_005071 solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6

1464 U03506 solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1

1465 NM_005628 solute carrier family 1 (neutral amino acid transporter), member 5

1466 NM_003049 solute carrier family 10 (sodium/bile acid cotransporter family), member 1

1467 NM_000452 solute carrier family 10 (sodium/bile acid cotransporter family), member 2

1468 L32185 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 1

1469 AB004857 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2

1470 NM_014585 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 3

1471 NM_005072 solute carrier family 12 (potassium/chloride transporters), member 4



1474 NM_000339 solute carrier family 12 (sodium/chloride transporters), member 3

1475 NM_000338 solute carrier family 12 (sodium/potassium/chloride transporters), member 1

1476 NM_001046 solute carrier family 12 (sodium/potassium/chloride transporters), member 2

1477 NM_020708 solute carrier family 12, (potassium-chloride transporter) member 5

1478 NM_012450 solute carrier family 13 (sodium/sulfate symporters), member 4

1479 NM_003984 solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2

1480 NM_022829 solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3

1481 NM_015865 solute carrier family 14 (urea transporter), member 1 (Kidd blood group)

1482 NM_007163 solute carrier family 14 (urea transporter), member 2

1483 S78203 solute carrier family 15 (H+/peptide transporter), member 2

1484 U13173 solute carrier family 15 (oligopeptide transporter), member 1

1485 L31801 solute carrier family 16 (monocarboxylic acid transporters), member 1

1486 NM_006517 solute carrier family 16 (monocarboxylic acid transporters), member 2 (putative transporter)

1487 NM_004207 solute carrier family 16 (monocarboxylic acid transporters), member 3





1492 NM_005074 solute carrier family 17 (sodium phosphate), member 1



1495 NM_003056 solute carrier family 19 (folate transporter), member 1

1496 K03195 solute carrier family 2 (facilitated glucose transporter), member 1

1497 NM_030777 solute carrier family 2 (facilitated glucose transporter), member 10


1499 J03810 solute carrier family 2 (facilitated glucose transporter), member 2

1500 M20681 solute carrier family 2 (facilitated glucose transporter), member 3



1503 NM_003039 solute carrier family 2 (facilitated glucose/fructose transporter), member 5

1504 NM_014580 solute carrier family 2, (facilitated glucose transporter) member 8

1505 NM_013272 solute carrier family 21 (organic anion transporter), member 11







1512 NM_005630 solute carrier family 21 (prostaglandin transporter), member 2

1513 AJ001417 solute carrier family 22 (extraneuronal monoamine transporter), member 3

1514 AF057039 solute carrier family 22 (organic anion transporter), member 6

1515 NM_002555 solute carrier family 22 (organic cation transporter), member 1-like

1516 NM_003059 solute carrier family 22 (organic cation transporter), member 4

1517 NM_003060 solute carrier family 22 (organic cation transporter), member 5

1518 NM_005116 solute carrier family 23 (nucleobase transporters), member 1

1519 NM_005847 solute carrier family 23 (nucleobase transporters), member 2

1520 NM_004727 solute carrier family 24 (sodium/potassium/calcium exchanger), member 1


61


1523 U14528 solute carrier family 26 (sulfate transporter), member 2

1524 NM_000111 solute carrier family 26, member 3


1526 NM_004213 solute carrier family 28 (sodium-coupled nucleoside transporter), member 1

1527 NM_004212 solute carrier family 28 (sodium-coupled nucleoside transporter), member 2

1528 NM_004955 solute carrier family 29 (nucleoside transporters), member 1

1529 NM_002394 solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2

1530 NM_000341 solute carrier family 3 (cystine, dibasic and neutral amino acid transporters), member 1

1531 NM_021194 solute carrier family 30 (zinc transporter), member 1


1533 NM_001859 solute carrier family 31 (copper transporters), member 1

1534 NM_001860 solute carrier family 31 (copper transporters), member 2


1536 NM_005660 solute carrier family 35 (UDP-galactose transporter), member 2

1537 NM_018964 solute carrier family 37 (glycerol-3-phosphate transporter), member 1



1540 NM_000342 solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)

1541 NM_003040 solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)

1542 NM_005070 solute carrier family 4, anion exchanger, member 3

1543 NM_032034 solute carrier family 4, sodium bicarbonate transporter-like, member 11

1544 NM_021815 solute carrier family 5 (choline transporter), member 7

1545 NM_006933 solute carrier family 5 (inositol transporters), member 3

1546 NM_014227 solute carrier family 5 (low affinity glucose cotransporter), member 4

1547 NM_000453 solute carrier family 5 (sodium iodide symporter), member 5

1548 NM_000343 solute carrier family 5 (sodium/glucose cotransporter), member 1

1549 M95549 solute carrier family 5 (sodium/glucose cotransporter), member 2

1550 NM_021095 solute carrier family 5 (sodium-dependent vitamin transporter), member 6

1551 NM_007231 solute carrier family 6 (neurotransmitter transporter), member 14

1552 NM_003044 solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12

1553 NM_005629 solute carrier family 6 (neurotransmitter transporter, creatine), member 8

1554 M95167 solute carrier family 6 (neurotransmitter transporter, dopamine), member 3

1555 NM_003042 solute carrier family 6 (neurotransmitter transporter, GABA), member 1

1556 S75989 solute carrier family 6 (neurotransmitter transporter, GABA), member 11

1557 NM_016615 solute carrier family 6 (neurotransmitter transporter, GABA), member 13

1558 NM_004211 solute carrier family 6 (neurotransmitter transporter, glycine), member 5

1559 S70609 solute carrier family 6 (neurotransmitter transporter, glycine), member 9

1560 S80071 solute carrier family 6 (neurotransmitter transporter, L-proline), member 7

1561 NM_001043 solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2

1562 X70697 solute carrier family 6 (neurotransmitter transporter, serotonin), member 4

1563 Z18956 solute carrier family 6 (neurotransmitter transporter, taurine), member 6

1564 NM_003045 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1


1566 AJ000730 solute carrier family 7 (cationic amino acid transporter, y+ system), member 4

1567 AF077866 solute carrier family 7 (cationic amino acid transporter, y+ system), member 5





1572 NM_017965 solute carrier family 7, (cationic amino acid transporter, y+ system) member 10

1573 NM_014331 solute carrier family 7, (cationic amino acid transporter, y+ system) member 11

1574 NM_021097 solute carrier family 8 (sodium/calcium exchanger), member 1

1575 M81768 solute carrier family 9 (sodium/hydrogen exchanger), isoform 1 (antiporter, Na+/H+, amiloride sensitive)

1576 U28043 solute carrier family 9 (sodium/hydrogen exchanger), isoform 3

1577 NM_004594 solute carrier family 9 (sodium/hydrogen exchanger), isoform 5

1578 NM_001049 somatostatin receptor 1

1579 M81830 somatostatin receptor 2




1583 NM_003105 sortilin-related receptor, L(DLR class) A repeats-containing

1584 S67798 sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)

1585 NM_003080 sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase)

1586 NM_032038 spinster-like protein

1587 NM_015136 stabilin 1

1588 NM_017564 stabilin-2

1589 NM_003498 stannin

1590 NM_003156 stromal interaction molecule 1

1591 NM_001041 sucrase-isomaltase

1592 NM_018969 super conserved receptor expressed in brain 3

1593 NM_013437 suppression of tumorigenicity

1594 NM_021978 suppression of tumorigenicity 14 (colon carcinoma, matriptase, epithin)

62

1595 NM_004711 synaptogyrin 1




1599 X06389 synaptophysin

1600 NM_005639 synaptotagmin I

1601 NM_003180 synaptotagmin V

1602 D38522 Synaptotagmin-11

1603 AB102948 Synaptotagmin-14

1604 AB109022 Synaptotagmin-15

1605 NM_002997 syndecan 1

1606 J04621 syndecan 2 (heparan sulfate proteoglycan 1, cell surface-associated, fibroglycan)

1607 NM_014654 syndecan 3 (N-syndecan)

1608 NM_002999 syndecan 4 (amphiglycan, ryudocan)

1609 NM_014723 syntaphilin

1610 NM_004603 syntaxin 1A (brain)

1611 NM_003163 syntaxin 1B

1612 NM_004177 syntaxin 3A

1613 NM_004604 syntaxin 4A (placental)

1614 NM_004853 syntaxin 8

1615 NM_005816 T cell activation, increased late expression

1616 S62045 tachykinin receptor 1

1617 M57414 tachykinin receptor 2

1618 M89473 tachykinin receptor 3

1619 NM_000116 tafazzin (cardiomyopathy, dilated 3A (X-linked); endocardial fibroelastosis 2; Barth syndrome)

1620 AF494231 Taste receptor type 2 member 38







1627 AY114091 Taste receptor type 2 member 46







1634 NM_019599 taste receptor, type 2, member 1

1635 AF227136 taste receptor, type 2, member 10










1645 NM_006019 T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein a isoform 3

1646 NM_015686 TED protein

1647 L06139 TEK tyrosine kinase, endothelial (venous malformations, multiple cutaneous and mucosal)

1648 NM_022144 tenomodulin protein

1649 X14253 Teratocarcinoma-derived growth factor 1 precursor (Cripto-1 growth factor) (CRGF)

1650 M96956 Teratocarcinoma-derived growth factor 2(Cripto-3 growth factor)

1651 NM_001120 tetracycline transporter-like protein

1652 NM_006675 tetraspan transmembrane 4 super family

1653 NM_012466 tetraspanin TM4-B

1654 NM_000361 thrombomodulin

1655 NM_001061 thromboxane A synthase 1 (platelet, cytochrome P450, subfamily V)

1656 NM_001060 thromboxane A2 receptor

1657 NM_006288 Thy-1 cell surface antigen

1658 NM_033051 thymic stromal co-transporter

1659 Y00406 Thyroid peroxidase

1660 NM_000369 thyroid stimulating hormone receptor

1661 NM_013381 thyrotropin-releasing hormone degrading ectoenzyme

1662 NM_003301 thyrotropin-releasing hormone receptor

1663 NM_032036 TLH29 protein precursor

1664 NM_018676 TMTSP for transmembrane molecule with thrombospondin module

1665 NM_030956 toll-like receptor 10



63





1672 NM_012288 TRAM-like protein

1673 X01060 transferrin receptor (p90, CD71)

1674 NM_003227 transferrin receptor 2

1675 K03222 transforming growth factor, alpha

1676 L11695 transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53kD)

1677 D50683 transforming growth factor, beta receptor II (70-80kD)

1678 L07594 transforming growth factor, beta receptor III (betaglycan, 300kD)

1679 NM_003304 transient receptor potential cation channel, subfamily C, member 1




1683 NM_002420 transient receptor potential cation channel, subfamily M, member 1





1688 NM_018727 transient receptor potential cation channel, subfamily V, member 1




1692 NM_012338 transmembrane 4 superfamily member (tetraspan NET-2)

1693 NM_012339 transmembrane 4 superfamily member (tetraspan NET-7)

1694 M90657 transmembrane 4 superfamily member 1

1695 NM_004615 transmembrane 4 superfamily member 2






1701 NM_003272 transmembrane 7 superfamily member 1 (upregulated in kidney)


1703 NM_024082 transmembrane gamma-carboxyglutamic acid protein 3

1704 NM_024081 transmembrane gamma-carboxyglutamic acid protein 4

1705 NM_005656 transmembrane protease, serine 2

1706 NM_016425 transmembrane protease, serine 4

1707 NM_030770 transmembrane protease, serine 5 (spinesin)

1708 NM_013390 transmembrane protein 2

1709 NM_031440 transmembrane protein 7

1710 NM_021259 transmembrane protein 8 (five membrane-spanning domains)

1711 NM_031925 transmembrane protein induced by tumor necrosis factor alpha

1712 NM_017599 transmembrane protein vezatin

1713 NM_003692 transmembrane protein with EGF-like and two follistatin-like domains 1

1714 NM_016192 transmembrane protein with EGF-like and two follistatin-like domains 2

1715 NM_007180 trehalase (brush-border membrane glycoprotein)

1716 NM_018643 triggering receptor expressed on myeloid cells 1

1717 NM_018965 triggering receptor expressed on myeloid cells 2

1718 X85960 TRK-fused gene

1719 NM_012467 tryptase gamma 1

1720 NM_018153 tumor endothelial marker 8

1721 NM_003810 tumor necrosis factor (ligand) superfamily, member 10

1722 AF019047 tumor necrosis factor (ligand) superfamily, member 11


1724 NM_006573 tumor necrosis factor (ligand) superfamily, member 13b




1728 NM_003326 tumor necrosis factor (ligand) superfamily, member 4 (tax-transcriptionally activated glycoprotein 1, 34kD)

1729 NM_000074 tumor necrosis factor (ligand) superfamily, member 5 (hyper-IgM syndrome)


1731 L08096 tumor necrosis factor (ligand) superfamily, member 7



1734 X01394 tumor necrosis factor (TNF superfamily, member 2)

1735 NM_003844 tumor necrosis factor receptor superfamily, member 10a

1736 AF016268 tumor necrosis factor receptor superfamily, member 10b

1737 AF016267 tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain

1738 AF029761 tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain

1739 NM_003839 tumor necrosis factor receptor superfamily, member 11a, activator of NFKB

1740 NM_003790 tumor necrosis factor receptor superfamily, member 12 (translocating chain-association membrane protein)

64

1741 NM_012452 tumor necrosis factor receptor superfamily, member 13B

1742 NM_003820 tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)

1743 NM_004195 tumor necrosis factor receptor superfamily, member 18


1745 M33294 tumor necrosis factor receptor superfamily, member 1A

1746 M32315 tumor necrosis factor receptor superfamily, member 1B



1749 X60592 tumor necrosis factor receptor superfamily, member 5

1750 M67454 tumor necrosis factor receptor superfamily, member 6




1754 NM_002354 tumor-associated calcium signal transducer 1

1755 NM_002353 tumor-associated calcium signal transducer 2

1756 NM_016639 type I transmembrane protein Fn14

1757 NM_012410 type I transmembrane receptor (seizure-related protein)

1758 NM_003332 TYRO protein tyrosine kinase binding protein

1759 D17517 TYRO3 protein tyrosine kinase

1760 NM_005424 tyrosine kinase with immunoglobulin and epidermal growth factor homology domains

1761 NM_025217 UL16 binding protein 2

1762 NM_024518 UL16 binding protein 3

1763 NM_003728 unc-5 homolog B (C. elegans)

1764 NM_007000 uroplakin 1A

1765 NM_006952 uroplakin 1B

1766 AB000450 vaccinia related kinase 2

1767 NM_003574 VAMP (vesicle-associated membrane protein)-associated protein A (33kD)

1768 NM_004738 VAMP (vesicle-associated membrane protein)-associated protein B and C

1769 NM_004666 vanin 1

1770 NM_004665 vanin 2

1771 NM_018399 vanin 3

1772 M30257 vascular cell adhesion molecule 1

1773 NM_004624 vasoactive intestinal peptide receptor 1

1774 NM_003382 vasoactive intestinal peptide receptor 2

1775 L07868 v-erb-a erythroblastic leukemia viral oncogene homolog 4

1776 M11730 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog

1777 M29366 v-erb-b2 erythroblastic leukemia viral oncogene homolog 3

1778 NM_003383 very low density lipoprotein receptor

1779 U64520 vesicle-associated membrane protein 3 (cellubrevin)

1780 NM_003761 vesicle-associated membrane protein 8 (endobrevin)

1781 AF440756 Vitelliform macular dystrophy 2-like protein 1

1782 AF440757 Vitelliform macular dystrophy 2-like protein 2

1783 AK096459 Vitelliform macular dystrophy 2-like protein 3

1784 AH006947 Vitelliform macular dystrophy protein 2

1785 X06182 v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog

1786 NM_018400 voltage-gated sodium channel beta-3 subunit (scn3b gene)

1787 M34353 v-ros UR2 sarcoma virus oncogene homolog 1

1788 NM_018117 WD40 repeat domain 11 protein

1789 NM_020208 X transporter protein 3

1790 NM_003399 X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound

1791 AC004126 Zona pellucida glycoprotein 1

1792 NM_003460 zona pellucida glycoprotein 2 (sperm receptor)

1793 NM_007155 zona pellucida glycoprotein 3A (sperm receptor)

1794 NM_021186 zona pellucida glycoprotein 4

1795 AL355990 solute carrier family 6 (neurotransmitter transporter), member 17

identification of cell surface markers from...

Documents