hoover high school mr.plazaks biology : write an answer here what is the sequence of an rna molecule...

21
Hoover High School Mr.Plazak’s Biology

Upload: michelle-murphy

Post on 27-Mar-2015

219 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA

Hoover High School

Mr.Plazak’s Biology

Page 2: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA

:Write an answer here

What is the sequence of an RNA molecule produced from transcription of the following DNA strand: GCCACGT

Page 3: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA

CGGUGCA

Page 4: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA

A certain protein is 60 amino acids long. How many nucleotides are required in DNA to code for this protein?

Page 5: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA

180

Page 6: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA

What type of molecule is codon is found in?

Page 7: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA

mRNA

Page 8: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA

A: B:Write an answer here Write an answer here

C: D:

Define Translation

Page 9: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA

The process by wich an mRNA molecule is

translated into a protien

Page 10: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA

A:

The genes in the chromosomes of living cells are made of what?

Page 11: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA

DNA

Page 12: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA

A: B:Write an answer here Write an answer here

The process of reading mRNA and turning it into a polypeptide chain is known as what?

Page 13: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA

Translation

Page 14: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA

Give the complimentary DNA sequence of the following DNA:

ATCGGTGAACGTAACCATTTAAA

Page 15: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA

TAGCCACTTGCATTGGTAAATTT

Page 16: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA

The nucleotide sequence of a DNA codon is GTA. A messenger RNA molecule with a complementary codon is transcribed from the DNA. In the process of protein synthesis, a transfer RNA pairs with the mRNA codon. What is the nucleotide sequence of the tRNA anticodon?

Page 17: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA

GUA

Page 18: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA

A: B:Write an answer here Write an answer here

Define Mutation?

Page 19: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA

Changes in the DNA sequence that affect genetic information

Page 20: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA

Inheritance of acquired

characteristics

Page 21: Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA

Great Job!!!!Great Job!!!!

Thank you for playing!Thank you for playing!