hemoglobin beta-subunit (hbb)

21
Hemoglobin Beta- subunit (HBB) Josh Bram and Wilton Smith

Upload: eagan

Post on 23-Feb-2016

49 views

Category:

Documents


0 download

DESCRIPTION

Hemoglobin Beta-subunit (HBB). Josh Bram and Wilton Smith. What is Hemoglobin?. Oxygen (and CO 2 ) transporter for all vertebrates Tetramer composed of four protein subunits (two alpha and two beta subunits) Four Iron-containing haeme centers carry one oxygen molecule each - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: Hemoglobin Beta-subunit (HBB)

Hemoglobin Beta-subunit (HBB)

Josh Bram and Wilton Smith

Page 2: Hemoglobin Beta-subunit (HBB)

What is Hemoglobin?• Oxygen (and CO2) transporter

for all vertebrates• Tetramer composed of four

protein subunits (two alpha and two beta subunits)

• Four Iron-containing haeme centers carry one oxygen molecule each

• Beta-subunit mutations cause:– Sickle-cell anemia– Beta-thalessemia

• 146 amino acid protein subunit

Page 3: Hemoglobin Beta-subunit (HBB)

Hemoglobin - β Mutation Diseases

Sickle Cell Anemia• Mutation causing beta-

globin units to stick together in masses and deform Red Blood Cells

• RBCs take crescent shape and have many consequences

• These include premature death and blocking of small blood vessels

Beta Thalassemia• Either a decrease or

absence of beta-globin production

• Prevents Red Blood Cells from having enough Hemoglobin to supply oxygen to the body

• In mice, leads to sickly and weak individuals, or stillborn offspring

Page 4: Hemoglobin Beta-subunit (HBB)

Peromyscus leucopus

Page 5: Hemoglobin Beta-subunit (HBB)

Primer Design

• Targeted Intron 2 (~700 base pairs)• Forward Primer (E2E3F):

5’ ctccatgtggatcctgagaac 3’– GC%: 52.38 – 21 base pairs– Melting point: 55° C

• Reverse Primer (E2E3R): 5’ acgatcatattgcccaggag 3’

– GC%: 50.00– 20 base pairs– Melting Point: 55° C

Page 6: Hemoglobin Beta-subunit (HBB)

DNA Extraction

• Qiagen DNeasy Blood & Tissue Kit• Two samples of P. leucopus extracted– Sample 1 extracted after 20 minute incubation– Sample 2 extracted after extended incubation

• Both DNA samples yielded amplification results at one time or another; however, sample 2 proved to be a more reliable DNA source

Page 7: Hemoglobin Beta-subunit (HBB)

Polymerase Chain Reaction (PCR)

• 6.25 μL Mastermix– Mix composed of parts:

• 50 x 1.25 μL 10x buffer = 62.5 μL• 50 x 1.25 μL dNTP = 62.5 μL• 50 x 0.1 μL Taq Polymerase = 5 μL

• 4.25 μL dH2O• 1.00 μL DNA• 0.50 μL PF• 0.50 μL PR

Page 8: Hemoglobin Beta-subunit (HBB)

Initial Identification

• Six sample PCR– Sample DNA 1 at 50˚C,

55˚C, and 60˚C– Sample DNA 2 at 50˚C,

55˚C, and 60˚C

• Successful gene amplification for Sample DNA 2 at 60˚C PCR (well seven)

2 kb1.5 kb

1 kb700 bp500 bp300 bp100 bp

Page 9: Hemoglobin Beta-subunit (HBB)

What happened?

• Only Sample DNA 2 used for future PCR reactions

• Gene amplification failed to occur at 60˚C (or any temperature)

• Possible errors in PCR mix setup, PCR machine setup, random error, denatured primers

Page 10: Hemoglobin Beta-subunit (HBB)

Successfully Identified

• PCR run at multiple primer concentrations (1X, 1.5X, 2X) for Sample DNA 2

• Successful gene amplification for across all primer concentrations (wells two, three, and four)

1, 1.5, and 2x primer concentrations all show amplification at approx. 700 bp

Page 11: Hemoglobin Beta-subunit (HBB)

Initial 50 μL PCR products

• 50 μL PCR reactions for eventual sequencing

• All PCR ingredient volumes multiplied by four for 50 μL PCR

• Wells two and three show the HBB PCR products (1X and 1.5X Primer concentrations)

HBB PCR Prodcuts, approx. 700 bp

Page 12: Hemoglobin Beta-subunit (HBB)

PCR Product Cleanup for Analysis

• Used Qiagen PCR Purification Kit• Cleanup up PCR Product to send for

sequencing• Sent 5 μL of each primer, 10 μL of PCR product• Sent to Penn State sequencing facility in

Chandlee building

Page 13: Hemoglobin Beta-subunit (HBB)

HBB Sequence

Page 14: Hemoglobin Beta-subunit (HBB)

HBB Forward Primer

• Compared to Mus sequence

Page 15: Hemoglobin Beta-subunit (HBB)

HBB Reverse Primer

• Compared to Mus sequence

Page 16: Hemoglobin Beta-subunit (HBB)

BLAST Results

Page 17: Hemoglobin Beta-subunit (HBB)

Population Samples

• Six Population Sample PCR at 60˚C– TK20806– TK20808– TK20809– TK20813– TK20852– TK20857

• All samples showed gene amplification

East

West

Page 18: Hemoglobin Beta-subunit (HBB)

5E (806) vs 9W (852)

Page 19: Hemoglobin Beta-subunit (HBB)

Conserved vs Unconserved

Page 20: Hemoglobin Beta-subunit (HBB)

Site 179

Depending on reading frame: Cys to Tyr, Val to Met, Leu to Leu