iai accepts, published online ahead of print on 7 march...

Malaria immunoepidemiology in low transmission: Correlation of infecting 1

genotype and immune response to domains of Plasmodium falciparum Merozoite 2

Surface Protein-3 3

4

Running title: Anti-PfMSP3 antibody responses in the Peruvian Amazon. 5

6

Stephen J. Jordan1,2, Ana L. Oliveira1, Jean N. Hernandez3, Robert A. Oster4, Debasish 7

Chattopadhyay1, OraLee H. Branch5, Julian C. Rayner*1,6 8

9

1William C Gorgas Center for Geographic Medicine, Division of Infectious Diseases, 10

Department of Medicine, University of Alabama at Birmingham, 845 19th Street South, 11

BBRB 568, Birmingham, AL 35294-2170, USA 12

2Department of Cell Biology, University of Alabama at Birmingham, Birmingham, AL 13

35294, USA 14

3Laboratorio de Investigaciones de Productos Naturales y Antiparasitarios, Universidad 15

Nacional de la Amazonia Peruana, Iquitos, Peru 16

4Division of Preventive Medicine, Department of Medicine, University of Alabama at 17

Birmingham, Birmingham, AL 35294, USA 18

5Department of Medical Parasitology, New York University, 341 East 25th Street, Old 19

Public Health Building Rm 210, 606, New York, NY 10010-2533, USA 20

6 Current address: Malaria Programme, Wellcome Trust Sanger Institute, Wellcome 21

Trust Genome Campus, Hinxton, Cambridge CB10 1SA, UK. 22

23

Copyright © 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Infect. Immun. doi:10.1128/IAI.01332-10 IAI Accepts, published online ahead of print on 7 March 2011

on October 29, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

Corresponding Author Contact Information 24

Dr. Julian Rayner, Malaria Programme, Wellcome Trust Sanger Institute, Wellcome 25

Trust Genome Campus, Hinxton, Cambridge CB10 1SA, United Kingdom 26

([email protected], +44 1223 492327 (phone), +44 1223 494919 (fax)) 27


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

ABSTRACT 28

Malaria caused by Plasmodium falciparum is a major cause of global infant mortality, 29

and no effective vaccine currently exists. Multiple potential vaccine targets have been 30

identified and immunoepidemiology studies have played a major part in assessing those 31

candidates. When such studies are carried out in high transmission settings, individuals 32

are often super-infected with complex mixtures of genetically distinct P. falciparum 33

types, making it impossible to directly correlate the genotype of the infecting antigen 34

with the antibody response. By contrast in regions of low transmission P. falciparum 35

infections are often genetically simple, and direct comparison of infecting genotype and 36

antigen-specific immune responses is possible. As a test of the utility of this approach, 37

responses against several domains and allelic variants of the vaccine candidate P. 38

falciparum Merozoite Surface Protein 3 (PfMSP3) were tested in serum samples 39

collected near Iquitos, Peru. Antibodies recognizing both the conserved C-terminal and 40

the more variable N-terminal domain were identified, but anti-N-terminal responses 41

were more prevalent, of higher titers, and primarily of cytophilic subclasses. Comparing 42

antibody responses to different PfMSP3 variants with the PfMSP3 genotype present at 43

the time of infection showed that anti-N-terminal responses were largely allele class-44

specific, but there was some evidence for responses that cross-reacted across allele 45

classes. Evidence for cross-reactive responses was much stronger when variants within 46

one allele class were tested, which has implications for the rational development of 47

genotype-transcending PfMSP3-based vaccines.48


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

INTRODUCTION 49

The effort to develop a vaccine targeting blood stage Plasmodium falciparum 50

parasites, which are responsible for virtually all malaria-related deaths world-wide, has 51

been notably impacted by two recent Phase IIb trials which did not result in detectable 52

protection (21, 27). While disappointing, these results have had the beneficial impact of 53

triggering extensive discussion of how vaccine candidates are selected and what data is 54

necessary to rationally advance them along the vaccine development pipeline (3, 7, 10). 55

These analyses clearly identify genetic diversity as one of the most significant problems 56

in P. falciparum vaccine development. Blood stage vaccine candidates are of particular 57

concern on this score, as they are exposed to the adaptive immune system, a strong 58

selective pressure which can drive genetic diversity (36). Indeed, many blood stage 59

antigens appear to be under balancing selective pressure, suggesting immune 60

responses to them are largely allele specific, and that multiple allelic variants co-61

circulate within a given parasite population (18, 38). 62

Immunoepidemiology studies have been an extremely useful tool in the malaria 63

vaccine development process. However, as the vaccine development process moves 64

forward, there is an urgent need for these studies to tackle the question of genetic 65

diversity and allele-specific immune responses head on. Allele-specific responses are 66

frequently detected using antibody depletion experiments, where antibodies that 67

recognize one antigen are depleted from a serum sample by multiple incubations with 68

that antigen before the presence of antibodies that recognize a different antigen variant 69

are measured. Such studies have been extremely successful, with important 70

implications for vaccine candidates such as AMA1 (23, 24), MSP1 (14, 34) and MSP3 71


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

(4, 22, 25). However, they are not always possible in all studies because of sample 72

volume limitations, particularly when multiple different variants of each antigen are used 73

in separate competition experiments on the same serum sample. 74

An alternative and simple method to detect allele-specific immune responses 75

would be to directly compare the immune response to multiple antigen genotypes with 76

the antigen genotype present in the P. falciparum infection from which the sample has 77

been taken. If an individual serum sample contained antibodies that only recognized the 78

infecting allele type, this would be a strong argument for allele-specificity. Such an 79

approach is clearly difficult in hyperendemic transmission environments, where 80

individuals are routinely infected with multiple overlapping P. falciparum genotypes. By 81

contrast, in hypoendemic environments, where P. falciparum infections are genetically 82

simple and often spaced by several months, the response against both the infecting and 83

non-infecting genotype could be reasonably compared, and a direct correlation between 84

genetic variation and the immune response inferred. In the context of a longitudinal 85

study, where the infection history of each individual is known for an extended period of 86

time, and hence the length of time since they had been exposed to other allelic types is 87

established, that comparison would be even more powerful. 88

To test the validity of this approach we used samples from a longitudinal 89

epidemiological cohort near Iquitos, Peru (1), and investigated responses against P. 90

falciparum Merozoite Surface Protein 3 (PfMSP3). PfMSP3 is encoded by one member 91

of a multi-gene family (30), is expressed on the surface of merozoites (16, 19), and 92

consists of two major domains, a polymorphic N-terminal domain and a relatively 93

conserved C-terminal domain (11, 15). Genetic diversity within the N-terminal domain 94


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

consists of sequence polymorphisms and multiple indel mutations, which define two 95

allele-classes termed 3D7 and K1(6, 11). Antibodies targeting PfMSP3 are associated 96

with long-term clinical protection, and full-length PfMSP3 provides strong protection 97

against homologous challenge in an Aotus monkey model (8, 26). To date, PfMSP3 98

vaccine efforts have so far focused almost exclusively on the C-terminal domain, both 99

because it is highly conserved and because specific sub-regions of the C-terminal 100

domain can generate protective immune responses in vitro (5, 13, 17, 29, 32). However 101

anti-PfMSP3 N-terminal domain antibodies are also able to elicit protective responses 102

(29). 103

As a proof of concept study to test the approach of using sera from genotyped 104

infections in a hypoendemic environment to identify allele-specific immune responses, 105

we tested anti-PfMSP3 antibody responses in samples that had previously been 106

genotyped for their infecting PfMSP3 allele. Responses against both variants of the 107

PfMSP3 N-terminal domain in circulation at the study site were tested, as well as the 108

more conserved C-terminal domain and two other N-terminal variants not found at the 109

study site. The magnitude and isotype distribution of each response was measured, and 110

correlations between responses to the infecting and non-infecting antigens compared. 111

The results confirm that the majority of anti-PfMSP3 responses are against the N-112

terminus, rather than the C-terminal domain targeted by current vaccines. These 113

responses were largely allele-specific, as others have shown in hyperendemic samples 114

(22, 25), and this validates the approach of using genotyped samples from 115

hypoendemic transmission environments as an approach to identify allele-specific 116

responses. The comparison of responses across multiple N-terminal variants, which has 117


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

not previously been reported, provided no evidence for allele-specificity within one allele 118

class, which has important implications for the development of any PfMSP3-based 119

vaccine that includes the highly immunogenic N-terminal domain. 120

121

Materials and Methods 122

Study Site, Subjects, and Sample Collection. A detailed description of the 123

MIGIA cohort study has been previously described (1). Briefly, the study involves the 124

residents of the Zungarococha community, a cluster of 4 villages located south of 125

Iquitos in the Peruvian Amazon. The village residents have homogenous housing 126

construction, income levels, and access to healthcare, provided by the MIGIA cohort 127

physicians at a community health post. Travel outside the community is rare, with the 128

most frequent travel being to the city of Iquitos, where malaria transmission is 129

nonexistent. The Zungarococha community was chosen as the focus of the MIGIA 130

cohort because of the presence of continuing stable hypo-endemic transmission of both 131

P. vivax and P. falciparum, with frequency of infection rates for P. falciparum being < 0.5 132

infections/person/year. 133

Cases of P. falciparum were detected by both active and passive means. Active 134

cases involved symptomatic individuals presenting at a local health post located in 135

Zungarococha village, where they were tested for malaria parasites by Geimsa-stained 136

microscopy and underwent a comprehensive medical evaluation. PCR verification of the 137

microscopy result was subsequently performed using species-specific primers. Active 138

case detection involved random sampling of villagers over the course of the malaria 139

transmission season. All confirmed cases of Plasmodium infection were treated with 140


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

appropriate anti-malarial medication. Blood samples from confirmed P. falciparum 141

infections were separated into a serum and packed RBC fraction by centrifugation and 142

each was cataloged and stored at -80°C until needed. 143

Antigen Construction and Purification. Domain-specific PfMSP3 recombinant 144

proteins were amplified from HB3 (HB3 N-terminal domain, C-terminal domain), Dd2 145

(K1 N-terminal domain), or 3D7 (3D7 and Nig80 N-terminal domains) genomic DNA. 146

The forward and reverse primers used were 5’-147

CCGGCTCGAGGATTTTAGTGGTGGAGAATTTTCGTGGCC-3’ and 5’-148

CGGGATCCTTATTCCCAACCTAAAATATAATC-3’, 5’-149

CCGGCTCGAGTCTATGGAATTCGGAGGTTTTAC-3’ and 5’-150

CGGGATCCTTATTCCCAACCTAAAATATAATC-3’, and 5’-151

CCGGCTCGAGGATTATATTTTAGGTTGGGAATTTGGAGG-3’ and 5’-152

CGGGATCCTTAATGATTTTTAAAATATTTGGATAATTC-3’ for the HB3 and 3D7 N-153

terminal domains, K1 N-terminal domain, and Conserved domain, respectively. The 154

Nig80 N-terminal fragment was created using PCR overlap extension (9) with 5’-155

ATGCGGATCCGATTTTAGTGGTGGAGAATTTTTGTGGCCTGG-3’ 156

and 5’- 157

CTGCTTCTTTAGCAGCTTCTTCTGCCTCTTTAGAAGCATTTTCAGCATCTTCGGAAG158

C -3’ primers for the 5’ fragment, 5’-159

GCTGCTAATGATGCTGAAAATGCTTCAAAAGAGGC-3’ and 5’-160

AATTCTGCAGTTATTCCCAACCTAAAATATAATC-3’ 161


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

for the 3’ fragment, and 5’-162

ATGCGGATCCGATTTTAGTGGTGGAGAATTTTTGTGGCCTGG-3’ and 5’-163

AATTCTGCAGTTATTCCCAACCTAAAATATAATC-3’ 164

for the splicing reaction. Antigens were expressed as hexa-his tagged fusion proteins 165

from pET15b (Novagen) or pRSETA (Invitrogen) vectors in the E. coli BL21(DE3)pLysS 166

“Rosetta” strain (Novagen), and purified using affinity and anion exchange 167

chromatography, as previously described (2). 168

Circular Dichroism. To confirm correct folding of each recombinant antigen, 169

circular Dichroism (CD) spectra were obtained on an Aviv model 400 CD spectrometer 170

(Lakewood, NJ). Data were collected from 260 nm to 185 nm in 0.5 nm increments with 171

a 10 sec averaging time per point. Spectra were baseline corrected and smoothed, and 172

converted to mean residue ellipticity for plotting and analysis. Secondary structural 173

calculations were performed with PROSEC. 174

ELISA Assays and Competition Assays. 50ng of purified PfMSP3 antigen was 175

coated to each well and a 1:100 dilution of patient sera was used for each assay. Bound 176

antibodies were detected by the addition of HRP-conjugated anti-IgG (Chemicon) at a 177

dilution of 1:5,000, or HRP-conjugated IgG-isotype-specific (Southern Biotech) and IgM-178

specific (Fisher Scientific) secondary antibodies at a dilution of 1:1000. ChromoPure 179

human IgG (Jackson ImmunoResearch Laboratories) was used to standardize total IgG 180

antibody responses. IgG isotype antibody responses are presented as optical density of 181

1:100 sera dilution due the unavailability of isotype-specific standards. All plates were 182

read at 450nm using a Uniread 800 ELISA plate reader (GeneMate, Kaysville, UT). 183

Serially-diluted positive pools were run concurrently with each set of ELISAs to ensure 184


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

all OD450 measurements remained within the linear range and to facilitate ELISA 185

normalization. Responses were scored as ELISA-positive if they were three standard 186

deviations above the mean of a negative control pool of serum obtained from Peruvian 187

residents in Iquitos who have never been infected with P. falciparum. Serum samples 188

from 11 individuals were used in a pool for all negative controls. Negative cut-off values 189

for HB3 N-terminus, K1 N-terminus, and C-terminus antigens were 0.888 µg/ml, 1.026 190

µg/ml, and 0.979 µg/ml , respectively. Competition assays were performed as 191

previously described (22). Titrating K1 or HB3 N-terminus antigens were added at 1ng, 192

100ng, or 1000ng concentrations to compete for anti-HB3 or anti-K1 antibody binding, 193

respectively. As a control, homologous antigen was used to out-compete antibody 194

binding to the ELISA plate. 195

Statistical Analysis. Comparisons between proportions of ELISA antigens and 196

allele infections were performed using the two-group chi-square test or Fisher’s exact 197

test when the assumptions of the chi-square were not tenable. Comparisons between 198

mean IgG levels for ELISA antigens, separately for allele infections (Fig. 3,4,5) were 199

performed using the Kruskal-Wallis test since IgG levels and antibody responses were 200

determined to not be normally distributed. When a statistically significant overall result 201

was obtained, the Dunn multiple comparisons procedure was used to determine which 202

specific pairs of means were significantly different. Spearman correlation analyses 203

were performed to examine the relationships between IgG levels of the ELISA antigens 204

(Fig. 5C, 5D, and Fig. 6A). All statistical tests were two-sided and were performed using 205

a 5% significance level (i.e. alpha = 0.05). SAS software (version 9.1.3; SAS Institute, 206

Inc., Cary, NC) was used to perform all statistical analyses. 207


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

Ethics committee approval. This study was approved by review boards of the 208

University of Alabama at Birmingham, New York University, Universidad Peruana 209

Cayetano Heredia, and the Peruvian Ministerio de Salud, Instituto Naccional de Salud. 210

Written consent was obtained from all participants prior to study enrollment. 211

212

Results 213

Production of PfMSP3 domain antigens. Our previous genotyping study 214

established that both PfMSP3 allele classes, 3D7-like and K1-like, were in circulation at 215

the MIGIA study site, and were identical in sequence to the previously published HB3 216

and K1 sequences, respectively (12). Three recombinant antigens were generated to 217

represent the PfMSP3 domains in circulation at the study site; two N-terminal domain 218

antigens, HB3 and K1, and one C-terminal domain antigen corresponding to the C-219

terminal sequence shared by both alleles (Fig. 1A). Purification of these antigens 220

yielded milligram quantities of >95% pure protein (Fig. 1B), and far-UV circular 221

dichroism (CD) spectroscopy readings (Fig. 1C) were consistent with previous 222

biophysical studies (2), indicating that all three antigens have native secondary 223

structures. 224

Comparison of antibody responses to infecting and non-infecting antigens. 225

The three antigens were used to detect anti-PfMSP3 responses in time-of-infection sera 226

samples from 369 distinct P. falciparum infections collected between 2003 and 2006, all 227

of which had previously been genotyped for the infecting PfMSP3 allele (12). More than 228

90% of P. falciparum of infections at this study site are of the PfMSP3 3D7-like alleles 229

class, so samples were selected to reflect these observed allele frequencies; 335 from 230


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

HB3 infections and 34 from K1 infections. No samples were from individuals co-infected 231

with more than one allele, which happens in less than 0.5% of infections because of the 232

low transmission rates (12). Sera samples were tested against all three antigens, and 233

ELISA results were normalized and converted into absolute concentration of anti-234

PfMSP3 IgG. 235

Approximately 90% of individuals had positive responses against the HB3 N-236

terminal antigen, compared to 75-85% that had positive responses against the C-237

terminal antigens (Fig 2A). When responses were compared to the infecting PfMSP3 238

genotype there was evidence of a skew towards a response to the infecting allele: a 239

significantly higher percentage of HB3-infected individuals had positive responses 240

against the HB3 N-terminal domain than either the K1 N-terminal domain or the C-241

terminal domain (Fig. 2A, p < 0.0001), and there was a significant increase in anti-K1 242

responses in K1-infected individuals relative to HB3-infected individuals (p = 0.016). 243

Interestingly, although anti-N-terminal domain responses were skewed towards the 244

infecting genotype, many individuals responded to both the infecting and non-infecting 245

genotype; 57% of HB3-infected individuals generated positive responses against the 246

non-infecting K1 N-terminal domain. When considering the distribution of antibody 247

responses, more than twice as many HB3-infected individuals had anti-HB3 N-terminal 248

domain antibody levels greater than 10µg/ml compared to C-terminal domain antibody 249

responses, and more than three times as many had anti-HB3 antibody levels above 250

20µg/ml (p < 0.0001) (Fig. 2B). We did not detect a significant difference comparing N-251

terminal and C-terminal responses in K1-infected individuals, which is likely due to the 252

small sample size of K1-infected individuals (Fig. 2C). 253


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

Anti-PfMSP3 responses are primarily anti-N-terminal domain allele specific 254

responses. Direct comparison of the antibody response against each antigen [µg/ml] 255

within each infecting allele class was then performed to characterize the strength of 256

anti-PfMSP3 responses. In HB3 infected individuals, mean antibody levels reacting with 257

the HB3 N-terminal domain were 2.2-fold higher than mean antibody levels that reacted 258

with the C-terminal domain (p < 0.05), and also 3.1-fold higher than mean antibody 259

levels that reacted with the K1 N-terminal domain (Fig. 3A). In K1-infected individuals, 260

there was no significant difference in antibody levels to the K1 N-terminal domain and 261

C-terminal domain antibodies, but mean levels recognizing the K1 N-terminal domain 262

were 2.8-fold higher than levels recognizing the HB3 N-terminal domain (this difference 263

did not reach statistical significance, presumably because of the low numbers of K1-264

infected individuals) (Fig. 3B). The N-terminal domain therefore appears to be the 265

immunodominant PfMSP3 domain in this study site, and is largely targeted by allele-266

specific antibodies, in keeping with previous results from The Gambia (22, 25). 267

Anti-PfMSP3 N-terminal domain antibodies are primarily cytophilic 268

subclasses. Because cytophilic IgG subclasses, IgG1 and IgG3, have been 269

previously associated with protection against malaria (20, 33, 37), each antiserum 270

sample that scored as positive by total IgG ELISA was tested for isotype class 271

distribution using isotype-specific secondary antibodies and presented as optical density 272

at 1:100 dilution, because a lack of isotype-specific standards for normalization 273

precluded conversion to absolute isotype-specific antibody levels. Because of sample 274

volumes, isotype distribution was established only for the antigens present in the 275

infection, namely the infecting N-terminal domain and the conserved C-terminal domain. 276


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

34 serum samples that were typed for antigen specificity (Fig 3) had insufficient volume 277

remaining to carry out isotype experiments, leaving 304 samples from HB3-infected 278

individuals and 21 samples from K1-infected individuals to be typed. Anti-N-terminal 279

domain antibodies were primarily of the IgG1 and IgG3 cytophilic subclasses; in HB3-280

infected individuals mean anti-HB3 N-terminal domain IgG3 levels were higher than 281

mean IgG1 levels (p < 0.05) whereas in K1-infected individuals, mean IgG1 and IgG3 282

responses against the K1 N-terminal domain were identical (Fig 4). By contrast, 283

antibodies recognizing the C-terminal domain were significantly enriched for IgM 284

responses regardless of the infecting allele (p < 0.05). 285

Anti PfMSP3 N-terminal domain responses across variants within the 3D7 286

allele class. Although this data and others have shown that anti-N-terminal domain 287

responses are primarily allele-specific, no previous study has tested reactivity across 288

variants within a given allele class. To test for allele-specificity across such variants, N-289

terminal domain antigens for two other naturally occurring 3D7-class alleles were 290

generated. One antigen was identical to the 3D7 allele, which differs from the HB3 291

sequence used in the initial studies at only a single non-synonymous single nucleotide 292

polymorphism (SNP). This SNP is the most prevalent polymorphism in the 3D7-class 293

alleles globally(6) and has been detected at the MIGIA study site, being found in 10/630 294

previously genotyped 3D7-class alleles (12). None of these infections were included in 295

this study, but, although unlikely, it is possible that some individuals in this study had 296

previously been infected with this allele. As a more extreme difference, a previously 297

published 3D7-class PfMSP3 sequence from Nigeria (Nig80) was chosen, which 298

possesses a heptad indel mutation in addition to the 3D7 SNP (25). No similar Nig80 299


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

sequence has been reported across more than 600 infections at this study site, or 300

elsewhere in South America, making it is extremely unlikely that any of the individuals at 301

the MIGIA study site have been previously exposed to this allele. 302

242 antiserum samples from HB3-infected individuals with sufficient serum 303

volume remaining were used to test responses to both the 3D7 and Nig80 N-terminal 304

antigens. 71% of individuals had positive responses to the 3D7 antigen, and 61% to the 305

Nig80 antigen, compared to 75% to the HB3 antigen (Fig 5A). There was no significant 306

difference in mean IgG levels between 3D7 and HB3, but a 0.3-fold reduction in 307

responses against the Nig80 antigen (p=0.001) (Fig 5B). To compare responses at an 308

individual, rather than population level, the response to either the 3D7 or Nig80 antigen 309

was compared with the response to the HB3 antigen in the same individual. Responses 310

to the HB3 antigen correlated strongly with responses to both the 3D7 (Fig. 5C; 311

Spearman’s r = 0.8985, p < 0.0001) and Nig80 antigens (Fig. 5D; Spearman’s r = 312

0.8685, p < 0.0001) antigens. There is therefore little evidence of allele-specific 313

responses between these three variants of the 3D7-allele class. 314

Anti PfMSP3 N-terminal domain responses across allele classes. Although 315

responses against the PfMSP3 N-terminal domain were primarily against the infecting 316

allele class, suggesting allele-specificity (Figs 2, 3), it was notable that detectable 317

responses against the K1 N-terminal domain antigen were present in 57% of HB3-318

infected individuals, suggesting that some anti-N-terminal domain responses are not 319

allele specific. To investigate this more closely, responses against the infecting and 320

non-infecting allele class were compared for each individual infection. The strength of 321

responses was clearly skewed toward the infecting N-terminal allele (Fig. 6A), but there 322


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

was a statistically significant positive correlation between the strength of response 323

against both the infecting and non-infecting N-terminal domains (Spearman’s r = 324

0.5645, p < 0.0001 for HB3-infected, Spearman’s r = 0.4780, p = 0.0043 for K1-325

infected). 326

To establish whether these represent true inter-allele cross-reactive responses, 327

competition ELISAs were performed on the few serum samples where sufficient volume 328

was present for such tests. Of the samples that had both strongly positive anti-HB3 and 329

anti-K1 responses (upper right quadrant of Fig 6A, above 10µg/ml for both antigens), 11 330

samples had sufficient volume of serum for the multiple rounds of depletion with 331

different concentrations of antigens needed for competition assays. Of these 11 332

samples, in 6 cases responses against one antigen could be competed by pre-333

incubating with the heterologous antigen, denoting clear cross-reactive responses (Fig. 334

6B, Left panel). In the other 5 cases responses were present to both antigens, but could 335

only be competed with the homologous antigen, suggesting the simultaneous presence 336

of allele-specific responses to both antigens (Fig. 6B, Right panel). Both correlation and 337

competition ELISA analyses therefore suggest that some antibody responses generated 338

by the PfMSP3 N-terminal domain can cross-react across allele classes. 339

340

Discussion 341

This manuscript investigated the antibody responses against a leading vaccine 342

candidate, P. falciparum Merozoite Surface Protein-3 (PfMSP3), in a hypoendemic 343

transmission environment, in order to test the approach of using genotyped samples 344

from such environments can be used to rapidly identify allele-specific and allele-345


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

transcending antibody responses. As seen in other studies, responses to PfMSP3 were 346

widespread, with approximately 90% of individuals responding positively against the 347

HB3 N-terminal antigen, and 75% responding to the C-terminal antigen. The PfMSP3 N-348

terminal domain was significantly more immunogenic than the C-terminal domain, 349

eliciting, in HB3 infected individuals, a 2.3-fold increase in mean IgG antibody levels and 350

a 3.6-fold increase in “high responder” individuals- those who exhibited IgG antibody 351

levels greater than 20µg/ml, compared to the C-terminal domain. These results are in 352

line with data from The Gambia, which demonstrated significantly higher N-terminal 353

domain antibody responses, especially in young children (22, 25). Additionally, anti-N-354

terminal domain antibodies were largely comprised of cytophilic IgG1 and IgG3 355

subclasses, which have previously been associated with protection against malaria (20, 356

33, 37). 357

The fact that the samples in this study had previously been genotyped for 358

infecting PfMSP3 allele type, and came from individuals who had on average not had a 359

previous P. falciparum infection for at least one year, allowed the extent of allele-360

specificity to be tested directly. When comparing responses within the 3D7-allele class, 361

there was little evidence for allele-specificity, with responses against two non-infecting 362

3D7-class allele mutants exhibiting strong pair-wise correlation with responses to the 363

infecting HB3 N-terminal domain (p < 0.0001). These antigens differed only at a handful 364

of amino acids, so presumably the majority of responses are recognizing epitopes that 365

are conserved across the variants, perhaps the residues responsible for stabilizing the 366

coiled-coil domains that are almost exclusively conserved within each allele class. The 367


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

existence of responses against such conserved regions is not necessarily surprising, 368

but is important and has not been previously shown. 369

Comparing responses across N-terminal domain allele classes confirms previous 370

findings that demonstrated anti-N-terminal domain immune responses are weighted 371

toward being allele-specific (22, 25), However this study also provides clear evidence 372

that some anti-N-terminal domain responses target epitopes shared across allele 373

classes. At a population level, 57% of HB3-infected individuals elicited positive 374

responses against the K1 N-terminal domain, and there was a significant positive 375

correlation between individual responses to the 3D7- and K1-class domains, although 376

not as strong as the correlation between responses to variants within the 3D7-allele 377

class. Competition ELISAs confirmed that at least some of these responses were truly 378

cross-reactive, as they could be competed away with both the HB3 and K1 N-terminal 379

domain antigens. In theory, these apparent cross-reactive responses could be 380

explained by recent infections with a K1 class allele that were undetected in the cohort 381

study. However using available frequency-of-infection and allele frequency data for this 382

study site, there is only a 0.84% probability of an undetected K1 infection occurring in 383

any one individual within the past 2 years, clearly not enough to explain 57% of HB3 384

infected individuals containing antiserum that can cross-react with K1 antigens. The 385

most parsimonious explanation of the data is therefore that infection with HB3 allele 386

PfMSP3 antigen generates a response against epitopes that are conserved across both 387

allele classes, although at the expense of significant immunogenicity. 388

The P. falciparum genome presents a large number of potential vaccine 389

candidates and it is therefore critical that go/no-go decisions based on solid evidence be 390


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

applied to limit the number of candidates entering expensive later stage vaccine trials 391

(3, 7, 10). The PfMSP3 N-terminal domain had previously been largely ignored from 392

consideration based on concerns about sequence diversity, and because the C-terminal 393

domain has been extensively studied in the context of antibody dependent cellular 394

immunity assays (ADCI), the mechanism by which PfMSP3 is thought to induce 395

protection in vivo (19, 29, 39). Long peptides based on the C-terminal domain can 396

induce potent antibody responses in vivo that are capable of killing P. falciparum 397

parasites, have good safety profiles in initial trials, and clearly warrant further 398

investigation as candidate antigens (5, 13, 17, 26, 31, 32). However, the PfMSP3 N-399

terminal domain is also capable of inducing ADCI-mediated killing in vitro (29), data 400

from both Peru (this paper) and The Gambia (25) suggests that the PfMSP3 N-terminal 401

domain is a more potent immunogen than the C-terminal domain in vivo, and in The 402

Gambia, responses against the N-terminal domain correlated with protection against 403

clinical malaria (25). The totality of this data suggests that the PfMSP3 N-terminal 404

domain could be reconsidered as a potential vaccine antigen, if the problems of genetic 405

diversity can be addressed. The findings reported here that anti-N-terminal domain 406

responses include responses to epitopes conserved within an allele class, and also to a 407

lesser extent to epitopes conserved across allele classes, raise the possibility that 408

regions of the N-terminal domain could be identified that may overcome this problem. 409

Mapping those conserved epitopes within the N-terminal domain, as well as testing for 410

functional cross-protection in in vitro assays, are therefore high priorities for further 411

research. 412

413


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

Acknowledgements 414

The authors wish to thank Patrick Sutton and Eva Clark for help with sample 415

processing and Mike Jablonsky for his help with the circular dichroism. We would like to 416

thank all residents in the Zungarococha community who participate so willingly in the 417

MIGIA cohort study. We thank all the staff of the MIGIA project, which is a strong 418

collaboration with the Universidad Nacional de la Amazonia Peruana. We thank all for 419

sample collection, clinic visits and management, and laboratory sample processing and 420

care. 421

422

Conflict of Interest 423

The authors declare no conflict of interest. 424

425

Financial Support 426

This work was supported by the National Institute of Health grants R21 AI072421 and 427

R01 AI064849, and the UAB Sparkman Center for Global Health. 428

429


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

References 430

1. Branch, O., W. M. Casapia, D. V. Gamboa, J. N. Hernandez, F. F. Alava, N. Roncal, 431

E. Alvarez, E. J. Perez, and E. Gotuzzo. 2005. Clustered local transmission and 432

asymptomatic Plasmodium falciparum and Plasmodium vivax malaria infections in a 433

recently emerged, hypoendemic Peruvian Amazon community. Malar J 4:27. 434

2. Burgess, B. R., P. Schuck, and D. N. Garboczi. 2005. Dissection of merozoite surface 435

protein 3, a representative of a family of Plasmodium falciparum surface proteins, 436

reveals an oligomeric and highly elongated molecule. J Biol Chem 280:37236-37245. 437

3. Coppel, R. L. 2009. Vaccinating with the genome: a Sisyphean task? Trends Parasitol 438

25:205-212. 439

4. Demanga, C. G., L. J. Daher, E. Prieur, C. Blanc, J. L. Perignon, H. Bouharoun-440

Tayoun, and P. Druilhe. 2010. Toward the rational design of a malaria vaccine 441

construct using the MSP3 family as an example: contribution of antigenicity studies in 442

humans. Infect Immun 78:486-494. 443

5. Druilhe, P., F. Spertini, D. Soesoe, G. Corradin, P. Mejia, S. Singh, R. Audran, A. 444

Bouzidi, C. Oeuvray, and C. Roussilhon. 2005. A malaria vaccine that elicits in 445

humans antibodies able to kill Plasmodium falciparum. PLoS Med 2:e344. 446

6. Escalante, A. A., A. A. Lal, and F. J. Ayala. 1998. Genetic polymorphism and natural 447

selection in the malaria parasite Plasmodium falciparum. Genetics 149:189-202. 448

7. Greenwood, B., and G. Targett. 2009. Do we still need a malaria vaccine? Parasite 449

Immunol 31:582-586. 450

8. Hisaeda, H., A. Saul, J. J. Reece, M. C. Kennedy, C. A. Long, L. H. Miller, and A. W. 451

Stowers. 2002. Merozoite surface protein 3 and protection against malaria in Aotus 452

nancymai monkeys. J Infect Dis 185:657-664. 453

9. Ho, S. N., H. D. Hunt, R. M. Horton, J. K. Pullen, and L. R. Pease. 1989. Site-directed 454

mutagenesis by overlap extension using the polymerase chain reaction. Gene 77:51-59. 455


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

10. Holder, A. A. 2009. Malaria vaccines: where next? PLoS Pathog 5:e1000638. 456

11. Huber, W., I. Felger, H. Matile, H. J. Lipps, S. Steiger, and H. P. Beck. 1997. Limited 457

sequence polymorphism in the Plasmodium falciparum merozoite surface protein 3. Mol 458

Biochem Parasitol 87:231-234. 459

12. Jordan, S. J., O. H. Branch, J. C. Castro, R. A. Oster, and J. C. Rayner. 2009. 460

Genetic diversity of the malaria vaccine candidate Plasmodium falciparum merozoite 461

surface protein-3 in a hypoendemic transmission environment. Am J Trop Med Hyg 462

80:479-486. 463

13. Lusingu, J. P., S. Gesase, S. Msham, F. Francis, M. Lemnge, M. Seth, S. 464

Sembuche, A. Rutta, D. Minja, M. D. Segeja, S. Bosomprah, S. Cousens, R. Noor, 465

R. Chilengi, and P. Druilhe. 2009. Satisfactory safety and immunogenicity of MSP3 466

malaria vaccine candidate in Tanzanian children aged 12-24 months. Malar J 8:163. 467

14. Mamillapalli, A., S. Sunil, S. S. Diwan, S. K. Sharma, P. K. Tyagi, T. Adak, H. Joshi, 468

and P. Malhotra. 2007. Polymorphism and epitope sharing between the alleles of 469

merozoite surface protein-1 of Plasmodium falciparum among Indian isolates. Malar J 470

6:95. 471

15. McColl, D. J., and R. F. Anders. 1997. Conservation of structural motifs and antigenic 472

diversity in the Plasmodium falciparum merozoite surface protein-3 (MSP-3). Mol 473


16. McColl, D. J., A. Silva, M. Foley, J. F. Kun, J. M. Favaloro, J. K. Thompson, V. M. 475

Marshall, R. L. Coppel, D. J. Kemp, and R. F. Anders. 1994. Molecular variation in a 476

novel polymorphic antigen associated with Plasmodium falciparum merozoites. Mol 477


17. Nebie, I., A. Diarra, A. Ouedraogo, A. B. Tiono, A. T. Konate, A. Gansane, I. 479

Soulama, S. Cousens, O. Leroy, and S. B. Sirima. 2009. Humoral and cell-mediated 480


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

immunity to MSP3 peptides in adults immunized with MSP3 in malaria endemic area, 481

Burkina Faso. Parasite Immunol 31:474-480. 482

18. Ochola, L. I., K. K. Tetteh, L. B. Stewart, V. Riitho, K. Marsh, and D. J. Conway. 483

2010. Allele frequency-based and polymorphism-versus-divergence indices of balancing 484

selection in a new filtered set of polymorphic genes in Plasmodium falciparum. Mol Biol 485

Evol 27:2344-2351. 486

19. Oeuvray, C., H. Bouharoun-Tayoun, H. Grass-Masse, J. P. Lepers, L. 487

Ralamboranto, A. Tartar, and P. Druilhe. 1994. A novel merozoite surface antigen of 488

Plasmodium falciparum (MSP-3) identified by cellular-antibody cooperative mechanism 489

antigenicity and biological activity of antibodies. Mem Inst Oswaldo Cruz 89 Suppl 2:77-490

80. 491

20. Oeuvray, C., M. Theisen, C. Rogier, J. F. Trape, S. Jepsen, and P. Druilhe. 2000. 492

Cytophilic immunoglobulin responses to Plasmodium falciparum glutamate-rich protein 493

are correlated with protection against clinical malaria in Dielmo, Senegal. Infect Immun 494

68:2617-2620. 495

21. Ogutu, B. R., O. J. Apollo, D. McKinney, W. Okoth, J. Siangla, F. Dubovsky, K. 496

Tucker, J. N. Waitumbi, C. Diggs, J. Wittes, E. Malkin, A. Leach, L. A. Soisson, J. B. 497

Milman, L. Otieno, C. A. Holland, M. Polhemus, S. A. Remich, C. F. Ockenhouse, J. 498

Cohen, W. R. Ballou, S. K. Martin, E. Angov, V. A. Stewart, J. A. Lyon, D. G. 499

Heppner, and M. R. Withers. 2009. Blood stage malaria vaccine eliciting high antigen-500

specific antibody concentrations confers no protection to young children in Western 501

Kenya. PLoS One 4:e4708. 502

22. Osier, F. H., S. D. Polley, T. Mwangi, B. Lowe, D. J. Conway, and K. Marsh. 2007. 503

Naturally acquired antibodies to polymorphic and conserved epitopes of Plasmodium 504

falciparum merozoite surface protein 3. Parasite Immunol 29:387-394. 505


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

23. Osier, F. H., G. D. Weedall, F. Verra, L. Murungi, K. K. Tetteh, P. Bull, B. W. Faber, 506

E. Remarque, A. Thomas, K. Marsh, and D. J. Conway. 2010. Allelic diversity and 507

naturally acquired allele-specific antibody responses to Plasmodium falciparum apical 508

membrane antigen 1 in Kenya. Infect Immun 78:4625-4633. 509

24. Polley, S. D., T. Mwangi, C. H. Kocken, A. W. Thomas, S. Dutta, D. E. Lanar, E. 510

Remarque, A. Ross, T. N. Williams, G. Mwambingu, B. Lowe, D. J. Conway, and K. 511

Marsh. 2004. Human antibodies to recombinant protein constructs of Plasmodium 512

falciparum Apical Membrane Antigen 1 (AMA1) and their associations with protection 513

from malaria. Vaccine 23:718-728. 514

25. Polley, S. D., K. K. Tetteh, J. M. Lloyd, O. J. Akpogheneta, B. M. Greenwood, K. A. 515

Bojang, and D. J. Conway. 2007. Plasmodium falciparum merozoite surface protein 3 516

is a target of allele-specific immunity and alleles are maintained by natural selection. J 517

Infect Dis 195:279-287. 518

26. Roussilhon, C., C. Oeuvray, C. Muller-Graf, A. Tall, C. Rogier, J. F. Trape, M. 519

Theisen, A. Balde, J. L. Perignon, and P. Druilhe. 2007. Long-term clinical protection 520

from falciparum malaria is strongly associated with IgG3 antibodies to merozoite surface 521

protein 3. PLoS Med 4:e320. 522

27. Sagara, I., A. Dicko, R. D. Ellis, M. P. Fay, S. I. Diawara, M. H. Assadou, M. S. 523

Sissoko, M. Kone, A. I. Diallo, R. Saye, M. A. Guindo, O. Kante, M. B. Niambele, K. 524

Miura, G. E. Mullen, M. Pierce, L. B. Martin, A. Dolo, D. A. Diallo, O. K. Doumbo, L. 525

H. Miller, and A. Saul. 2009. A randomized controlled phase 2 trial of the blood stage 526

AMA1-C1/Alhydrogel malaria vaccine in children in Mali. Vaccine 27:3090-3098. 527

28. Saul, A. 2007. Malaria vaccines based on the Plasmodium falciparum merozoite surface 528

protein 3--should we avoid amino acid sequence polymorphisms or embrace them? J 529

Infect Dis 195:171-173. 530


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

29. Singh, S., S. Soe, J. P. Mejia, C. Roussilhon, M. Theisen, G. Corradin, and P. 531

Druilhe. 2004. Identification of a conserved region of Plasmodium falciparum MSP3 532

targeted by biologically active antibodies to improve vaccine design. J Infect Dis 533

190:1010-1018. 534

30. Singh, S., S. Soe, S. Weisman, J. W. Barnwell, J. L. Perignon, and P. Druilhe. 2009. 535

A conserved multi-gene family induces cross-reactive antibodies effective in defense 536

against Plasmodium falciparum. PLoS One 4:e5410. 537

31. Sirima, S. B., I. Nebie, A. Ouedraogo, A. B. Tiono, A. T. Konate, A. Gansane, A. I. 538

Derme, A. Diarra, I. Soulama, N. Cuzzin-Ouattara, S. Cousens, and O. Leroy. 2007. 539

Safety and immunogenicity of the Plasmodium falciparum merozoite surface protein-3 540

long synthetic peptide (MSP3-LSP) malaria vaccine in healthy, semi-immune adult 541

males in Burkina Faso, West Africa. Vaccine 25:2723-2732. 542

32. Sirima, S. B., A. B. Tiono, A. Ouedraogo, A. Diarra, A. L. Ouedraogo, J. B. Yaro, E. 543

Ouedraogo, A. Gansane, E. C. Bougouma, A. T. Konate, Y. Kabore, A. Traore, C. 544

Roma, I. Soulama, A. J. Luty, S. Cousens, and I. Nebie. 2009. Safety and 545

immunogenicity of the malaria vaccine candidate MSP3 long synthetic peptide in 12-24 546

months-old Burkinabe children. PLoS One 4:e7549. 547

33. Stanisic, D. I., J. S. Richards, F. J. McCallum, P. Michon, C. L. King, S. Schoepflin, 548

P. R. Gilson, V. J. Murphy, R. F. Anders, I. Mueller, and J. G. Beeson. 2009. 549

Immunoglobulin G subclass-specific responses against Plasmodium falciparum 550

merozoite antigens are associated with control of parasitemia and protection from 551

symptomatic illness. Infect Immun 77:1165-1174. 552

34. Sutton, P. L., E. H. Clark, C. Silva, and O. H. Branch. 2010. The Plasmodium 553

falciparum merozoite surface protein-1 19 KD antibody response in the Peruvian 554

Amazon predominantly targets the non-allele specific, shared sites of this antigen. Malar 555

J 9:3. 556


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

35. Sutton, P. L., V. Neyra, J. N. Hernandez, and O. H. Branch. 2009. Plasmodium 557

falciparum and Plasmodium vivax infections in the Peruvian Amazon: propagation of 558

complex, multiple allele-type infections without super-infection. Am J Trop Med Hyg 559

81:950-960. 560

36. Takala, S. L., and C. V. Plowe. 2009. Genetic diversity and malaria vaccine design, 561

testing and efficacy: preventing and overcoming 'vaccine resistant malaria'. Parasite 562

Immunol 31:560-573. 563

37. Taylor, R. R., S. J. Allen, B. M. Greenwood, and E. M. Riley. 1998. IgG3 antibodies to 564

Plasmodium falciparum merozoite surface protein 2 (MSP2): increasing prevalence with 565

age and association with clinical immunity to malaria. Am J Trop Med Hyg 58:406-413. 566

38. Tetteh, K. K., L. B. Stewart, L. I. Ochola, A. Amambua-Ngwa, A. W. Thomas, K. 567

Marsh, G. D. Weedall, and D. J. Conway. 2009. Prospective identification of malaria 568

parasite genes under balancing selection. PLoS One 4:e5568. 569

39. Trucco, C., D. Fernandez-Reyes, S. Howell, W. H. Stafford, T. J. Scott-Finnigan, M. 570

Grainger, S. A. Ogun, W. R. Taylor, and A. A. Holder. 2001. The merozoite surface 571

protein 6 gene codes for a 36 kDa protein associated with the Plasmodium falciparum 572

merozoite surface protein-1 complex. Mol Biochem Parasitol 112:91-101. 573

574

575

576

577

578

579

580

581


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

582

583

Figure Legends 584

585

Figure 1. Purity and folding of PfMSP3 domain antigens. (A) Three PfMSP3 586

constructs were generated to test antibody responses by ELISA: HB3 and K1 allele N-587

terminal domains and the conserved C-terminal domain. The N-terminal domains began 588

at the proteolytic cleavage site and included all 3 heptad repeats. The C-terminal 589

domain began just C-terminal to the last heptad repeat. (B) Coomassie-blue stained 590

SDS-PAGE demonstrates PfMSP3 construct antigens are > 95% pure as measured by 591

scanning densitometry. (C) Circular dichroism spectroscopy reveals signature peaks at 592

215nm and 190nm indicative of constructs being comprised largely of alpha-helical 593

structures, consistent with published data for full-length PfMSP3. 594

595

Figure 2. Distribution of anti-PfMSP3 responses in HB3- and K1-infected 596

individuals (A) Percent positive responses, by infected allele, either HB3 (N = 335) or 597

K1 (N = 34) for each PfMSP3 domain antigen. Responses were scored positive if they 598

were three standard deviations above the mean of a negative control pool of serum 599

from individuals who had never been infected with P. falciparum. Negative cut-off values 600

for each antigen are listed in Materials and Methods. The double and triple asterisks 601

denote p=0.016 and p < 0.0001, respectively. (B,C) Number of individuals who exhibit 602

given IgG antibody levels [µg/ml] against each PfMSP3 domain antigen in HB3- (B) and 603

K1-infected (C) individuals. Neg shows number of samples below the negative cut-off 604


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

values, which are listed in Materials and Methods. Neg-4 are samples up to 4µg/ml 605

higher than the negative cut-off, 5-9 are samples from 5-9µg/ml above the negative cut-606

off, and so on. 607

608

Figure 3. Anti-PfMSP3 responses are primarily anti-N-terminal domain allele 609

specific responses. IgG antibody levels [µg/ml] against each PfMSP3 domain antigen 610

in HB3-infected (Fig. 3A, N = 335) and K1-infected (Fig. 3B, N = 34) individuals. 611

Whiskers represent upper and lower quartiles, and mean values are indicated by the 612

hashed line. 613

614

Figure 4. Responses against the PfMSP3 N-terminal domain are largely of 615

cytophilic subclasses. PfMSP3 isotype antibody levels (OD450 1:100 sera dilution) for 616

IgG1-4 and IgM responses against N-terminal and C-terminal domains. Only 617

homologous N-terminal domain responses were assessed. The whiskers denote the 618

upper and lower quartiles. The mean is denoted by the hashed line. 619

620

Figure 5. Anti PfMSP3 N-terminal domain responses across variants within the 621

3D7 allele class. (A) Percent positive responses of ELISA positive HB3-infected 622

individuals (N = 242) against 3D7-class mutants 3D7 and Nig80. (B) IgG antibody 623

levels [µg/ml] against 3D7-class mutants. The whiskers denote the upper and lower 624

quartiles. The mean is denoted by the hashed line. (C,D) Pair-wise correlation between 625

anti-HB3 responses and either anti-3D7 (C) or anti-Nig80 (D) antibody responses; the 626

black line indicates a best-fit exponential line. 627


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

628

Figure 6. Anti PfMSP3 N-terminal domain responses across allele-classes 629

(A) Pair-wise correlation between anti-HB3 and anti-K1 antibody responses separated 630

on the basis of their infecting PfMSP3 allele; the black line indicates a best-fit 631

exponential line. N = 369 (B) Competition ELISAs were performed using titrating 632

amounts of competing antigen (0-1000ng) to assess cross-reaction; some samples 633

showed evidence of cross-reactivity (left panel), while others showed only allele-specific 634

responses (right panel). 635

636


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

iai accepts, published online ahead of print on 7 march...

Documents