hsa-mir-34b is a plasma-stable microrna that is elevated in

Hsa-miR-34b is a plasma-stable microRNA thatis elevated in pre-manifest Huntington’s disease

Philip Michael Gaughwin1,{, Maciej Ciesla1,3,{, Nayana Lahiri2, Sarah J. Tabrizi2,

Patrik Brundin1,{ and Maria Bjorkqvist1,∗,{

1Neuronal Survival Unit, Department of Experimental Medical Sciences, Wallenberg Neuroscience Center, Lund

University, S-221 84 Lund, Sweden, 2Department of Neurodegenerative Disease, UCL Institute of Neurology, Queen

Square, London WC1N 3BG,UK and 3Department of Medical Biotechnology, Jagiellonian University, Cracow, Poland

Received December 17, 2010; Revised February 27, 2011; Accepted March 14, 2011

Huntington’s disease (HD) is a devastating, neurodegenerative condition, which lacks effective treatment.Normal Huntingtin (HTT) and mutant Huntingtin (mHTT) are expressed in multiple tissues and can alter tran-scription of microRNAs (miRs). Importantly, miRs are present in a bio-stable form in human peripheral bloodplasma and have recently been shown to be useful biomarkers in other diseases. We therefore sought toidentify potential miR biomarkers of HD that are present in, and have functional consequences for, neuronaland non-neuronal tissues. In a cell line over-expressing mHTT-Exon-1, miR microarray analysis was used toidentify candidate miRs. We then examined their presence and bio-stability in control and HD plasma. Wefound that miR-34b is significantly elevated in response to mHTT-Exon-1, and its blockade alters the toxicityof mHTT-Exon-1 in vitro. We also show that miR-34b is detectable in plasma from small input volumes and isinsensitive to freeze-thaw-induced RNA degradation. Interestingly, miR-34b is significantly elevated inplasma from HD gene carriers prior to symptom onset. This is the first study suggesting that plasma miRsmight be used as biomarkers for HD.

INTRODUCTION

Huntington’s disease (HD) is an autosomal dominant neurode-generative disorder characterized by choreiform movements,personality changes, dementia and weight loss. It is causedby a CAG repeat expansion in the gene encoding Huntingtin(HTT) (1) and currently lacks effective treatment (2,3). Neur-onal death is extensive, particularly in the striatum and cer-ebral cortex. Degenerative changes and cell death also occurin other brain regions and outside the central nervous system(4,5). The age at onset of motor symptoms is typically inmid-life, and non-motor symptoms may appear earlier (6).Although the age of onset is inversely related to the lengthof the CAG repeat, the correlation is not absolute, indicatingthat other factors also affect the age of symptomatic onset.Furthermore, progression of symptoms varies significantlybetween patients (7). Therefore, it would be valuable tohave biomarkers that reflect disease mechanisms and predict

symptom onset and progression (2). Plasma markers thattrack with disease progression would be particularly valuablein clinical treatment trials.

The normal function of HTT protein is poorly understood. Itis expressed in multiple tissues (4,8) and interacts with manyother proteins (9–11). Mutant HTT (mHTT Protein) promotesdeath of cortical and striatal neurons in several cell cultureparadigms (12,13), by altering gene transcription and trans-lation (8). Intriguingly, recent studies demonstrate the toxicityof mHTT is cell type-dependent. mHTT does not compromisethe viability of pluripotent, undifferentiated human embryonicstem cell (hESC) lines (14) and induced pluripotent stem cell(iPSC) lines (15).

MicroRNAs (miRs) are transcribed from a diverse andexpanding gene population encoding small, single-strandedRNA molecules that mediate the post-transcriptional regu-lation of gene expression (16). Recent studies demonstratethat miRs are present in normal human plasma and are

†Joint First Authors.‡Joint Senior Authors.

∗To whom correspondence should be addressed at: Neuronal Survival Unit, Department of Experimental Medical Science, Wallenberg NeuroscienceCenter, BMC A10, 221 84 Lund, Sweden. Tel: +46 462220525; Fax:+46 462220531; Email: [email protected]

# The Author 2011. Published by Oxford University Press. All rights reserved.For Permissions, please email: [email protected]

Human Molecular Genetics, 2011, Vol. 20, No. 11 2225–2237doi:10.1093/hmg/ddr111Advance Access published on March 19, 2011

Dow

nloaded from https://academ

ic.oup.com/hm

g/article/20/11/2225/635624 by guest on 04 February 2022

comparatively insensitive to RNA degradation (17–20). Toour knowledge, no study has examined whether plasma-stablemiR levels correlate with symptoms or signs of HD. Clearly,the measurement of bio-stable miR levels in plasma derivedfrom HD patients is pertinent to the development of much-needed biomarkers.

Here, we present evidence that hsa-miR-34b (miR-34b), aP53-regulated miR (21), is up-regulated in response tomHTT in both pluripotent and neuronally differentiatedhuman cells and in human plasma. We show that miR-34bis significantly elevated in plasma from HD gene carriersalready prior to symptom onset. Its detection by Taqmanquantitative polymerase chain reaction (qPCR) assays islinear and robust, and is comparatively insensitive to RNAdegradation. We also report that miR-34b levels may influ-ence mHTT cytoplasmic distribution and toxicity in vitro.Our study is the first to show that plasma miRs are potentialbiomarkers for HD.

RESULTS

NT2 cells are a viable model to study mHTT-Exon-1activity

We first developed a human, cell-based model to identifymHTT-induced miRs that may represent potential biomarkercandidates. Previous studies have used mHTT-Exon-1expression to model the transcriptional dysregulation observedin response to mHTT (22). Based on previous studies (23,24),we selected NT2 cells, an embryonal carcinoma-derived, plur-ipotent cell line capable of directed, neuronal differentiation(25,26) to identify mHTT-induced miRs. We performed tran-sient transfection of mHTT-Exon-1 constructs [23 polygluta-mine repeat-bearing mHTT Exon-1 (23Q-HTT), 73Q-HTTand 145Q-HTT] (Supplementary Material, Fig. S1A), fol-lowed by G418 selection of undifferentiated NT2 cells (Sup-plementary Material, Fig. S1B). We observed strong andcomparable expression of ‘mHTT-Exon-1’ constructs andgreen fluorescent protein (GFP), at the level of transcription(Fig. 1A, Supplementary Material, Fig. S2A–C).

To control for the possibility that mHTT-Exon-1 over-expression altered nominal gene expression in undifferentiatedNT2 cells, we evaluated messenger ribonucleic acid (mRNA)levels of OCT4 and NANOG. mRNA levels of OCT4 andNANOG did not alter in response to 145Q-HTT constructtransfection (Fig. 1B) consistent with observations inhESCs and hiPSCs (14,15). In contrast, 145Q-HTT signifi-cantly reduced the low mRNA levels of dopamine receptorD2 (DRD2) [Fig. 1C, P , 0.05 relative to 23Q-HTT, n ¼ 4replicates: threshold cycles in 23Q-HTT cells, mean+ stan-dard deviation: ACTB, 16.7+ 0.4, brain-derived neurotrophicfactor (BDNF) 26.7+ 0.2, DRD2 34.5+ 0.5]. At the level oftranslation, we detected robust immuno reactivity for IC2(mHTT-associated polyglutamine expansion antibody) in23Q-HTT (Fig. 1D and E), 73Q-HTT (data not shown) and145Q-HTT (Fig. 1G and H) transfected cells in addition toGFP expression (Fig. 1F and I). IC2 immuno reactivitywas not observed in non-transfected NT2 cells (data notshown). The pattern of polyglutamine immuno reactivity

observed using the IC2 antibody was qualitatively similarto that observed using the monoclonal antibody MAB5942/2B4, which targets mHTT-Exon-1.

mHTT-Exon-1-transfected NT2 cells readily differentiateinto neurons

The transcriptional targets of mHTT in pluripotent cells arepoorly understood. However, mHTT-Exon-1 has been shownto modulate neuron-enriched transcripts (8). Therefore, wecreated stably transfected NT2 cells and differentiated theminto mature neurons with the addition of retinoic acid (RA)(26) (Supplementary Material, Fig. S1D). Importantly, themRNA levels for GFP (Fig. 2A) and mHTT-Exon-1(Fig. 2B) remained stable during RA-induced differentiation.Strikingly, 145Q-HTT transfection significantly attenuatedthe increase in neurogenic differentiation 1 (NEUROD)(Fig. 2E), microtubule-associated protein tau (MAPT)(Fig. 2F), BDNF (Fig. 2G) and DRD2 (Fig. 2H) mRNA tran-script levels during neuronal differentiation (P , 0.05, n ¼ 6replicates). Furthermore, 145Q-HTT transfection delayed thedown-regulation of pluripotency markers OCT4 (Fig. 2C)and NANOG (Fig. 2D). Thus, the application ofmHTT-Exon-1-transfected NT2 cells as a model ofmHTT-induced transcription is supported by IC2-positive,nuclear immuno staining and the reduction in pluripotentand neuron-specific transcript levels, including knownmHTT targets (BDNF and DRD2).

miR-34b and miR-1285 are up-regulated by mHTT in vitro

We next applied this cell-based model to identify novel,mHTT-induced miRs that could be potentially detectable inplasma. We performed a miR microarray analysis ofmHTT-Exon-1 transfected, undifferentiated NT2 cells. Surpris-ingly, few miRs were significantly elevated in response to145Q-HTT and 73Q-HTT transfection, relative to 23Q-HTTtransfection (Fig. 3A). Indeed, only two annotated miRs(miR-34b, miR-1285) and one predicted miR(hsa-miRPLUS-F1024) exhibited significant up-regulationwith a fold change of .1.2 relative to 23Q-HTT (Table 1,Fig. 3B and Supplementary Material, Fig. S3). We next exam-ined the expression and bio-stability of miR-34b andmiR-1285 mature transcript levels in HD patient plasma,using hsa-miR-16 as an internal normalization control. Levelsof mature miR-34b and miR-1285 were detectable over aplasma input range of 10–250 ml for both miRs with compar-able efficiency to miR-16 (Fig. 3C). Thereafter, we examinedthe bio-stability of miR-34b and miR-1285 in response tosequential rounds of plasma freeze–thaw. Importantly, weobserved no significant change in miR-34b or miR-1285 tran-script levels relative to miR-16 (Fig. 3D). miR-34b andmiR-1285, therefore, represent ideal potential biomarkers forplasma detection, as they are bio-stable relative to protein-basedmarkers and their detection is linear for even low amounts ofinput plasma.

2226 Human Molecular Genetics, 2011, Vol. 20, No. 11

Dow


ic.oup.com/hm


http://hmg.oxfordjournals.org/cgi/content/full/ddr111/DC1








miR-34b is elevated in pre-manifest HD plasmaand in mHTT-expressing, NT2-derived neurons

We next measured miR-34b or miR-1285 in age-matchedcontrols and in HD patient plasma samples (Table 2).Most interestingly, levels of miR-34b were significantlyelevated in pre-manifest HD patient plasma (P , 0.05, n ¼11 samples) relative to age-matched controls (n ¼ 12samples) (Fig. 4A). In contrast, miR-1285 plasma levelswere not statistically significant in pre-manifest samplescompared with age-matched controls (P ¼ 0.48). To

explore the relevance of miR-34b changes in neuronal popu-lations, we next examined the expression of miR-34b indifferentiating NT2 cells (Fig. 4B). Consistent with theplasma and microarray observations, miR-34b levels weresignificantly higher in differentiating, 145Q-HTT-transfected,NT2-derived neurons relative to 23Q-HTT-transfected cells(P , 0.05, n ¼ 4 replicates). These results suggest thatmiR-34b constitutes a novel potential biomarker of HDthat is induced by mHTT and is detectable before theonset of clinical symptoms. Clearly, this observation isbased on a small patient cohort, and additional observations

Figure 1. mHTT-induced gene and protein expression in pluripotent NT2 cells. NT2 cells were transiently transfected with mHTT-Exon-1 constructs (Sup-plementary Material, Fig. S1A) as described (Supplementary Material, Fig. S1B). mRNA expression levels were normalized to ACTB and expressed as percen-tage of 23Q-HTT mRNA levels. Comparable levels of transgene-derived mRNAs (A) GFP and mHTT-Exon-1 and (B) pluripotency-associated OCT4 andNANOG were observed. However, in response to 145Q-HTT transfection, (C) DRD2 levels were reduced. Nuclear (Hoechst, D, G) IC2 antibody immuno stain-ing (E, H) in addition to (F, I) cytoplasmic GFP expression was observed for (D–F) 23Q-HTT and (G–I) 145Q-HTT transient transfection. Arrows, putativeIC2-immuno-reactive perinuclear inclusions. ∗P , 0.05 relative to 23Q-HTT-transfected cells. Scale bar, 25 mm.

Human Molecular Genetics, 2011, Vol. 20, No. 11 2227

Dow


ic.oup.com/hm





in larger patient numbers are required to establish the bio-marker potential of miR-34b.

mHTT over-expression has pro-survival effectsin undifferentiated NT2 cells

Previous studies have not explored the functional conse-quences of mHTT-Exon-1 over-expression in pluripotentcells. Therefore, we examined whether 145Q-HTT signifi-cantly altered survival or proliferation of undifferentiatedNT2 cells. We used quantitative assays of cell survival(caspase-3/7 activity), cell proliferation [5′-bromo-2′-deoxyur-idine (BrDU) incorporation] and pluripotency [alkaline

phosphatase (AP) activity]. Surprisingly, we found that145Q-HTT expression increased all these parameters. Thus,145Q-HTT significantly reduced caspase-3/7 activity relativeto 23Q-HTT-transfected cells (Fig. 5A, P , 0.05, n ¼ 6replicates). 145Q-HTT-transfected, GFP+ cells also had sig-nificantly reduced immuno staining for caspase-3 (Fig. 5Dand E) relative to 23Q-HTT-transfected cells (Fig. 5B, C andSupplementary Material, Fig. S4A, P , 0.05, n ¼ 6 repli-cates). 145Q-HTT transfection also significantly increasedBrDU incorporation (Fig. 5F, P , 0.05, n ¼ 6 replicates) andAP levels (Fig. 5G, P , 0.05, n ¼ 6 replicates) relative to23Q-HTT-transfected cultures. We observed a non-significant(Supplementary Material, Fig. S4B, P ¼ 0.18) trend for a

Figure 2. mHTT-induced gene expression changes during neuronal differentiation of NT2 cells. NT2 cells were stably nucleofected with 23Q-HTT (black bars)and 145Q-HTT (white bars) as described (Supplementary Material, Fig. S1D) and differentiated for 7, 14 and 21 days in the presence of RA. mRNA expressionlevels were normalized to ACTB and expressed as percentage of undifferentiated (Day 0) mHTT-Exon-1-transfected, mRNA levels. Comparable levels oftransgene-derived mRNAs (A) GFP and mHTT-Exon-1 were observed throughout RA-induced differentiation. 145Q-HTT transfection significantly delayedthe down-regulation of pluripotent markers (C) OCT4 and (D) NANOG, and the up-regulation of neuronal genes (E) NEUROD1, (F) MAPT, (G) BDNF and(H) DRD2. ∗P , 0.05 relative to 23Q-HTT-transfected cells.


Dow


ic.oup.com/hm





similar difference with Ki67 immuno staining of145Q-HTT-transfected cells (Supplementary Material,Fig. S4C–F). 73Q-HTT-transfected cell measurements forcell death, cell proliferation and AP levels were not signifi-cantly different from 23Q-HTT. This is an intriguing andnovel finding that suggests mHTT expression can have a pro-survival effect in a pluripotent human cell line.

mHTT over-expression is toxic for NT2-derived neurons

In contrast to the results obtained in pluripotent cells (14,15),mHTT-Exon-1 expression is selectively cytotoxic to neurons

(27). Therefore, we measured neuronal differentiation(MAPT, SMI312), caspase-3 immuno reactivity and phos-phorylated neurofilament length (SMI312) as indicators of neur-onal survival in NT2-derived neurons (Supplementary Material,Fig. S1D). 145Q-HTT-transfected, SMI312+ cells had greatercaspase-3 immuno reactivity (Fig. 6A and H; P , 0.05, n ¼ 4replicates) and reduced axon length (Fig. 6B and I; P , 0.05,n ¼ 4 replicates), relative to 23Q-HTT-transfected cells(Fig. 6F and G). Importantly, the relative numbers of23Q-HTT- and 145Q-HTT-transfected, NT2-derived neurons(examined after 21 days of RA-induced differentiation) werenot significantly different when examined by immuno staining

Figure 3. mHTT-induced miR expression in undifferentiated NT2 cells and human plasma. (A) Venn diagram of miRs that are significantly differentiallyexpressed (.1.2-fold change in 145Q relative to 23Q, non-adjusted P , 0.001) in 23Q-HTT, 73Q-HTT and 145Q-HTT-transfected NT2 cells (Table 1).Both miR-34b and miR-1285 were significantly elevated in undifferentiated NT2 cells (B) and their detection in human HD patient plasma was linear relativeto control miR-16 (C) in plasma input volumes of 10–250 ml [base 2 log(ml input volume) versus threshold cycle for Taqman probe detection]. Freeze–thaw ofmiR-34b and miR-1285 did not significantly reduce miR detection (D). ∗P , 0.05 relative to 23Q-HTT after B–H correction (Table 1).


Dow


ic.oup.com/hm








for axonal MAPT (Fig. 6C–E) and the phosphorylated neurofi-lament marker SMI312 (Fig. 6G and I). These findings indicatethat, subsequent to directed differentiation, 145Q-HTT exerts

toxic effects on survival and function in neurons derived fromNT2 cells, in marked contrast to their effects on undifferen-tiated, pluripotent NT2 cells.

Table 1. Candidate miRs elevated in response to mHTT over-expression in undifferentiated NT2 cells

Matureav miR ID 73Q/23Q 145Q/73Q 23Q/145Q F P (raw) P (B–H) LogFC P-value

hsa-miR-34b 0.30 0.17 20.47 37.0 0.0000 0.04 88888 88888hsa-miR-1285 0.20 0.31 20.51 19.2 0.0002 0.35 88888 88888hsa-miR-340 0.22 20.01 20.21 17.5 0.0003 0.40 8hsa-miR-196a∗ 0.17 0.07 20.24 15.7 0.0005 0.46 8hsa-miR-487b 0.20 0.00 20.20 14.2 0.0007 0.46 8hsa-miR-520c-3p 0.10 20.15 0.05 14.2 0.0007 0.46 8hsa-miR-339-5p 0.28 20.11 20.18 14.2 0.0007 0.46 8hsa-miR-129∗ 0.07 0.10 20.17 12.3 0.0013 0.46hsa-miR-708 0.19 20.23 0.05 12.1 0.0014 0.46hsa-miR-421 20.05 20.09 0.14 11.7 0.0016 0.46hsa-miR-130b 0.20 20.19 20.01 10.8 0.0021 0.46hsa-miR-381 20.21 20.01 0.22 10.4 0.0025 0.46hsa-miR-197 0.16 0.07 20.24 10.4 0.0025 0.46hsa-miR-33a 0.10 20.26 0.16 10.2 0.0027 0.46hsa-miR-1908 20.25 0.29 20.04 10.1 0.0028 0.46hsa-miR-129-3p 0.13 20.12 20.01 9.8 0.0032 0.46hsa-miR-122 20.04 0.14 20.10 9.7 0.0032 0.46hsa-miR-769-3p 20.04 0.28 20.24 9.5 0.0034 0.46hsa-miR-19a 0.03 20.19 0.16 9.5 0.0035 0.46hsa-miR-744∗ 0.12 20.04 20.08 9.5 0.0035 0.46hsa-miR-1269 0.00 0.33 20.32 9.3 0.0037 0.46 8hsa-miR-549 0.13 0.03 20.17 9.3 0.0037 0.46hsa-miR-302b 0.08 0.28 20.35 9.3 0.0038 0.46 8hsa-miR-625∗ -0.11 20.03 0.13 9.3 0.0038 0.46hsa-miR-516b 20.16 0.06 0.11 9.3 0.0038 0.46hsa-miR-642 20.27 0.25 0.02 9.2 0.0040 0.46hsa-miR-320a 0.21 20.28 0.07 9.1 0.0040 0.46hsa-miR-562 20.03 20.13 0.16 9.0 0.0043 0.46hsa-miR-624∗ 20.08 0.17 20.09 8.9 0.0043 0.46hsa-miR-302a 20.11 20.14 0.24 8.8 0.0046 0.46hsa-miR-25∗ 20.27 0.04 0.22 8.8 0.0046 0.46hsa-miR-302c 20.02 20.13 0.15 8.7 0.0047 0.46hsa-miR-933 20.15 0.07 0.09 8.7 0.0048 0.46hsa-miR-486-3p 0.14 20.14 0.01 8.5 0.0051 0.46hsa-miR-935 0.07 0.09 20.17 8.5 0.0051 0.46hsa-miR-491-3p 20.03 20.17 0.20 8.5 0.0051 0.46hsa-miR-1233 20.01 0.17 20.15 8.4 0.0053 0.46hsa-miR-1281 20.04 0.25 20.20 8.4 0.0054 0.46hsa-miR-552 20.30 0.13 0.18 8.4 0.0055 0.46hsa-miR-302e 0.12 0.17 20.30 8.3 0.0056 0.46 8hsa-miR-198 20.16 0.04 0.12 8.2 0.0058 0.46hsa-miR-1305 20.11 0.16 20.04 8.2 0.0059 0.46hsa-miR-422a 20.11 20.07 0.18 8.0 0.0063 0.46hsa-let-7a 0.08 0.08 20.16 7.9 0.0066 0.46hsa-miR-493∗ 20.03 0.27 20.24 7.9 0.0067 0.46hsa-miR-302f 20.17 0.13 0.04 7.8 0.0069 0.46hsa-miR-519e 20.10 0.23 20.13 7.8 0.0071 0.46hsa-miR-593 20.05 0.13 20.08 7.7 0.0073 0.46hsa-miR-621 20.05 0.21 20.16 7.7 0.0073 0.46hsa-miR-24-2∗ 20.06 20.14 0.20 7.6 0.0075 0.46hsa-miR-600 20.12 0.01 0.11 7.6 0.0077 0.46hsa-miR-19b 20.31 0.05 0.26 7.5 0.0079 0.46 8hsa-miR-23b 0.23 20.18 20.05 7.4 0.0082 0.46hsa-miR-10b 20.04 0.13 20.09 7.4 0.0084 0.46hsa-miR-646 0.03 0.19 20.22 7.3 0.0085 0.46hsa-miR-32 0.14 20.25 0.11 7.2 0.0089 0.46

Pair-wise comparisons of 145Q-HTT up-regulated (.0.2-fold) miRs relative to 23Q-HTT and 73Q-HTT (Fig. 3A, n ¼ 4 replicates per transfection). 23Q/145Q,fold change relative to 145Q-HTT. AveExpr, average signal intensity; F, F-statistic. P, P-value significance of difference between 145Q and 23Q as determined byone-way ANOVA. P(B–H), P-value adjusted for Benjamini–Hochberg correction for multiple testing (B–H). (8) indicates miRs with a fold change (LogFC).1.2 or a non-adjusted P-value P , 0.001. miRs in bold were selected for further analysis.


Dow


ic.oup.com/hm


Blockade of endogenous miR-34b antagonizesmHTT-induced pro-survival activity

The role of miR-34b as a P53-regulated factor promoting celldeath and/or senescence in somatic cell-derived cancers iswell described (21,28,29). However, its function in pluripotentcells is not known. Therefore, we investigated whethermHTT-induced miR-34b (Fig. 3A and B) modulates mHTTcellular distribution and cell survival in pluripotent NT2cells. To inhibit endogenous miR-34b activity, we used aco-transfection strategy to apply antisense oligonucleotidesdirected against miR-34b (AS-34b) (Supplementary Material,Fig. S1C). We first measured the total nuclear and cytoplasmicarea occupied by mHTT-Exon-1 fragments by normalizing thetotal mHTT-Exon-1 immuno-positive area (using the mono-clonal antibody MAB5942/2B4) to the Hoechst+ area. Weobserved that, relative to scrambled control oligonucleotide(AS-SCR) -transfected cells (Fig. 7A and B), blockade ofmiR-34b activity (Fig. 7C and D) significantly increased the145Q-HTT immuno-reactive area (Fig. 7E, P , 0.05, n ¼ 4replicates). Most interestingly, compared with AS-SCR(Fig. 7F and G), miR-34b blockade markedly increasedcleaved-caspase-3 nuclear immuno reactivity in 145Q-HTTco-transfected cells (Fig. 7H–J, P , 0.05, n ¼ 4 replicates).Blockade of miR-34b also antagonized the reduced levels ofcaspase-3/7 activity in 145Q-HTT-transfected cells (Fig. 7K,P , 0.05, n ¼ 4 biological replicates). Critically, blockadeof miR-34b removed the pro-survival effect of 145Q-HTTexpression observed in undifferentiated NT2 cells (Fig. 5A).These data suggest that mHTT-induced miR-34b may reducethe cytoplasmic distribution and cellular toxicity ofmHTT-Exon-1 and thereby mediate the protective effect ofmHTT (Fig. 5A) in undifferentiated NT2 cells.

DISCUSSION

There is a strong need for bio-stable measures that changeconsistently with disease pathology in HD. Although themutant HD gene constitutes the ultimate trait biomarker,attempts to find mRNA- and protein-based state biomarkershave not yet yielded desired results. Biomarkers that are obser-vable in the pre-manifest period are especially important, asthey coincide with a window of opportunity for disease-modifying interventions. Here, we have developed a novelhuman cell line-based assay to identify miR biomarkers thatmay be of functional significance in HD progression in bothneuronal and non-neuronal cell populations. We show thatmiR-34b constitutes a plasma bio-stable marker that affordsrobust detection from volumes as low as 10 ml. MultipleRNAs can be isolated from a single plasma sample, and

amplification is linear over a large range of plasma inputvolumes. To our knowledge, this is the first identification ofa miR associated with the pre-clinical manifestation of HDthat is detectable outside of the nervous system. It is antici-pated that these observations will serve as a platform forfurther studies evaluating the role of miRNAs as potentialbiomarkers of neurodegenerative disease.

Recent studies have demonstrated the value of biomechani-cal tests of motor function as reliable biomarkers of HD pro-gression (2,30). Molecular correlates of disease progressionprovide insight into potential therapeutic targets and dysregu-lation of gene expression in response to mHTT (31,32). This isespecially true in HD, which is caused by mHTT, a proteincapable of modulating gene transcription and translation in asystemic manner in different somatic cell populations (8). InHD patient-derived whole blood, Borovecki et al. (33) ident-ified multiple mRNAs that were significantly elevated relativeto control subjects. However, this finding has not been repli-cated (34). We concede that our findings are based on asmall cohort of patients and it will be critical to evaluate thesignificance of this enrichment in larger patient samples andin longitudinal samples.

Neurons exhibit exquisite sensitivity to mHTT. We (4) andothers (8) have also observed changes consistent withmHTT-induced cytotoxicity in several somatic cell typesthat may precede symptomatic neuronal dysfunction. Fewstudies have examined mHTT toxicity in pluripotent mouseand human cells. NT2 cells share key features of pluripotentcells (OCT4/NANOG expression, broad lineage potential andAP activity) and express mHTT-interacting transcriptionfactors such as NRSF/REST (32,35) and P53 (36–38). Pre-vious studies of IT15 (HTT) and proximal transcripts(D4S234E) suggested differences in sub-cellular localizationand HTT aggregation between undifferentiated NT2 cellsand NT2-derived neurons (23,24), although cellular toxicitywas not studied. Our data suggest that mHTT promotes cellsurvival of undifferentiated, pluripotent NT2 cells, butbecomes toxic when the cells have differentiated and acquireda somatic (neuronal) phenotype. Consistent with this obser-vation, hESC lines (14) and iPSC lines (15) that expressmHTT are viable and exhibit nominal ESC characteristics atthe level of transcription. This intriguing observation supportsthe hypothesis that common mHTT-interacting products ofsomatic cell transcriptomes mediate mHTT-induced cytotox-icity. These products are absent or functionally sequesteredfrom mHTT in pluripotent cells. Comparative, functionalgenomic approaches to identifying common mHTT interactionpartners in hESCs and hiPSCs and their somatic derivativesmay provide better insight into the molecular basis formHTT cytotoxicity in vitro.

mHTT-Exon-1 over-expression models of HTT genomicfunction indicate that mHTT interacts with primarily intronicand intergenic genomic regions (22), where most small RNAgenes are localized (39). Therefore, mHTT interaction withtranscription factors such as REST and P53, among others,may regulate miR transcription. Previous studies demonstratethat miR-34b is transcriptionally activated by P53 (21), andothers have speculated that mHTT might alter P53-regulatedmiRs in HD (40,41). We observe that inhibition of miR-34bis sufficient to antagonize the pro-survival effects of mHTT

Table 2. Demographics of HD patient plasma samples

Diseasestage

Number ofsubjects

Female–male

Mean age(range)

Mean CAG(range)

Control 12 (7:5) 49 (21–65)Pre-manifest 11 (7:4) 40 (23–49) 42 (38–45)Early 8 (3:5) 51 (43–65) 43 (41–47)Moderate 8 (5:3) 51 (43–61) 46 (43–49)


Dow


ic.oup.com/hm




in pluripotent cells. miR-34b is known to represses translationof MYC (42) and cAMP-responsive element binding (CREB)(29), among other putative targets (43,44). Interestingly,MYC promotes apoptosis and differentiation of hESCs, inmarked contrast to mESCs (45). The present study has notaddressed whether mHTT-induced, miR-34b up-regulationhas different effects in neurons or other cell types. Clearly,NT2 cells and emerging mHTT-dominant-negative hESC or

hiPSC cell lines and their differentiated progeny representpowerful technology platforms to identify novel miR-34btargets and address the context-specific effects of miR-34bin future studies.

We did not observe significant changes in any of the miRspreviously associated with REST (46–48). REST interactswith distinct genes in pluripotent and somatic populations(49). It appears to be dispensable for ESC pluripotency or self-

Figure 5. mHTT exerts a pro-survival effect on undifferentiated NT2 cells. 145Q-HTT transfection significantly reduced (A) caspase-3/7 activity and (D–E)caspase-3 immuno reactivity relative to (B and C) 23Q-HTT-transfected cells. Also, 145Q-HTT also associated with increased (F) BrDU incorporation and (G)AP protein levels relative to 23Q-HTT transfected cells. ∗P , 0.05 relative to 23Q-HTT-transfected cells. Scale bar, 25 mm.

Figure 4. miR-34b is elevated in pre-manifest HD plasma and differentiating NT2 cells. Levels of miR-1285 (black bars) and miR-34b (white bars) were quan-tified from 100 ml of blinded HD clinical samples (pre-manifest HD, n ¼ 11 samples; early HD, n ¼ 8 samples; moderate HD, n ¼ 8 samples) and age-matchedcontrols (n ¼ 12 samples). A significant increase in miR-34b was observed in pre-manifest HD samples (A). A similar up-regulation of miR-34b relative to day 0miRNA levels was observed in (B) differentiating NT2 cells in vitro (Supplementary Material, Fig. S1D). 145Q-HTT-transfected cells (white bars) exhibitedhigher levels of miR-34b than 23Q-HTT transfected cells (black bars). ∗P , 0.05 relative to (A) control plasma samples and (B) undifferentiated, mHTT-Exon-1transfected cells.


Dow


ic.oup.com/hm



renewal (50,51), although this is disputed (52). However,mHTT may alter expression of neuron-associated,REST-repressed miRs and transcripts that are de-repressedor activated by REST on neuronal differentiation (53). It islikely that the homogenous cellular assay used here has under-estimated the diversity of miRs that might be elevated ordecreased in human plasma. To identify such genes, next-generation sequencing of HD patient plasma and age-matchedcontrol samples might identify populations of plasma-enrichedmiRs in a quantitative manner, as has been previouslydescribed (17). These strategies would also allow for compara-tive analysis of mHTT-induced changes in pluripotent and dif-ferentiated NT2 cells at the level of transcription. We hope ourstudy will provide impetus for these experiments and that thefunctional significance of miR changes can be further eluci-dated in both in vitro and in vivo models of HD.

MATERIALS AND METHODS

Human plasma samples

Blood samples were obtained from control subjects andgenetically diagnosed HD subjects at National Hospital forNeurology and Neurosurgery, Queen Square, London, UK,and processed as previously described (54). The study popu-lation consisted of 12 control subjects, 11 pre-manifest HDsubjects, 8 early and 8 moderate HD subjects (Table 2). Thestudy was conducted in accordance with the Declaration of

Helsinki and approved by the ION/NHNN ethical reviewboard and the NHNN Research and Development Committee.Institutional Review Board (IRB) and consent permitted theuse of samples for biomarker studies. The operator wasunaware of the disease state of each sample during processingand statistical analysis. To examine miR linearity of amplifica-tion, we used samples from a single, known HD patient andisolated RNA from serial dilutions of plasma (10, 25, 50,100 and 250 ml v/v RNAse-free H2O to a final volume of250 ml). To examine miR bio-stability, a separate series ofknown HD patient plasma samples were pooled, aliquoted(100 ml/sample, n ¼ 6 samples per freeze-thaw round) andsubjected to multiple rounds (1–3) of freeze–thaw in dryice (10 min) followed by incubation at room temperature(15 min). To examine blinded samples, 100 ml of patient andcontrol plasma was used for miRNA extraction and reversetranscription/polymerase chain reaction.

mHTT-Exon-1 constructs

pCDNA 3.1 constructs were obtained (SupplementaryMaterial, Fig. S1A) that encode the first 90 amino acids(Exon1) of human HTT with short (23Q, CH0017), medium(73Q, CH0018) and long (145Q, CH0019) variant polygluta-mine repeats (translated from a mixed codon where mix ¼[CAG, CAA, CAG, CAA, CAA]n) and Neomycin resistance(Fig. 1A) (Coriell, Camden, NJ, USA; www.corriell.org),both under the cytomegalovirus promoter. A separate

Figure 6. mHTT exerts a toxic effect on NT2-derived neurons. Stably transfected NT2 cells were differentiated in RA for 21 days and cellular survival and differ-entiation assayed by immuno staining and analysis of nuclear morphology. Relative to 23Q-HTT-transfected cells, 145Q-HTT increased the number of (A) SMI312immuno-reactive cells co-stained for caspase-3 (F–I) relative to 23Q-HTT. 145Q-HTT transfection also significantly reduced the length of SMI312-positiveimmuno-reactive neuronal processes (B) but did not alter the total number of neurons (C). This was also observed using MAPT immuno staining (C, D–E).∗P , 0.05. Scale bar, 50 mm.


Dow


ic.oup.com/hm




expression cassette encoding GFP downstream of the phos-phoglycerate kinase promoter was added (courtesy ofDr T. Hjalt, Lund University). Plasmids were amplified inEscherichia coli strand in lysogeny broth with ampicillin over-night at 378C with shaking. For isolation of plasmid, we usedMaxiPrep Kit (Qiagen GmbH, Hilden, Germany).

Cell culture

All cell culture reagents were supplied by Invitrogen Ltd(Carlsbad, CA, USA) unless otherwise specified. TheNTera2 (NT2, #CRL-1973) cell line was obtained fromATCC (c/o LGC Standards Office, Boras, Sweden; www.atcc.org). Cells were cultured in 75 cm2 flasks (BD Bio-sciences, San Jose, CA, USA) in standard culture media(Dulbecco’s modified Eagle’s medium supplemented with10% fetal bovine serum, 100 U penicillin, 100 mg streptomycinand 1× minimal essential medium non-essential amino acidssupplement) in 5% CO2/O2 at 378C.

Cell transfection and nucleofection

Low-passage NT2 cells, with a minimum of three biologicalreplicates derived from two temporally separate passages,were used for all studies unless otherwise stated. For transienttransfection of undifferentiated NT2 cells, Lipofectami-ne2000TM transfection reagent was used to deliver plasmids(1.0 mg/1 × 106 cells) or oligonucleotide antagonists of miRs(Anti-miRs, Applied Biosystems, Foster City, CA, USA;

10 nM/1 × 106 cells) in plasma-free media with 100% mediachange 30 min post-transfection. Twenty-four hours post-selection, G418 (1 mg/ml) was applied and media werechanged every other day for 6 days. Nucleofection of NT2cells for differentiation was performed using the CellLine Nucleofector Kit (Lonza AG, Basel, Switzerland) essen-tially according to the manufacturers protocol but using pro-gramme A01 instead of X01. One day after transfection, G418(1.0 mg/ml) was applied for 6 days. Afterwards, cells were har-vested and re-plated on poly-L-lysine-coated (1 mg/ml) 6-wellor 96-well black-walled optical plates (NuncTM, ThermoFisherScientific, Waltham, MA, USA) in standard culture media with10 mM RA (Sigma-Aldrich, St Louis, MO, USA) and 0.5 mg/mlG418. Cells were cultivated for 3 weeks (7, 14 and 21 day timepoints) with media changed every other day.

Analysis of cell death, cell proliferation and AP activity

All assays were performed according to the manufacturer’sprotocol using transfected/nucleofected cells post-G418 selec-tion in 96-well black-walled optical plates in the standardculture medium. To normalize cell density prior to theassay, cell number was counted by haemocytometer and ali-quoted at 2 × 104 cells/well. Cell death was measured withthe Apo-ONE Homogenous Caspase-3/7 Assay at 1, 6 and18 h post-lysis (Promega Inc., Madison, WI, USA). Cell pro-liferation was measured using the BrDU incorporation assay(Millipore Inc., Billerica, MA, USA) after an 18 h BrDU(20 mM) incubation period. Alkaline phosphatase (AP) activity

Figure 7. Blockade of miR-34b activity in pluripotent cells increases mHTT toxicity. Undifferentiated NT2 cells were co-transfected with mHTT-Exon-1 con-structs and a functional blocking oligonucleotide that targets miR-34b (AS-34b) or a non-targeting antisense oligonucleotide (AS-SCR) (Supplementary Material,Fig. S1C). Following 23Q-HTT (C) or 145Q-HTT (D) co-transfection with AS-34b, the mHTT-Exon-1 (MAB5942/2B4 antibody) immuno-reactive area (normal-ized to Hoechst+ immuno-stained area) was increased, relative to AS-SCR control (A and B). AS-34b co-transfection with (H and I) mHTT-Exon-1 constructsincreased (J) cleaved caspase-3 immuno reactivity and (K) antagonized the effects of 145Q-HTT on caspase-3/7 activity relative to (F–G) AS-SCR control.∗P , 0.05 relative to indicated cells. Scale bar, 100 mm.


Dow


ic.oup.com/hm




was measured using the Alkaline Phosphatase ES Characteriz-ation Kit (Millipore) after 1 day of culture. AP measurementswere normalized to a standard curve based on supplied recom-binant protein (data not shown). Fluorescence and absorbancemeasurements were made using a FluoStar OPTIMA micro-plate reader (BMC Labtech, Germany).

RNA isolation

All molecular biology reagents were supplied by Invitrogenunless otherwise stated. To isolate RNA from cell lines, trans-fected/nucleofected NT2 cells were washed twice withphosphate-buffered saline (PBS) and harvested using 0.25%trypsin, inactivated with the standard culture medium and pel-leted by centrifuging for 5 min at 600g. Cells were then lysedusing TRIzol reagent. To isolate RNA from plasma, samples(10–250 ml, v/v H2O) were aliquoted on ice and lysed in 5volumes (1.0 ml) of TRIzol. RNA isolation from TRIzol wasperformed essentially according to the manufacturer’s instruc-tions but with 100% ethanol precipitation followed by columnpurification (miRNeasy RNA Purification Kit, Qiagen).On-column RNAse-free DNAseI treatment (Qiagen) was per-formed according to the manufacturer’s protocols. Total RNA/miRNA was eluted in 25 ml ddH2O and stored at 2808C. ForqPCR assays, RNA concentration was determined by theabsorbance at 260 nm and the 260/280 nm and 260/230 nmratios using Nandrop3300 (ThermoFisher Scientific). TypicalRNA yields for plasma isolation were variable, but were inthe range of 0.5–5 ng/ml.

mRNA reverse transcription and PCR

All PCRs were performed using a Bio-Rad Mini-Opticon48-well real-time PCR machine in low-profile optical tubes(20 ml per reaction). SuperScript III reverse transcriptase wasused with Oligo-dT primers and 1.0 mg of total RNA accordingto the manufacturer’s protocols in a volume of 25 ml. PCR (n ¼3–4 replicates per sample) was performed using a 100×dilution of cDNA, 20 pmol primers and 2x MaximaTM SYBRGreen Master Mix (Fermentas GmbH, St Leon-Rot, Germany)in a reaction volume of 20 ml. mRNA amplification conditionswere as follows: hold, 958C, 5 min; 25–40 cycles (958C for20 s, 628C 20 s, 728C 30 s). Primer sequences (obtained fromthe Realtime PCR Primer Database, http://medgen.ugent.be/rtprimerdb/; 55) were as follows (all written in 5′ –3′ orientationwith the length of the product in base pairs, bp): ACTB-F,AAGGGACTTCCTGTAACAATGCA, ACTB-R, CTGGAACGGTGAAGGTGACA, 321 bp; BDNF-F, AGTGCCGAACTACCCAGTGCTA, BDNF-R, CTTATGAATCGCCAGCCAATTC, 75 bp; DRD2-F, AGCCACCACCAGCTGACTCT,DRD2-R, GGGCATGGTCTGGATCTCAA, 140 bp; GFP-F,AACTACAACAGCCACAA, GFP-R, GTGTTCTGCTGGTAGTGGTC, 127 bp; HTTExon1-F, ACAGCCGCTGCTGCCT,HTTExon1R, CGGCTCCTCAGCCACA, 78 bp; IL6-F,GGCACTGGCAGAAAACAACC, IL6-R, GCAAGTCTCCTCATTGAATCC, 84 bp; NANOG-F, AATACCTCAGCCTCCAGCAGATG, NANOG-R, TGCGTCACACCATTGCTATTCTTC, 150 bp; NEUROD1-F, TCACATCATGAGCGAGTCATGA, NEUROD1-R, TGAAACTGGCGTGCCTCTAA,69 bp; OCT4-F, GAGGAACCGAGTGAGAGGCAACC,

OCT4-R, CATAGTCGCTGCTGCTTGATCGCTTG, 156 bp;MAPT-F, TTTGGTGGTGGTTAGAGATATGC, MAPT-R,CCGAGGTGCGTGAAGAAATG, 72 bp. The success of eachreaction was deduced based on the observation of a single reac-tion product on an agarose gel and/or a single peak on the DNAmelting temperature curve determined at the end of the reaction(Supplementary Material, Fig. S2). For some reactions,semi-qPCR was performed based on measurement of intensityof bands with ImageJ software after 2% agarose gel electrophor-esis, with comparable results to fluorescent mRNA detection.All results are presented as percent of cytoskeletal Actin(ACTB primer set) expression before normalization to23Q-HTT levels.

miR reverse transcription and PCR

For miR bio-stability and linearity assays, input total RNAwas normalized to 5 ng for pooled HD patient plasma. Forblinded samples, 5 ml of the RNA eluate was used withoutprior RNA normalization. For NT2 samples, input was nor-malized to 10 ng. Multiscribe Reverse Transcriptase(Applied Biosystems) was used with inventoried miR-specificprimers in a total volume of 7.5 ml according to the manufac-turer’s protocol. PCR (n ¼ 3 replicates per sample) was per-formed in a reaction volume of 20 ml using 2.0 ml cDNA,1.0 ml inventoried Taqman primers for hsa-miR-16,hsa-miR-34b and hsa-miR-1285 (Applied Biosystems), 10 ml2× NoAmpErase UNG Master Mix (Applied Biosystems)and 7.0 ml of RNAse-free H2O. miR amplification conditionswere as follows: hold, 958C, 5 min; 50 cycles (958C for15 s, 608C 60 s). For SYBR green and Taqman mRNAprimers, PCR amplicon cut-off levels were established at 35cycles. For Taqman miRNA amplicons from NT2 cells andhuman plasma samples, PCR amplicon cut-off levels wereestablished at 45 cycles (excluding dilution assays, Fig. 3C).Negative RT samples did not exhibit amplicons at 35 and 45cycles, respectively (data not shown).

Locked nucleic acid (LNA) microarray

Total RNA including the miRNA fraction from four replicateexperiments was directly labelled (Cy3) and hybridized tomiRCURY LNA miR v 11.0 arrays (Exiqon AS, Vedbaek,Denmark). Combined input RNA from all samples (Cy5)was used as a reference control (Exiqon Microarray Services,Vedbaek, Denmark). Array data sets were normalized by var-iance stabilizing normalization (56) using the vsn packagewith Bioconductor (http://www.bioconductor.org).

Immunocytochemistry

Cells were cultured in uncoated (undifferentiated NT2 cells) orpoly-L-lysine-coated (differentiated NT2 cells) eight-wellchamber slides (BD Biosciences), fixed overnight in 4% paraf-ormaldehyde (Sigma) at 48C and treated with 95% ethanol v/vPBS for 10 min at 2208C. After three washes with PBS, cellswere blocked with 5% normal goat plasma (Sigma) and 0.05%Triton X-100 (Sigma) in PBS for 30 min and then incubatedwith primary antibody (see below) overnight at 48C. Afterextensive washing, the cells were incubated with the


Dow


ic.oup.com/hm



secondary antibody (Alexa Fluor 488 goat anti-rabbit IgG oranti-chicken IgY, Alexa Fluor 594 goat anti-mouse IgG oranti-rabbit IgG; Invitrogen) for 2 h at room temperature.Cells were washed and the nuclei counterstained withHoechst33342 (Sigma). The following primary antibodieswere used: anti-caspase-3 (mouse IgG, Cell SignallingTechnology, Beverly, MA, USA, 9662, 1:1000),anti-cleaved-caspase-3 (Rabbit IgG, Cell Signalling Technol-ogy, 9661; 1:1000), anti-GFP (Chicken IgY, Invitrogen,A10262; 1:500), anti-HTT-Exon-1 [mouse IgG, Millipore,MAB5492/2B4 (recognizing N-terminus amino acids 1–82);1: 500], anti-Ki67 (Rabbit IgG, Abcam, Cambridge, UK; 1:1000), anti-polyglutamine (Mouse IgG, Clone 5TF1-1C2,MAB1574; Millipore, 1: 1000), anti-phosphorylated neurofila-ment (Mouse IgG2a, Covance, Emeryville, CA, USA,SMI312; 1:500) and anti-Tau (anti-MAPT) (Rabbit IgG,Sigma, T6402; 1:2000). Slides were analysed using laser scan-ning confocal (Carl Zeiss) or Nikon Eclipse 80i (Nikon,Tokyo, Japan) fluorescent microscopes with analysis onNIS-Elements software (Nikon) and ImageJ-64.

Statistical analysis

Analyses of microarray normalization and significance of rela-tive changes in gene expression were performed with Biocon-ductor and the use of the Limma, marray, pvclust and statmodpackages. Significance was determined by one-way analysis ofvariance (ANOVA) and Benjamini–Hochberg (B–H) correc-tion. For cell culture experiments, all data are expressed at themean+ standard error of the mean (SEM). Significance wasassayed by unpaired Student’s t-test (a ¼ 0.05) or one-wayANOVA (a ¼ 0.05).

SUPPLEMENTARY MATERIAL

Supplementary Material is available at HMG online.

ACKNOWLEDGEMENTS

We thank Srikanth Ranganathan for reading the manuscriptand for valuable criticism. We are also grateful to HazelPinhero, Maria Telium and Niels Frandsen (Exiqon A/S,Vedbaek, Denmark) for their expertise in miR array hybridiz-ation and technical assistance. We acknowledge the experttechnical assistance of Birgit Haraldsson and Britt Lindberg.The Swedish Research Council and a grant from theAnna-Lisa Rosenberg Foundation supported this study.

Conflict of Interest statement. None declared.

FUNDING

P.M.G. is supported by the Wenner-Gren Foundation andM.C. by an ERASMUS Foundation Studentship. M.B. is sup-ported by the Bente Rexed Foundation.

REFERENCES

1. The Huntington’s Disease Collaborative Research Group (HDCRG).(1993) A novel gene containing a tri-nucleotide repeat that is expandedand unstable on Huntington’s disease chromosomes. Cell, 72, 971–983.

2. Tabrizi, S.J., Langbehn, D.R., Leavitt, B.R., Roos, R.A., Durr, A.,Craufurd, D., Kennard, C., Hicks, S.L., Fox, N.C., Scahill, R.I. et al.

(2009) Biological and clinical manifestations of Huntington’s disease inthe longitudinal TRACK-HD study, cross-sectional analysis of baselinedata. Lancet Neurol., 8, 791–801.

3. Walker, F.O. (2007) Huntington’s disease. Lancet, 369, 218–228.

4. van der Burg, J.M., Bjorkqvist, M. and Brundin, P. (2009) Beyond thebrain, widespread pathology in Huntington’s disease. Lancet Neurol., 8,765–774.

5. Vonsattel, J.P., Myers, R.H., Stevens, T.J., Ferrante, R.J., Bird, E.D. andRichardson, E.P. Jr. (1985) Neuropathological classification ofHuntington’s disease. J. Neuropathol. Exp. Neurol., 44, 559–577.

6. Petersen, A., Hult, S. and Kirik, D. (2009) Huntington’s disease—newperspectives based on neuroendocrine changes in rodent models.Neurodegener. Dis., 6, 154–164.

7. Rosas, H.D., Salat, D.H., Lee, S.Y., Zaleta, A.K., Pappu, V., Fischl, B.,Greve, D., Hevelone, N. and Hersch, S.M. (2008) Cerebral cortex and theclinical expression of Huntington’s disease, complexity and heterogeneity.Brain, 131, 1057–1068.

8. Sassone, J., Colciago, C., Cislaghi, G., Silani, V. and Ciammola, A.(2009) Huntington’s disease, the current state of research with peripheraltissues. Exp. Neurol., 219, 385–397.

9. Bates, G. (2003) Huntingtin aggregation and toxicity in Huntington’sdisease. Lancet, 361, 1642–1644.

10. Harjes, P. and Wanker, E.E. (2003) The hunt for Huntingtin function,interaction partners tell many different stories. Trends Biochem. Sci., 28,425–433.

11. Hoffner, G. and Djian, P. (2002) Protein aggregation in Huntington’sdisease. Biochimie, 84, 273–278.

12. Sawa, A., Tomoda, T. and Bae, B.I. (2003) Mechanisms of neuronal celldeath in Huntington’s disease. Cytogenet. Genome Res., 100, 287–295.

13. Zeron, M.M., Chen, N., Moshaver, A., Lee, A.T., Wellington, C.L.,Hayden, M.R. and Raymond, L.A. (2001) Mutant huntingtin enhancesexcitotoxic cell death. Mol. Cell Neurosci., 17, 41–53.

14. Niclis, J.C., Trounson, A.O., Dottori, M., Ellisdon, A.M., Bottomley, S.P.,Verlinsky, Y. and Cram, D.S. (2009) Human embryonic stem cell modelsof Huntington disease. Reprod. Biomed. Online, 19, 106–113.

15. Park, I.H., Arora, N., Huo, H., Maherali, N., Ahfeldt, T., Shimamura, A.,Lensch, M.W., Cowan, C., Hochedlinger, K. and Daley, G.Q. (2008)Disease-specific induced pluripotent stem cells. Cell, 134, 877–886.

16. Ruvkun, G. (2008) The perfect storm of tiny RNAs. Nat. Med., 14,1041–1045.

17. Chen, X., Ba, Y., Ma, L., Cai, X., Yin, Y., Wang, K., Guo, J., Zhang, Y.,Chen, J., Guo, X. et al. (2008) Characterization of microRNAs in serum, anovel class of biomarkers for diagnosis of cancer and other diseases. Cell

Res., 18, 997–1006.

18. Cortez, M.A. and Calin, G.A. (2009) MicroRNA identification in plasmaand serum, a new tool to diagnose and monitor diseases. Expert Opin.

Biol. Ther., 9, 703–711.

19. Gilad, S., Meiri, E., Yogev, Y., Benjamin, S., Lebanony, D., Yerushalmi,N., Benjamin, H., Kushnir, M., Cholakh, H., Melamed, N. et al. (2008)Serum microRNAs are promising novel biomarkers. PLoS ONE, 3, e3148.

20. Mitchell, P.S., Parkin, R.K., Kroh, E.M., Fritz, B.R., Wyman, S.K.,Pogosova-Agadjanyan, E.L., Peterson, A., Noteboom, J., O’Briant, K.C.,Allen, A. et al. (2008) Circulating microRNAs as stable blood-basedmarkers for cancer detection. Proc. Natl Acad. Sci. USA, 105,10513–10518.

21. Corney, D.C., Flesken-Nikitin, A., Godwin, A.K., Wang, W. and Nikitin,A.Y. (2007) MicroRNA-34b and MicroRNA-34c are targets of P53 andcooperate in control of cell proliferation and adhesion-independentgrowth. Cancer Res., 67, 8433–8438.

22. Benn, C.L., Sun, T., Sadri-Vakili, G., McFarland, K.N., DiRocco, D.P.,Yohrling, G.J., Clark, T.W., Bouzou, B. and Cha, J.H. (2008) Huntingtinmodulates transcription, occupies gene promoters in vivo, and bindsdirectly to DNA in a polyglutamine-dependent manner. J. Neurosci., 28,10720–10733.


Dow


ic.oup.com/hm



23. Bessert, D.A., Gutridge, K.L., Dunbar, J.C. and Carlock, L.R. (1995) Theidentification of a functional nuclear localization signal in the Huntingtondisease protein. Brain Res. Mol. Brain Res., 33, 165–173.

24. Carlock, L., Vo, T., Lorincz, M., Walker, P.D., Bessert, D., Wisniewski,D. and Dunbar, J.C. (1996) Variable sub-cellular localization of aneuron-specific protein during NTera 2 differentiation into post-mitotichuman neurons. Brain Res. Mol. Brain Res., 42, 202–212.

25. Andrews, P.W. (1984) Retinoic acid induces neuronal differentiation of acloned human embryonal carcinoma cell line in vitro. Dev. Biol., 103,285–293.

26. Andrews, P.W., Damjanov, I., Simon, D., Banting, G.S., Carlin, C.,Dracopoli, N.C. and Fogh, J. (1984) Pluripotent embryonal carcinomaclones derived from the human teratocarcinoma cell line Tera-2.Differentiation in vivo and in vitro. Lab. Invest., 50, 147–162.

27. Subramaniam, S., Sixt, K.M., Barrow, R. and Snyder, S.H. (2009) Rhes, astriatal specific protein, mediates mutant-huntingtin cytotoxicity. Science,324, 1327–1330.

28. He, C., Xiong, J., Xu, X., Lu, W., Liu, L., Xiao, D. and Wang, D. (2009)Functional elucidation of MiR-34 in osteosarcoma cells and primarytumor samples. Biochem. Biophys. Res. Commun., 388, 35–40.

29. Pigazzi, M., Manara, E., Baron, E. and Basso, G. (2009) miR-34b targetscyclic AMP-responsive element binding protein in acute myeloidleukemia. Cancer Res., 69, 2471–2478.

30. Wild, E.J., Mudanohwo, E.E., Sweeney, M.G., Schneider, S.A., Beck, J.,Bhatia, K.P., Rossor, M.N., Davis, M.B. and Tabrizi, S.J. (2008)Huntington’s disease phenocopies are clinically and geneticallyheterogeneous. Mov. Disord., 23, 716–720.

31. Pfister, E.L. and Zamore, P.D. (2009) Huntington’s disease, silencing abrutal killer. Exp. Neurol., 220, 226–229.

32. Roze, E., Saudou, F. and Caboche, J. (2008) Pathophysiology ofHuntington’s disease, from huntingtin functions to potential treatments.Curr. Opin. Neurol., 21, 497–503.

33. Borovecki, F., Lovrecic, L., Zhou, J., Jeong, H., Then, F., Rosas, H.D.,Hersch, S.M., Hogarth, P., Bouzou, B., Jensen, R.V. et al. (2005)Genome-wide expression profiling of human blood reveals biomarkers forHuntington’s disease. Proc. Natl Acad. Sci. USA, 102, 11023–11028.

34. Runne, H., Kuhn, A., Wild, E.J., Pratyaksha, W., Kristiansen, M., Isaacs,J.D., Regulier, E., Delorenzi, M., Tabrizi, S.J. and Luthi-Carter, R. (2007)Analysis of potential transcriptomic biomarkers for Huntington’s diseasein peripheral blood. Proc. Natl Acad. Sci. USA, 104, 14424–14429.

35. Lawinger, P., Venugopal, R., Guo, Z.S., Immaneni, A., Sengupta, D., Lu,W., Rastelli, L., Marin Dias Carneiro, A., Levin, V., Fuller, G.N. et al.(2000) The neuronal repressor REST/NRSF is an essential regulator inmedulloblastoma cells. Nat. Med., 6, 826–831.

36. Steffan, J.S., Kazantsev, A., Spasic-Boskovic, O., Greenwald, M., Zhu,Y.Z., Gohler, H., Wanker, E.E., Bates, G.P., Housman, D.E. andThomson, L.M. (2000) The Huntington’s disease protein interacts withP53 and CREB-binding protein and represses transcription. Proc. NatlAcad. Sci. USA, 97, 6763–6768.

37. Curtin, J.C., Dragnev, K.H., Sekula, D., Christie, A.J., Dmitrovsky, E. andSpinella, M.J. (2001) Retinoic acid activates P53 in human embryonalcarcinoma through retinoid receptor-dependent stimulation of P53trans-activation function. Oncogene, 20, 2559–2569.

38. Bae, B.I., Xu, H., Igarashi, S., Fujimuro, M., Agrawal, N., Taya, Y.,Hayward, S.D., Moran, T.H., Montell, C., Ross, C.A. et al. (2005) P53mediates cellular dysfunction and behavioural abnormalities inHuntington’s disease. Neuron, 47, 29–41.

39. Borel, C., Gagnebin, M., Gehrig, C., Kriventseva, E.V., Zdobnov, E.M.and Antonarakis, S.E. (2008) Mapping of small RNAs in the humanENCODE regions. Am. J. Hum. Genet., 82, 971–981.

40. Bithell, A., Johnson, R. and Buckley, N.J. (2009) Transcriptionaldysregulation of coding and non-coding genes in cellular models ofHuntington’s disease. Biochem. Soc. Trans., 37, 1270–1275.

41. Johnson, R. and Buckley, N.J. (2009) Gene dysregulation in Huntington’sdisease, REST, microRNAs and beyond. Neuromolecular Med., 11,183–199.

42. Leucci, E., Cocco, M., Onnis, A., De Falco, G., van Cleef, P., Bellan, C.,van Rijk, A., Nyagol, J., Byakika, B., Lazzi, S. et al. (2008) MYCtranslocation-negative classical Burkitt lymphoma cases, an alternativepathogenetic mechanism involving miRNA deregulation. J. Pathol., 216,440–450.

43. Hermeking, H. (2010) The miR-34 family in cancer and apoptosis. CellDeath Differ., 17, 193–199.

44. Hermeking, H. (2007) P53 enters the microRNA world. Cancer Cell, 12,414–418.

45. Sumi, T., Tsuneyoshi, N., Nakatsuji, N. and Suemori, H. (2007) Apoptosisand differentiation of human embryonic stem cells induced by sustainedactivation of c-Myc. Oncogene, 26, 5564–5576.

46. Conaco, C., Otto, S., Han, J.J. and Mandel, G. (2006) Reciprocal actionsof REST and a microRNA promote neuronal identity. Proc. Natl Acad.Sci. USA, 103, 2422–2427.

47. Johnson, R., Zuccato, C., Belyaev, N.D., Guest, D.J., Cattaneo, E. andBuckley, N.J. (2008) A microRNA-based gene dysregulation pathway inHuntington’s disease. Neurobiol. Dis., 29, 438–445.

48. Wu, J. and Xie, X. (2006) Comparative sequence analysis reveals anintricate network among REST, CREB and miRNA in mediating neuronalgene expression. Genome Biol., 7, R85.

49. Johnson, R., Teh, C.H., Kunarso, G., Wong, K.Y., Srinivasan, G., Cooper,M.L., Volta, M., Chan, S.S., Lipovich, L.L., Pollard, S.P. et al. (2008)REST regulates distinct transcriptional networks in embryonic and neuralstem cells. PLoS Biol., 6, e256.

50. Buckley, N.J., Johnson, R., Sun, Y.M. and Stanton, L.W. (2009) Is RESTa regulator of pluripotency? Nature, 457, E5–E6.

51. Jorgensen, H.F., Chen, Z.F., Merkenschlager, M. and Fisher, A.G. (2009)Is REST required for ESC pluripotency? Nature, 457, E4–E5(discussion E7).

52. Singh, S.K., Kagalwala, M.N., Parker-Thornburg, J., Adams, H. andMajumder, S. (2008) REST maintains self-renewal and pluripotency ofembryonic stem cells. Nature, 453, 223–227.

53. Jorgensen, H.F., Terry, A., Beretta, C., Pereira, C.F., Leleu, M., Chen,Z.F., Kelly, C., Merkenschlager, M. and Fisher, A.G. (2009) RESTselectively represses a subset of RE1-containing neuronal genes in mouseembryonic stem cells. Development, 136, 715–721.

54. Dalrymple, A., Wild, E.J., Joubert, R., Sathasivam, K., Bjorkqvist, M.,Petersen, A., Jackson, G.S., Isaacs, J.D., Kristiansen, M., Bates, G.P. et al.(2007) Proteomic profiling of plasma in Huntington’s disease revealsneuro-inflammatory activation and biomarker candidates. J. ProteomeRes., 6, 2833–2840.

55. Pattyn, F., Robbrecht, P., De Paepe, A., Speleman, F. and Vandesompele,J. (2006) RTPrimerDB, the real-time PCR primer and probe database.Nucleic Acids Res., 34, D684–D688.

56. Pradervand, S., Weber, J., Thomas, J., Bueno, M., Wirapati, P., Lefort, K.,Dotto, G.P. and Harshman, K. (2009) Impact of normalization on miRNAmicroarray expression profiling. RNA, 15, 493–501.


Dow


ic.oup.com/hm


hsa-mir-34b is a plasma-stable microrna that is elevated in

Documents