1Indian Journal of Medical Microbiology, (2014) 32(2): 143-147

multiple copies (alleles) of the ribosomal operon in their genome increases the possibility that a substantial amount of sequence variation exists in these spacer regions, even among strains of the same species. This diversity represents a powerful tool for the design of specific oligonucleotides for polymerase chain reaction (PCR)‑based detection protocols.[2]

Acinetobacter species consists of strictly aerobic, Gram‑negative coccobacillus, non‑fermentative bacterium, encapsulated, non‑motile, catalase positive, oxidase negative and growing at 20-30°C on usual laboratory culture media. This organism is broadly distributed in soil, water and in the hospital environment and generally considered an opportunistic pathogen in patients.[3‑5] Members of the genus Acinetobacter began to be documented as an important hospital pathogen in the late 1970s, but at that time, it was easily treated as it was susceptible to commonly used antimicrobials.[6,7]

Acinetobacter spp. recently received considerable awareness from the public, scientific and medical communities. In the clinical environment, Acinetobacter baumannii and its close relatives are the species of greatest clinical importance (accounts for about 80% of reported infections) mostly because of its exceptional ability to develop resistance to most currently existing antibiotics, thus to survive in various ranges of environments, including those within health‑care institutions, leading to challenging outbreaks.[8,9] As a hospital pathogen, A. baumannii primarily affects patients in the intensive care unit (ICU), including burn patients, trauma patients and patients requiring mechanical ventilation.[7] A. baumannii

Introduction

In bacteria, 16S and 23S ribosomal ribonucleic acid (rRNA) genes are separated by a spacer region, which is transcribed collectively with the ribosomal genes and therefore is called an internal transcribed spacer(s) (ITS). These genomic regions show a high degree of variability between species, both in their base length and in their sequence.[1] The fact that most bacterial species harbor

Original Article

Identification of Acinetobacter clinical isolates by polymerase chain reaction analysis of 16S‑23S ribosomal ribonucleic acid internal transcribed spacer

*MAA Sarhan, AA Osman, WO Haimour, MN Mohamed, TH Taha, NM Abdalla

AbstractBackground: The genus Acinetobacter is a diverse group of Gram‑negative bacteria involve at least 33 species using the molecular methods. Although the genus Acinetobacter comprises a number of definite bacterial species, some of these species are of clinical importance. Therefore, it is of vital importance to use a method which is able to reliably and efficiently differentiate the numerous Acinetobacter species. Objectives: This study aims to identify Acinetobacter of clinical isolates from Assir region to the species level by 16S‑23S intergenic spacers internal transcribed spacer (ITS) of ribosomal ribonucleic acid (rRNA). Materials and Methods: Deoxyribonucleic acid extraction, polymerase chain reaction amplification of 16S-23S intergenic spacer sequences (ITS) was performed using the bacterium-specific universal primers. Results: Based on the 16S‑23S intergenic spacers (ITS) of rRNA sequences, all isolates tested were identified as Acinetobacter baumannii. The isolates shared a common ancestral lineage with the prototypes A. baumannii U60279 and U60280 with 99% sequence similarities. Conclusion: These findings confirmed 16S-23S rRNA ITS for the identification of A. baumannii of different genotypes among patients.

Key words: 16S-23S ribosomal ribonucleic acid, Acinetobacter baumannii, Assir region, polymerase chain reaction

*Corresponding author (email: <mohammed_sarhan@yahoo.com) Department of Biology (MAAS, THT), College of Science, King Khalid University, Abha 61413, Community Family and Medicine Department (AAO), College of Medicine, King Khalid University, Abha 61421, Department of Community Family & Medicine (WOH), Assir Central Hospital Lab, Abha, Kingdom of Saudi Arabia, Medical internist (MNM) Bashair Hospital, Ministry of Health, Khartoum, Sudan, Department of Environmental Biotechnology (THT), GEBRI-Institute, City for Scientific Research and Technology Applications, New Borg El Arab City, Alexandria, Egypt, Department of Clinical Microbiology and Parasitology (NMA) College of Medicine, King Khalid University, Abha, Saudi Arabia Received: 25‑04‑2013 Accepted: 18‑11‑2013

Access this article onlineQuick Response Code: Website:

www.ijmm.org

PMID: ***

DOI: 10.4103/0255-0857.129797

www.ijmm.org

144 Indian Journal of Medical Microbiology vol. 32, No. 2

as well as its close relatives, belonging to genomic species 3 (“Acinetobacter pittii”) and 13TU (“Acinetobacter nosocomialis”), from what is called the “A. baumannii complex”. These are the three species of the most clinical importance, causing a vast majority of Acinetobacter infections, but they cannot be differentiated by routine diagnostic tests.[10] The members of the complex are very difficult to separate reliably by phenotypic methods alone and frequently are placed into groups or complexes based on biochemical test results. The goal of the present study was to evaluate the use of PCR analysis of 16S‑23S rRNA ITS in the identification of the Acinetobacter among patients.

Materials and Methods

Samples collection

All patients admitted to Assir Central Hospitals General Lab with infections proved to be caused by Acinetobacter spp. by bacteriological investigations were selected during the study period December 2011‑2013. A total of 100 patients were involved in this study, including both sexes and ages (children and adults) with variable nosocomial infections. Nosocomial infections may be defined as any systemic or localized conditions that result from the response by an infectious agent or toxin.[11] Traditionally, a cut‑off of 48 h after admission is used to differentiate between hospital and community acquired infections.[12] Yet, this cut‑off point does not present the patients’ carrier status that can cause the infection. To overcome this problem, a classification based on pathogenesis of infection and the criteria for carrier status were offered.[13] Nosocomial infection include; respiratory tract infections, urinary tract infections, blood stream septicemia and skin sepsis. Aseptic precautions and measures were applied using cleaning with antiseptic of the margins of swab area, wearing gloves and uses of sterile swabs nevertheless no mixed infections were encountered in our samples. The laboratory specimens include; skin and nasal swabs (collected from the nares with a dry (stainless steel), un‑moistened swab, a tip of the collection swab was inserted approximately 2.56 cm into the nares and rolled five times in each nostril), urine (mid-stream urine, 20 ml) and blood (venous blood 5 ml). Collected specimens were transported and stored at room temperature. Clinical data, including the inpatient and out‑patient categories, antibiotics usage and patient’s history of diabetes was registered. Each sample was examined using all bacteriological tests including, gram staining characteristics, fermentation test, catalase and antibiotic sensitivity test. Each sample was cultured in two media (Blood agar and MacConkey agar) for 24 h. Positive Acinetobacter isolates were cultured on nutrient agar plates for molecular analysis. Following the incubation, bacterial colonies were picked with sterile wooden toothpicks, suspended in sterile Milli‑Q and boiled for 5 min. The suspension was then centrifuged at 12,000 rpm for 10 min and the resulting supernatant containing the bacterial deoxyribonucleic acid (DNA) (50 ng) was

used as a template for the polymerase chain reaction (PCR) amplification.

Amplification of ITS region and nucleotide sequence determination

PCR amplification of 16S-23S intergenic spacer sequences (ITS) was performed using the bacterium-specific universal primers 1512F 5`GTCGTAACAAGGTAGCCGTA3` and 6R 5`GGGTTCCCCCRTTCAGAAAT3` (Gene Link Inc., NY, USA). The amplified DNA fragment covered a small fragment of the 16S rRNA gene region, the ITS and a small fragment of the 23S rRNA gene region. The 5′ end of primer 1512F is located at position 1493 of the 16S rRNA gene and the 5′ end of primer 6R is located at position 108 downstream of the 5′ end of the 23S rRNA gene. PCR was performed with 5 μl (5 ng) of template DNA (Acinetobacter isolates and Escherichia coli as control) in a total reaction volume of 25 μl consisting of PCR reaction buffer (10 mM Tris‑HCl (pH 8.8), 50 mM KCl, 1.5 mM MgCl2), 0.8 mM deoxyribonucleoside triphosphates (0.2 mM each), 10 pmol of each primer, and 1 U of Taq DNA polymerase (Qiagen, USA). The PCR program consisted of the following cycles: Initial denaturation at 95°C for 3 min, and 30 cycles of denaturation at 95°C for 1 min, annealing at 55°C for 1 min, extension at 72°C for 1 min and a final extension at 72°C for 5 min using MWG-Biotech Primus 96 Plus Thermal Cycler. The products were visualized in 1% of agarose gel electrophoresis and their sizes were estimated by comparison with a 100 bp DNA ladder (Invitrogen, San Diego, CA). The PCR product was sequenced by Macrogen Inc., (Seoul, Korea). Sequence results from PCR product was aligned and assembled to obtain a complete 16S rRNA consensus. ITS DNA sequences of the isolates along with sequences of known Acinetobacter genospecies prototype strains retrieved from the GeneBank were aligned using were aligned by using molecular evolutionary genetic analysis programs (Mega 5.10), and manually optimized using

Figure 1: Amplification of Acinetobacter spp. with primers 1512F and 6R and separation of the polymerase chain reaction products by 1% agarose gel electrophoresis. Lanes: M, 100-bp deoxyribonucleic acid ladder

Sarhan, et al.: Newly emerged strain of Acinetobacter clinical isolates by PCR

www.ijmm.org

145April-June 2014

GeneDoc (version 2.7). Phylogenetic tree was constructed using the neighbor-joining algorithm, and the resulting tree was displayed using MEGA5.

GeneBank number

ITS sequence data examined in this study was deposited with GeneBank. Accession number is KC237879.1.

Results

The 16S‑23S ITS fragments of clinical isolates were amplified by PCR with primers 1512F and 6R. A single amplicon was observed with an approximate size of 786 bp [Figure 1]. The following sequencing analysis confirmed the identification of A. baumannii. The BLAST program in National Center for Biotechnology Information was used

Figure 2: Alignment of the Acinetobacter spp. isolates 16S‑23S ribosomal ribonucleic acid sequences using GeneDoc 2.7

www.ijmm.org

146 Indian Journal of Medical Microbiology vol. 32, No. 2

to align the 16S‑23S rRNA intergenic spacer sequence of the new isolates with previously published sequences in the public database. ITS sequence analysis showed that there was a strong similarity between the isolates and representative strains of the genus Acinetobacter in gene bank [Figure 2], indicating that 16S‑23S rRNA intergenic spacer sequence data is helpful for bacterial identification. There was only four nucleotide difference of the 16S‑23S ITS sequence between our isolates and A. baumannii ATCC 19606. The percentage of match to GenBank sequence U60279 (A. baumannii), U60280 (Acinetobacter ATCC19004, genomospecies 3), U60281 (Acinetobacter ATCC17903, genomospecies 13), and U60278 (Acinetobacter calcoaceticus, genomospecies 1) was 99.0%, 99.0%, 95.0%, and 92.0%, respectively [Figure 3].

Discussion

The high incidence of nosocomial infections is a vital problem on individual patients as well as on the health care system as observed by an increased morbidity including delayed wound healing, increased exposure to antimicrobial therapy and its possible antagonistic effects, and prolonged hospitalization.[14] Over the past two decades, Acinetobacter species has been associated with nosocomial infection, mainly those occurred in patients hospitalized in ICUs. Many nosocomial outbreaks due to A. baumannii isolates have been reported. The most common sources of infection are derived from respiratory tract, indwelling catheters and wounds. Due to problems in the routine clinical microbiology laboratories in speciation of Acinetobacter species and due to the high conservation of primary and secondary structures within species, rRNA genes (16S, 23S and 5S) are commonly used for bacterial identification several laboratories have investigated the use of PCR to rapidly detect and identify bacterial pathogens.[1,2,15] Accurate identification and typing of bacterial isolates are essential, particularly when determining strains involved in hospital outbreaks. The genome of the A. baumannii isolates is made of a single circular chromosome, accompanied by two plasmids, however the number of plasmids differ depending on the strain.[16] The whole genome size is about 3,976,747 base pairs in which 3454 are used for protein coding.[17] The GC‑content of the three sequences is around 40%, a value corresponding to that reported for other members of the Acinetobacter genus. A. baumannii has several genes that permit it to pick up foreign DNA from its

environment, as well as other microbes and incorporate it into its genome.[18]

In our study, we attempted to use ITS sequences in order to obtain information about the variation occurring among A. baumannii subspecies and strains. When one ITS amplicon was found in all of the subspecies and strains analyzed, the nucleotide sequences showed similarity percentages higher than 98%. This means that the main intraspecies evolutionary divergence is due to the rearrangement of sequence blocks shared by all of the strains rather than to the accumulation of mutations, which would generate strain-specific sequence blocks. It has been proposed that sequence similarity must be below 95% to qualify as evidence of a novel species, suggesting that the new isolate may be another strain of A. baumannii.[19]

Conclusion

The rapid and accurate identification of clinically significant Acinetobacter strains by molecular tools will improve insight into their epidemiology and allow for targeted therapeutic and infection control measures against clinically important strains.

Acknowledgement

This work was supported by a grant (KKU‑MED‑11‑017) from the Deanship of scientific research, King Khalid University, Abha, Saudi Arabia.

References

1. Gürtler V, Stanisich VA. New approaches to typing and identification of bacteria using the 16S-23S rDNA spacer region. Microbiology 1996;142:3‑16.

2. Lee SK, Wang HZ, Law SH, Wu RS, Kong RY. Analysis of the 16S‑23S rDNA intergenic spacers of marine vibrios for species-specific signature DNA sequences. Mar Pollut Bull 2002;44:412‑20.

3. Centers for Disease Control. Acinetobacter in Healthcare Settings. Centers for Disease Control and Prevention, 2012. Available from: http://www.cdc.gov/HAI/organisms/Acinetobacter.html.

4. Baumann P. Isolation of Acinetobacter from soil and water. J Bacteriol 1968;96:39‑42.

5. Baumann P, Doudoroff M, Stanier RY. A study of the Moraxella Group. II. Oxidative‑negative species (genus Acinetobacter). J Bacteriol 1968;95:1520‑41.

6. Camp C. A review of Acinetobacter baumannii as a highly successful pathogen in times of war. Lab Med 2010;41:650-7.

7. Towner KJ. Acinetobacter: An old friend, but a new enemy. J Hosp Infect 2009;73:355‑63.

8. Peleg AY, Seifert H, Paterson DL. Acinetobacter baumannii: Emergence of a successful pathogen. Clin Microbiol Rev 2008;21:538‑82.

9. Cerqueira GM, Peleg AY. Insights into Acinetobacter baumannii pathogenicity. IUBMB Life 2011;63:1055-60.

10. Visca P, Seifert H, Towner KJ. Acinetobacter infection – An emerging threat to human health. IUBMB Life 2011;63:1048‑54.

Figure 3: Phylogenetic tree for the strains of Acinetobacter based on the nucleotide sequences by the neighbor-joining method. The numbers shown next to the nodes indicate percent bootstrap P values of the 500 replicates

Sarhan, et al.: Newly emerged strain of Acinetobacter clinical isolates by PCR

www.ijmm.org

147April-June 2014

11. Horan TC, Andrus M, Dudeck MA. CDC/NHSN surveillance definition of health care-associated infection and criteria for specific types of infections in the acute care setting. Am J Infect Control 2008;36:309‑32.

12. Kayser FH, Bienz KA, Eckert J, Zinkernagel RM. Medical Microbiology. New York: Thieme; 2005.

13. Shankar KR, Brown D, Hughes J, Lamont GL, Losty PD, Lloyd DA, et al. Classification and risk-factor analysis of infections in a surgical neonatal unit. J Pediatr Surg 2001;36:276‑81.

14. Herwaldt LA, Cullen JJ, Scholz D, French P, Zimmerman MB, Pfaller MA, et al. A prospective study of outcomes, healthcare resource utilization, and costs associated with postoperative nosocomial infections. Infect Control Hosp Epidemiol 2006;27:1291‑8.

15. Boyer SL, Flechtner VR, Johansen JR. Is the 16S-23S rRNA internal transcribed spacer region a good tool for use in molecular systematics and population genetics? A case study in cyanobacteria. Mol Biol Evol 2001;18:1057‑69.

16. Iacono M, Villa L, Fortini D, Bordoni R, Imperi F, Bonnal RJ, et al. Whole‑genome pyrosequencing of an epidemic multidrug‑resistant Acinetobacter baumannii strain belonging

How to cite this article: Sarhan M, Osman AA, Haimour WO, Mohamed MN, Taha TH, Abdalla NM. Identification of Acinetobacter clinical isolates by polymerase chain reaction analysis of 16S-23S ribosomal ribonucleic acid internal transcribed spacer. Indian J Med Microbiol 2014;32:143-7.

Source of Support: Grant (KKU-MED-11-017) from the Deanship of scientific research, King Khalid University, Abha, Saudi Arabia, Conflict of Interest: None declared.

to the European clone II group. Antimicrob Agents Chemother 2008;52:2616‑25.

17. A. baumannii genome sequence. Available from: http://www.ncbi.nlm.nih.gov/genome/?term=Acinetobacter+baumannii [Last accessed details 2014 February 5].

18. Smith MG, Gianoulis TA, Pukatzki S, Mekalanos JJ, Ornston LN, Gerstein M, et al. New insights into Acinetobacter baumannii pathogenesis revealed by high‑density pyrosequencing and transposon mutagenesis. Genes Dev 2007;21:601‑14.

19. Amann RI, Ludwig W, Schleifer KH. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol Rev 1995;59:143‑69.

Author Help: Online submission of the manuscripts

Articles can be submitted online from http://www.journalonweb.com. For online submission, the articles should be prepared in two files (first page file and article file). Images should be submitted separately.

1) First Page File: Prepare the title page, covering letter, acknowledgement etc. using a word processor program. All information related to your identity should

be included here. Use text/rtf/doc/pdf files. Do not zip the files.2) Article File: The main text of the article, beginning with the Abstract to References (including tables) should be in this file. Do not include any informa-

tion (such as acknowledgement, your names in page headers etc.) in this file. Use text/rtf/doc/pdf files. Do not zip the files. Limit the file size to 1 MB. Do not incorporate images in the file. If file size is large, graphs can be submitted separately as images, without their being incorporated in the article file. This will reduce the size of the file.

3) Images: Submit good quality color images. Each image should be less than 4096 kb (4 MB) in size. The size of the image can be reduced by decreas-

ing the actual height and width of the images (keep up to about 6 inches and up to about 1800 x 1200 pixels). JPEG is the most suitable file format. The image quality should be good enough to judge the scientific value of the image. For the purpose of printing, always retain a good quality, high resolution image. This high resolution image should be sent to the editorial office at the time of sending a revised article.

4) Legends: Legends for the figures/images should be included at the end of the article file.

View publication statsView publication stats