human genetics weibin shi michele sale. contact information shi: [email protected]; 243-9420...
Post on 18-Dec-2015
219 views
TRANSCRIPT
Contact InformationContact Information
Shi: Shi: [email protected]@virginia.edu; 243-9420; 243-9420
Sale: Sale: [email protected]@Virginia.EDU; 982-0368 ; 982-0368
Recommended textbooksRecommended textbooks
Medical GeneticsMedical Genetics-Jorde, Carey, Bamshad & White-Jorde, Carey, Bamshad & White
• Mosby, ISBN 13: 978-0-323-04035-8Mosby, ISBN 13: 978-0-323-04035-8
Human Molecular GeneticsHuman Molecular Genetics
- Strachan T, Read A- Strachan T, Read A
Garland Science,ISBN-10: 0815341822 Garland Science,ISBN-10: 0815341822
Overview of course contentOverview of course content
1: Organization of the human genome1: Organization of the human genome 2: Genetic variation2: Genetic variation 3. Patterns of inheritance3. Patterns of inheritance 4: Population genetics4: Population genetics 5: linkage disequilibrium5: linkage disequilibrium 6: Genetic epidemiology6: Genetic epidemiology 7: Applied research in human genetics7: Applied research in human genetics
Human chromosomesHuman chromosomes
23 pairs
46 chromosomes
22 pairs – autosomes
1 pair sex chromosomes
46,XYNormal male
NUCLEAR GENOME24 distinct chromosomes (22 autosomal + X + Y)3,200 Mbp25,000 genes
Mitochondrial genome16,569 bp37 genes
Small (16.5 kb) circular DNASmall (16.5 kb) circular DNA
rRNA, tRNA and protein encoding genes (37)rRNA, tRNA and protein encoding genes (37)
1 gene/0.45 kb1 gene/0.45 kb
Very few repeatsVery few repeats
No intronsNo introns
93% coding93% coding
Genes are transcribed as multimeric Genes are transcribed as multimeric transcriptstranscripts
Maternal inheritanceMaternal inheritance
Human Mitochondrial GenomeHuman Mitochondrial Genome
24 of 37genes are RNA coding24 of 37genes are RNA coding 22 tRNA22 tRNA 2 ribosomal RNA (23S, 16S)2 ribosomal RNA (23S, 16S)
13 of 37 genes are protein coding13 of 37 genes are protein coding
some subunits of some subunits of respiratory complexesrespiratory complexes
and and oxidative phosphorylationoxidative phosphorylation enzymes enzymes
What are the mitochondrial genes?What are the mitochondrial genes?
mt encodedmt encoded nuclearnuclearNADH dehydrogenase NADH dehydrogenase 7 subunits 7 subunits 35 subunits35 subunitsCytochrome b-c1 compCytochrome b-c1 comp 1 subunit 1 subunit 10 subunits10 subunitsCytochrome C oxidase Cytochrome C oxidase 3 subunits 3 subunits 10 subunits10 subunitsATP synthase complexATP synthase complex 2 subunits 2 subunits 14 subunits14 subunits
Limited autonomy of Limited autonomy of mitochondrial genomemitochondrial genome
Two independent ATG located in Frame-shift to each other, second stop codon is derived from TA + A (from poly-A)
Two overlapping genes encoded Two overlapping genes encoded by same strand of mt DNA by same strand of mt DNA
(unique example)(unique example)
3,200 Mb3,200 Mb23 (XX) or 24 (XY) linear chromosomes23 (XX) or 24 (XY) linear chromosomes25,000 genes25,000 genes1 gene/120kb1 gene/120kbIntrons in the most of the genesIntrons in the most of the genes1.5 % of DNA is coding1.5 % of DNA is codingGenes are transcribed individuallyGenes are transcribed individuallyRepetitive DNA sequences (45%)Repetitive DNA sequences (45%)Inherited from both parentsInherited from both parents
Human Nuclear GenomeHuman Nuclear Genome
Human Nuclear GenomeHuman Nuclear Genome
In human nuclear genome In human nuclear genome gene-rich regions are separated by gene gene-rich regions are separated by gene
desertsdeserts
Chr. 19 has the highest gene densityChr. 19 has the highest gene density
Chr. 13 & Y show the lowest gene densityChr. 13 & Y show the lowest gene density
Human genome base contentHuman genome base content
41% CG in average41% CG in average38% CG for Chr. 4 and Chr. 1338% CG for Chr. 4 and Chr. 1349% for Chr. 1949% for Chr. 19
Regions with wide swings in CG content Regions with wide swings in CG content (e.g. from 33.1% to 59.3%)(e.g. from 33.1% to 59.3%)
Gene density correlates with higher CG content Gene density correlates with higher CG content
CpG dinucleotide depletionCpG dinucleotide depletion
Expected frequencyExpected frequency is 4.2% is 4.2% Observed frequencyObserved frequency is five times lower is five times lower
Location of CpG islands in the Location of CpG islands in the genegene
CpG islands in the regulatory areas of human genesCpG islands in the regulatory areas of human genes
Human nuclear genomeHuman nuclear genome
Gene density Gene density varies widely varies widely Averagely Averagely 9 exons per gene9 exons per gene 363 exons in titin gene363 exons in titin gene Certain genes are intronslessCertain genes are intronsless Largest intron is 800 kb (WWOX gene)Largest intron is 800 kb (WWOX gene) Smallest introns – 10 bpSmallest introns – 10 bp Average 5’ UTRAverage 5’ UTR 0.2-0.3 kb 0.2-0.3 kb Average 3’ UTRAverage 3’ UTR 0.77 kb 0.77 kb Largest protein: titin: 38,138 aaLargest protein: titin: 38,138 aa
INTRONLESS GENESINTRONLESS GENES
Interferon genesInterferon genes Histone genesHistone genes Many ribonuclease genesMany ribonuclease genes Heat shock protein genesHeat shock protein genes Many G-protein coupled receptorsMany G-protein coupled receptors Various neurotransmitters receptors and Various neurotransmitters receptors and
hormone receptorshormone receptors
Classical gene families: Classical gene families: members members exhibit a high degree of sequence similarityexhibit a high degree of sequence similarity
alpha-albumin serum albumin vitamin D-binding protein
four placenta-specific genes, primates only
CS = chorionic somatomammotropin
Gene families: gene products bearing Gene families: gene products bearing short conservative amino acid motifsshort conservative amino acid motifs
DEAD box proteins are involved in mRNA splicing
and translation initiation; DEAD box (Asp-Glu-Ala-Asp)
WD proteins take part in a variety of regulatory functions, GH (Gly-His) should be at 23-41 aa distance from WD (Trp-Aps)
Gene superfamily: Proteins that are functionally related in a general sense, but show only weak homology
Non-coding RNA genesNon-coding RNA genes
Code for functional RNACode for functional RNA ncRNA represent 98% of all transcripts in a ncRNA represent 98% of all transcripts in a
mammalian cellmammalian cell ncRNA can be:ncRNA can be:
StructuralStructural CatalyticCatalytic RegulatoryRegulatory
How many genes in the How many genes in the nuclear genome?nuclear genome?
~3000 RNA genes in the nuclear genome ~3000 RNA genes in the nuclear genome
~10% of human gene count~10% of human gene count
have not been taken into account in gene have not been taken into account in gene countscounts
Non-coding RNANon-coding RNA
tRNA – transfer RNA: involved in tRNA – transfer RNA: involved in translationtranslation
rRNA – ribosomal RNA: structural rRNA – ribosomal RNA: structural component of ribosome, where translation component of ribosome, where translation takes placetakes place
snoRNA – small nucleolar RNA: snoRNA – small nucleolar RNA: functional/catalytic in rRNA maturationfunctional/catalytic in rRNA maturation
Antisense RNA: gene regulation/silencing Antisense RNA: gene regulation/silencing
microRNAmicroRNA
A new class of non-coding RNA geneA new class of non-coding RNA gene Products are 19~25 nt RNAsProducts are 19~25 nt RNAs Precursors are 70-100 nt.Precursors are 70-100 nt. Block translation or result in degradation of Block translation or result in degradation of
target mRNA target mRNA
Satellite DNA is repetitive DNA that Satellite DNA is repetitive DNA that could be separated by centrifugationcould be separated by centrifugation
Equilibrium density gradient
centrifugation
Sheared DNA in Cesium Chloride
gradient
MicrosatelliteMicrosatellite
di-, tri-, and tetra-nucleotide repeats di-, tri-, and tetra-nucleotide repeats
~10% of the nuclear genome~10% of the nuclear genome
TGCTCATCATCATCAGCTGCTCATCA------GC
TGCCACACACACACACACAGCTGCCACACACACA------GC TGCTCAGTCAGTCAGTCAGGC
TGCTCAGTCAG--------GC
MinisatellitesMinisatellites
1 tgattggtct ctctgccacc gggagatttc cttatttgga ggtgatggag gatttcagga 61 attttttagg aattttttta atggattacg ggattttagg gttctaggat tttaggatta 121 tggtatttta ggatttactt gattttggga ttttaggatt gagggatttt agggtttcag 181 gatttcggga tttcaggatt ttaagttttc ttgattttat gattttaaga ttttaggatt 241 tacttgattt tgggatttta ggattacggg attttagggt ttcaggattt cgggatttca 301 ggattttaag ttttcttgat tttatgattt taagatttta ggatttactt gattttggga 361 ttttaggatt acgggatttt agggtgctca ctatttatag aactttcatg gtttaacata 421 ctgaatataa atgctctgct gctctcgctg atgtcattgt tctcataata cgttcctttg
Repeat: AGGAATTTTT
• 6-64 bp repeating pattern
Interspersed repetitive DNA Interspersed repetitive DNA
SINE (Short interspersed nuclear elements): SINE (Short interspersed nuclear elements): Alu, Alu, ~0.3 kb, ~10,7% of human DNA (1,200, 000 copies)~0.3 kb, ~10,7% of human DNA (1,200, 000 copies) MIR, ~0.13 kb, 3% of human DNA (500,000 copies)MIR, ~0.13 kb, 3% of human DNA (500,000 copies)
LINE (Long interspersed nuclear elements): LINE (Long interspersed nuclear elements): ~0.8 kb, ~21% of human DNA (~1,00,000 copies)~0.8 kb, ~21% of human DNA (~1,00,000 copies)
Non-functional copy of a geneNon-functional copy of a gene Non-processed pseudogene Non-processed pseudogene
• Nonfunctional copies of the Nonfunctional copies of the genomicgenomic DNA sequence of a gene DNA sequence of a gene • Contain exons, intron, and flanking sequencesContain exons, intron, and flanking sequences
Processed pseudogeneProcessed pseudogene• Nonfunctional copies of the Nonfunctional copies of the exonic sequencesexonic sequences of a gene of a gene • Reverse-transcribed from an RNA transcriptReverse-transcribed from an RNA transcript• No 5’ promoterNo 5’ promoter• No intronsNo introns• Often includes polyA tailOften includes polyA tail
Both include events that make the gene non-functionalBoth include events that make the gene non-functional• FrameshiftFrameshift• Stop codonsStop codons
Could be as high as 20-30% of all Genomic sequence Could be as high as 20-30% of all Genomic sequence predictions could be pseudogenepredictions could be pseudogene
We assume pseudogenes have no function, but we really don’t We assume pseudogenes have no function, but we really don’t know!know!
PseudogenesPseudogenes
Human Genome OrganizationHUMAN GENOME
Genes and gene-related sequences
Extragenic DNA
Nuclear genome3,200 Mb
25,000 genes
Mitochondrial genome16.5 kb
37 genes
Coding DNA
Noncoding DNA
Unique or low copy number
Moderate to highly
repetitive
Pseudogenes Gene fragments
Introns,untranslated
sequences, etc.
Tandemly repeated
Interspersedrepeats
Unique or moderately repetitive
Two rRNAgenes
22 tRNAgenes
13 polypeptide-encoding genes