Copyright © 2019 Pei et al.This is an open-access article distributed under the terms of the Creative Commons Attribution4.0 International license, which permits unrestricted use, distribution and reproduction in anymedium provided that the original work is properly attributed.

Research Articles: Neurobiology of Disease

ICAM5 as a novel target for treating cognitiveimpairment in Fragile X Syndrome

https://doi.org/10.1523/JNEUROSCI.2626-18.2019

Cite as: J. Neurosci 2019; 10.1523/JNEUROSCI.2626-18.2019

Received: 15 October 2018Revised: 12 December 2019Accepted: 15 December 2019

This Early Release article has been peer-reviewed and accepted, but has not been throughthe composition and copyediting processes. The final version may differ slightly in style orformatting and will contain links to any extended data.

Alerts: Sign up at www.jneurosci.org/alerts to receive customized email alerts when the fullyformatted version of this article is published.

1 1

ICAM5 as a novel target for treating cognitive impairment in Fragile X 1

Syndrome 2

3

Abbreviated title: ICAM5 in Fragile X Syndrome 4

5

Author names and affiliations: Ya-ping Pei1,2,3*, Yue-yi Wang1,2,3*,Dan Liu1,2,3*, 6

Hui-yang Lei5, Zhi-hao Yang1,2,3, Zi-wei Zhang1,2,3, Man Han1,2,3, Ke Cheng1,2,3, 7

Yu-shan Chen1,2,3, Jin-quan Li1,2,3, Gui-rong Cheng1,2,3, Lang Xu1,2,3, Qing-ming Wu1,2, 8

Shawn M. McClintock1,2,4, Ying Yang5, Yong Zhang6, Yan Zeng1,2,3 9 * Co-first authors 10 1 Brain and Cognition Research Institute, Wuhan University of Science and 11

Technology, Wuhan, China 12 2 Hubei Province Key Laboratory of Occupational Hazard Identification and Control, 13

Wuhan University of Science and Technology, Wuhan, China 14 3 Big Data Science and Engineering Research Institute, Wuhan University of Science 15

and Technology, Wuhan, China 16 4 Department of Psychiatry, UT Southwestern Medical Center, Dallas, Texas, USA 17 5 Department of Pathophysiology, School of Basic Medicine and The Collaborative 18

Innovation Center for Brain Science, Key Laboratory of Hubei Province and Ministry 19

of Education of China for Neurological Disorders, Tongji Medical College, 20

Huazhong University of Science and Technology, Wuhan, China 21 6 Department of Neurobiology, School of Basic Medical Sciences and Neuroscience 22

Research Institute, Peking University; Key Lab for Neuroscience, Ministry of 23

Education of China and National Committee of Health and Family Planning of China, 24

Peking University, Beijing, China. 25

26

Corresponding author: Yan Zeng, Brain and Cognition Research Institute, Wuhan 27

University of Science and Technology, Wuhan, China. E-mail: 28

yanzeng11@foxmail.com 29

30

Number of pages: 29 31

Number of Figures: 6 32

2 2

Number of Tables: 0 33

Number of words for Abstract: 217 34

Number of words for Introduction: 574 35

Number of words for Discussion: 1223 36

37

Conflict of interest statement: The authors declare no competing financial interests 38

39

Acknowledgments: This work was supported by the National Natural Science 40

Foundation of China (grant 81571095 and 81870901 to Dr. Yan Zeng), Hubei Natural 41

Science Foundation (grant 2016CFB501 to Dr. Yan Zeng), and Hubei health and 42

family planning commission (grant WJ2015MB050 to Dr. Yan Zeng). Dr. 43

McClintock reports honoraria as teaching faculty from TMS Health Solutions. 44

45

46 47

3 3

Abstract 48

Fragile X syndrome (FXS) is the most common inherited form of intellectual 49

disability, resulted from the silencing of the Fmr1 gene and the subsequent loss of 50

FMRP. Spine dysgenesis and cognitive impairment have been extensively 51

characterized in FXS, however, the underlying mechanism remains poorly understood. 52

As an important regulator of spine maturation, intercellular adhesion molecule 5 53

(ICAM5) mRNA may be one of the targets of FMRP and involved in cognitive 54

impairment in FXS. Here we show that in Fmr1 KO male mice, ICAM5 was 55

excessively expressed during the late developmental stage, and its expression was 56

negatively correlated with the expression of FMRP and positively related with the 57

morphological abnormalities of dendritic spines. While in vitro reduction of ICAM5 58

normalized dendritic spine abnormalities in Fmr1 KO neurons, and in vivo 59

knock-down of ICAM5 in the dentate gyrus rescued the impaired spatial and fear 60

memory and anxiety-like behaviors in Fmr1 KO mice, through both granule cell and 61

mossy cell with a relative rate of 1.32 ± 0.15. Furthermore, biochemical analyses 62

showed direct binding of FMRP with ICAM5 mRNA, to the coding sequence of 63

ICAM5 mRNA. Taken together, our study suggests that ICAM5 is one of the targets 64

of FMRP and implicates in the molecular pathogenesis of FXS. ICAM5 could be a 65

therapeutic target for treating cognitive impairment in FXS. 66

67

4 4

Significance Statement 68

Fragile X syndrome (FXS) is characterized by dendritic spine dysgenesis and 69

cognitive dysfunctions, while one of the FMRP latent targets, ICAM5, is well 70

established for contributing both spine maturation and learning performance. In this 71

study, we examined the potential link between ICAM5 mRNA and FMRP in FXS, and 72

further investigated the molecular details and pathological consequences of ICAM5 73

overexpression. Our results indicate a critical role of ICAM5 in spine maturation and 74

cognitive impairment in FXS and suggest ICAM5 is a potential molecular target for 75

the development of medication against FXS.76

5 5

Introduction 77

Fragile X syndrome (FXS) is the most common inherited cause of mental retardation, 78

resulted from the transcriptional silencing of the fragile X mental retardation 1 (Fmr1) 79

gene and the subsequent loss of fragile X mental retardation protein (FMRP) (Davis 80

& Broadie, 2017). FXS is characterized by cognitive impairment associated with a 81

broad spectrum of psychiatric comorbidities, including hyperactive behavior, autism 82

spectrum disorder, poor attention, and seizure (Specchia, D'Attis, Puricella, & 83

Bozzetti, 2017; Wang, Bray, & Warren, 2012). Currently, there is no effective therapy 84

for treating cognitive impairment in FXS, making the quest for novel targets of 85

considerable importance. A common neuropathologic phenotype seen in FXS is 86

dendritic spine malformation, which is associated with an increased number of long, 87

thin, and tortuous spines, and a pruning failure during spine transition from 88

development to mature ones(Irwin et al., 2001; Portera & Yuste, 2001; Wijetunge et 89

al., 2014). Dysgenesis of dendritic spines is also observed in many other 90

neurodevelopmental disorders (NDDs)(Bourgeron, 2009; Calabrese, Wilson, & 91

Halpain, 2006; De, Fernández, Buzzi, Di, & Bagni, 2012; Irwin et al., 2001; Penzes, 92

Cahill, Jones, Vanleeuwen, & Woolfrey, 2011; Portera & Yuste, 2001; Wijetunge et 93

al., 2014). Thus, determining the molecular mechanisms involved in impaired 94

dendritic spine formation and maturation and cognitive impairment may shed light on 95

FXS and other NDDs for the development of new therapeutic strategies. 96

Under normal condition, FMRP exists at high level in dendritic spines (Antar, 97

Dictenberg, Plociniak, Afroz, & Bassell, 2005; Davis & Broadie, 2017). Through 98

binding to mRNAs, FMRP regulates the expression of many genes at the 99

post-transcriptional level (Jennifer C Darnell & Klann, 2013; Specchia et al., 2017), 100

including mRNA dendritic localization, axonal/dendritic transport, and export from 101

6 6

the nucleus to the cytoplasm(Bassell & Warren, 2008; Melko & Bardoni, 2010; 102

Pasciuto, Emanuela, Bagni, & Claudia, 2014). In FXS pathological condition, FMRP 103

loss-of-function results in excessive protein synthesis, and further defects in synaptic 104

plasticity, as well as cognitive impairment (Bassell & Warren, 2008; Jennifer C 105

Darnell & Klann, 2013). Over the last 20 years, a large number of potential mRNA 106

targets of FMRP have been found(Brown & Huynh, 2001; J. C. Darnell et al., 2011; Jr 107

et al., 2012). A well-known study proposed an underestimated list of 842 mRNA 108

targets of FMRP, and also listed a total of 19493 related complexes including 109

intercellular adhesion molecule 5 (ICAM5) (J. C. Darnell et al., 2011). However, the 110

pathological consequences of these mRNA targets remain unclear. 111

ICAM5 is a cell adhesion molecule that belongs to the immunoglobulin (Ig) 112

superfamily (Yoshihiro Yoshihara & Mori, 1994). It is widely expressed in 113

telencephalic neurons and plays an important role in higher order cognitive and motor 114

functions(Mitsui, Saito, Mori, & Yoshihara, 2007; Mori, Fujita, Watanabe, Obata, & 115

Hayaishi, 1987; Oka, Mori, & Watanabe, 1990). In the early postnatal life of 116

mammals, the ontogenic appearance of ICAM5 is consistent with the timing of 117

dendritic outgrowth, spine formation, and synaptogenesis, and its expression persists 118

into adulthood(Li et al., 2000; Mori et al., 1987; Y. Yoshihara et al., 1994). Besides, 119

cleavage of ICAM5 leads to a reduced density of filopodia via β1 integrin interaction 120

and the consequent phosphorylation of cofilin (Conant et al., 2011), decreases 121

glutamatergic transmission and neuronal excitability (Niedringhaus, Chen, Dzakpasu, 122

& Conant, 2012), and alters spine maturation and learning performance (Nakamura et 123

al., 2001). These findings suggest that ICAM5 is involved in dendritic spine 124

morphogenesis and synapse development. However, the involvement of ICAM5 in 125

the neuropathology and spine maturation in FXS remains unclear. 126

7 7

In this study, we aim to examine a possible link between ICAM5 and FMRP in 127

FXS, and to further investigate the molecular detail and the pathological 128

consequences. We confirmed that ICAM5 mRNA is a target of FMRP. In FXS mouse 129

model, ICAM5 expression is aberrantly increased, correlated with the developmental 130

delay of spine maturation and the concomitant cognitive impairment, and the 131

reduction of ICAM5 expression rescues the behavioral disorders in Fmr1 KO mice. 132

133

134

8 8

Materials and methods 135

Animals 136

Fmr1 knock-out (KO) (FVB.129P2-Pde6b+Tyrc-ch Fmr1tm1Cgr/J) and wild type (WT) 137

(FVB.129P2-Pde6b+ Tyrc-ch/AntJ) mice were purchased from Jackson Laboratories 138

(Bar Harbor, ME, USA). All procedures that involved animals were performed in 139

accordance with a protocol approved by the Wuhan University of Science and 140

Technology Animal Research Committee. Male mice were used in all experiments. 141

142

Western blotting analysis 143

The protein level from each selected telencephalic region was measured by western 144

blot analysis as previously described (Zeng, Liu, Wu, Liu, & Hu, 2012). Primary 145

antibodies used in this study were goat polyclonal anti-ICAM5 (Santa Cruz 146

Biotechnology, 2507S, 1:1000), rabbit polyclonal anti-ICAM5 (Abcam, ab232785, 147

1:1000) and rabbit polyclonal anti-FMRP (Cell Signaling Technology, 4317S, 148

1:1000). 149

150

Primary neuron culture, transfection, and morphometrical analysis 151

Primary mouse neuronal cultures were obtained from the cerebral cortex of embryos 152

(E17 - E18) (Hozumi et al., 2003). For neuron transfection, lentiviral vectors were 153

used with 1 × 108 TU/ml (MOI = 10). To suppress and overexpress FMR1, we used 154

GV118 (Shanghai Genechem Co., Ltd. China) with a target sequence 155

5’-ACGAAACTTAGTAGGCAAA-3’ and the GV303 vector (Shanghai Genechem 156

Co., Ltd. China) with full length FMR1 respectively. After 24h transfection, the 157

neurons were cultured 2 days for protein measurement and 8 days for morphological 158

observation of the dendritic spines. Dil staining was performed as described before 159

9 9

(Cheng, Trzcinski, & Doering, 2014), and dendritic spines were examined using a 160

FV1000 confocal microscope (FluoView1000, Olympus, Tokyo, Japan). Spine head 161

width and length of dendritic protrusions were measured by Image J. Only spines 162

within 100 μm of cell bodies were evaluated. 163

164

Quantitative real-time (RT) PCR 165

We evaluated the mRNA level of FMR1 and ICAM5 in Fmr1 KO versus WT mice by 166

quantitative RT-PCR. Total RNA was extracted by TRIzol Reagent (Invitrogen, USA) 167

and subsequently synthesized into single-strand cDNA using Superscript II reverse 168

transcriptase (Invitrogen, USA). The cDNA amplification was performed using SYBR 169

Premix Ex Tap (Tli RNaseH Plus, Takara) on the BIO-RAD CFX96 system (Chen et 170

al., 2018). Genes and forward/reverse primers used for qRT-PCR are: β-actin, forward: 171

CTCTTTTCCAGCCTTCCTTCTTG, reverse: AGAGGTCTT TACGGATGTCAACG; 172

FMR1, forward: ATCGCTAATGCCACTGTTCTTT, reverse: CGACCCATTCCTTG 173

ACCATC; ICAM5, forward: AGAACAGGAAGGCACCAAACAG, reverse: CTGG 174

CTCACTCAAAGTCAGAAGAG; U1 snRNA, forward: GGGAGATACCATGATC 175

ACGAAGGT, reverse: CCACAAATTATGCA GTCGAGTTTCCC. 176

177

Linear sucrose gradient fractionation 178

Three weeks mouse hippocampus lysates and neurons were submitted to FengRui 179

Biotechnology Co., Ltd/YuSen Biotechnology Co., Ltd (Hunan/Shanghai, China) for 180

ribosome bound mRNA test. 181

182

Golgi impregnation procedure and spine analysis 183

The Golgi staining method was performed with the FD Rapid GolgiStain Kit (FD 184

10 10

Neurotechnologies, Columbia, MD, USA) as previously described in Tian (Tian et al., 185

2015) and Gao (Gao et al., 2015). Categories of spine morphology were identified as 186

follows: mushroom-shaped spine (spine with a large bulbous head, the diameter of 187

spine head minus the diameter of the spine neck ≥1.5μm); thin spine (filopodia-like 188

protrusion, diameters of spine and neck are nearly equal, and spine length is greater 189

than spine width); stubby spine (short spine without a well-defined spine neck). 190

191

RNA-binding protein immunoprecipitation (RIP) and RNA immunoprecipitation 192

sequencing (RIP-Seq) cDNA library construction 193

RIP experiments were conducted using the Magna RIP™ RNA-Binding Protein 194

Immunoprecipitation Kit (Millipore, MA, USA) according to the manufacturer’s 195

instructions (Moradi et al., 2016). For RIP-Seq analysis, two types of biological 196

replicates of total RNA samples were obtained, one from the input group (lysate) and 197

one from the FMRP group (lysate incubated with anti-FMRP antibody and magnet). 198

Biological replicates were then submitted to Novogene (Beijing, China) for 199

sequencing. The cDNA library synthesis from total RNA combined with FMRP was 200

carried out according to the manufacturer’s protocols (Illumina, San Diego, CA, 201

USA). To identify FMRP binding sites on ICAM5 mRNA, we used 202

Crosslinking-Immunprecipitation and High-Throughput sequencing (HITS-CLIP) 203

with MEME and Dreme software (Bailey et al., 2009) to analyze and then Tomtom 204

software (Gupta, Stamatoyannopoulos, Bailey, & Noble, 2007) to compare the 205

existing motifs in the database. 206

207

11 11

Stereotactic surgery and virus injection 208

Mice were anesthetized with isoflurane and placed in a stereotaxic apparatus (Item: 209

68030, RWD, Shenzhen, China). To suppress ICAM5 expression in dentate gyrus 210

(DG), AAV-ICAM5 shRNA-EGFP (BrainVTA Co., Ltd., Wuhan, China) was injected 211

into the either DG (the anterior-posterior coordinate was -1.70 mm, and the lateral 212

position was ± 1.20 mm) of one-month-old Fmr1 KO mice. Four weeks after virus 213

injection, mice were submitted to the following tests. 214

215

Slice physiology 216

Slices (400 μm) were obtained from virus or vector infected Fmr1 KO male mice. 217

Mice were anesthetized with isoflurane and rapidly decapitated, and brains were 218

quickly removed and transferred into ice-cold artificial cerebrospinal fluid (ACSF) 219

containing the following (in mM): 124 NaCl, 26 NaHCO3, 3 KCl, 2 CaCl2, 1 MgCl2, 220

1.25 KH2PO4, and 10 glucose, pH 7.4 (oxygenated with 95% O2 and 5% CO2). Slices 221

were cut in ice-cold dissection solution with a vibrating blade microtome, and 222

incubated in an interface chamber for 0.5 h at 34–36°C and 1h at room temperature. 223

The 64-channel multi-electrode (MED64) system (Alpha MED Sciences, Tokyo, 224

Japan) was used to record field excitatory postsynaptic potentials (fEPSPs) as 225

previously described(Chang et al., 2015; Chin-Wei, Yi-Jung, Jing-Jane, & 226

Chao-Ching, 2010). Slices were placed on the top of the 8×8 microelectrode arrays 227

(MED-P515A probe), incubated with continuously infused ACSF at 34°C at the flow 228

rate of 2 mL/min. Stimuli was delivered to the slice via one selected site and the 229

intensity were calculated by 50% of the maximal synaptic response determined by 230

12 12

input-output curves, while the response microelectrodes were used to record the 231

fEPSPs. A LTD was induced with low-frequency stimulation (1 Hz, 900 pulses). 232

Spontaneous excitatory postsynaptic currents (sEPSC) were collected from granular 233

cells in the hippocampal DG using conventional whole cell recording techniques with 234

a Multiclamp 700B amplifier connected to a 1550B A/D board and Clampex 10 235

program suite (Molecular Devices, Sunnyvale, CA). Intracellular solution contained 236

(in mM): 150 KCl, 10 HEPES, 4Mg2ATP, 0.5 NaGTP, 10 phosphocreatine, and 0.2% 237

biocytin or 135 K-gluconate, 15 KCl, 5 NaCl, 0.5 EGTA, 10 HEPES, 2Mg2ATP, and 238

0.2% biocytin, pH 7.3 and 270-290 mOsm, 3–7 MΩ resistance. sEPSC were collected 239

in voltage clamp mode at a holding potential value of -70 mV at a temperature of 240

30-32 °C. Using the template-based analysis feature of Clampfit 10.0, sEPSC events 241

were collected and analyzed. Access resistance was monitored throughout the 242

experiment and data from experiments were excluded if the access resistance or the 243

input resistance changed more than 20% during the experiment. 244

245

Behavioral tests 246

Morris water maze (MWM) test and fear conditioning paradigm test were used to 247

assess spatial learning, fear learning, and memory as previously described (Zeng et 248

al., 2012). Open field (OF) test and elevated plus maze (EPM) tests were used to 249

characterize the mice’s locomotor and anxiety-like behaviors (Gao et al., 2015). 250

Social interaction test was performed with a three-chamber device as previously 251

reported (Tabuchi et al., 2007). After 5 min habituation, the testing mouse was placed 252

in the middle chamber first, a strange mouse S1 that had no prior contact with the 253

13 13

testing mouse was placed in right side chamber while left side chamber was empty in 254

the session 1. Then testing mouse was tested in session 2 with another strange mouse 255

(S2), but in left chamber, while the right chamber was empty. In the session 3, the 256

testing mouse had options between the first already-investigated S1 and a new strange 257

mouse (S3). Both doors to the side chambers were then unblocked and the subject 258

mouse was allowed to explore the entire social test box for 10 minutes in each 259

session. 260

261

Experimental design and statistical analysis 262

Fmr1 KO and age matched WT male mice were used in all experiments. In all cases, 263

4 or more animals of the same age and genotype were used for each parameter. Each 264

neuron was considered as an individual data point for dendritic morphological and 265

electrophysiological experiments. For western blot and behavioral test, n values 266

(number of animals) were reported. Statistical analyses were done using Microsoft 267

Excel and SPSS 16.0 software. For the comparison between two groups, data were 268

analyzed with unpaired two-tailed Student’s t test. One-way ANOVA and two-way 269

ANOVA followed by Bonferroni’s post hoc tests were performed for multiple 270

comparisons. The statistical test and sample size (n) for each experiment were 271

specified in the figure legends. Data were presented as mean ± SEM, with p < 0.05 272

being considered statistically significant. 273

274

14 14

Results 275

Lack of FMRP in Fmr1 KO mice results in changed ICAM5 expression and 276

immature thin spines 277

We first examined the expression of ICAM5 expression in the developing prefrontal 278

cortex, hippocampus and amygdala (Fig. 1A) in WT and Fmr1 KO mice. In Fmr1 KO 279

mice, ICAM5 expression was increased during late brain development from P21 till 280

P90 when the mice developed a mature hippocampus (Fig. 1A and B), while in 281

prefrontal cortex and amygdala, the expression of ICAM5 was also found increased 282

since P21 (Fig. 1A). At P21, ICAM5 expression in Fmr1 KO mice was increased up 283

to 20% ± 1.9% (p =0.0034) relative to that in WT hippocampus, up to 27% ± 1.5% in 284

the prefrontal cortex, and 25% ± 1.9% in the amygdala. However, the ICAM5 mRNA 285

level at P21 was unchanged in the prefrontal cortex, the hippocampus, or the 286

amygdala (Fig. 1C), suggesting a translational disorder of ICAM5 mRNA in Fmr1 287

KO mice. In accordance with this, polyribosome fractionation analysis showed that 288

ribosome-bounded ICAM5 mRNA was significantly increased (39% ± 1.8%, p = 289

0.0051) in 3 weeks Fmr1 KO hippocampus (Fig. 1D) compared to WT, further 290

suggesting a potential role of FMRP on ICAM5 translation. 291

As ICAM5 negatively regulates dendritic spine maturation and facilitates 292

immature spine formation (Conant et al., 2011), we examined the dendritic spines of 293

Golgi-impregnated Fmr1 KO and WT neurons. As shown in Fig. 1 (F and G), spine 294

number and length measurements were significant higher in KO compared to those in 295

WT hippocampus neurons at P21 (40% ± 2.8%, p = 0.039; 43% ± 1.7%, p = 0.0032). 296

The same tendency was also found in the prefrontal cortex and the amygdala (data not 297

shown), indicating a spine overproduction in FXS. Concomitantly, during P21 and the 298

later brain development, WT spines exhibited a steady state, whereas Fmr1 KO spines 299

15 15

remained at pre-pruning levels. As shown in Fig. 1H, at P21, the percentages of 300

immature thin and stubby spines in the Fmr1 KO hippocampus were significantly 301

higher than that in WT (26% ± 3.1%, p = 0.0071), while mature mushroom-shaped 302

spines were significantly decreased (34% ± 2.7%, p = 0.0051). These results showed a 303

developmental delay in the down regulation of spine turnover and in the transition 304

from immature to mature spine subtypes, which matches the time course and reported 305

role of ICAM5 overexpression in the literature (Raemaekers et al., 2012). 306

307

Reduction of ICAM5 normalizes dendritic spine abnormalities in Fmr1 KO 308

neurons 309

To verify the involvement of ICAM5 in dendritic spines, we suppressed ICAM5 310

expression in Fmr1 KO neurons and compared with neurons transfected empty 311

lentiviral vectors (Mock). As shown in Fig. 2 A and B, ICAM5 protein level in Fmr1 312

KO neurons was significantly decreased by ICAM5 shRNA (45% ± 1.6%, p = 0.0114), 313

validating ICAM5 protein suppression. The total spine number was not modified by 314

ICAM5 suppression (Fig. 2C and D). However, the thin spines in ICAM5 shRNA 315

Fmr1 KO neurons were fewer than those in controls (39% ± 2.4%, p = 0.0143, Fig. 316

2C and F), and no significant changes in stubby spines, while the mushroom spines 317

increased (23% ± 2.6%, p = 0.0289), which suggests that ICAM5 suppression 318

attenuated the aberrant maturation of dendritic spines in Fmr1 KO neurons. In 319

addition, the mean length of all spine types was significantly decreased (18% ± 1.8%, 320

p = 0.0153, Fig. 2E). Together, these data demonstrate that the overexpression of 321

ICAM5 in FXS is positively related to the abnormal dendritic spine length and 322

maturation in Fmr1 KO neurons. 323

324

16 16

FMRP affects ICAM5 protein expression and dendritic morphology in cultured 325

neurons 326

To identify whether the increased ICAM5 protein level in Fmr1 KO mice resulted 327

from the loss of FMRP, we modified the FMRP protein levels in WT and KO neurons 328

and examined the alterations in ICAM5 expression and dendritic morphology. Two 329

days after transfection with lentiviral vector, FMRP and ICAM5 expression was tested 330

by western blotting. As shown in Fig. 3, the ICAM5 protein level was negatively 331

correlated with the FMRP level. In WT neurons, ICAM5 was significantly increased 332

(30% ± 1.5%, p = 0.0342, Fig. 3A and B) by FMR1 interference, and ICAM5 mRNA 333

kept unchanged (Fig. 3C, p = 0.0924). Whereas FMR1 overexpression significantly 334

decreased ICAM5 in KO neurons (35% ± 1.2%, p = 0.0272, Fig. 3I and J), without 335

affecting ICAM5 mRNA (Fig. 3K, p =0.0853). However, polyribosome fractionation 336

analysis showed that ribosome-bounded ICAM5 mRNA was significantly increased 337

(23% ± 1.3%, p = 0.0283) after FMR1 interference in WT neurons (Fig. 3D), and the 338

consistently FMR1 overexpression resulted in reduced ribosome-bounded ICAM5 339

mRNA in KO neurons (32% ± 2.0%, p = 0.0121, Fig. 3L), indicating the role of 340

FMRP on ICAM5 translation. 341

To further examine the translational effect of FMR1 on dendritic morphology, we 342

observed spine morphology 7 days after FMR1 shRNA or Ovp-FMR1 lentiviral 343

transfection. Spine length was significantly elongated in FMR1 knock-down WT 344

neuron (28% ± 2.9%, p = 0.0204, Fig. 3E and G) and shortened in FMR1 345

overexpression KO neuron (18% ± 3.1%, p = 0.0294, Fig. 3M and O). Furthermore, 346

the percentage of thin spines in FMR1 knock-down WT neurons increased 47% ± 347

2.7% (p = 0.0113) than that in controls (Fig. 3H), while the percentage of mushroom 348

spines significantly reduced (44% ± 3.3%, p = 0.0192). By contrast, the percentage of 349

17 17

thin spines decreased in FMR1 overexpressed KO neurons (33% ± 2.8%, p = 0.0221, 350

Fig.3M and P) and the mushroom spines increased (29% ± 3.3%, p = 0.0382). These 351

results indicate that FMRP-related ICAM5 protein expression corresponds with 352

dendritic spine morphology, although the total number of dendritic spines was not 353

changed (Fig. 3 F and N). Given the role of ICAM5 in dendritic spine formation and 354

maturation as reported in the literature (Tim et al., 2012) and confirmed in this study 355

(Fig. 2), we hypothesize that FMRP directly affects ICAM5 expression, which 356

consequently influences spine morphology. 357

358

FMRP directly binds to ICAM5 mRNA in vitro 359

To determine whether ICAM5 mRNA is a FMRP target, we tested FMRP/ICAM5 360

mRNA interaction in vitro with RIP followed by qRT-PCR and DNA gel 361

electrophoresis. As shown in Fig. 4A and B, ICAM5 mRNA appeared in the FMRP 362

antibody extracted group and the total input group, but not in the IgG extracted or 363

Blank (no template PCR control) groups, indicating a direct binding of FMRP to 364

ICAM5. 365

HITS-CLIP results show that ten FMRP-connected mRNA motifs were 366

frequently detected, and six of them were highly matched with the ICAM5 mRNA 367

sequence (Fig. 4C and D). Namely, they were AGACMMM, RAAAAWC, 368

ARAAAAW, CACAGCA, SCVAVCH, and TSKGGKC (M=A/C, R=A/G, W=A/T, 369

K=G/U, S=G/C, V=G/A/C and H=A/T/C). Within the ICAM5 mRNA, 93% of the six 370

motifs appeared within the coding sequence (CDS) (Fig. 4D). Most of them located 371

very close to one another, and some are overlapped (data not shown). Gene Ontology 372

(GO, http://www.geneontology.org/) was used to gain insight into the biological 373

functions encoded by the FMRP target transcripts. As seen in Fig. 4E, the FMRP 374

18 18

target transcripts were mainly located around the nucleus and membrane-bounded 375

organelles, suggesting the direct biological modulating role of FMRP on ICAM5. 376

377

Genetic reduction of ICAM5 in DG corrects behavioral deficits in FXS 378

To evaluate the functional relevance of elevated ICAM5 expression in FXS, we 379

examined spatial and fear memory and exploratory and anxiety-like behaviors in 380

Fmr1 KO and ICAM5 knock-down (AAV-ICAM5 shRNA-EGFP) Fmr1 KO mice, 381

and compared their performance with WT, ICAM5 knock-down WT, and adenovirus 382

empty vector (AAV-EGFP) transfected Fmr1 KO and WT mice. 383

We first evaluated spatial memory with the hidden platform Morris water maze 384

(MWM). During the training sessions, KO mice showed significantly longer escape 385

latencies than WT, but the latency was shortened in ICAM5 shRNA KO mice (Fig. 386

5A). After 5 days of training, spatial memory retention was evaluated by removing the 387

hidden platform. KO mice (39% ± 2.3%, p = 0.0255, to WT) showed no preference 388

for the correct quadrant, whereas both the WT and ICAM5 shRNA KO groups spent 389

more time in the correct quadrant (Fig. 5B) and crossed the previous hidden platform 390

location more frequently (Fig. 5C), which suggested impairment of spatial memory 391

performance of Fmr1 KO mice and corrected by reduction of ICAM5 expression. WT 392

mock and ICAM5 shRNA WT mice exhibited no difference from WT. Besides, at the 393

visible-platform test, all group of mice showed comparable escape latency and 394

swimming speed (data not shown), suggesting a comparable motor and visual 395

function among the different mice, and no change in vision or swimming speed was 396

found that could influence the behavioral tests. 397

The social interaction test was performed as shown in the schematic drawing 398

(Fig. 5D). After habituation, all mice presented a preference for strange mouse, S1 in 399

19 19

session 1 and for S2 in session 2, over Blank (data not shown). However, in session 3 400

WT and ICAM5 shRNA KO mice showed a preference for new strange mouse S3, 401

instead of re-put strange mouse S1 (Fig. 5E, 54% ± 2.9%, p = 0.0130; 50% ± 2.0%, p 402

= 0.0183). However KO and KO Mock groups did not showed the preference (p = 403

0.6364 and p = 0.4272), indicating reduced social interaction and memory in Fmr1 404

KO mice and reversed effect of ICAM5 reduction. WT mock and ICAM5 shRNA WT 405

mice showed no difference from WT. 406

For the fear conditioning learning test, during the second and third tone-shock 407

pairs (Fig. 5F), freezing time was decreased about 50% ± 3.5% (p = 0.0065) in KO 408

mice relative to WT. During the intermission, KO mice also showed less freezing time, 409

suggesting impaired fear memory (Fig. 5G, p = 0.0124). A day after the contextual test, 410

KO mice continued to exhibit less freezing time (Fig. 5H, p = 0.0219) when delivered 411

into the contextual fear conditioning environment. There was also decreased memory 412

consolidation for cued fear conditioning (Fig. 5I, p = 0.0153) two hours after the 413

contextual fear conditioning test. All above impaired memory related behaviors were 414

improved in ICAM5 shRNA KO mice compared to KO mice, during the contextual 415

test (Fig. 5G, p = 0.0166), in the conditioning environment (Fig. 5H, p = 0.0138) and 416

cued fear condition (Fig. 5I, p = 0.0247), whereas WT mock and ICAM5 shRNA WT 417

mice had no difference from WT. 418

In addition, the mice were then tested for exploratory behavior in open field (OF) 419

test (Fig. 6A-D). Fmr1 KO mice exhibited longer total travel distance (Fig. 6A, 46% 420

± 2.3%, p = 0.0053), however, less percentage of total distance inside the center than 421

WT (Fig. 6B, 39% ± 2.8%, p = 0.0211), and more percentage of total distance out of 422

center (Fig. 6C, 21%, p = 0.0283), and more number of times across the edges (Fig. 423

6D, 58% ± 1.9%, p = 0.0315). The results suggested a significantly elevated 424

20 20

exploration activity and unconditioned anxiety-related behavior in Fmr1 KO mice, 425

which was reversed by DG ICAM5 knockdown for total travel distance (Fig. 6A, 38% 426

± 3.6%, p = 0.0032), center distance (Fig. 6B, 24% ± 2.1%, p = 0.0455), out-of-center 427

distance (Fig. 6C, 21%, p = 0.0365) and times across the edges (Fig. 6D, 57% ± 4.4%, 428

p = 0.0024). In elevated plus-maze (EPM) test, Fmr1 KO mice also showed impaired 429

anxiety-like behavior. Fmr1 KO mice displayed less time spent in and fewer times 430

entered the closed arms (Fig. 6E and F, 35% ± 3.7%, p = 0.0145 and 18% ± 2.4%, p = 431

0.0426), which was also recovered in ICAM5 shRNA group (28% ± 1.6%, p = 0.0211 432

and 16% ± 1.5%, p =0.0421). Instead, WT mock and ICAM5 shRNA WT mice 433

showed no difference from WT in OF and EPM test. 434

After the behavioral tests, mice were sacrificed, and their brains were collected 435

for detecting transfection efficiency and ICAM5 expression. The ICAM5 protein level 436

in the Fmr1 KO hippocampus was significantly decreased by ICAM5 shRNA 437

intervention (43% ± 1.1%, Fig. 6G and H). Moreover, the large amount of EGFP 438

expression showed that AAV-ICAM5 shRNA-EGFP was successfully transfected into 439

the dentate gyrus (Fig. 6I), validating ICAM5 protein suppression. Surprisingly, both 440

granule cells (GCs) and mossy cells (MCs) were transfected with a relative rate of 441

1.32 ± 0.15, accounting for 56.94% ± 2.96 % and 43.06% ± 2.32 % of total 442

transfected cells. 443

In order to investigate the electrophysiological modification after ICAM5 444

suppression, sEPSC was recorded on the EGFP expressed neurons after Mock or 445

ICAM5 shRNA injection. Compared with the Mock group, ICAM5 shRNA 446

intervention significantly increased the amplitude of sEPSC (Fig. 6J and K, p = 447

0.0160) without changing the frequency (Fig. 6J and K) in GCs, which was consistent 448

with the results of morphological maturation of the dendritic spines (Fig. 2F). Besides, 449

21 21

ICAM5 shRNA intervention significantly rescued the impaired synaptic plasticity, 450

where the classic abnormal LTD is improved (Fig. 6L, p = 0.0032). Although, we did 451

not observe significant difference in LTP between Fmr1 KO and WT mice (data not 452

shown), which is also found by many groups based on different experimental 453

conditions (John, Jessen, Daniel, Fine, & Johann, 2005; Perez Velazquez, 2002). 454

455

Discussion 456

The present study verified for the first time the novel FMRP target ICAM5 mRNA 457

and explored its contribution to spine abnormalities and behavioral defects in FXS. 458

We found that the loss of FMRP relieves its direct binding with ICAM5 mRNA and 459

induces ICAM5 overexpression, which is translationally related to dendritic spine 460

morphological abnormalities in Fmr1 KO neurons. Viral intervention of ICAM5 461

expression in DG reverses the cognitive deficits in the FXS mouse model Fmr1 KO 462

mice, demonstrating the therapeutic value of ICAM5 for treating cognitive 463

dysfunctions in FXS. To our knowledge, this is the first study that detected the role of 464

ICAM5 in cognitive function in vivo. 465

A salient neuropathological defect in FXS is dendritic spine dysgenesis, but its 466

underlying mechanism is still unclear. Previous reports indicate that FMRP regulates 467

the expression of synaptic proteins including PSD-95, CaMKIIα, and MAP1B(R. B. 468

Darnell, 2010; Hou et al., 2006; Kao, Aldridge, Weiler, & Greenough, 2010; Lu & 469

Kunkel, 2004; Mcmahon & Rosbash, 2016; Zalfa et al., 2007). ICAM5 is also 470

reported to promote spine outgrowth via homophilic binding(Li et al., 2000; Recacha 471

et al., 2014), via ICAM5-ERM (ezrin/radixin/moesin) interaction and ectodomain 472

interaction with β1 integrins (Yang, 2012). The homophilic adhesion of ICAM5 473

mediates induction of dendritic outgrowth (Li et al., 2000), since the ICAM5 474

22 22

cytoplasmic region binds ERM family proteins that link membrane proteins to actin 475

cytoskeleton(Yutaka et al., 2007), while the ICAM5 and β1 interaction via the two 476

first Ig-domains stimulates cofilin phosphorylation and facilitates MMP-dependent 477

spine maturation(Conant et al., 2011; Lin et al., 2013). However, ICAM5, the direct 478

negative regulator of dendritic spine maturation has never been examined in FXS. 479

ICAM5 is expressed at low levels in embryos but rapidly increased after birth when 480

large numbers of synapses are formed (H. Matsuno et al., 2006). During spine 481

maturation, ICAM5 expression gradually decreases (H. Matsuno et al., 2006), which 482

is also observed in our results with age. However, in Fmr1 KO mice, since postnatal 483

day 21, ICAM5 was more abundantly expressed than in WT, which is consistent with 484

the timing of increased thin spines and decreased mushroom spines. Besides, reduced 485

ICAM5 expression resulted in spine maturation (Fig. 2F) and synaptic response (Fig. 486

6J-L) in Fmr1 KO neurons, indicating the involvement of ICAM5 in KO neuron spine 487

formation. Regarding the reported effect of ICAM5 in spine pruning and formation 488

(H. Matsuno et al., 2006), these results indicated a critical role of ICAM5 in FXS 489

spine maturation and brain development. Considering that ICAM5 increases since 490

P21, the alterations in spine length and number at P14 indicating the existence of 491

multiple mechanisms in FXS spine abnormality. 492

FMRP is a RNA-binding protein controlling mRNA translation by promoting 493

their dynamic transport and stalling their translation (Jennifer C Darnell & Klann, 494

2013; J. C. Darnell et al., 2011). Most of the previous studies supported that FMRP 495

binds to a large number of mRNAs (J. C. Darnell et al., 2011). Our results showed 496

that ICAM5 expression is excessively expressed in Fmr1 KO mice, and the 497

expression of FMRP was negatively correlated with the expression of ICAM5. 498

Further experiment indicated that FMRP interacts directly with ICAM5 mRNA, 499

23 23

which is consistent with the findings of Darnel et al (J. C. Darnell et al., 2011). 500

Besides, FMRP bound ICAM5 mRNA predominantly in the coding regions, and 501

mainly located around the nucleus and membrane-bounded organelles. FMRP is well 502

known for binding proteins and RNA, in turn regulating RNA processing and 503

metabolism (Zhang et al., 2015), which corresponds with the biological modulation of 504

FMRP on ICAM5 mRNA in our study. These results indicate the overexpressed 505

ICAM5 attributed to the loss of FMRP in FXS. 506

Since both ICAM5 (Mizuno, Yoshihara, Inazawa, Kagamiyama, & Mori, 1997) 507

and FMRP (Hinds et al., 1993) are highly expressed in the cortex and amygdala in 508

WT mice, besides hippocampus we also detected ICAM5 expression in the cortex and 509

amygdala in FXS. The results are consistent in all three regions that ICAM5 was 510

excessively expressed in Fmr1 KO mice, indicating that loss of FMRP induced 511

ICAM5 overexpression could lead to a potential broad pathological consequence in 512

the mammalian brain and FXS. Indeed, we found remarkable numbers of immature 513

spines in neurons from these three regions. The overexpressed ICAM5 corresponded 514

the timing of increased thin spines and decreased mushroom spines. All these results 515

indicate a potential broad role of ICAM5 in the mammalian brain and FXS. 516

The role of ICAM5 is well studied for the last decade, however, the therapeutic 517

role of ICAM5 is still unclear, e.g. if abnormal ICAM5 expression could influence 518

any behavioral disorders in vivo is never studied. Our results indicated that ICAM5 519

knock-down reversed behavioral disorders in Fmr1 KO mice. Intellectual disability is 520

a characteristic phenotypic feature of FXS, which is not fully understood and cannot 521

be improved by current medication. As reported by many research groups, Fmr1 KO 522

mice exhibited impaired memory and exploratory and anxiety-like behaviors(Baker et 523

al., 2010; Spencer, Alekseyenko, Serysheva, Yuva-Paylor, & Paylor, 2010), which 524

24 24

were ameliorated in some degree by lowering ICAM5 expression in DG, a pivotal 525

area connecting amygdala and prefrontal cortex (Zancadamenendez, Alvarezsuarez, 526

Sampedropiquero, Cuesta, & Begega, 2017). Interestingly, ICAM5 suppression did 527

not change the behavior in WT mice. It has been reported that ICAM5-deficient mice 528

showed a decreased density of filopodia and an acceleration of spine maturation in 529

vitro and in vivo(Matsuno & H., 2006). However, it is unclear that if 530

ICAM5-deficient mice exhibit behavior change, and it could be interesting for future 531

study to evaluate the effect of ICAM5 suppression in normal WT mice. Thus, 532

overexpression of ICAM5 in postnatal development in Fmr1 KO mice may be a 533

neurobiological mechanism for FXS pathological phenotypes and a therapeutic target 534

for treatment of FXS cognitive impairment. 535

GCs and MCs are two excitatory cell types of the DG. The GC bodies form the 536

granule cell layer, while the MCs are located only in hilus and are the most common 537

cells in polymorphic layer(Amaral, Scharfman, & Lavenex, 2007). MCs excite or 538

inhibit GCs through direct inputs(Soriano & Frotscher, 1994) or interneurons 539

activation(H. E. Scharfman, 1995), and precede GCs in detecting changes and help 540

expand the range of GC pattern separation(Jung et al., 2019). The understanding of 541

MCs in DG function is limited, but their contributions to behavior have been proposed 542

including memory, novelty and anxiety(Scharfman & E., 2016). It is still unclear that 543

if MCs are involved in the spine dysgenesis and pathophysiology in FXS. Our results 544

indicated that both GCs and MCs were transfected, with a relative rate of 1.32 ± 0.15. 545

After ICAM5 intervention the sEPSC amplitude was increased in Fmr1 KO GCs, 546

probably induced by direct dendritic spine maturation or by the enhanced excited 547

inputs from MCs. Furthermore, ICAM5 intervention in MCs could also contribute to 548

the reversed behavior disorder in KO mice. However, the proportional contribution 549

25 25

for GCs and MCs is still unknown. Future experiments using cell-type specific 550

inactivation might directly test MC contribution to FXS. 551

In summary, our results suggest that ICAM5 is an mRNA target of FMRP and 552

plays a critical role in the spine dysgenesis and pathophysiology of FXS. FMRP could 553

regulate translational events involved in the synthesis of ICAM5 probably via direct 554

binding and concomitantly influences dendritic spine development and disease 555

severity. Genetic ICAM5 intervention attenuated behavioral deficits in Fmr1 KO mice, 556

which may provide therapeutic benefits in the treatment of FXS cognitive impairment 557

and other NDDs. 558

559

26 26

Reference 560

Amaral, D. G., Scharfman, H. E., & Lavenex, P. (2007). The dentate gyrus: fundamental 561 neuroanatomical organization (dentate gyrus for dummies), 163(4), 3 562

Antar, L. N., Dictenberg, J. B., Plociniak, M., Afroz, R., & Bassell, G. J. (2005). Localization of 563 FMRP-associated mRNA granules and requirement of microtubules for activity-dependent 564 trafficking in hippocampal neurons. Genes Brain & Behavior, 4(6), 350-359 565

Bailey, T. L., Boden, M., Buske, F. A., Frith, M., Grant, C. E., Clementi, L., . . . Noble, W. S. (2009). 566 MEME Suite: tools for motif discovery and searching. Nucleic Acids Research, 37(Web 567 Server issue), 202-208 568

Baker, K. B., Wray, S. P., Ritter, R., ., Mason, S., ., Lanthorn, T. H., & Savelieva, K. V. (2010). Male 569 and female Fmr1 knockout mice on C57 albino background exhibit spatial learning and 570 memory impairments. Genes Brain & Behavior, 9(6), 562-574 571

Bassell, G. J., & Warren, S. T. (2008). Fragile X Syndrome: Loss of Local mRNA Regulation Alters 572 Synaptic Development and Function. Neuron, 60(2), 201 573

Bourgeron, T. (2009). A synaptic trek to autism. Current Opinion in Neurobiology, 19(2), 231 574 Brown, V., & Huynh, M. (2001). Interactive CD-ROM: making learning easier. Collegian, 8(1), ii-iv 575 Calabrese, B., Wilson, M. S., & Halpain, S. (2006). Development and regulation of dendritic spine 576

synapses. Physiology, 21(2), 38-47 577 Chang, H. K., Kim, K. H., Kang, K. W., Kang, Y. J., Kim, T. W., Park, H. K., . . . Kim, C. J. (2015). 578

Antidepressants modulate glycine action in rat hippocampus. Journal of Exercise 579 Rehabilitation, 11(6), 311-319 580

Chen, Q. Y., Li, J., Sun, H., Wu, F., Zhu, Y., Kluz, T., . . . Murphy, A. (2018). Role of miR-31 and 581 SATB2 in arsenic-induced malignant BEAS-2B cell transformation. Molecular 582 Carcinogenesis 583

Cheng, C., Trzcinski, O., & Doering, L. C. (2014). Fluorescent labeling of dendritic spines in cell 584 cultures with the carbocyanine dye “DiI”. Frontiers in Neuroanatomy, 8(8), 30 585

Chin-Wei, H., Yi-Jung, H., Jing-Jane, T., & Chao-Ching, H. (2010). Effects of lamotrigine on field 586 potentials, propagation, and long-term potentiation in rat prefrontal cortex in multi-electrode 587 recording. Journal of Neuroscience Research, 83(6), 1141-1150 588

Conant, K., Lonskaya, I., Szklarczyk, A., Krall, C., Steiner, J., Maguire Zeiss, K., & Lim, S. T. 589 (2011). Methamphetamine associated cleavage of the synaptic adhesion molecule 590 intercellular adhesion molecule 5. Journal of Neurochemistry, 118(4), 521-532 591

Darnell, J. C., & Klann, E. (2013). The translation of translational control by FMRP: therapeutic targets 592 for FXS. Nature Neuroscience, 16(11), 1530 593

Darnell, J. C., Van Driesche, S. J., Zhang, C., Hung, K. Y., Mele, A., Fraser, C. E., . . . Chi, S. W. 594 (2011). FMRP stalls ribosomal translocation on mRNAs linked to synaptic function and 595 autism. Cell, 146(2), 247-261 596

Darnell, R. B. (2010). HITS-CLIP: panoramic views of protein-RNA regulation in living cells. Wiley 597 Interdisciplinary Reviews Rna, 1(2), 266-286 598

Davis, J. K., & Broadie, K. (2017). Multifarious Functions of the Fragile X Mental Retardation Protein. 599 Trends in Genetics 600

27 27

De, R. S., Fernández, E., Buzzi, A., Di, M. D., & Bagni, C. (2012). Molecular and cellular aspects of 601 mental retardation in the Fragile X syndrome: from gene mutation/s to spine 602 dysmorphogenesis. Advances in Experimental Medicine & Biology, 970, 517 603

Gao, L., Tian, M., Zhao, H. Y., Xu, Q. Q., Huang, Y. M., Si, Q. C., . . . Sun, L. B. (2015). TrkB 604 activation by 7, 8 dihydroxyflavone increases synapse AMPA subunits and ameliorates 605 spatial memory deficits in a mouse model of Alzheimer's disease. Journal of Neurochemistry, 606 136(3), 620 607

Gupta, S., Stamatoyannopoulos, J. A., Bailey, T. L., & Noble, W. S. (2007). 2007 Gupta et Volume al. 608 8, Issue 2, Article R24 Open Access Method Quantifying similarity between motifs. Genome 609 Biology, 8(2), 90-105 610

Hinds, H. L., Ashley, C. T., Sutcliffe, J. S., Nelson, D. L., Warren, S. T., Housman, D. E., & Schalling, 611 M. (1993). Tissue specific expression of FMR-1 provides evidence for a functional role in 612 fragile X syndrome 613

Hou, L., Antion, M. D., Hu, D., Spencer, C. M., Paylor, R., & Klann, E. (2006). Dynamic translational 614 and proteasomal regulation of fragile X mental retardation protein controls mGluR-dependent 615 long-term depression. Neuron, 51(4), 441-454 616

Hozumi, Y., Ito, T., Nakano, T., Nakagawa, T., Aoyagi, M., Kondo, H., & Goto, K. (2003). Nuclear 617 localization of diacylglycerol kinase zeta in neurons. European Journal of Neuroscience, 618 18(6), 1448–1457 619

Irwin, S. A., Patel, B., Idupulapati, M., Harris, J. B., Crisostomo, R. A., Larsen, B. P., . . . Kozlowski, P. 620 B. (2001). Abnormal dendritic spine characteristics in the temporal and visual cortices of 621 patients with fragile-X syndrome: a quantitative examination. American Journal of Medical 622 Genetics, 98(2), 161–167 623

John, L., Jessen, R. E., Daniel, K., Fine, A. K. S., & Johann, D. H. (2005). Age-dependent and selective 624 impairment of long-term potentiation in the anterior piriform cortex of mice lacking the fragile 625 X mental retardation protein. Journal of Neuroscience, 25(41), 9460-9469 626

Jr, A. M., Mukherjee, N., Bandaru, P., Miller, J. B., Nusbaum, J. D., Corcoran, D. L., . . . Hafner, M. 627 (2012). FMRP targets distinct mRNA sequence elements to regulate protein expression. 628 Nature, 492(7429), 382 629

Jung, D., Kim, S., Sariev, A., Sharif, F., Kim, D., & Royer, S. (2019). Dentate granule and mossy cells 630 exhibit distinct spatiotemporal responses to local change in a one-dimensional landscape of 631 visual-tactile cues. Sci Rep, 9(1), 9545. doi: 10.1038/s41598-019-45983-6 632

Kao, D. I., Aldridge, G. M., Weiler, I. J., & Greenough, W. T. (2010). Altered mRNA transport, 633 docking, and protein translation in neurons lacking fragile X mental retardation protein. 634 Proceedings of the National Academy of Sciences of the United States of America, 107(35), 635 15601 636

Li, T., Henrietta, N., Patrick, K., Yoshihiro, Y., Kensaku, M., Andersson, L. C., . . . Gahmberg, C. G. 637 (2000). Intercellular Adhesion Molecule-5 Induces Dendritic Outgrowth by Homophilic 638 Adhesion. Journal of Cell Biology, 150(1), 243 639

Lin, N., Li, T., Sergei, S., Helena, V., Olaya, L., Kyle, V., . . . Gahmberg, C. G. (2013). Interactions 640 between ICAM-5 and β1 integrins regulate neuronal synapse formation. Journal of Cell 641 Science, 126(1), 77-89 642

28 28

Lu, R., & Kunkel, L. M. (2004). The fragile X protein controls microtubule-associated protein 1B 643 translation and microtubule stability in brain neuron development. Proceedings of the 644 National Academy of Sciences of the United States of America, 101(42), 15201 645

Matsuno, & H. (2006). Telencephalin Slows Spine Maturation. Journal of Neuroscience the Official 646 Journal of the Society for Neuroscience, 26(6), 1776-1786 647

Matsuno, H., Okabe, S., Mishina, M., Yanagida, T., Mori, K., & Yoshihara, Y. (2006). Telencephalin 648 slows spine maturation. Journal of Neuroscience the Official Journal of the Society for 649 Neuroscience, 26(6), 1776 650

Mcmahon, A. C., & Rosbash, M. (2016). Promiscuous or discriminating: Has the favored mRNA target 651 of Fragile X Mental Retardation Protein been overlooked? Proceedings of the National 652 Academy of Sciences of the United States of America, 113(26), 201607665 653

Melko, M., & Bardoni, B. (2010). The role of G-quadruplex in RNA metabolism: involvement of 654 FMRP and FMR2P. Biochimie, 92(8), 919-926 655

Mitsui, S., Saito, M., Mori, K., & Yoshihara, Y. (2007). A Transcriptional Enhancer That Directs 656 Telencephalon-Specific Transgene Expression in Mouse Brain. Cerebral Cortex, 17(3), 657 522-530 658

Mizuno, T., Yoshihara, Y., Inazawa, J., Kagamiyama, H., & Mori, K. (1997). cDNA Cloning and 659 Chromosomal Localization of the Human Telencephalin and Its Distinctive Interaction with 660 Lymphocyte Function-associated Antigen-1 *. Journal of Biological Chemistry, 272(2), 661 1156-1163 662

Moradi, F., Berglund, P., Linnskog, R., Leandersson, K., Andersson, T., & Prasad, C. P. (2016). Dual 663 mechanisms of action of the RNA-binding protein human antigen R explains its regulatory 664 effect on melanoma cell migration. Translational Research the Journal of Laboratory & 665 Clinical Medicine, 172, 45-60 666

Mori, K., Fujita, S. C., Watanabe, Y., Obata, K., & Hayaishi, O. (1987). Telencephalon-specific antigen 667 identified by monoclonal antibody. Proceedings of the National Academy of Sciences of the 668 United States of America, 84(11), 3921-3925 669

Nakamura, K., Manabe, T., Watanabe, M., Mamiya, T., Ichikawa, R., Kiyama, Y., . . . Nabeshima, T. 670 (2001). Enhancement of hippocampal LTP, reference memory and sensorimotor gating in 671 mutant mice lacking a telencephalon-specific cell adhesion molecule. European Journal of 672 Neuroscience, 13(1), 179-189 673

Niedringhaus, M., Chen, X., Dzakpasu, R., & Conant, K. (2012). MMPs and soluble ICAM-5 increase 674 neuronal excitability within in vitro networks of hippocampal neurons. Plos One, 7(8), e42631 675

Oka, S., Mori, K., & Watanabe, Y. (1990). Mammalian telencephalic neurons express a 676 segment-specific membrane glycoprotein, telencephalin. Neuroscience, 35(1), 93 677

Pasciuto, Emanuela, Bagni, & Claudia. (2014). SnapShot: FMRP mRNA Targets and Diseases. Cell, 678 158(6), 1446-1446 679

Penzes, P., Cahill, M. E., Jones, K. A., Vanleeuwen, J. E., & Woolfrey, K. M. (2011). Dendritic spine 680 pathology in neuropsychiatric disorders. Nature Neuroscience, 14(3), 285 681

Perez Velazquez, J. L. (2002). Reduced cortical synaptic plasticity and GluR1 expression associated 682 with fragile X mental retardation protein deficiency. Molecular & Cellular Neuroscience, 683 19(2), 138-151 684

Portera, C. C., & Yuste, R. (2001). [On the function of dendritic filopodia]. Revista De Neurologia, 685 33(12), 1158 686

29 29

Raemaekers, T., Peric, A., Baatsen, P., Sannerud, R., Declerck, I., Baert, V., . . . Annaert, W. (2012). 687 ARF6-mediated endosomal transport of Telencephalin affects dendritic filopodia-to-spine 688 maturation. Embo Journal, 31(15), 3252–3269 689

Recacha, R., Jiménez, D., Tian, L., Barredo, R., Gahmberg, C. G., & Casasnovas, J. M. (2014). Crystal 690 structures of an ICAM-5 ectodomain fragment show electrostatic-based homophilic 691 adhesions. Acta Crystallographica, 70(7), 1934-1943 692

Scharfman, & E., H. (2016). The enigmatic mossy cell of the dentate gyrus. Nature Reviews 693 Neuroscience, 17(9), 562-575 694

Scharfman, H. E. (1995). Electrophysiological evidence that dentate hilar mossy cells are excitatory 695 and innervate both granule cells and interneurons. Journal of Neurophysiology, 74(1), 179-194 696

Soriano, E., & Frotscher, M. (1994). Mossy cells of the rat fascia dentata are 697 glutamate-immunoreactive, 4(1), 65-69 698

Specchia, V., D'Attis, S., Puricella, A., & Bozzetti, M. P. (2017). dFmr1 Plays Roles in Small RNA 699 Pathways ofDrosophila melanogaster. International Journal of Molecular Sciences, 18(5) 700

Spencer, C. M., Alekseyenko, O., ., Serysheva, E., ., Yuva-Paylor, L. A., & Paylor, R., . (2010). Altered 701 anxiety-related and social behaviors in the Fmr1 knockout mouse model of fragile X 702 syndrome. Genes Brain & Behavior, 4(7), 420-430 703

Tabuchi, K., Blundell, J., Etherton, M. R., Hammer, R. E., Liu, X., Powell, C. M., & Südhof, T. C. 704 (2007). A Neuroligin-3 Mutation Implicated in Autism Increases Inhibitory Synaptic 705 Transmission in Mice. Science, 318(5847), 71-76 706

Tian, M., Zeng, Y., Hu, Y., Yuan, X., Liu, S., Li, J., . . . Fu, D. (2015). 7, 8-Dihydroxyflavone induces 707 synapse expression of AMPA GluA1 and ameliorates cognitive and spine abnormalities in a 708 mouse model of fragile X syndrome. Neuropharmacology, 89, 43-53 709

Tim, R., Aleksandar, P., Pieter, B., Ragna, S., Ilse, D., Veerle, B., . . . Wim, A. (2012). ARF6-mediated 710 endosomal transport of Telencephalin affects dendritic filopodia-to-spine maturation. Embo 711 Journal, 31(15), 3252-3269 712

Wang, T., Bray, S. M., & Warren, S. T. (2012). New perspectives on the biology of fragile X syndrome. 713 Current Opinion in Genetics & Development, 22(3), 256 714

Wijetunge, D. S., Karunathilake, K. H., Chaudhari, A., Katani, R., Dudley, E. G., Kapur, V., . . . 715 Kariyawasam, S. (2014). Complete nucleotide sequence of pRS218, a large virulence plasmid 716 that augments pathogenic potential of meningitis-associated Escherichia coli strain RS218. 717 BMC Microbiology, 14(1), 1-16 718

Yang, H. (2012). Structure, Expression, and Function of ICAM-5. Comparative & Functional 719 Genomics, 2012(3), 368938 720

Yoshihara, Y., & Mori, K. (1994). Telencephalin: a neuronal area code molecule? Neuroscience 721 Research, 21(2), 119-124 722

Yoshihara, Y., Oka, S., Nemoto, Y., Watanabe, Y., Nagata, S., Kagamiyama, H., & Mori, K. (1994). An 723 ICAM-related neuronal glycoprotein, telencephalin, with brain segment-specific expression. 724 Neuron, 12(3), 541 725

Yutaka, F., Hitomi, M., Miwa, K., Takehiko, S., Kensaku, M., & Yoshihiro, Y. (2007). Interaction 726 between telencephalin and ERM family proteins mediates dendritic filopodia formation. 727 Journal of Neuroscience the Official Journal of the Society for Neuroscience, 27(33), 728 8866-8876 729

30 30

Zalfa, F., Eleuteri, B., Dickson, K. S., Mercaldo, V., De, R. S., Di, P. A., . . . Grant, S. G. (2007). A new 730 function for the fragile X mental retardation protein in regulation of PSD-95 mRNA stability. 731 Nature Neuroscience, 10(5), 578 732

Zancadamenendez, C., Alvarezsuarez, P., Sampedropiquero, P., Cuesta, M., & Begega, A. (2017). 733 Requiring collaboration: Hippocampal-prefrontal networks needed in spatial working memory 734 and ageing. A multivariate analysis approach. Neurobiology of Learning & Memory, 140, 735 33-42 736

Zeng, Y., Liu, Y., Wu, M., Liu, J., & Hu, Q. (2012). Activation of TrkB by 7,8-dihydroxyflavone 737 prevents fear memory defects and facilitates amygdalar synaptic plasticity in aging. Journal of 738 Alzheimers Disease Jad, 31(4), 765 739

Zhang, P., Kotb, A., Liu, Y., Kumiko, T. Y., Je-Hyun, Y., Grammatikakis, I., . . . Yang, I. H. (2015). 740 Novel RNA- and FMRP-binding protein TRF2-S regulates axonal mRNA transport and 741 presynaptic plasticity. Nature Communications, 6, 8888 742

743

31 31

Fig. 1 Increased ICAM5 expression and immature spines in Fmr1 KO mice. A. 744

Representative western blotting images and quantification of ICAM5 expression from 745

three brain regions (the PFC, HIPP and AMY) during postnatal developmental stage. 746

B. Representative western blotting images and quantification of ICAM5 expression at 747

P90 in the hippocampus. C. Quantification of ICAM5 mRNA with qRT-PCR in 748

prefrontal cortex, hippocampus and amygdala in Fmr1 KO and WT at P21. D. 749

Relatively more ribosome-bounded ICAM5 mRNA was found in 21-day old Fmr1 750

KO mice. E. Representative photograph of Golgi stained apical dendrites of Fmr1 KO 751

and WT neurons. F and G. Increased spine number and prolonged spine length in 752

Fmr1 KO neurons after Golgi staining (per 10 μm dendrite). H. Dendritic spine 753

classification by morphology in Fmr1 KO and WT hippocampus. N = 480 terminals 754

for WT and n = 493 terminals for Fmr1 KO (6 mice per group). Data are presented as 755

mean ± SEM. *** p < 0.001, ** p < 0.01, *p < 0.05 by unpaired two-tailed Student’s t 756

test; 757

758

Fig. 2 ICAM5 shRNA affected dendritic morphology in cultured Fmr1 KO neurons. 759

A and B. Representative western blotting images of ICAM5 and quantification of 760

ICAM5 expression after transfection. C. Representative dendritic segments from 761

Fmr1 KO neurons after transfection (Dil staining). D and E. Statistical analyses of the 762

number and length of spines per 10 μm dendrite. F. Morphology analyses for thin, 763

mushroom, and stubby shaped spines. N = 506 terminals for KO + Mock and n = 500 764

terminals for KO + ICAM5 shRNA (8 mice each group). Data are presented as mean 765

± SEM; *p < 0.05 by unpaired two-tailed Student’s t test. 766

767

32 32

Fig. 3 FMR1 affected ICAM5 protein expression and dendritic morphology in 768

cultured WT and KO neurons. A-H. FMR1 shRNA transfected cultured WT neurons. 769

A and B. Raised ICAM5 and reduced FMRP expression after FMR1 shRNA 770

transfection. C and D. qRT-PCR analyses of total and ribosome-bounded ICAM5 771

mRNA, respectively. E, F and G. Representative dendritic segments from cultured 772

neurons (E, Dil staining) and statistical analyses of spine number/length (F and G) per 773

10 μm dendrites. H. Dendritic spine classification by morphology after FMR1 774

interference. N = 496 terminals for WT+ Mock, n = 470 terminals for WT+ FMR1 775

shRNA (8 mice per group). I-P. FMR1 overexpression transfected cultured KO 776

neurons. I and J. Representative western blotting images and quantification of 777

ICAM5 and FMRP. K and L. qRT-PCR analyses of total and ribosome-binding 778

ICAM5 mRNA, respectively. M-O. Representative dendritic segments from cultured 779

neurons (Dil staining) and statistical analyses of spine number/length per 10 μm 780

dendrite. P. Dendritic spine classification by morphology after FMR1 overexpression. 781

N = 490 terminals for KO + Mock, and n = 524 terminals for KO+ OVP-FMR1 (8 782

mice per group). Data are presented as mean ± SEM. *** p < 0.001, **p < 0.01, *p < 783

0.05 by unpaired two-tailed Student’s t test. 784

785

Fig. 4 FMRP binding sites on ICAM5 mRNA determined by sequence analysis. A. 786

ICAM5 mRNA was found in FMRP extracted group by qPCR. Negative control: 787

Blank and IgG groups. Positive control: ICAM5 mRNA in lysate input group and U1 788

snRNA in SNRNP70 group. B. DNA gel electrophoresis of the qPCR products of A. 789

33 33

C. Six major ICAM5 RNA recommended segments were inferred as the FMRP 790

binding sites. D. Left: Distribution of the six FMRP binding motifs (a, b, c, d, e, and f) 791

across the representative ICAM5 mRNA. Open boxes and bold lines indicate CDS 792

and untranslated regions (UTRs), respectively. Right: Occurrence frequency of the six 793

motifs in CDS and UTRs. E. The top 3 Gene Ontology (GO) terms enriched in FMRP 794

target transcripts and their GO categories; n = 3, ***p < 0.001 by one-way ANOVA 795

with a Bonferroni post hoc test. 796

797

Fig. 5 ICAM5 knock-down rescued the impaired behavioral performances in Fmr1 798

KO mice. A-C. MWM test. A. Mean escape latency of reaching the submerged 799

platform during the training period. B and C. Time spend in target quadrant and 800

platform crossings after training. D and E. Social interaction test. D. The scheme of 801

the three-chamber social interaction test. E. Contact time of the testing mouse with a 802

strange mouse. F-I Fear conditioning paradigm test. F. Percentage of freezing during 803

the period of associative conditioned stimulus-unconditioned stimulus (CS-US) 804

pairing. G. Averaged freezing time during the intertrial intervals (ITI) of the testing 805

session. H and I. Contextual fear conditioning and cued fear conditioning 24h after 806

CS-US pairing stimulation. N = 6 for WT, n =7 for WT + Mock, n =7 for WT + 807

ICAM5 shRNA, n = 6 for KO, n = 6 for KO + Mock, and n = 6 for KO + ICAM5 808

shRNA. Data are presented as mean ± SEM, two-way ANOVA was used with a 809

Bonferroni post hoc test for statistical analysis. **p < 0.01, *p < 0.05 compared with 810

WT, and ## p < 0.01, # p < 0.05 compared with Fmr1 KO mice. 811

34 34

812

Fig. 6 ICAM5 knock-down improved the locomotor or anxiety-like behaviors in 813

Fmr1 KO mice. A-D. Open-field test. A. Overall distance traveled during the 5-min 814

open-field test. B-C. Percentages of the distance in center area over total distance (B) 815

and peripheral distance over total distance (C). D. Number of times across the cells 816

per min. E and F. Elevated plus maze. E. Times entered into closed arms over total 817

entries into both closed and open arms. F. Percentage of time spent in closed arms. 818

N = 6 for WT, n =7 for WT + Mock, n =7 for WT + ICAM5 shRNA, n = 6 for KO, n 819

= 9 for KO + Mock, and n = 6 for KO + ICAM5 shRNA. **p < 0.01, *p < 0.05 820

compared with WT, and ## p < 0.01, # p < 0.05 compared with Fmr1 KO mice. G and 821

H. ICAM5 expression in hippocampus after ICAM5 knock-down. I. Confocal images 822

(left) of the KO dentate gyrus transfected with ICAM5 shRNA virus (green) and 823

DAPI staining nucleus (blue), while the percentages of transfected GCs and MCs are 824

shown on the right. N = 7. J-K. Example and statistical analyses of sEPSC amplitude 825

and frequency in EGFP expressed neurons in KO mock and KO ICAM5 shRNA mice. 826

N=18 neurons for KO + Mock and n=14 neurons for KO + ICAM5 shRNA (4 mice 827

per group). L. Representative traces before and after LTD induction (left) and mean 828

fEPSP slopes averaged 50-60 min after LTD induction (right). N = 7 for WT, n = 6 for 829

KO + Mock, and n = 5 for KO + ICAM5 shRNA. Data are presented as mean ± SEM, 830

unpaired two-tailed Student’s t test and two-way ANOVA with a Bonferroni post hoc 831

test were used for statistical analysis. **p < 0.01, and *p < 0.05. 832