home field advantage: why the pittsburgh steelers don’t like playing in denver brian couch, liz...
TRANSCRIPT
Home Field Advantage: Why the Pittsburgh Steelers Don’t Like
Playing in DenverBrian Couch, Liz Flaherty, Carly Jordan,
Susan Jorstad, Desirée Salazar, Roberto Tinoco, Rich Wilson
Facilitators: Lisa Elfring and Ralph Preszler
Topic: Gene Expression: Linking Genes to Phenotypes
Context: Majors General Biology, 150+ students, mixed preparation, high DFW rate, different fields (ex, pre-health), diverse socioeconomic and ethnic groups, students at a state university
Prior Knowledge: Protein structure, Mendelian genetics, transcription, translation
Unit Learning Goals:–Understand the link between gene and
phenotype–Understand how a mutation in DNA
affects the amino acid sequence–Understand that a change in amino acid
sequence can result in changes in protein function–Develop science process skills
Teachable Tidbit Learning Outcomes:A. Give examples of how genotypic changes can lead to phenotypic changes (1) B. Given a wild type and mutant amino acid and/or mRNA sequences, identify the type of mutation that occurred (2) C. Compare and contrast the effects of different mutations on the resulting amino acid sequence (4)D. Design an experiment to test how amino acid sequence affects protein function (5)E. Draw a concept map that illustrates the relationships between genes and phenotypes (5)F. Interpret graphical data about biological phenomenon (4)
Q1: What is Ryan’s genotype?
A. He is homozygous for the normal allele.B. He is heterozygous. C. He is homozygous for the mutant allele.D. He is hemizygous.
Q2: Which of the following contributes to sickle cell disease in Ryan?
A. O2 levels
B. Mutated DNAC. Abnormal proteinD. All of the aboveE. Not enough information
GROUP ACTIVITY!
Let’s take a closer look at Ryan’s DNA!
Ryan’s normal allele 5’ … CTATGGTGCACCTGACTCCTGAGGAGAAGT … 3’ Ryan’s mutant allele 5’ … CTATGGTACACCTGACTCCTGTGGAGAAGT … 3’
Q3: Rank the following mutations (from low to high) with regards to the severity of their impacts on the final protein: 1) nonsense early in sequence2) silent 3) missense mutation of valine for alanine 4) missense mutation of valine for lysine.
A. 1, 2, 3, 4B. 2, 3, 4, 1 C. 1, 2, 4, 3D. 2, 3, 1, 4E. 2, 4, 3, 1
Q4: In each of Ryan’s red blood cells, what type of hemoglobin proteins are present?
A. Normal and mutant hemoglobinB. Mutant hemoglobinC. Normal hemoglobinD. None since they lack nucleusE. It depends on oxygen levels
Take-Home ActivityTr
eatm
ent T
ype
Targets
For each treatment type, place an X in the box(s) that the treatment will resolve.
Diversity
• Highlight role model from an under-represented group
• Disease range vs. homework question• Inequality in access to healthcare• Pedagogical diversity: group work, think-pair-
share, data interpretation, concept maps, visual-auditory
Think-Pair-ShareHow could this amino acid substitution change the shape of the protein and the cell?
Image Source: Berkley’s “Understanding Evolution” Image Source: www.medindia.net
Protein Cell