JOURNAL OF BACTERIOLOGY,0021-9193/99/$04.0010

Aug. 1999, p. 4929–4936 Vol. 181, No. 16

Copyright © 1999, American Society for Microbiology. All Rights Reserved.

Identification of a Gene in Staphylococcus xylosus Encoding aNovel Glucose Uptake Protein

HEIKE FIEGLER,† JOANNIS BASSIAS,‡ IVANA JANKOVIC, AND REINHOLD BRUCKNER*

Mikrobielle Genetik, Universitat Tubingen, D-72076 Tubingen, Germany

Received 26 April 1999/Accepted 9 June 1999

By transposon Tn917 mutagenesis, two mutants of Staphylococcus xylosus were isolated that showed higherlevels of b-galactosidase activity in the presence of glucose than the wild type. Both transposons integrated ina gene, designated glcU, encoding a protein involved in glucose uptake in S. xylosus, which is followed by aglucose dehydrogenase gene (gdh). Glucose-mediated repression of b-galactosidase, a-glucosidase, and b-glu-curonidase activities was partially relieved in the mutant strains, while repression by sucrose or fructoseremained as strong as in the wild type. In addition to the pleiotropic regulatory effect, integration of thetransposons into glcU reduced glucose dehydrogenase activity, suggesting cotranscription of glcU and gdh.Insertional inactivation of the gdh gene and deletion of the glcU gene without affecting gdh expression showedthat loss of GlcU function is exclusively responsible for the regulatory defect. Reduced glucose repression ismost likely the consequence of impaired glucose uptake in the glcU mutant strains. With cloned glcU, anEscherichia coli mutant deficient in glucose transport could grow with glucose as sole carbon source, provideda functional glucose kinase was present. Therefore, glucose is internalized by glcU in nonphosphorylated form.A gene from Bacillus subtilis, ycxE, that is homologous to glcU, could substitute for glcU in the E. coli glucosegrowth experiments and restored glucose repression in the S. xylosus glcU mutants. Three more proteins withhigh levels of similarity to GlcU and YcxE are currently in the databases. It appears that these proteinsconstitute a novel family whose members are involved in bacterial transport processes. GlcU and YcxE are thefirst examples whose specificity, glucose, has been determined.

Carbon catabolite repression (CR) is a ubiquitous regulatoryprocess in microorganisms, whereby the availability of a rapidlymetabolizable carbon source inhibits expression of genes en-coding proteins mainly concerned with the utilization of alter-native carbon sources (47). The mechanisms by which CR isachieved are best understood in Escherichia coli and Bacillussubtilis (48). Studies on CR in Bacillus megaterium (26), Lac-tobacillus pentosus (32), Lactobacillus casei (36), Lactococcuslactis (33), Listeria monocytogenes (2), and Staphylococcus xy-losus (12) suggested common regulatory pathways in AT-richgram-positive bacteria that are distinct from those found inenteric bacteria (48). CR in Bacillus and related organisms ismediated by the catabolite control protein A (CcpA) (23),which binds to operator sites known as catabolite responsiveelements (cre) (25). Contradictory in vitro results have beenreported regarding the effector(s) stimulating the DNA-bind-ing activity of CcpA (16, 20, 27–29, 35, 42). One of the mostimportant CcpA effectors is a phosphorylated form of HPr, thephosphocarrier protein of the phosphoenolpyruvate-depen-dent phosphotransferase system (PTS) (41). Phosphorylationof HPr at a serine residue is carried out by HPr kinase (19, 44),which appears to be the key component in signal transductionleading to CR. In B. subtilis, CcpB and Crh, proteins that aresimilar to CcpA and HPr, respectively, have been implicated inCR (7, 18), but the significance of these findings for otherAT-rich gram-positive organisms is not clear at the moment.

Among metabolizable carbohydrates, glucose is preferred bya number of bacteria. To ensure efficient glucose uptake, sev-eral glucose transport systems are operative in many of theseorganisms. For example, studies with PTS-deficient strains ofB. subtilis, (10), Streptococcus mutans (6, 9), Streptococcus bovis(46), and Staphylococcus aureus (45) indicated that glucose isinternalized by PTS-dependent as well as -independent mech-anisms. Apart from a gene encoding a hexose:H1 symporterfrom B. subtilis (39), no other genes responsible for non-PTSglucose uptake have been identified in these organisms.

We are interested in CR in the AT-rich gram-positive bac-terium S. xylosus (49), a nonpathogenic Staphylococcus that isinvolved in meat fermentations (22). By a transposon mutagen-esis aimed at isolating CR mutants of S. xylosus, a gene wasidentified whose inactivation resulted in a reduction of glu-cose-mediated CR. The inactivated gene was found to encodea non-PTS glucose uptake protein.

MATERIALS AND METHODS

Bacterial strains and plasmid vectors. S. xylosus strains used in this study arelisted in Table 1. Cloning in E. coli was performed by using DH5a[F80dlacZDM15 D(lacZYA-argF) recA1 endA1 hsdR17 supE44 thi-1 gyrA96 relA1deoR]. Heterologous glcU and ycxE expression was tested in E. coli ZSC112 [ptsGptsM glkA] (8) by using the glucose kinase (glkA)-containing plasmid pGRB144(53). B. subtilis 168 (trpC2) served to amplify ycxE. The partial S. xylosus genomiclibrary was constructed with pUC18. With the shuttle vectors pRB473 (5) andpRB474 (13), cloning in S. xylosus and complementation studies were carriedout. Allelic replacements were achieved with the aid of the temperature-sensitiveshuttle plasmids pBT1 and pBT2 and ermB fragments from Tn551 (4). PlasmidpTV1Ts (57) served for the transposon mutagenesis.

Growth media, DNA manipulations, and transformation. DNA manipula-tions, plasmid DNA isolation, Southern blot analysis, transformation of E. coli,and preparation of media and agar plates for bacterial growth were performedaccording to standard procedures. Plasmid DNA was introduced into S. xylosusby electroporation with glycine-treated electrocompetent cells (4). PCR wascarried out with Vent polymerase (New England Biolabs) or rTth DNA Poly-merase, XL (Perkin Elmer). S. xylosus was grown in B-medium consisting of 1%peptone, 0.5% yeast extract, 0.5% NaCl, and 0.1% K2HPO4. To test for catab-olite repression, sugars were added to a final concentration of 25 mM.

* Corresponding author. Mailing address: Mikrobielle Genetik,Universitat Tubingen, Auf der Morgenstelle 28, D-72076 Tubingen,Germany. Phone: 49-7071-2974635. Fax: 49-7071-294634. E-mail ad-dress: reinhold.brueckner@uni-tuebingen.de.

† Present address: Hamatologikum, GSF-Munchen, D-81377 Mu-nich, Germany.

‡ Present address: European Patent Office, D-80331 Munich, Ger-many.

4929

on April 10, 2019 by guest

http://jb.asm.org/

Dow

nloaded from

Transposon mutagenesis. Transposon mutagenesis with Tn917 from pTV1Tswas performed as described previously (14). The six mutants were identified asdark blue colonies on agar plates supplemented with 100 mg of 5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside (X-Gal)/ml, erythromycin (2.5 mg/ml),and glucose (25 mM) after incubation at 37°C for 24 h.

Primers used for PCR and primer extension. The following glcU-gdh-specificprimers were used (the positions refer to the glcU-gdh sequence from accessionno. Y14043): H10, CAGGGATCCCCACTATTACTCTC (142–155); H11, CAGGAATTCGCATGGTCATATCTC (1173–1187); H17, CAGGAATTCGTTATCCTTTACCGCCC (1998–2014); H19, CAGGGTACCGGTAAAGTAGTAGTTATCACAGG (1240–1262); H20, CAGAAGCTTGTTATCCTTTACCGCCCATAAATGC (1990–2014); H30, CAGAAGCTTCCACTATTACTCTC (142–155); H31, CAGGTCGACGCATGGTCATATCTC (1173–1187); H36, CAGGGATCCCACTCTCTATTTGTTTTTCTCCCC (269–292); and H37, GACAAGCTTCCTCCTGCATCAACTGACATTG. Primer H37 hybridized 1.5 kbupstream of glcU, where only partial DNA sequence is available. For the primerextension reaction, the following primer was applied: TCCCTCTAATCTGATTATAAGGACC (384–405).

To clone ycxE, the following primers deduced from the B. subtilis sequenceD50453 (56) were used: BS1, CTAGCATGCACGCTCCTGAAAGC (position123576–123593); BS2, CTCGTCGACTTTTGCCTGCTCCTTGCCG (position124657–124677).

Construction of glcU and ycxE expression plasmids. Plasmid pUD1, contain-ing the glcU-gdh operon on a BamHI-EcoRI fragment, was constructed withprimers H10-H17 and plasmid pRB473. Plasmid pGU1, containing glcU alone,was obtained by using primers H10-H11 and pRB473. Combination of glcU andglkA on plasmid pUK1 was achieved by cloning a HindIII-SalI fragment of glcUobtained with primer pair H30-H31 into pGRB144, the glkA-containing plasmid.

For combining ycxE from B. subtilis with glkA from S. xylosus, primers BS1 andBS2 were applied. Cloning of the amplified SphI-SalI ycxE fragment intopGRB144 yielded pYK1. The ycxE-glkA region was moved as a SphI-KpnI frag-ment into the vegII promoter-containing plasmid pRB474 to yield pYK2. Thecorresponding ycxE plasmids without glkA, pYE1 and pYE2, were obtained bydeleting the SalI-KpnI glkA fragments from pYK1 and pYK2, respectively.

Construction of a gdh deletion mutant. The construction of the gdh deletionplasmid, pDGDH, was carried out in two steps. First, the BamHI-EcoRI frag-ment from pGU1 was cloned into pEC3 (4) in front of the ermB gene. Theresulting plasmid was designated pEC-glcU. Secondly, a gdh deletion derivative(9gdh) was synthesized with primer pair H19-H20. In this KpnI-HindIII fragmentthe first 15 bp of gdh including translation initiation signals were deleted. In athree-fragment cloning, the BamHI-KpnI glcU-ermB fragment, the 9gdhKpnI-HindIII fragment, and the BamHI-HindIII-cut plasmid pBT2 were com-bined to yield pDGDH (glcU ermB 9gdh). Allelic replacement of the wild-type gdhgene by ermB 9gdh was carried out as previously described (4). The resultingstrain, S. xylosus TX213 (ermB 9gdh), was taken for further studies after thechromosomal organization of the glcU ermB 9gdh region had been confirmed bySouthern blot and PCR analyses.

Construction of a glcU deletion mutant. The construction of a glcU deletionplasmid started with the cloning of an EcoRI-BamHI-gdh fragment amplified byprimers H16-H17 into vector pRB473. Into the resulting plasmid, an H36-H37-amplified BamHI-HindIII fragment containing about 1.3 kb upstream of glcUwas cloned, yielding plasmid pDglcU. The plasmid, which contained DNA sur-rounding glcU, was introduced into wild-type S. xylosus C2a. Spontaneous glcUdeletion from the chromosome by gene conversion was detected on B mediumagar plates containing X-Gal (100 mg/ml) and glucose (25 mM). Three bluecolonies indicating loss of glcU were cured from pDglcU, and the chromosomalDNA was analyzed for loss of glcU by PCR. One representative of these colonieswas designated S. xylosus TX214 (DglcU) and was taken for further studies.

Determination of enzyme activities in cell extracts. For determination ofenzymatic activities in S. xylosus, cells were grown in B medium or in B mediumsupplemented with 25 mM of the appropriate carbon source to an optical densityat 578 nm (OD578) of 1.5. Crude extracts were prepared by disrupting the cellswith glass beads (53), and determination of the b-galactosidase, b-glucuronidase,and a-glucosidase activities was done as previously described (12). To assay theactivity of glucose dehydrogenase, S. xylosus cells were grown in B medium with25 mM of glucose to an OD578 of 2. Crude extracts were prepared in 75 mMTris-HCl, pH 8.0. The enzyme activity was assayed spectrophotometrically by

monitoring the increase of absorbance at 340 nm, which is indicative of NADHproduction. The assay was performed at 30°C in 75 mM Tris-HCl (pH 8.0), 0.1M glucose, 2 mM NAD, and 5 to 500 mg of cellular protein. Protein concentra-tions were determined by the method of Bradford (3).

Measurements of glucose uptake. Uptake of glucose in S. xylosus was mea-sured with whole cells grown in B-medium or B-medium supplemented with 25mM of glucose. Staphylococcal cells were harvested at an OD578 of 1.5, washedin transport buffer (0.1 M morpholinepropanesulfonic acid, 0.5 mM MgSO4, 10mM NaCl, pH 7.0), and resuspended in the same buffer to a final OD578 of 3.0.After addition of 200 mM [14C]glucose (6.2 mCi/mmol) to 1 ml of prewarmed(30°C) cells, 0.15-ml samples were taken at intervals, collected on membranefilters with a pore size of 0.45 mm, and washed with 5 ml of transport buffer.Filters were dried at 80°C for 1 h. The radioactivity was determined by liquidscintillation counting. Uptake rates are expressed in nanomoles of glucose perminute per milligram of cellular protein. The amount of protein was determinedby the method of Bradford (3).

Uptake of glucose in E. coli was carried out accordingly with cells grown inLuria Bertani medium that were adjusted to an OD578 of 15.

RNA preparation and primer extension analysis. Preparation of RNA and theprimer extension reactions were done as described previously (1). The primerused in these experiments contained infrared dye IRD700 at the 59 end. Reversetranscripts were run on 8% polyacrylamide-urea gels and were detected with aLi-Cor DNA sequencer. The file containing the picture of that gel was importedinto Photoshop and printed on glossy paper.

Nucleotide sequence accession number. The DNA sequence reported here isavailable from the EMBL database under accession no. Y14043.

RESULTS

Isolation of S. xylosus mutants altered in CR. In order toisolate CR mutants in S. xylosus, transposon mutagenesis withTn917 was performed. Expression of the b-galactosidase gene,which is subject to CR (1, 53), served to monitor the appear-ance of mutants on agar plates containing glucose and X-Gal.While wild-type cells stay light blue for about 48 h, CR mutantsshould develop a darker color. By using this strategy, six bluecolonies were isolated that harbored a copy of Tn917 in theirchromosome. The mutant strains were designated S. xylosusTX207 to TX212.

Molecular characterization of the mutants. Southern blotanalysis using a Tn917-specific probe revealed that the trans-poson integrated at five different locations within a commongenomic region of about 1 kb. Determination of the orienta-tion of Tn917 in the genome of the mutants yielded oppositeorientations in TX211 and TX212 (Fig. 1). Therefore, thesestrains were taken as representatives for further analysis. Chro-mosomal DNA from the neighborhood of the transposon in-sertions in strains TX211 and TX212 including the Tn917 ermBgene was cloned in E. coli with the erythromycin resistance asselection marker. With the genomic DNA from the TX211-derived fragment as a hybridization probe, a 3.6-kb HindIIIfragment was identified in the wild-type strain covering theregion where the Tn917 insertions occurred in the mutants.After cloning the HindIII fragment in E. coli, a nucleotidesequence of 2.2 kb immediately adjacent to the transposoninsertion sites was determined. In addition, the exact positionsof the transposons in strains TX211 and TX212 were deter-mined by DNA sequencing.

Nucleotide sequence of the mutated region. The nucleotidesequence is composed of 2,193 bp harboring two large openreading frames (Fig. 1). The first specifies a protein of 288amino acids with a calculated molecular mass of 30.6 kDa.Structural predictions (24) and hydropathy analysis (31) sug-gested that the orf1-encoded protein constitutes an integralmembrane protein. Since it turned out to encode a glucoseuptake protein, the gene was designated glcU. Similaritysearches in databases identified two proteins from B. subtilisand B. megaterium, which share 55 and 56% identical residueswith GlcU, respectively. The function of both proteins, en-coded by ycxE in B. subtilis (30, 56) and orf2 in B. megaterium(34), remains to be elucidated. In addition, two putative mem-

TABLE 1. S. xylosus strains used

Strain Genotypea Reference or source

C2a Wild type 21TX211 glcU::Tn917 This workTX212 glcU::Tn917 This workTX213 gdh::ermB This workTX214 DglcU This work

a All strains listed are derivatives of S. xylosus DSM 20267 (49) cured of theendogenous plasmid pSX267 (21).

4930 FIEGLER ET AL. J. BACTERIOL.

on April 10, 2019 by guest

http://jb.asm.org/

Dow

nloaded from

brane proteins, one from Lactobacillus helveticus (AJ002481)and the other from Streptococcus pyogenes (U17382), whosefunctions have not been determined, show identities of 40 and32%, respectively, with GlcU from S. xylosus.

The deduced product of the second gene, a protein of 263amino acids with a molecular mass of 28.6 kDa, showed simi-larity to various bacterial dehydrogenases and reductases.Since the identity with glucose-1-dehydrogenases from B.megaterium and B. subtilis was especially striking (56% identi-ty), the gene was designated gdh. Interestingly, two gdh genesin B. subtilis and B. megaterium are encoded downstream of theglcU homologs, ycxE and orf2, mentioned above (30, 34, 56).Therefore, the genetic organization of this locus is conservedamong the two bacilli and S. xylosus.

Activities of catabolic enzymes in the wild type and the glcUmutant strains. The isolation of the glcU mutants TX211 andTX212 as blue colonies from X-Gal agar plates containingglucose suggested that glucose-mediated repression of b-galac-tosidase activity is altered. To determine whether repression byother carbohydrates and repression of other enzymes are alsoaffected by the mutations, the b-galactosidase, b-glucuroni-dase, and a-glucosidase activities of the wild type and the glcUmutant strains were compared in cultures containing glucose,fructose, sucrose, or no additional sugar. As shown in Table 2,inactivation of glcU resulted in a partial loss of glucose repres-sion of all tested enzymes but left sucrose- or fructose-medi-ated repression at the wild-type level. The effect was mostpronounced for the b-galactosidase activity, where the 17-fold

FIG. 1. Genetic organization of the glcU gdh region of S. xylosus. The region that has been sequenced (accession no. Y14043) is shown. The size and orientationof the genes were deduced from the nucleotide sequence. The location and orientation of Tn917 in the S. xylosus mutants TX211 and TX212 are indicated. Thenucleotide sequence of the glcU promoter region is also shown. Numbering refers to the complete DNA sequence (Y14043). The transcriptional start site and aninverted repeat structure are indicated by arrows.

TABLE 2. Catabolic enzyme activities in S. xylosus C2a, glcU mutant strains TX211, TX212, and TX214, and gdh mutant strain TX213

Enzyme Growth conditiona

Enzyme activity in strain (nmol of nitrophenol released min/mg of protein)b

C2a(wild type)

TX211(glcU::Tn917)

TX212(glcU::Tn917)

TX213(gdh::ermB)

TX214(DglcU)

b-galactosidase B 1 lactose 105 106 97 106 95B 1 lactose 1 glucose 6 28 32 10 35B 1 lactose 1 sucrose 34 39 31 ndc ndB 1 lactose 1 fructose 41 48 44 nd nd

b-glucuronidase B 23 21 20 19 18B 1 glucose 5 9 8 5 8B 1 sucrose 9 8 9 nd ndB 1 fructose 9 9 9 nd nd

a-glucosidase B 11 10 11 12 13B 1 glucose 1 4 5 2 4B 1 sucrose 3 4 3 nd ndB 1 fructose 4 3 4 nd nd

a Cells were grown in complex B medium (B) containing 25 mM of the indicated sugars or without additional carbohydrate; they were harvested at an OD578 of 1.5and disrupted with glass beads. Extracts prepared from 40 ml of cells were used for determination of the enzyme activities.

b Enzymatic activities were determined by using p-nitrophenyl-b-D-galactopyranoside (b-galactosidase), p-nitrophenyl-b-D-glucuronide (b-glucuronidase), and p-ni-trophenyl-a-D-glucopyranoside (a-glucosidase) as substrates. Values of at least three independent experiments are shown. Standard deviations were in the range of615%.

c nd, not determined.

VOL. 181, 1999 GLUCOSE UPTAKE IN S. XYLOSUS 4931

on April 10, 2019 by guest

http://jb.asm.org/

Dow

nloaded from

repression in the wild type was reduced to an only 3-foldreduction. It appears that loss of GlcU function in S. xylosuspartially relieves catabolic enzymes from glucose repression.

Glucose dehydrogenase activity in the wild type and the glcUmutant strains. The genetic organization of the glcU-gdh re-gion (Fig. 1) suggested that the two genes could form anoperon. Therefore, integration of Tn917 into glcU should re-duce gdh expression, perhaps depending on the orientation ofthe transposon relative to the gdh gene. As summarized inTable 3, Tn917 integration exerts a strong polar effect on gdhexpression. When Tn917 and glcU-gdh transcription proceedopposite to each other (TX211), glucose dehydrogenase activ-ity was 30-fold reduced compared to that of the wild type. Thesame orientation of Tn917 and glcU-gdh transcription (TX212)still resulted in a threefold drop in glucose dehydrogenaseactivity. These results strongly indicate that the gdh gene doesnot possess its own promoter and that gdh expression is de-pendent on readthrough transcription initiated beyond thetransposon insertion sites. Therefore, glcU and gdh most likelyform an operon in S. xylosus, a situation also encountered atthe respective locus, ycxE gdh, in B. subtilis (37, 43).

Catabolic enzyme activities in a glucose dehydrogenase-de-ficient S. xylosus strain. The virtually identical relief of glucose-mediated repression of catabolic enzymes in the strains S.xylosus TX211 and TX212, in which glucose dehydrogenaseactivity differed about 10-fold (Table 3), suggested that theregulatory phenotype in the mutant strains is the result of glcUinactivation rather than of reduced gdh expression. To rule outthat lowered glucose dehydrogenase activity is responsible forthe phenotype, a gdh insertion mutant was constructed as de-scribed in Materials and Methods. The resulting strain, desig-nated S. xylosus TX213, was tested for b-galactosidase, b-glu-curonidase, and a-glucosidase activities in the presence andabsence of glucose in the medium. As summarized in Table 2,inactivation of the gdh gene did not result in a relief of glucose-mediated repression of these activities.

In addition to the catabolic enzyme activities, glucose dehy-drogenase activity was determined in the gdh mutant strainTX213. No activity was detectable under these growth andassay conditions (Table 3), suggesting that the inactivated gdhgene is the only one in S. xylosus.

Catabolic enzyme activities in a glcU deletion strain express-ing wild-type levels of glucose dehydrogenase activity. To ruleout the possibility that only the concomitant loss of GlcU andglucose dehydrogenase function affects regulation, a glcU de-letion was introduced into the chromosome of S. xylosus as

described in Materials and Methods. In the resulting strain, S.xylosus TX214, the glucose dehydrogenase activity was foundto be at wild-type level (Table 3), showing that the glcU dele-tion was nonpolar on gdh expression. Subsequent assays ofthree catabolic enzyme activities yielded no difference from theS. xylosus TX211 and TX212 values (Table 2). Therefore, thepartial loss of glucose repression observed in the transposonmutants is exclusively due to GlcU deficiency. Glucose dehy-drogenase does not participate in this process. The regulatoryphenotype in all glcU mutant strains could be complementedby cloned glcU on plasmid pGU1 (data not shown).

Glucose uptake in glcU mutant strains. Considering thestructural prediction for GlcU to contain membrane-spanningsegments and the glucose-dependent regulatory phenotype inthe absence of GlcU function, we reasoned that GlcU could bea protein responsible for PTS-independent glucose uptake inS. xylosus. Therefore, transport of glucose and the nonmetabo-lizable analogue 2-deoxyglucose was examined in the wild typeand the glcU mutant strains TX211, TX212, and TX214. Sinceglucose uptake was identical in all GlcU-deficient strains, thevalues for S. xylosus TX211 are shown as a representativeexample (Fig. 2A). With glucose as the substrate in the assaysand cells grown in the absence of glucose, a clear reduction ofthe uptake rate was detectable in the glcU mutant strain. Thehigh residual uptake activity is certainly due to the PTS and,perhaps, to additional glucose transport systems. Attempts areunder way to isolate a PTS mutant of S. xylosus, in which GlcUfunction should be more pronounced. In contrast to glucoseuptake, no difference in transport activity could be detectedwith 2-deoxyglucose as substrate (data not shown).

Surprisingly, the glcU mutant strain TX211 showed a higherglucose uptake activity than the wild type, when the strainswere grown in the presence of glucose (Fig. 2B). The additionof glucose to the growth medium yielded opposite effects inboth strains. While glucose uptake in the wild type was 1.4-foldreduced (Fig. 2A), it was 1.6-fold higher in the glcU mutantTX211 (Fig. 2B). On the other hand, determination of theglucose concentration in the medium after 6 h of growthyielded 3.1 mM for the wild-type culture but 6.6 mM in theTX211 spent medium, clearly showing that TX211 took up lessglucose. These conflicting results may reflect the influence ofaccumulated glucose or metabolites on the determination ofglucose uptake rates. It has been shown in yeast that intracel-lular glucose can reduce apparent glucose transport rates inuptake experiments by up to 50% (51). As the S. xylosus strainsgrow with excess glucose (25 mM), they may indeed accumu-late glucose or metabolites under these conditions. Loss ofGlcU function could lead to reduced accumulation and, con-sequently, to the overestimation of glucose uptake in the mu-tant strains. In addition to these problems, regulation of glu-cose transport, which could be influenced by a functionalGlcU, impedes the interpretation of the glucose uptake assaysin glucose-grown cells.

Complementation of an E. coli mutant deficient in glucoseuptake. To provide additional evidence that GlcU is capable oftaking up glucose, we tried to complement the glucose trans-port deficiency of the E. coli mutant strain ZSC112 (8). Thisstrain carries mutations in ptsG and ptsM, which specify themajor glucose permeases of E. coli, and a mutation in theglucose kinase gene glk. To enable ZSC112 to grow with glu-cose as the sole carbon source, genes mediating glucose trans-port and phosphorylation must be provided. With either glcUcloned on plasmid pGU1 or glkA cloned on plasmid pGRB144,ZSC112 could not grow in minimal medium containing glucose(Fig. 3A). When glcU was combined with the glucose kinasegene glkA from S. xylosus on plasmid pUK1, the strain grew

TABLE 3. Glucose dehydrogenase activities in the wild-type S.xylosus C2a, glcU mutant strains TX211, TX212, and TX214 and gdh

mutant strain TX208

StrainaGlucose dehydrogenase activity

(nmol of NADH produced/min/mgof protein)b

S. xylosus C2a................................................................. 182S. xylosus TX211 (glcU::Tn917)................................... 6S. xylosus TX212 (glcU::Tn917)................................... 64S. xylosus TX213 (gdh::ermB) ...................................... ,1S. xylosus TX214 (DglcU) ............................................. 195

a Cells were grown in complex B medium with 25 mM glucose; they wereharvested at an OD578 of 1.5 and disrupted with glass beads. Extracts preparedfrom 40 ml of cells were used for determination of glucose dehydrogenaseactivities.

b Glucose dehydrogenase activity was determined by monitoring the increaseof absorbance at 340 nm as a measure of NADH production. Values (at leastthree independent experiments) are equivalent to nanomoles of glucose oxidizedby glucose dehydrogenase. Standard deviations were in the range of 612%.

4932 FIEGLER ET AL. J. BACTERIOL.

on April 10, 2019 by guest

http://jb.asm.org/

Dow

nloaded from

well with glucose as carbon source (Fig. 3A). Therefore, glcUmediates glucose uptake in E. coli substantiating its participa-tion in this process in S. xylosus. The dependency of the E. colimutant on a functional glucose kinase, when GlcU is respon-sible for glucose uptake, demonstrates that glucose is internal-ized by GlcU in nonphosphorylated form.

Glucose uptake in the E. coli mutant ZSC112 could bedemonstrated provided that glcU was cloned together withglkA (Fig. 4, pUK1). With glcU alone, uptake slightly exceededthat of the background within the first 30 s of the assays. Atlater time points, it was indistinguishable from the values with-out cloned genes (Fig. 4). The relatively low transport activitymay be due to low expression or limited stability of the mem-

brane protein in the heterologous host. Glucose uptake withcloned glucose kinase was not altered compared to that of thebackground (data not shown).

Determination of the transcriptional start site of glcU. Todetermine the transcriptional start site of glcU, RNA was iso-lated from wild-type cells grown with or without glucose andprimer extension reactions were carried out with a glcU-spe-cific primer. As shown in Fig. 5, transcription start sites werelocated 66 bp upstream from the glcU start codon (Fig. 1). Thereverse transcript was stronger in glucose-grown cells but wasalso detectable without the addition of glucose to the growthmedium. Inspection of the DNA sequence around the pro-moter region revealed an inverted repeat located about 40 bp

FIG. 2. Glucose uptake in S. xylosus wild type C2a and in the glcU mutant TX211. (A) Glucose uptake in cells grown in complex medium without glucose. The cellswere grown in B medium without addition of glucose. Glucose uptake was determined by using 200 mM [14C]glucose (6.2 mCi/mmol). The values representmeasurements of three cultures. Standard deviations were in the range of 615%. (B) Glucose uptake in cells grown in complex medium with glucose. The cells weregrown in B medium with 25 mM glucose. Glucose uptake was determined by using 200 mM [14C]glucose (6.2 mCi/mmol). The values represent measurements of threecultures. Standard deviations were in the range of 617%.

FIG. 3. Growth of E. coli ZSC112 (ptsG ptsM glk) in glucose-containing minimal medium. (A) Growth of ZSC112 with cloned glcU from S. xylosus. Theplasmid-containing strains were grown in M9 minimal medium containing 10 mM glucose and ampicillin (100 mg/ml). (B) Growth of ZSC112 with cloned ycxE fromB. subtilis. The plasmid-containing strains were grown in M9 minimal medium containing 10 mM glucose and ampicillin (100 mg/ml).

VOL. 181, 1999 GLUCOSE UPTAKE IN S. XYLOSUS 4933

on April 10, 2019 by guest

http://jb.asm.org/

Dow

nloaded from

upstream of the glcU promoter. It remains to be determinedwhether this repeat serves as a site for glucose-specific regu-lation or as a terminator for upstream genes.

Identification of the glcU ortholog from B. subtilis. As men-tioned above, B. subtilis contains a gene, designated ycxE (30),encoding a product with high identity (55%) to GlcU in frontof a glucose dehydrogenase gene. We were therefore inter-ested to determine whether ycxE would also specify a glucoseuptake protein. To that end, a ycxE fragment was amplifiedfrom chromosomal B. subtilis DNA by PCR and cloned intothe glkA-containing plasmid pGRB144, yielding pYK1. Sincethe B. subtilis ycxE-gdh operon has been described to be ex-

pressed from a promoter recognized by the alternative sigmafactor sG (43), a promoter, vegII from B. subtilis, which is alsoactive in E. coli (40) was placed in front of ycxE to yield pYK2.Growth experiments with E. coli ZSC112 harboring plasmidpYK1 or pYK2, showed that ycxE with its own promoter didnot enable the strain to grow efficiently with glucose as carbonsource (Fig. 3B, pYK1). Expression of ycxE driven by vegII,however, resulted in growth (Fig. 3B, pYK2) comparable tothat mediated by S. xylosus glcU. Therefore, the B. subtilis ycxEgene specifies, like glcU, a glucose uptake protein.

The identification of the ycxE gene product as a glucoseuptake protein prompted us to determine whether ycxE couldalso substitute for glcU in glucose-mediated regulation in S.xylosus. To avoid possible complications with overexpressedglkA, this gene was deleted from plasmids pYK1 and pYK2,yielding pYE1 and pYE2, respectively. After transformation ofthe glcU mutant TX211 with the pYE plasmids, b-galactosi-dase, a-glucosidase, and b-glucuronidase activities were mea-sured in cells grown in the presence or absence of glucose.While ycxE expressed from vegII on plasmid pYE2 restoredglucose repression in the glcU mutant, plasmid pYE1 harbor-ing ycxE only with its own promoter had no effect (data notshown). Apparently, the sG-specific B. subtilis promoter ofycxE is not active in S. xylosus.

DISCUSSION

The screening for transposon-generated CR mutants in S.xylosus led to the identification of an operon encoding a glu-cose uptake protein, GlcU, and a glucose dehydrogenase.GlcU and the glucose kinase GlkA (53), constitute a glucoseutilization system enabling S. xylosus to catabolize glucose in-dependently from the PTS.

In B. subtilis and B. megaterium, operons are present con-taining a glcU homolog in front of a glucose dehydrogenasegene (34, 56). Growth experiments with the B. subtilis GlcUcounterpart, YcxE, in E. coli demonstrated that the YcxEprotein also mediates glucose uptake. Since the correspondingB. megaterium protein shows a high degree of identity (78%) toYcxE, it is reasonable to assume the same function for thatprotein. Therefore, the three genes, glcU from S. xylosus, ycxEfrom B. subtilis, and orf2 from B. megaterium constitute a novelgroup of orthologous genes encoding glucose uptake proteins.

The physiological roles of these proteins, however, appear tobe different in Bacillus and S. xylosus. The Bacillus glcU or-tholog and the following gdh gene are transcribed 3 h after theonset of sporulation in the forespore by sG-containing RNApolymerase (37), and glucose dehydrogenase activity is de-tected in forespores and in mature spores (17). Therefore, theycxE gene product may also be present in spores and couldperhaps play a role in glucose uptake in the germination pro-cess (52, 54). It does not seem to contribute to glucose uptakeduring vegetative growth. On the other hand, GlcU serves in S.xylosus, additionally to the PTS, to take up glucose duringgrowth. Coexpression of glcU and gdh suggests that GlcU alsorecruits glucose for glucose dehydrogenase. Production of glu-conate by that enzyme would open an alternative route toobtaining energy from glucose. As this possibility did not in-fluence CR, glucose dehydrogenase may be more importantunder physiological conditions that are different from those inour study.

Besides the glcU orthologs, two genes that are clearly ho-mologous to glcU are currently in the databases (AJ002481 andU17382). Both are found in gram-positive bacteria, S. pyogenesand L. helveticus, respectively, and both specify membraneproteins consistent with a function in transport processes. Due

FIG. 4. Glucose uptake in E. coli ZSC112 harboring cloned glcU from S.xylosus. The cells were grown in Luria Bertani medium. Glucose uptake wasdetermined by using 200 mM [14C]glucose (6.2 mCi/mmol). The values representmeasurements of three cultures. Standard deviations were in the range of 613%.

FIG. 5. Primer extension analysis of glcU transcription. RNA was preparedfrom S. xylosus C2a grown without and with glucose. Primer extension productswere separated along with DNA sequencing reactions on an 8% polyacrylamide-urea gel. Lane 1, Primer extension reaction with 15 mg of RNA from cells grownwithout glucose; lane 2, Primer extension reaction with 15 mg of RNA from cellsgrown with 25 mM glucose.

4934 FIEGLER ET AL. J. BACTERIOL.

on April 10, 2019 by guest

http://jb.asm.org/

Dow

nloaded from

to the limited similarity to GlcU (40 and 32%, respectively) itappears difficult to predict the substrate for these putativeuptake proteins, and experimental data are currently not avail-able. Therefore, the function of these two proteins remains tobe determined. So far, the family of glcU-related genes consistsof only five members. The rapid progress in whole genomesequencing will most likely reveal new homologs and mayeventually answer the question whether this group of genesremains restricted to gram-positive bacteria.

While the participation of GlcU in glucose uptake of S.xylosus is clear, the mechanism by which GlcU allows glucoseto enter the cells remains to be elucidated. The activity of GlcUin uptake assays could only be demonstrated when glucose wasmetabolizable. In S. xylosus, GlcU-mediated transport of 2-de-oxyglucose was not detectable, and in E. coli uptake of glucoseby GlcU was apparently dependent on a functional glucosekinase. These results are indicative of sugar uptake by facili-tated diffusion. By this process, sugars are taken up without theconsumption of energy, but the carbohydrates cannot be accu-mulated against a concentration gradient. In conventional,long-term uptake assays, the activity of facilitated diffusionsystems is only detectable with metabolizable substrates andshows a pronounced dependence on the respective sugar ki-nases (11). The fast equilibration of external and internal sugarconcentrations mediated by facilitators may be detected byshort-term uptake assays. In addition, influx counterflow isobserved in sugar-preloaded cells (11, 38, 55). Attempts todemonstrate that GlcU indeed constitutes a glucose facilitatorhave so far not been successful. Despite this failure, we stillfavor the idea that GlcU is one of the few bacterial examplesof facilitated diffusion systems (38, 46, 50, 55). Clearly, morework will be needed to elucidate the mechanism of GlcU-mediated glucose uptake.

Inactivation of glcU in S. xylosus resulted in a partial loss ofglucose-mediated repression of a-glucosidase, b-glucuroni-dase, and b-galactosidase activities (Table 2). Since repressionof a-glucosidase expression in glucose-grown cells is exclu-sively exerted by CcpA (12), GlcU is obviously required for fullglucose-mediated CcpA activity. To account for this observa-tion, we suggest the following. When GlcU is inactive, reducedglucose uptake leads to diminished accumulation of glycolyticintermediates and eventually to a less active HPr kinase. Con-sequently, activation of CcpA by HPr-ser-P in the presence ofglucose is reduced but not totally lost. If one considers glucose-6-phosphate as an alternative effector for CcpA (15, 20), theconsequences for CcpA activation in the absence of GlcUwould be the same. In any case, the influence of GlcU onglucose-mediated CR should depend on a functional glucosekinase. And indeed, a glucose kinase mutant of S. xylosus,which has been described previously (53), has virtually thesame regulatory phenotype as the glcU mutant strain. Theisolation and subsequent inactivation of the HPr kinase genewill be needed to distinguish the in vivo significance of HPr-ser-P and glucose-6-phosphate as effectors for CcpA in S. xy-losus.

The question arises why our b-galactosidase expressionscreen to detect mutants defective in CR appeared to be biasedtowards glcU or, as in a previous study, the glucose kinase geneglkA (53), genes that both affect PTS-independent glucose uti-lization. Initially, we expected to isolate the ccpA and the HPrkinase gene. During the analysis of ccpA, which had beendetected by a PCR approach (13), and the lactose operon (1),it became clear that CR of the lac operon is not exclusively dueto CcpA. Plating the ccpA mutant on b-galactosidase screeningplates resulted in small colonies that were less colored than thewild type, instead of the expected dark blue clones. Appar-

ently, the growth defect of the ccpA mutant (13) preventeddetection of the regulatory phenotype. One is tempted to spec-ulate that the HPr kinase mutant may exhibit a similar growthdefect. Another surprise was the failure to detect PTS genes.Whether this observation really indicates that non-PTS glucosetransport dominates PTS-mediated glucose transport underthese conditions remains an interesting question for futurestudies.

In conclusion, the current work has led to the identificationof a novel group of proteins responsible for PTS-independentuptake of glucose and, most likely, other compounds. Detailedbiochemical work will be necessary to elucidate the mechanismby which these proteins recognize and take up their substrates.

ACKNOWLEDGMENTS

We thank F. Gotz, in whose laboratory the work has been carriedout, for continuous interest and support and P. L. Hyunh for excellenttechnical assistance. We also thank G. Sprenger for helpful advice inuptake assays.

The work was supported by the European Community Biotech Pro-gramme (BIO2-CT92-0137) and by the Deutsche Forschungsgemein-schaft (Br 947/3-1).

REFERENCES

1. Bassias, J., and R. Bruckner. 1998. Regulation of lactose utilization genes inStaphylococcus xylosus. J. Bacteriol. 180:2273–2279.

2. Behari, J., and P. Youngman. 1998. A homolog of CcpA mediates catabolitecontrol in Listeria monocytogenes but not carbon source regulation of viru-lence genes. J. Bacteriol. 180:6316–6324.

3. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation ofmicrogram quantities of protein utilizing the principle of protein-dye bind-ing. Anal. Biochem. 72:248–254.

4. Bruckner, R. 1997. Gene replacement in Staphylococcus carnosus and Staph-ylococcus xylosus. FEMS Microbiol. Lett. 151:1–8.

5. Bruckner, R., E. Wagner, and F. Gotz. 1993. Characterization of a sucrasegene from Staphylococcus xylosus. J. Bacteriol. 175:851–857.

6. Buckley, N. D., and I. R. Hamilton. 1994. Vesicles prepared from Strepto-coccus mutans demonstrate the presence of a second glucose transportsystem. Microbiology 140:2639–2648.

7. Chauvaux, S., I. T. Paulsen, and M. H. Saier, Jr. 1998. CcpB, a noveltranscription factor implicated in catabolite repression in Bacillus subtilis. J.Bacteriol. 180:491–497.

8. Curtis, S. J., and W. Epstein. 1975. Phosphorylation of D-glucose in Esche-richia coli mutants defective in glucosephosphotransferase, mannosetrans-ferase, and glucokinase. J. Bacteriol. 122:1189–1199.

9. Cvitkovitch, D. G., D. A. Boyd, T. Thevenot, and I. R. Hamilton. 1995.Glucose transport by a mutant of Streptococcus mutans unable to accumulatesugars via the phosphoenolpyruvate phosphotransferase system. J. Bacteriol.177:2251–2258.

10. Dahl, M. K. 1997. Enzyme IIglc contributes to trehalose metabolism inBacillus subtilis. FEMS Microbiol. Lett. 148:233–238.

11. DiMarco, A. A., and A. H. Romano. 1985. D-Glucose transport system ofZymomonas mobilis. J. Bacteriol. 49:151–157.

12. Egeter, O., and R. Bruckner. 1996. Catabolite repression mediated by thecatabolite control protein CcpA in Staphylococcus xylosus. Mol. Microbiol.21:739–749.

13. Egeter, O., and R. Bruckner. 1995. Characterization of a genetic locusessential for maltose-maltotriose utilization in Staphylococcus xylosus. J. Bac-teriol. 177:2408–2415.

14. Fiegler, H., and R. Bruckner. 1997. Identification of the serine acetyltrans-ferase gene of Staphylococcus xylosus. FEMS Microbiol. Lett. 148:181–187.

15. Fujita, Y., and Y. Miwa. 1994. Catabolite repression of the Bacillus subtilisgnt operon mediated by the CcpA protein. J. Bacteriol. 176:511–513.

16. Fujita, Y., Y. Miwa, A. Galinier, and J. Deutscher. 1995. Specific recognitionof the Bacillus subtilis gnt cis-acting catabolite-responsive element by a pro-tein complex formed between CcpA and seryl-phosphorylated HPr. Mol.Microbiol. 17:953–960.

17. Fujita, Y., R. Ramaley, and E. Freese. 1977. Location and properties ofglucose dehydrogenase in sporulating cells and spores of Bacillus subtilis. J.Bacteriol. 132:282–293.

18. Galinier, A., J. Haiech, M. C. Kilhoffer, M. Jaquinod, J. Stulke, J. Deutscher,and I. Martin-Verstraete. 1997. The Bacillus subtilis crh gene encodes aHPr-like protein involved in carbon catabolite repression. Proc. Natl. Acad.Sci. USA 94:8439–8444.

19. Galinier, A., M. Kravanja, R. Engelmann, W. Hengstenberg, M. C. Kilhoffer,J. Deutscher, and J. Haiech. 1998. New protein kinase and protein phos-

VOL. 181, 1999 GLUCOSE UPTAKE IN S. XYLOSUS 4935

on April 10, 2019 by guest

http://jb.asm.org/

Dow

nloaded from

phatase families mediate signal transduction in bacterial catabolite repres-sion. Proc. Natl. Acad. Sci. USA 95:1823–1828.

20. Gosseringer, R., E. Kuster, A. Galinier, J. Deutscher, and W. Hillen. 1997.Cooperative and non-cooperative DNA binding modes of catabolite controlprotein CcpA from Bacillus megaterium result from sensing two differentsignals. J. Mol. Biol. 266:665–676.

21. Gotz, F., J. Zabielski, L. Philipson, and M. Lindberg. 1983. DNA homologybetween the arsenate resistance plasmid pSX267 from Staphylococcus xylosusand the penicillinase plasmid pI258 from Staphylococcus aureus. Plasmid9:126–137.

22. Hammes, W. P. 1990. Bacterial starter cultures in food production. FoodBiotechnol. 4:383–397.

23. Henkin, T. M., F. J. Grundy, W. L. Nicholson, and G. H. Chambliss. 1991.Catabolite repression of alpha-amylase gene expression in Bacillus subtilisinvolves a trans-acting gene product homologous to the Escherichia coli lacland galR repressors. Mol. Microbiol. 5:575–584.

24. Hofmann, K., and W. Stoffel. 1993. TMbase—a database of membranespanning segments. Biol. Chem. Hoppe-Seyler 347:166.

25. Hueck, C. J., W. Hillen, and M. H. Saier, Jr. 1994. Analysis of a cis-activesequence mediating catabolite repression in gram-positive bacteria. Res.Microbiol. 145:503–518.

26. Hueck, C. J., A. Kraus, D. Schmiedel, and W. Hillen. 1995. Cloning, expres-sion and functional analyses of the catabolite control protein CcpA fromBacillus megaterium. Mol. Microbiol. 16:855–864.

27. Kim, J. H., and G. H. Chambliss. 1997. Contacts between Bacillus subtiliscatabolite regulatory protein CcpA and amyO target site. Nucleic Acids Res.25:3490–3496.

28. Kim, J. H., Z. T. Guvener, J. Y. Cho, K. C. Chung, and G. H. Chambliss.1995. Specificity of DNA binding activity of the Bacillus subtilis catabolitecontrol protein CcpA. J. Bacteriol. 177:5129–5134.

29. Kim, J. H., M. I. Voskuil, and G. H. Chambliss. 1998. NADP, corepressor forthe Bacillus catabolite control protein ccpA. Proc. Natl. Acad. Sci. USA95:9590–9595.

30. Kunst, F., N. Ogasawara, I. Moszer, A. M. Albertini, G. Alloni, V. Azevedo,M. G. Bertero, P. Bessieres, A. Bolotin, S. Borchert, R. Borriss, L. Boursier,A. Brans, M. Braun, S. C. Brignell, S. Bron, S. Brouillet, C. V. Bruschi, B.Caldwell, V. Capuano, N. M. Carter, S. K. Choi, J. J. Codani, I. F. Conner-ton, A. Danchin, et al. 1997. The complete genome sequence of the gram-positive bacterium Bacillus subtilis. Nature 390:249–256.

31. Kyte, J., and R. F. Doolittle. 1982. A simple method for displaying thehydropathic character of a protein. J. Mol. Biol. 157:105–132.

32. Lokman, B. C., M. Heerikhuisen, R. J. Leer, A. van den Broek, Y. Borsboom,S. Chaillou, P. W. Postma, and P. H. Pouwels. 1997. Regulation of expres-sion of the Lactobacillus pentosus xylAB operon. J. Bacteriol. 179:5391–5397.

33. Luesink, J. L., R. E. M. A. van Herpen, B. P. Grossiord, O. P. Kuipers, andd. V. W. M. 1998. Transcriptional activation of the glycolytic las operon andcatabolite repression of the gal operon in Lactococcus lactis are mediated bythe catabolite control protein CcpA. Mol. Microbiol. 30:789–798.

34. Mitamura, T., R. V. Ebora, T. Nakai, Y. Makino, S. Negoro, I. Urabe, and H.Okada. 1990. Structure of isoenzyme genes of glucose dehydrogenase fromBacillus megaterium IAM1030. J. Ferment. Bioeng. 70:363–369.

35. Miwa, Y., K. Nagura, S. Eguchi, H. Fukuda, J. Deutscher, and Y. Fujita.1997. Catabolite repression of the Bacillus subtilis gnt operon exerted by twocatabolite-responsive elements. Mol. Microbiol. 23:1203–1213.

36. Monedero, V., M. J. Gosalbes, and G. Perez-Martınez. 1997. Cataboliterepression in Lactobacillus casei ATCC 393 is mediated by CcpA. J. Bacte-riol. 179:6657–6664.

37. Nakatani, Y., W. Nicholson, W. L. Neitzke, P. Setlow, and E. Freese. 1988.Sigma-G RNA polymerase controls forespore-specific expression of the glu-cose dehydrogenase operon in Bacillus subtilis. Nucleic Acids Res. 17:999–1017.

38. Parker, C., W. O. Barnell, J. L. Snoep, L. O. Ingram, and T. Conway. 1995.Characterization of the Zymomonas mobilis glucose facilitator gene product(glf) in recombinant Escherichia coli: examination of transport mechanism,kinetics and the role of glucokinase in glucose transport. Mol. Microbiol.15:795–802.

39. Paulsen, I. T., S. Chauvaux, P. Choi, and M. H. Saier, Jr. 1998. Character-

ization of glucose-specific catabolite-resistant mutants of Bacillus subtilis:identification of a novel hexose:H1 symporter. J. Bacteriol. 180:498–504.

40. Peschke, U., V. Beuck, H. Bujard, R. Gentz, and S. Le Grice. 1985. Efficientutilization of Escherichia coli transcriptional signals in Bacillus subtilis. J.Mol. Biol. 186:547–555.

41. Postma, P. W., J. W. Lengeler, and G. R. Jacobson. 1993. Phosphoenolpyru-vate: carbohydrate phosphotransferase systems of bacteria. Microbiol. Rev.6:543–594.

42. Ramseier, T. M., J. Reizer, E. Kuster, W. Hillen, and M. H. Saier. 1995. Invitro binding of the CcpA protein of Bacillus megaterium to cis-acting catab-olite responsive elements (CREs) of gram-positive bacteria. FEMS Micro-biol. Lett. 129:207–213.

43. Rather, P. N., and C. P. Moran, Jr. 1988. Compartment-specific transcrip-tion in Bacillus subtilis: identification of the promoter for gdh. J. Bacteriol.170:5086–5092.

44. Reizer, J., C. Hoischen, F. Titgemeyer, C. Rivolta, R. Rabus, J. Stulke, D.Karamata, M. H. J. Saier, and W. Hillen. 1998. A novel protein kinase thatcontrols carbon catabolite repression in bacteria. Mol. Microbiol. 27:1157–1169.

45. Reizer, J., S. L. Sutrina, M. H. Saier, G. C. Stewart, A. Peterkofsky, and P.Reddy. 1989. Mechanistic and physiological consequences of HPr(ser) phos-phorylation on the activities of the phosphoenolpyruvate:sugar phospho-transferase system in gram-positive bacteria: studies with site-specific mu-tants of HPr. EMBO J. 8:2111–2120.

46. Russell, J. B. 1990. Low-affinity, high-capacity system of glucose transport inthe ruminal bacterium Streptococcus bovis: evidence for a mechanism offacilitated diffusion. Appl. Environ. Microbiol. 56:3304–3307.

47. Saier, M. H., Jr. 1991. A multiplicity of potential carbon catabolite repres-sion mechanisms in prokaryotic and eukaryotic microorganisms. New Biol.3:1137–1147.

48. Saier, M. H., Jr., S. Chauvaux, J. Deutscher, J. Reizer, and J. J. Ye. 1995.Protein phosphorylation and regulation of carbon metabolism in gram-neg-ative versus gram-positive bacteria. Trends Biochem. Sci. 20:267–271.

49. Schleifer, K. H., and W. E. Kloos. 1975. Isolation and characterization fromhuman skin. I. Amended descriptions of Staphylococcus epidermidis andStaphylococcus saprophyticus and description of three new species: Staphy-lococcus cohnii, Staphylococcus haemolyticus and Staphylococcus xylosus. J.Syst. Bacteriol. 174:3042–3048.

50. Sweet, G., C. Gandor, R. Voegele, N. Wittekindt, J. Beuerle, V. Truniger,E. C. Lin, and W. Boos. 1990. Glycerol facilitator of Escherichia coli: cloningof glpF and identification of the glpF product. J. Bacteriol. 172:424–430.

51. Teusink, B., J. A. Diderich, H. V. Westerhof, K. van Dam, and M. C. Walsh.1998. Intracellular glucose concentration in derepressed yeast cells consum-ing glucose is high enough to reduce the glucose transport rate by 50%. J.Bacteriol. 180:556–562.

52. Vary, J. C., and H. O. Halvorson. 1968. Initiation of bacterial spore germi-nation. J. Bacteriol. 95:1327–1334.

53. Wagner, E., S. Marcandier, O. Egeter, J. Deutscher, F. Gotz, and R. Bruck-ner. 1995. Glucose kinase-dependent catabolite repression in Staphylococcusxylosus. J. Bacteriol. 177:6144–6152.

54. Wax, R., and E. Freese. 1968. Initiation of the germination of Bacillus subtilisspores by a combination of compounds in place of L-alanine. J. Bacteriol.95:433–438.

55. Weisser, P., R. Kramer, H. Sahm, and G. A. Sprenger. 1995. Functionalexpression of the glucose transporter of Zymomonas mobilis leads to resto-ration of glucose and fructose uptake in Escherichia coli mutants and pro-vides evidence for its facilitator action. J. Bacteriol. 177:3351–3354.

56. Yamane, K., M. Kumano, and K. Kurita. 1996. The 25 degrees–36 degreesregion of the Bacillus subtilis chromosome: determination of the sequence ofa 146 kb segment and identification of 113 genes. Microbiology 142:3047–3056.

57. Youngman, P., H. Poth, B. Green, K. York, G. Olmedo, and K. Smith. 1989.Methods for genetic manipulation, cloning, and functional analysis of sporu-lation genes in Bacillus subtilis, p. 65–87. In I. Smith, A. Slepecky, and P.Setlow (ed.), Regulation of procaryotic development. American Society forMicrobiology, Washington, D.C.

4936 FIEGLER ET AL. J. BACTERIOL.

on April 10, 2019 by guest

http://jb.asm.org/

Dow

nloaded from