homework 3 / tz Κατ’ Οίκον Εργασία 3 – 2020...Ένας...

HMY 370 / ECE 370 Εισαγωγή στην Βιοϊατρική Μηχανική Introduction to Biomedical Engineering

Τμήμα Ηλεκτρολόγων Μηχανικών και Μηχανικών Υπολογιστών

Πολυτεχνική Σχολή – Πανεπιστήμιο Κύπρου

Homework 3 / Κατ’ Οίκον Εργασία 3 – 2020

Name/Όνομα: Ο Πιο Καλός Ο Μαθητής Date/Ημερ.: 31/3/2020

You may need some (or none) of the following equations/constants

Μπορεί να χρειαστείτε κάποιες (ή καμία) από τις πιο κάτω εξισώσεις/σταθερές

__________________________________________________________________________

For linear motion (const. a) For circular motion (const. a) Parabolic Trajectory

0

2

0

2 2

0

0

2

1

2

2

1( )

2

1

2kin

F Ma p Mv

v xa v

t t

v v a t

x v t a t

v v a x

x v v t

E Mv

dynE mgh τ = r x F = |F||r|sinθ = I a

L = I ω

For linear uniform objects

I = Ml2 (M = mass, l = length)

For other objects

1 0

2

0

2 2

1 0

1 0

2

1

2

2

1( )

2

1

2

lin

kin

at t

a t

t a t

a

t

v r

E I

2

0

220

0

sin 2

sin2

2sin

vR

g

vh

g

vt

g




Doppler Ultrasound

2 cos 2 cos1d US US

US US

v vf f f

v US US USf v

Οπτική Ιστών (Tissue Optics)

t b

oI I e

't s a ' (1 )s sg 1

t

t

l

__________________________________________________________________________________

Κώδικας DNA Αμινοξέων (Amino acid DNA code)

Note: The start codon is ATG (same as Met)




Multiple Choice Questions (15 x 2 = 30 pts) Ερωτήσεις Πολλαπλής Επιλογής (15 x 2 = 30 μ.)

1. A toxin can cause convulsive paralysis by

Μια τοξίνη μπορεί να προκαλέσει παράλυση μετά από σπασμούς

A. Blocking acetylcholine from binding to its receptor

Εμποδίζοντας την ακετυλοχολίνη από το να προσδεθεί στον υποδοχέα της

B. Blocking acetylcholine from leaving its receptor

Εμποδίζοντας την ακετυλοχολίνη από το να φύγει από τον υποδοχέα της

C. Causing motor neurons to release massive amounts of epinephrine

Προκαλώντας απελευθέρωση τεραστίων ποσοτήτων επινεφρίνης από τους κινητικούς

νευρώνες

D. Blocking acetylcholine from being released by motor neurons

Εμποδίζοντας την έκκριση ακετυλοχολίνης από τους κινητικούς νευρώνες

2. You observe a patient who appears normal as he is sitting still. However, when he tries to move

his movements are erratic, uncoordinated, and choreiform (like dancing). Which part of his brain

is most likely causing these symptoms?

Παρατηρείτε ένα ασθενή που φαίνεται φυσιολογικός καθώς κάθεται ακίνητος. Ωστόσο, όταν

προσπαθεί να κινηθεί οι κινήσεις του είναι ακανόνιστες, ασυντόνιστες, και χορειόμορφες (σαν

χορευτικές). Ποιο μέρος του εγκεφάλου του είναι πιο πιθανό να προκαλεί αυτά τα συμπτώματα;

A. Motor Cortex / Κινητικός Φλοιός

B. Basal Ganglia / Βασικά Γάγγλια

C. Cerebellum / Παρεγκεφαλίδα

D. Spinal Cord / Νωτιαίος Μυελός

3. An ice skater performs a spin. If his angular velocity is 4.3π rad.s-1 and his moment of inertia is

0.9 kgm2 at the beginning of the spin, what would his angular velocity be if his moment of inertia

became 0.75kgm2? Assume that no angular momentum is lost.

Ένας παγοδρόμος εκτελεί μια περιστροφή. Αν η γωνιακή ταχύτητα της είναι 4.3π rad.s-1 και η ροπή

της αδράνειας είναι 0,9 kgm2 στην αρχή της περιστροφής, ποια θα είναι η γωνιακή ταχύτητα του

είναι αν η ροπή της αδράνειας γίνει 0,75kgm2; Υποθέστε ότι διατηρείται η στροφορμή.

A. 17.19 rad/s

B. 16.21 rad/s

C. 16.75 rad/s

D. 16.52 rad/s

4. Which of the following will increase stability?

Ποιο από τα πιο κάτω αυξάνει τη σταθερότητα;

A. lower center of gravity / χαμηλότερο κέντρο βάρους

B. decrease mass / μειωμένη μάζα

C. decrease size of base of support / μειωμένο μέγεθος βάσης στήριξης

D. decrease friction / μειωμένη τριβή

5. Which of the following is true about orthotics?

Ποιο από τα πιο κάτω είναι σωστό σε σχέση με τα ορθοτικά;

A. Orthotics can be made only out of hard materials such as steel

Τα ορθοτικά μπορούν να κατασκευαστούν μόνο από σκληρά υλικά όπως ατσάλι

B. Orthotics only offer support without any control.

Τα ορθοτικά προσφέρουν μόνο στήριξη χωρίς έλεγχο

C. Orthotics can only be applied to extremities.

Τα ορθοτικά μπορούν αν εφαρμοστούν μόνο στα άκρα

D. Orthotics are simple and do not require special fitting.

Τα ορθοτικά είναι απλά και δεν χρειάζονται προσαρμογή




6. In myo-electric prosthetics, the control of the prosthetic is based on signals collected

Στα μυο-ηλεκτρικά προσθετικά, ο έλεγχος του πρσθετικού βασίζεται σε σήματα που συλλέγονται

A. From the muscles of the limb using contact electrodes

Από τους μύες του άκρου χρησιμοποιώντας ηλεκτρόδια επαφής

B. From the muscles of the limb using needle electrodes

Από τους μύες του άκρου χρησιμοποιώντας ηλεκτρόδια βελόνες

C. From the muscles of the limb using a brain-computer interface

Από τους μύες του άκρου χρησιμοποιώντας διεπαφή εγκεφάλου-υπολογιστή

D. From the muscle of the back and shoulder using contact electrodes

Από τους μύες της πλάτης και του ώμου χρησιμοποιώντας ηλεκτρόδια επαφής

7. All of the following can cause toxicity from an implantable biomaterial, EXCEPT

Όλα τα παρακάτω μπορεί να προκαλέσουν τοξικότητα από έναν εμφυτεύσιμο βιοϋλικό, ΕΚΤΟΣ

A. Θραύση λόγω μεγάλης πίεσης / Break due to excess pressure

B. Φθορά από παρατεταμένη χρήση / Wear due to prolonged use

C. Διάβρωση μετάλλου / Metal Corrosion

D. Χημική αντίδραση με το αίμα / Chemical reaction with the blood

8. The latest generation of implants are designed mainly to

Τα εμφυτεύματα τελευταίας γενιάς σχεδιάζονται κυρίως για να

A. Match the geometry of the tissue or organ with basic materials

Ταιριάζουν στη γεωμετρία του ιστού ή του οργάνου με βασικά υλικά

B. Match the geometry of the tissue or organ with advanced materials

Ταιριάζουν στη γεωμετρία του ιστού ή του οργάνου με προηγμένα υλικά

C. Match the geometry as well as the function of the organ or tissue with advanced materials

Ταιριάζουν στη γεωμετρία καθώς και στη λειτουργία του οργάνου ή του ιστού με προηγμένα

υλικά

D. Match the geometry as well as the function and induce regeneration of the organ or

tissue

Ταιριάζουν στη γεωμετρία καθώς και στη λειτουργία και προκαλούν αναγέννηση του

οργάνου ή του ιστού

9. Biocompatibility is:

Βιοσυμβατότητα είναι:

A. The ability of a material to perform its function with the correct response from the host

for a particular application

Είναι η ικανότητα ενός υλικού να εκτελεί τη λειτουργία του με σωστή αντίδραση του

ξενιστή σε μια συγκεκριμένη εφαρμογή

B. The ability of a material to perform its function without a response from the host for a

particular application

Είναι η ικανότητα ενός υλικού να εκτελεί τη λειτουργία του χωρίς αντίδραση από τον ξενιστή

σε μια συγκεκριμένη εφαρμογή

C. The ability of a material to perform its function with the correct response from the host for a

any application

Είναι η ικανότητα ενός υλικού να εκτελεί τη λειτουργία του με σωστή αντίδραση του ξενιστή

για οποιαδήποτε εφαρμογή

D. The ability of a material to perform its function without a response from the host for a any

application

Είναι η ικανότητα ενός υλικού να εκτελεί τη λειτουργία του χωρίς αντίδραση από τον ξενιστή

για οποιαδήποτε εφαρμογή




10. Assuming that both parent plants in the diagram below are homozygous (have two copies of the

same type of gene), why would all of the f1 generation have yellow phenotypes?

Αν υποθέσουμε ότι και τα δύο μητρικά φυτά στο παρακάτω σχήμα είναι ομόζυγα (έχουν δύο

αντίγραφα του ίδιου τύπου του γονιδίου), γιατί όλη η f1 γενιά έχει κίτρινους φαινοτύπους;

A. because the f1 genotypes are homozygous / γιατί οι γονότυποι της f1 είναι ομόζυγοι

B. because yellow is dominant over green / γιατί το κίτρινο είναι επικρατές ως προς το πράσινο

C. because green is dominant over yellow / γιατί το πράσινο επικρατές ως προς το κίτρινο

D. because both parents passed on yellow alleles / γιατί και οι δύο γονείς έδωσαν κίτρινο γονίδιο

11. Α genetic disease is passed by men who have the disease to all their daughters but none of their

sons, if the gene is

Μια γενετική ασθένεια μεταδίδεται από άντρες που έχουν την ασθένεια σε όλες τις κόρες αλλά

κανένα από τους γιούς, αν το γονίδιο είναι

A. Recessive Υπολειπόμενο

B. Dominant Επικρατές

C. On the X chromosome Στο Χ χρωμόσωμα

D. On the Y chromosome Στο Υ χρωμόσωμα

12. Which statement defines cloning?

Ποιο από τα πιο κάτω ορίζει την κλωνοποίηση;

A. Splitting embryos to make twins.

Διαχωρισμός εμβρύων για να δημιουργία δίδυμων.

B. Making offspring phenotypically identical to one parent.

Δημιουργία απογόνων φαινοτυπικά ταυτόσημων με έναν γονέα.

C. Producing identical plants and animals by natural or artificial means.

Παραγωγή ίδιων φυτών και ζώων με φυσικά ή τεχνητά μέσα.

D. Producing genetically identical copies of an individual, cell or gene.

Παραγωγή γενετικά όμοιων αντιγράφων ενός ατόμου, ενός κυττάρου ή ενός γονιδίου.

13. You have cloned a new gene from your favorite species of experimental organism, which has had

very few genes cloned so far. Which of the following techniques would you expect to provide

information about the function of this gene?

Έχετε κλωνοποιήσει ένα νέο γονίδιο από το αγαπημένο σας είδος πειραματικού οργανισμού, από

το οποίο πολύ λίγα γονίδια έχουν κλωνοποιηθεί μέχρι στιγμής. Ποια από τις παρακάτω τεχνικές θα

περιμένατε να σας δώσει πληροφορίες σχετικά με τη λειτουργία του γονιδίου αυτού;

A. Comparison of the gene sequence to proteins in this organism.

Σύγκριση της αλληλουχίας του γονιδίου με πρωτεΐνες αυτού του οργανισμού

B. Comparison of the gene sequence to proteins in other organisms.

Σύγκριση της αλληλουχίας του γονιδίου με πρωτεΐνες άλλου οργανισμού

C. Comparison of the gene sequence to other DNA sequences in this organism.

Σύγκριση της αλληλουχίας του γονιδίου με άλλο DNA αυτού του οργανισμού

D. Comparison of the gene sequence to DNA sequences from other organisms.

Σύγκριση της αλληλουχίας του γονιδίου με αλληλουχίες DNA άλλου οργανισμού




14. A model in systems biology is usually NOT

Ένα μοντέλο βιολογίας συστημάτων συνήθως ΔΕΝ είναι

A. simplified

απλοποιημένο

B. a mathematical representation of biological processes

μια μαθηματική αναπαράσταση μιας βιολογικής διαδικασίας

C. the central element of systems biology research

το κεντρικό στοιχείο της έρευνας της βιολογία συστημάτων

D. valid under all conceivable environmental conditions

εφαρμόσιμο σε όλες τις πιθανές συνθήκες του περιβάλλοντος

15. The following sequence contains the last portion a human gene. Which of the following is true?

(Remember that the strands are read from 5’ to 3’)

Η παρακάτω ακολουθία περιέχει το τελευταίο τμήμα ενός ανθρώπινου γονιδίου. Ποιο από τα

παρακάτω είναι αλήθεια; (Να θυμάστε ότι οι σειρές διαβάζονται από 5 'προς 3') 3’ – cccgctattataaccgcgctctagcgctcgctagctcgc – 5’

5’ – gggcgataatattggcgcgagatcgcgagcgatcgagcg – 3’

A. The top strand is the coding strand.

Η πάνω σειρά είναι αυτή που αποκωδικοποιείται

B. The bottom strand is the coding strand

Η κάτω σειρά είναι αυτή που αποκωδικοποιείται

C. Both strands are coding the same gene

Και η δύο σειρές κωδικοποιούν το ίδιο γονίδιο.

D. The bottom strand has been mutated

Η κάτω σειρά έχει μεταλλαχθεί




Short Answer Questions (70 pts) Ερωτήσεις με σύντομες απαντήσεις (70 μ.)

1. A football player is kicking a ball by rotating his leg as a rigid body about

the hip. At the instant of interest, i.e. when he kicks the ball, his leg is

angled 86° clockwise from forward, the limb is rotating

counterclockwise at 1400°/s, and the limb is accelerating

counterclockwise at 2500°/s2. The inertial properties of the player’s leg

are:

Ένας ποδοσφαιριστής κτυπά μια μπάλα περιστρέφοντας το πόδι του ως

άκαμπτο σώμα γύρω από το ισχίο. Την στιγμή ενδιαφέροντος, όταν

δηλαδή κτυπάει την μπάλα, το πόδι του είναι κεκλιμένο κατά 86°

δεξιόστροφα από τα εμπρός, το άκρο περιστρέφεται αριστερόστροφα σε

1400°/s και το άκρο επιταχύνεται αριστερόστροφα σε 2500°/s2. Οι αδρανειακές ιδιότητες του

ποδιού του παίκτη είναι:

Mass of the leg / Μάζα του ποδιού: 4.6 kg

Length of the leg / Μήκος του ποδιού: 65 cm

Distance from the hip to the center of mass of the leg / Απόσταση από το ισχίο μέχρι το

κέντρο βάρους του ποδιού: 35 cm

a. What is the rotational inertia of the leg about the hip?

Ποια είναι η περιστροφική αδράνεια του ποδιού γύρω από το ισχίο;

b. At the instant of interest, what are the magnitude and direction of the net torque acting on the

player’s leg at the hip?

Τη στιγμή ενδιαφέροντος, ποιο είναι το μέγεθος και η κατεύθυνση της ροπής που ενεργεί στο

πόδι του παίκτη στο ισχίο;

c. At the instant of interest, what is the magnitude of the centripetal force that the player must

apply to keep his leg in such motion?

Την στιγμή ενδιαφέροντος, ποιο είναι το μέγεθος της κεντρομόλου δύναμης που πρέπει να

εφαρμόσει ο παίκτης για να κρατήσει το πόδι του σε τέτοια κίνηση;

The force above is transferred to a 0.42 kg ball is moving towards the player along the ground at 1

m/s just before it is contacted by a player’s foot. The player’s foot is in contact with the ball for 20

ms.

Η παραπάνω δύναμη μεταφέρεται σε μια μπάλα των 0,42 κιλών που κινείται προς τον παίκτη κατά

μήκος του εδάφους με ταχύτητα 1 m/s ακριβώς πριν την επαφή της με το πόδι ενός παίκτη. Το πόδι

του παίκτη έρχεται σε επαφή με την μπάλα για 20 ms.

d. What are the magnitude and direction of the ball’s linear velocity at the end of the period of

contact between the player’s foot and the ball? Note: Ignore the influence of friction between

the ball and the ground. If you did not answer part c, assume the force is 40 N.

Ποιο είναι το μέγεθος και η κατεύθυνση της γραμμικής ταχύτητας της μπάλας στο τέλος της

περιόδου επαφής μεταξύ του ποδιού του παίκτη και της μπάλας; Σημείωση: Αγνοήστε την

επίδραση της τριβής μεταξύ της μπάλας και του εδάφους. Εάν δεν απαντήσατε στο ερώτημα c,

υποθέστε ότι η δύναμη είναι 40 Ν.

a.

2 224.6 (0.65 )

0.6483 3

ml kg mI kgm

b. The torque is anti-clockwise with amplitude: / Η ροπή είναι αριστερόστροφη με πλάτος:

86o

Forward

65 cm




2 2. .deg . .

(0.648 )(2500deg/ sec) 1620 28.27sec sec

kg m kg m radIa kgm

c.

28.27sin 43.50

sin 0.65 sin(90)F r F N

r

d. The force is applied to the ball for Δt. Η δύναμη εφαρμόζεται στη μπάλα για Δt.

2

43.50103.57

0.42 secball

N mF m a a

kg

0 1 (103.57)(20 3) 1.07sec

ball

mv v a t e

The direction will be to the right. / Η κατεύθυνση θα είναι προς τα δεξιά.




2. In the Champions League final, the defender of Ethnikos Ashias throws an out directly on the head

of his teammate, 12 meters away, giving the ball a height of 4 meters to avoid the defender of Real

Madrid who jumps in front of him. Assume that his arm was perpendicular to the direction of the

ball, when released, and all the kinetic energy of his arm and ball was transferred to the ball as

shown in the figure below. Assume g=9.8m/s2, the mass of the ball is 0.45 kg and the rotational

inertia of the arm and ball is 0.90 kgm2. You might also find the identity sin(2θ)=2sin(θ)cos(θ)

useful.

Στο τελικό του Τσάμπιονς Λιγκ ο αμυντικός του Εθνικού Άσσιας ρίχνει ένα άουτ στο κεφάλι του

συμπαίκτη του, 12 μέτρα μακριά, δίνοντας στη μπάλα ύψος 4 μέτρων για να αποφύγει τον αμυντικό

της Ρεάλ Μαδρίτης που πηδά μπροστά του. Αν υποθέσουμε ότι ο βραχίονας του ήταν κάθετος στη

κατεύθυνσης της μπάλας όταν απελευθερώθηκε και όλη η κινητική ενέργεια του χεριού και της

μπάλας μεταφέρθηκε στην μπάλα όπως φαίνεται στο παρακάτω σχήμα. Υποθέστε g = 9.8 m/s2, η

μάζα της μπάλας είναι 0.45 kg και η περιστροφική αδράνεια του βραχίονα και της μπάλας είναι

0,90 kgm2. Μπορεί επίσης να βρείτε την ταυτότητα sin (2θ) = 2sin (θ) cos (θ) χρήσιμη.

a. What was the initial velocity and angle of the ball when it was released from the player’s hand?

Ποια ήταν η αρχική ταχύτητα και η γωνία της μπάλας μόλις απελευθερώθηκε από το χέρι του

παίκτη; (4)

b. What was the angular velocity of the arm and ball just before release?

Ποια ήταν η γωνιακή ταχύτητα του βραχίονα και της μπάλας ακριβώς πριν την απελευθέρωση;

(2)

c. If the player started the throwing motion with his arm at rest at an angle of 25ο from the

horizontal, what was the angular acceleration required to achieve the angular velocity above?

Εάν ο παίκτης ξεκίνησε την κίνηση ρίψης με τον βραχίονα του σε κατάσταση ηρεμίας υπό

γωνία 25ο από την οριζόντια, ποια ήταν η γωνιακή επιτάχυνση που απαιτείται για την επίτευξη

της γωνιακής ταχύτητας παραπάνω; (2)

d. How much time did it take to complete he throw?

Πόσο χρόνο χρειάστηκε για να ολοκληρώσει την ρίψη; (2)

a.

220

2 2

0 0

sin2 4

tan( ) 53.13

sin(2 ) 2sin( )cos( )

o

vh

g h

Rv vR

g g

0

2 2 9.8 411.07 /

sin( ) sin(53.13)

gh x xv m s

R

h

v0

θ

25o




b. 2 2

0 0

1 1 0.4511.07 7.83 /

2 2 0.90

ballball

mm V I v rad s

I

c.

22 2 2

0

(7.83) 02 28.35 /

2((90 53.13) 25) /180a a rad s

d. 0

7.83 00.28

28.35a t t s




3. Electromyogram-controlled prosthetics are one option for providing increased control of a

prosthetic.

Το ηλεκτρομυογράφικα ελεγχόμενα προσθετικά είναι μια επιλογή για την παροχή αυξημένου

έλεγχο ενός προσθετικού.

a. Describe how these prosthetics work and provide a block diagram to more clearly illustrate

your answer.

Περιγράψτε πώς λειτουργούν αυτά τα προσθετικά και να σχεδιάστε ένα διάγραμμα για να

εξηγήσετε με μεγαλύτερη σαφήνεια την απάντησή σας.

b. What are the advantages and disadvantages of these prosthetics compared to prosthetics

moved using straps attached to the body. (Mention at least 3 of each).

Ποια είναι τα πλεονεκτήματα και τα μειονεκτήματα αυτών των προσθετικών σε σύγκριση με

προσθετικά που μετακινούνται χρησιμοποιώντας ιμάντες που συνδέονται με το σώμα.

(Αναφέρετε τουλάχιστον 3 από το καθένα).

c. Certain prosthetics (like the C-leg) are not controlled by the EMG but can nonetheless move

according to the user’s intended motion. (Remember the video we saw in class of the people

walking with one or two C-legs). How is this achieved? Provide a block diagram to more

clearly illustrate your answer.

Ορισμένα προσθετικά (όπως το C-πόδι) δεν ελέγχονται με EMG, αλλά μπορούν παρόλα αυτά

να κινούνται σύμφωνα με την προβλεπόμενη κίνηση του χρήστη. (Θυμηθείτε το βίντεο που

είδαμε στο μάθημα με ανθρώπους να περπατούν με ένα ή δύο C-πόδια). Πώς επιτυγχάνεται

αυτό; Σχεδιάστε ένα διάγραμμα για να εξηγήσετε με μεγαλύτερη σαφήνεια την απάντησή σας.

a. These prosthetics work by acquiring electrical signals (via surface electrodes) from the

remaining muscles of the limb and based on the features of those signals, they move the

prosthetic. See the figure below.

Αυτά τα προσθετικά λειτουργούν με την απόκτηση ηλεκτρικών σημάτων (μέσω επιφανειακών

ηλεκτροδίων) από τους εναπομείναντες μύες του άκρου και με βάση τα χαρακτηριστικά αυτών

των σημάτων, μετακινούν το προσθετικό. Βλέπετε το πιο κάτω σχήμα.

b. Compared to prosthetics moved using straps, these prosthetics have the following advantages

Σε σύγκριση με τα προσθετικά που κινούνται με ιμάντες, αυτά τα προσθετικά έχουν τα πιο

κάτω προτερήματα

Προτερήματα

Improved functionality

Αυξημένη λειτουργικότητα

Independently moving parts allow better handles

Τα ανεξάρτητα κινούμενα μέρη επιτρέπουν καλύτερες λαβές

Simpler connection

Πιο απλή σύνδεση

and disadvantages

και μειονεκτήματα

Increased cost

Μεγαλύτερο κόστος

Require some manual placement for some functions.

Απαιτούν κάποια χειροκίνητη τοποθέτηση για ορισμένες λειτουργίες.

Their mechanical properties are not perfect yet

Amplification

FilteringFeature Extraction

Classification

Electrodes

Processing UnitActuator




Οι μηχανικές ιδιότητες δεν είναι ακόμα τέλειες

c. Prosthetics like the C-leg are programed to sense the motion of the limb, predict the desire

movement and initiate the limb motion with build-in actuators. See figure below.

Τα προσθετικά όπως το C-πόδι προγραμματίζονται ώστε να ανιχνεύσουν την κίνηση του

άκρου, να προβλέπουν την επιθυμητή κίνηση και να ξεκινούν την κίνηση του άκρου με

ενσωματωμένους ενεργοποιητές. Βλέπετε το πιο κάτω σχήμα.

Feature Extraction

Classification

Sensors

Processing UnitActuator




4. Different types of biomaterials are currently used for implants. Metals, ceramics and polymers are

common.

Για τα εμφυτεύματα χρησιμοποιούνται σήμερα διάφοροι τύποι βιοϋλικών. Μέταλλα, κεραμικά και

πολυμερή είναι κοινά.

a. For each of the three categories above, list 2 advantages and 2 disadvantages.

Για καθεμία από τις τρεις παραπάνω κατηγορίες, καταγράψτε 2 πλεονεκτήματα και 2

μειονεκτήματα.

b. For each of the three categories above, also choose an example implant and explain why the

material is best suited for the application

Για καθεμία από τις τρεις παραπάνω κατηγορίες, επιλέξτε επίσης ένα παράδειγμα

εμφυτεύματος και εξηγήστε γιατί το υλικό είναι το καλύτερο για την εφαρμογή

a.

Metal /

Μέταλλα

Ceramic /

Κεραμικά

Polymer Πολυμερή

Advan

tages

/

Προτε

ρή

μα

τα

Ψηλή αντοχή

Αντοχή στη

φθορά και

κόπωση

Εύκολη

κατασκευή

Εύκολη

αποστείρωση

Μνήμη

σχήματος

Ψηλή αντοχή σε

συμπίεση

Αντοχή στη

φθορά και στη

διάβρωση

Μπορούν να

στιλβωθούν

Βιοδραστικά /

αδρανή

Φυσικά:

Χημική σύνθεση παρόμοια με το υλικό που αντικαθιστούν:

εύκολο να ενσωματωθούν σε ξενιστή και τροποποιήσιμα

Συνθετικά:

Εύκολη η μαζική παραγωγή και αποστείρωση

Μπορούν να προσαρμοστούν οι φυσικές, χημικές,

μηχανικές και αποικοδομητικές (degradative) ιδιότητες

τους

Εξαιρετική ευλυγισία και σταθερότητα

Ψηλή διαπερατότητα οξυγόνου (μεμβράνη)

Dis

advan

tages

/

Μει

ονε

κτή

μα

τα

Δεν

συμπιέζονται

Διάβρωση

Ευαισθησία

σε μεταλλικά

ιόντα και

τοξικότητα

Μεταλλική

όψη

Διαφορετικός

συντελεστής

συμπίεσης από το

οστό (ψηλότερος)

Χαμηλή αντοχή

σε εφελκυσμό

Χαμηλή αντοχή

σε θραύση

Δύσκολο να

κατασκευαστούν

Φυσικά:

Δύσκολο να συλλεχθούν σε μεγάλη ποσότητα

Αδύνατες μηχανικές ιδιότητες

Μη διασφάλιση της απομάκρυνσης των παθογόνων

Μπορεί να αναγνωριστούν ως ξένα από το ανοσοποιητικό

σύστημα

Συνθετικά:

Δεν αλληλεπιδρούν ενεργά με τον ιστό, ως εκ τούτου δεν

μπορούν να κατευθύνουν ή να βοηθήσουν στην επούλωση

γύρω από την περιοχή εμφύτευσης

b. Metals hip joint replacement (Must endure large and long lasting forces without breaking

and last for a long time)

Ceramics hip joint replacement cap (Must have very little friction and at the same time avoid

erosion and cracks under pressure)

Polymers silicone catheters (Must be flexile, durable, stable, non-reactive)

Μέταλλα αντικατάσταση άρθρωσης ισχίου (Πρέπει να αντέχει μεγάλες και μακράς

διαρκείας δυνάμεις χωρίς να σπάσει και να διαρκέσει για μεγάλο χρονικό διάστημα)

Κεραμικά κεφαλή άρθρωσης αντικατάστασης ισχίου (Πρέπει να έχει πολύ μικρή τριβή και

ταυτόχρονα να αποφεύγεται η διάβρωση και οι ρωγμές υπό πίεση)

Πολυμερή σιλικόνη καθετήρες (Πρέπει να είναι εύκαμπτοι, ανθεκτικοί, σταθεροί,

αδρανείς)




5. In Pokemon genetics, for the color gene: the symbol Y is for yellow Pikachu (see

picture), y is for white. For the tail gene: L is for jagged tail and l is for straight.

(Upper case is for dominant and lower case is for recessive.)

Στη γενετική των Pokemon, για το γονίδιο του χρώματος: το σύμβολο Υ είναι για

κίτρινο Pikachu (βλέπετε εικόνα), το y για άσπρο. Για το γονίδιο της ουράς: το L

είναι για οδοντωτή ουρά και το l για ίσια. (Κεφαλαία είναι τα επικρατή και μικρά

τα υπολειπόμενα).

a. In the cross Yy-Ll with Yy-Ll, what fraction of the Pikachu that will be:

Σε μια διασταύρωση Yy-Ll με Yy-Ll, ποιο ποσοστό Pikachu θα είναι:

A. Yellow / Κίτρινο

B. Straight tail / Ίσια Ουρά

C. White and straight tail / Άσπρο με ίσια ουρά

D. Yellow and straight tail / Κίτρινο με ίσια ουρά

E. Yellow and jagged tail / Κίτρινο με οδοντωτή ουρά

Examine the following family tree of Pokemons suffering from Pokemonitis Neurosa (marked as

black circles, for females, or squares, for males).

Εξετάστε το ακόλουθο γενεαλογικό δέντρο των Pokemons που πάσχουν από Pokemonitis Neurosa

(σημειώνονται ως μαύροι κύκλοι, για τις γυναίκες, ή τετράγωνα, για τους άνδρες).

b. If you assume Mendelian genetics, how is the disease inherited? Is the gene dominant or

recessive?

Αν θεωρήσετε ότι ισχύουν οι κανόνες γενετικής του Mendel, πως κληρονομείται η ασθένεια;

Είναι το γονίδιο επικρατές ή υπολειπόμενο;

c. Fill in the genotype for each member of the family on the line below each individual in the figure

above.

Συμπληρώστε τους γενότυπους για κάθε μέλος της πιο πάνω οικογένειας στις γραμμές κάτω από

το κάθε άτομο στο πιο πάνω σχήμα.

d. How can you explain the fact that there is one afflicted pokemon in the right family (children 9,

10, 12) whereas there is no afflicted pokemon in the left family (children 6-8)?

Πώς εξηγείτε το γεγονός ότι έχει προσβληθεί ένα Pokemon στη δεξιά οικογένεια (παιδιά 9, 10,

12), ενώ δεν έχει προσβληθεί κανένα Pokemon στην αριστερή οικογένεια (παιδιά 6-8);

e. How can you explain that healthy parents 8 and 9 have an offspring with the disease?

Πως εξηγείτε το γεγονός ότι οι δύο υγιείς γονείς 8 και 9 έχουν ένα παιδί με την ασθένεια;




a. All the possible combinations are

Όλοι οι δυνατοί συνδυασμοί είναι

LL Ll Ll ll

YY Yy Yy yy YY Yy Yy yy YY Yy Yy yy YY Yy Yy yy

A. 75% B. 25% C. 1/16 D. 3/16 E. 9/16

b. Recessive / Υπολοιπόμενο

c.

d. Most probably 2 is NN. (She could also be a carrier (Nn) and very lucky!)

Το πιο πιθανόν είναι η 2 να είναι ΝΝ. (Θα μπορούσε επίσης να είναι φορέας (Nn) και πολύ

τυχερή!)

e. They are carriers of the disease (Nn)

Είναι φορείς της ασθένειας (Nn)

nn

nn

nn nn nn nn

nn nn

nn NN (or Nn and lucky!)

Nn Nn Nn Nn Nn

Nn

Nn Nn or NN Nn or NN




6. BB, a second year student at UCY, failed physics last year.

His parents are both physicists, but he remembers that his

great-grandfather also failed physics. BB constructed the

family pedigree to the right and he is convinced that his poor

performance in physics is an inherited genetic trait.

Ο BB, ένας δευτεροετής φοιτητής στο ΠΚ, απέτυχε στη

φυσική πέρυσι. Οι γονείς του είναι και φυσικοί, αλλά

θυμάται ότι και ο παππούς του απέτυχε στη φυσική. Ο ΒΒ

δημιούργησε το οικογενειακό δέντρο στα δεξιά και είναι

πεπεισμένος ότι η κακή του απόδοση στη φυσική είναι ένα

κληρονομικό γενετικό χαρακτηριστικό.

a. If BΒ's hypothesis is true, what is the most likely mode of inheritance (dominant, recessive, x-

linked, etc.)?

Εάν η υπόθεση του ΒΒ είναι σωστή, ποιος είναι ο πιο πιθανός τρόπος κληρονομικότητας

(επικρατής, υπολειπόμενος, φυλετικός, κλπ.);

b. If individuals marrying into the family are homozygous

for the normal allele, complete the table. Use G or g to

denote the alleles of this gene. Be sure to identify and

note any ambiguities.

Εάν τα άτομα που παντρεύονται στην οικογένεια είναι

ομόζυγα για το κανονικό αλληλόμορφο, συμπληρώστε

τον πίνακα. Χρησιμοποιήστε G ή g για να δηλώσετε τα

αλληλόμορφα αυτού του γονιδίου. Προσέξτε και

υποδείξτε τυχόν ασάφειες.

c. BB meets LL in his remedial physics class. BB is a hard worker (homozygous for the H

allele). LL is lazy (homozygous for the h allele). The Hard-Working gene is on the same

chromosome as a gene that results in good grades (G) or bad grades (g). What could be the

genotypes and phenotypes of the grandchildren of BB (who is HHgg) and LL (who is hhGG)

if their daughter marries a lazy person with bad grades (hhgg)? Capital letters denote

dominance.

O BB συναντά την LL στο φροντιστήριο της Φυσικής. Ο ΒΒ είναι πολύ εργατικός (ομόζυγος

για το αλληλόμορφο H). Η LL είναι τεμπέλα (ομόζυγη για το αλληλόμορφο h). Το γονίδιο της

εργατικότητας είναι στο ίδιο χρωμόσωμα με ένα γονίδιο που οδηγεί σε καλούς βαθμούς (G) ή

κακούς βαθμούς (g). Ποιοι θα μπορούσαν να είναι οι γονότυποι και οι φαινότυποι των εγγονιών

του BB (ο οποίος είναι HHgg) και της LL (η οποία είναι hhGG) αν η κόρη τους παντρευτεί

έναν τεμπέλη με κακούς βαθμούς (hhgg); Τα κεφαλαία γράμματα υποδηλώνουν επικράτεια.

a. Recessive Υπολειπόμενο b.

c. BB: Hg-Hg + LL: hG-hG Daughter/Κόρη: Hg-hG +

Husband/Σύζυγος: hg-hg Hg-hg (hard working, low grades /

εργατικός, χαμηλοί βαθμοί) or hG-hg (lazy, high grades /

τεμπέλης, ψηλοί βαθμοί)

individual genotype

2

3

4

9

10

individual genotype

2 gg

3 Gg

4 Gg

9 Gg

10 GG/Gg

BB




7. You are studying a new gene. Suppose inheritance of two non-functional alleles of this gene results

in a genetic disorder (recessive). In a given family, the mother and father each have a mutation

(different) in one of the alleles of that gene. The sequences shown below:

Μελετάτε ένα καινούργιο γονίδιο. Υποθέστε ότι κληρονομικότητα δύο μη-λειτουργικών

αλληλόμορφων του γονιδίου αυτού οδηγεί σε μια γενετική διαταραχή (υπολειπόμενο). Σε μια

δεδομένη οικογένεια, η μητέρα και ο πατέρας έχουν ο καθένας από μια μετάλλαξη (διαφορετική)

σε ένα από τα αλληλόμορφα του εν λόγω γονιδίου. Οι αλληλουχίες τους φαίνονται πιο κάτω:

Mom #1: ATG CAT TAC ATG GTG CAC TGA ACC TCG GAC TCA CTC TGA

Mom #2: ATG CAT TAC ATG GTG CAC TCC ACC TCG GAC TCA CTC TGA

Dad #1: ATG CAT TAC ATG GTG CAC TCC ACT TCG GAC TCA CTC TGA

Dad #2: ATG CAT TAC ATG GTG CAC TCC ACC TCG GAC TCA CTC TGA

a. Which is the mutated allele for mom and which fro dad?

Ποιο είναι το μεταλλαγμένο αλληλόμορφο για τη μητέρα και ποιο για τον πατέρα; (2)

b. What will be the effect of each of the two mutations on the produced protein?

Ποια θα είναι η επίδραση της κάθε μιας από τις δύο μεταλλάξεις στην πρωτεΐνη που παράγεται;

(4)

c. Is mom a carrier of the disease? Is dad a carrier of the disease? Explain.

Είναι η μητέρα είναι φορέας της νόσου; Είναι ο πατέρας φορέας της νόσου; Εξηγήστε. (2)

d. What is the probability that a child in this family will have the genetic disorder?

Ποια είναι η πιθανότητα ότι ένα παιδί σε αυτή την οικογένεια θα έχει τη γενετική διαταραχή;

(2)

Mom #1: ATG CAT TAC ATG GTG CAC TGA ACC TCG GAC TCA CTC TGA

Mom #2: ATG CAT TAC ATG GTG CAC TCC ACC TCG GAC TCA CTC TGA

Dad #1: ATG CAT TAC ATG GTG CAC TCC ACT TCG GAC TCA CTC TGA

Dad #2: ATG CAT TAC ATG GTG CAC TCC ACC TCG GAC TCA CTC TGA

a. The mutated alleles are mom#1 and dad #1

Τα μεταλλαγμένα αλληλόμορφα είναι η μαμά # 1 και ο μπαμπάς # 1

b. Mom’s mutation introduces a stop codon prematurely in the sequence resulting in a shorter

(and most probably dysfunctional) protein. Dad’s mutation changes ACC to ACT but this has

no effect on the protein since this still encodes for the same amino acid (Thr).

Η μετάλλαξη της μαμάς εισάγει πρόωρα ένα κωδικόνιο λήξης στην αλληλουχία με αποτέλεσμα

μια βραχύτερη (και κατά πάσα πιθανότητα δυσλειτουργική) πρωτεΐνη. Η μετάλλαξη του

μπαμπά αλλάζει το ACC σe ACT, αλλά αυτό δεν έχει καμία επίδραση στην πρωτεΐνη, αφού

αυτή εξακολουθεί να κωδικοποιεί το ίδιο αμινοξύ (Thr).

c. Mom is a carrier, dad is not, since his protein is normal!

Η μαμά είναι φορέας, ο μπαμπάς δεν είναι, αφού η πρωτεΐνη είναι φυσιολογική!

d. With two carrier parents, the probability would be 25% but here the probability is 0% since

dad is normal.

Με δύο γονείς φορείς, η πιθανότητα θα είναι 25% αλλά εδώ η πιθανότητα είναι 0%, δεδομένου

ότι ο μπαμπάς είναι φυσιολογικός.




8. You have two cell populations one from normal cells and one from cancer cells. You suspect that

there may be some gene expression differences in these two populations. Initially you suspect 25

different genes.

Έχετε δύο κυτταρικούς πληθυσμούς, ένα από φυσιολογικά κύτταρα και ένα από καρκινικά

κύτταρα. Υποψιάζεστε ότι μπορεί να υπάρχουν κάποιες διαφορές γονιδιακής έκφρασης σε αυτούς

τους δύο πληθυσμούς. Αρχικά υποψιάζεστε 25 διαφορετικά γονίδια.

a. Describe how you could use a micro-array to identify expression differences.

Περιγράψτε πώς θα μπορούσατε να χρησιμοποιήσετε μια μικροσυστοιχία για να εντοπίσετε

διαφορές έκφρασης.

If the fluorescence in the resulting micro-array is as follows

Εάν ο φθορισμός στη προκύπτουσα μικροσυστοιχία είναι ως εξής

1

2

3

4

5

1 2 3 4 5

b. Why are some genes fluorescing yellow?

Γιατί είναι μερικά γονίδια φθορίζουν κίτρινο;

c. Which of the genes could be oncogenes? (give x,y coordinates)

Ποιο από τα γονίδια θα μπορούσαν να είναι ογκογονίδια; (Δώστε x, y συντεταγμένες)

d. Which of the genes could be tumor suppressor genes? (give x,y coordinates)

Ποιο από τα γονίδια θα μπορούσαν να είναι ογκοκασταλτικά; (Δώστε x, y συντεταγμένες)

a. Prepare an array with cDNA of the genes you would like to investigate

Collect mRNA from the cells and convert it to cDNA (more stable)

Add fluorescence beacons to the above (red=cancer, green=normal)

Incubate on the microarray

Wash the excess off

Measure the fluorescence

b. The genes are expressed in both (red+green=yellow)

c. (4,2) (5,3) (4,5) and (5,2) weakly

d. (3,1) (1,2) (1,5) and (5,5) weakly




9. You are studying the effects of a mutagen when applied to the skin of nude mice.

You apply the mutagen and then, at different time intervals, you obtain tissue

samples from normal and affected areas to examine the expression of some genes.

You take samples before the application of the mutagen and at 2 hrs, 2 days, 2,

12, and 24 months. You label the normal samples with a green fluorescent

molecule and the abnormal samples with a red fluorescent molecule. The images

of the microarrays are shown below.

Μελετάτε τα αποτελέσματα ενός μεταλλαξιογόνου όταν εφαρμόζεται στο δέρμα

των γυμνών ποντικών. Εφαρμόζετε το μεταλλαξιογόνο και στη συνέχεια, σε διαφορετικά χρονικά

διαστήματα, λαμβάνετε δείγματα ιστών από φυσιολογικές και προσβεβλημένες περιοχές για να

εξετάσετε την έκφραση κάποιων γονιδίων. Λαμβάνετε δείγματα πριν από την εφαρμογή του

μεταλλαξιογόνου και στις 2 ώρες, 2 ημέρες, 2, 12 και 24 μήνες. Ενώνετε στα κανονικά δείγματα

ένα πράσινο φθορίζον μόριο και στα μη φυσιολογικά δείγματα ένα κόκκινο φθορίζον μόριο. Οι

εικόνες των μικρο-συστοιχιών φαίνονται πιο κάτω.

a. Unfortunately, an undergraduate laboratory assistant has mixed up the images and are now out

of order. Write below each image the time at which it was collected. (Hint: you must look at

the changing expression of genes in order to decide.)

Δυστυχώς, ένας προπτυχιακός βοηθός εργαστηρίου έχει μπερδέψει τις εικόνες και είναι πλέον

εκτός σειράς. Γράψτε κάτω από κάθε εικόνα την ώρα συλλογής. (Συμβουλή: πρέπει να

εξετάσετε την μεταβαλλόμενη έκφραση των γονιδίων για να αποφασίσετε.)

b. Assuming that each gene in this particular panel performs a different function, what could be

the function of genes A to E? Explain why.

Υποθέτοντας ότι κάθε γονίδιο σε αυτή τη συγκεκριμένη ομάδα εκτελεί διαφορετική

λειτουργία, ποια θα μπορούσε να είναι η λειτουργία των γονιδίων Α έως Ε; Εξηγήστε γιατί.

a. The time sequence is as follows.

Before/Πριν 24 months 2 hrs 2 days 12 months 2 months

b. Gene A is deactivated in the cancer cells at 2hrs (1st mutation) tumor suppressor gene

Gene C is activated in the cancer cells at 2 days (2nd mutation) oncogene

Gene D is activated in the cancer cells at 2 months (3rd mutation) invasion gene

Gene E is activated in the cancer cells at 12 months (4th mutation) agiogenesis gene

Gene B is activated in the cancer cells at 24 months (5th mutation) increased mobility (metastasis)

A B C

D

E

A B C

D

E




Matlab Assignment / Εργασία Matlab 3

In the file named “BioinfData.mat” you will find two variables:

Variable “Code” contains the codes, names, and one letter abbreviations of the amino acid

and stop codons. (Remember that the Start codon is the same as Met.)

Variable “DNAData” contains some DNA sequence (it is actually the region coding for the

Cystic Fibrosis gene but for our purposes we will consider it an unknown.)

Load the data and find all possible genes (or coding regions) assuming that the code could be

overlapping. Also assume that any region less than 6 amino acids long is not really a coding region but

most likely an error in the sequencing process.

a. How many coding regions are there in this sequence? How long are the first 4 coding

regions? (Note: although the code may be overlapping, the stop codon must be in-frame with

the corresponding start codon. Hence the length of each DNA region should always be a

multiple of 3.)

b. What is the amino acid sequence for the first region? (Both in long and abbreviated format).

Please show all your code and answer all question.

a. To find the coding regions

load BioinfData

C=FindCodingRegions(DNAData,Code,6);

There are 96 coding regions >= 6 aminoacids.

The length of the first 4 regions is: 48, 4437, 54, and 99 bp

b. To find the amino acid sequence

[LongName ShortName]=FindAASequence(C{1},Code)

The amino acid sequence is

ThrSerGlnGlnValArgGluLysGlyLeuSerGlyArgHisProGlu

TSQQVREKGLSGRHPE

The functions used are shown below:

function C=FindCodingRegions(Data,Code,MinAALength) indStart=FindCodons(Data,FindAACode('Met',Code)); count=0; for p=1:length(indStart) indStop=FindCodonsInFrame(Data(indStart(p):end),FindAACode('STO',Code)); if indStop if length(indStart(p)+3:indStart(p)+indStop(1)-2)>((MinAALength-1)*3) count=count+1; C{count}=Data(indStart(p)+3:indStart(p)+indStop(1)-2,1); end; end; end;

function ind=FindCodons(Data,Codon); [m,n]=size(Data); l=length(Codon);




count=0; for p=1:m-2 for q=1:l if strcmp(Data(p:p+2,1)',Codon{q}) count=count+1; ind(count)=p; end; end; end; ind=sort(ind);

function C=FindAACode(AAName,Code) S=strcmp(Code,AAName); ind=find(S(:,2)); for p=1:length(ind) C{p}=Code{ind(p),1}; end;

function ind=FindCodonsInFrame(Data,Codon); [m,n]=size(Data); l=length(Codon); count=0; for p=1:3:m-2 for q=1:l if strcmp(Data(p:p+2,1)',Codon{q}) count=count+1; ind(count)=p; end; end; end; ind=sort(ind);

function [SLong SShort]=FindAASequence(CodingRegion,Code) SLong=[]; SShort=[]; [m,n]=size(CodingRegion); R=reshape(char(CodingRegion)',[3 m/3])'; [m,n]=size(R); for p=1:m [Name N]=FindAAName(R(p,:),Code); SLong=[SLong Name]; SShort=[SShort N]; end;

function [Name N]=FindAAName(AACode,Code) S=strcmp(Code,AACode); ind=find(S(:,1)); for p=1:length(ind) Name=Code{ind(p),2}; N=Code{ind(p),3}; end;

homework 3 / tz Κατ’ Οίκον Εργασία 3 – 2020...Ένας...

Documents