hoover high school mr.plazaks biology : write an answer here what is the sequence of an rna molecule...
TRANSCRIPT
![Page 1: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA](https://reader035.vdocuments.us/reader035/viewer/2022062417/5514fab055034693478b6298/html5/thumbnails/1.jpg)
Hoover High School
Mr.Plazak’s Biology
![Page 2: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA](https://reader035.vdocuments.us/reader035/viewer/2022062417/5514fab055034693478b6298/html5/thumbnails/2.jpg)
:Write an answer here
What is the sequence of an RNA molecule produced from transcription of the following DNA strand: GCCACGT
![Page 3: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA](https://reader035.vdocuments.us/reader035/viewer/2022062417/5514fab055034693478b6298/html5/thumbnails/3.jpg)
CGGUGCA
![Page 4: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA](https://reader035.vdocuments.us/reader035/viewer/2022062417/5514fab055034693478b6298/html5/thumbnails/4.jpg)
A certain protein is 60 amino acids long. How many nucleotides are required in DNA to code for this protein?
![Page 5: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA](https://reader035.vdocuments.us/reader035/viewer/2022062417/5514fab055034693478b6298/html5/thumbnails/5.jpg)
180
![Page 6: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA](https://reader035.vdocuments.us/reader035/viewer/2022062417/5514fab055034693478b6298/html5/thumbnails/6.jpg)
What type of molecule is codon is found in?
![Page 7: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA](https://reader035.vdocuments.us/reader035/viewer/2022062417/5514fab055034693478b6298/html5/thumbnails/7.jpg)
mRNA
![Page 8: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA](https://reader035.vdocuments.us/reader035/viewer/2022062417/5514fab055034693478b6298/html5/thumbnails/8.jpg)
A: B:Write an answer here Write an answer here
C: D:
Define Translation
![Page 9: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA](https://reader035.vdocuments.us/reader035/viewer/2022062417/5514fab055034693478b6298/html5/thumbnails/9.jpg)
The process by wich an mRNA molecule is
translated into a protien
![Page 10: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA](https://reader035.vdocuments.us/reader035/viewer/2022062417/5514fab055034693478b6298/html5/thumbnails/10.jpg)
A:
The genes in the chromosomes of living cells are made of what?
![Page 11: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA](https://reader035.vdocuments.us/reader035/viewer/2022062417/5514fab055034693478b6298/html5/thumbnails/11.jpg)
DNA
![Page 12: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA](https://reader035.vdocuments.us/reader035/viewer/2022062417/5514fab055034693478b6298/html5/thumbnails/12.jpg)
A: B:Write an answer here Write an answer here
The process of reading mRNA and turning it into a polypeptide chain is known as what?
![Page 13: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA](https://reader035.vdocuments.us/reader035/viewer/2022062417/5514fab055034693478b6298/html5/thumbnails/13.jpg)
Translation
![Page 14: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA](https://reader035.vdocuments.us/reader035/viewer/2022062417/5514fab055034693478b6298/html5/thumbnails/14.jpg)
Give the complimentary DNA sequence of the following DNA:
ATCGGTGAACGTAACCATTTAAA
![Page 15: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA](https://reader035.vdocuments.us/reader035/viewer/2022062417/5514fab055034693478b6298/html5/thumbnails/15.jpg)
TAGCCACTTGCATTGGTAAATTT
![Page 16: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA](https://reader035.vdocuments.us/reader035/viewer/2022062417/5514fab055034693478b6298/html5/thumbnails/16.jpg)
The nucleotide sequence of a DNA codon is GTA. A messenger RNA molecule with a complementary codon is transcribed from the DNA. In the process of protein synthesis, a transfer RNA pairs with the mRNA codon. What is the nucleotide sequence of the tRNA anticodon?
![Page 17: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA](https://reader035.vdocuments.us/reader035/viewer/2022062417/5514fab055034693478b6298/html5/thumbnails/17.jpg)
GUA
![Page 18: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA](https://reader035.vdocuments.us/reader035/viewer/2022062417/5514fab055034693478b6298/html5/thumbnails/18.jpg)
A: B:Write an answer here Write an answer here
Define Mutation?
![Page 19: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA](https://reader035.vdocuments.us/reader035/viewer/2022062417/5514fab055034693478b6298/html5/thumbnails/19.jpg)
Changes in the DNA sequence that affect genetic information
![Page 20: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA](https://reader035.vdocuments.us/reader035/viewer/2022062417/5514fab055034693478b6298/html5/thumbnails/20.jpg)
Inheritance of acquired
characteristics
![Page 21: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA](https://reader035.vdocuments.us/reader035/viewer/2022062417/5514fab055034693478b6298/html5/thumbnails/21.jpg)
Great Job!!!!Great Job!!!!
Thank you for playing!Thank you for playing!