hantavirus glycoprotein gn in virion assembly and
TRANSCRIPT
![Page 1: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/1.jpg)
HANTAVIRUS GLYCOPROTEIN GN IN VIRION ASSEMBLY AND
REGULATION OF INTERFERON RESPONSE
HAO WANG
Department of Virology, Haartman Institute,
University of Helsinki
Finland
Helsinki Graduate School in Biotechnology and Molecular Biology
Academic Dissertation
To be presented for public examination, with the permission of the Faculty of Medicine of the
University of Helsinki, in Lecture Hall 2, Haartman Institute, on 17th June 2011 at 12 noon
Helsinki 2011
![Page 2: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/2.jpg)
2
Supervised by: Professor Antti Vaheri
Department of Virology
Haartman Institute
University of Helsinki
Reviewed by: Docent Tero Ahola
Institute of Biotechnology
University of Helsinki
and
Docent Sampsa Matikainen
Finnish Institute of Occupational Health
Helsinki
Opponent: Professor Michèle Bouloy
Institute Pasteur
Paris
ISBN 978-952-92-9095-6 (nid.)
ISBN 978-952-10-7004-4 (PDF)
Unigrafia Oy, Helsinki University Print
![Page 3: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/3.jpg)
3
TABLE OF CONTENTS
1 LIST OF ORIGINAL PUBLICATIONS 5
2 ABBREVIATIONS 6
3 SUMMARY 8
4 REVIEW OF THE LITERATURE 10
4.1 Overview of hantaviruses 10
4.2 History 11
4.3 Virus structure and genome 12
4.4 Virus life cycle 13
4.4.1 Entry 13
4.4.2 Transcription 14
4.4.3 Translation 15
4.4.4 Replication 15
4.4.5 Virus maturation 16
4.4.5.1 Encapsidation 16
4.4.5.2 Assembly 17
4.4.5.3 Budding 18
4.5 Viral proteins 18
4.5.1 L protein 18
4.5.2 N protein 19
4.5.3 Gn and Gc proteins 21
4.6 Hantaviruses and immunity 22
4.6.1 Innate immunity 22
4.6.1.1 Hantaviruses and innate immunity 25
4.6.1.2 Induction of innate immunity by hantaviruses 25
4.6.1.3 Inhibition 27
4.6.2 Adaptive immunity 27
4.6.2.1 Humoral immune response and diagnostics 28
4.6.2.2 Cellular immune response 29
5 AIMS OF THE STUDY 31
6 MATERIALS AND METHODS 32
![Page 4: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/4.jpg)
4
7 RESULTS 37
7.1 Fate of Gn-CT of the apathogenic Tula hantavirus and its role in virus assembly 37
7.1.1 Degradation and aggresome formation of Gn-CT (I) 37
7.1.2 Interaction between Gn tail and N protein (II) 39
7.2 Regulation of interferon response by Old World hantaviruses 41
7.2.1 Viral dsRNA production and genomic RNA of hantavirus (III) 41
7.2.2 Hantavirus Gn-CT inhibits the activation of IFN- immune response (IV) 42
8 DISCUSSION 44
8.1 Analysis of the Gn protein sequence alignment and the selection of Gn-CT region 44
8.2 Degradation and aggresome formation of Gn-CT may be a general property of most
hantaviruses 44
8.3 The role of ITAM and zinc finger motifs in the interaction of N and Gn-CT 45
8.4 The role of hantavirus RNA in the induction of innate immunity 45
8.5 The role of Gn-CT of TULV in inhibition of innate immunity 46
9 CONCLUDING REMARKS 48
10 FUTURE PROSPECTS 49
11 ACKNOWLEDGEMENTS 50
12 REFERENCES 51
![Page 5: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/5.jpg)
5
1 List of original publications
This thesis is based on the following original publications which are referred to by
Roman mumerals in the text
I Wang H, Strandin T, Hepojoki J, Lankinen H, Vaheri A. Degradation and aggresome
formation of the Gn tail of the apathogenic Tula hantavirus. J Gen Virol. 2009
Dec;90(Pt 12):2995-3001
II Wang H*, Alminaite A*, Vaheri A, Plyusnin A. Interaction between hantaviral
nucleocapsid protein and the cytoplasmic tail of surface glycoprotein Gn. Virus Res.
2010 Aug;151(2):205-12.
III Wang H, Vaheri A, Weber F, Plyusnin A. Hantaviruses do not produce detectable
amounts of dsRNA in infected cells and their genome 5 -́termini bear monophosphate.
J Gen Virol. 2011 May;92(Pt 5):1199-204.
IV Wang H, Sillanpää M, Strandin T, Hepojoki J, Lankinen H, Julkunen I, Vaheri A. Tula
hantavirus Gn tail inhibits the activation of IFN beta innate immunity response. In
manuscript
*equal contribution
![Page 6: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/6.jpg)
6
2 Abbreviations
ANDV Andes hantavirus
CARDs caspase-recruitment domains
CHX cycloheximide
cRNA antigenomic RNA
DOBV Dobrava hantavirus
dsRNA double-stranded RNA
ECM extracellular matrix
eIF4F eukaryotic translation initiation factor 4F
FACS flow cytometry
GFP green fluorescent protein
Gn-CT Gn glycoprotein cytoplasmic tail
GPC glycoprotein precursor
GST glutathione-S-transferase
HCPS hantavirus cardiopulmonary syndrome
HFRS hemorrhagic fever with renal syndrome
HLA human leukocyte antigen
HTNV Hantaan hantavirus
IFN interferon
IKK IB kinase-
IPS-I IFN- promoter stimulator
IPTG isopropyl--D-1-thiogalactopyranoside
IRESs cis-acting internal ribosomal entry site
IRF interferon regulatory factor
ITAM immunoreceptor tyrosine based activation motif
MDA5 melanoma differentiation-associated gene 5
MHC major histocompatibility complex
![Page 7: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/7.jpg)
7
MTOC microtubule organizing center
MyD88 myeloid differentiation primary response gene (88)
NCR non-coding region
NE nephropahia epidemica
NF-B nuclear factor -light-chain-enhancer of activated B
cells
NOC nocodazole
NY-1 New York-1 hantavirus
ORF open reading frame
PAMPs pathogen-associated molecular patterns
PHV Prospect Hill hantavirus
PRRs pattern recognition receptors
PUUV Puumala virus
RdRp RNA-dependent RNA polymerase
RIG-I retinoic acid inducible gene I
RLH retinoic acid-inducible gene I-like RNA helicases
SAAV Saaremaa hantavirus
SEOV Seoul hantavirus
SFV Semliki Forest virus
SNV Sin Nombre hantavirus
TBK-1 TANK-binding kinase 1
TLR Toll-like receptor
TNF- tumor necrosis factor alpha
TRAF3 TNF receptor-associated factor 3
TULV Tula hantavirus
vRNA viral RNA
vRNP viral ribonucleoprotein
![Page 8: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/8.jpg)
8
3 Summary
Hantaviruses have a tri-segmented negative-stranded RNA genome. The S segment
encodes the nucleocapsid protein (N), M segment two glycoproteins, Gn and Gc, and the L
segment the RNA polymerase. Gn and Gc are co-translationally cleaved from a precursor and
targeted to the cis-Golgi compartment. The Gn glycoprotein consists of an external domain, a
transmembrane domain and a C-terminal cytoplasmic domain. In addition, the S segment of
some hantaviruses, including Tula and Puumala virus, have an open reading frame (ORF)
encoding a nonstructural potein NSs that can function as a weak interferon antagonist.
The mechanisms of hantavirus-induced pathogenesis are not fully understood but it is
known that both hemorrhagic fever with renal syndrome (HFRS) and hantavirus (cardio)
pulmonary syndrome (HCPS) share various features such as increased capillary permeability,
thrombocytopenia and upregulation of TNF-. Several hantaviruses have been reported to
induce programmed cell death (apoptosis), such as TULV-infected Vero E6 cells which is
known to be defective in interferon signaling. Recently reports describing properties of the
hantavirus Gn cytoplasmic tail (Gn-CT) have appeared. The Gn-CT of hantaviruses contains
animmunoreceptor tyrosine-based activation motif (ITAM) which directs receptor signaling
in immune and endothelial cells; and contain highly conserved classical zinc finger domains
which may have a role in the interaction with N protein. More functions of Gn protein have
been discovered, but much still remains unknown.
Our aim was to study the functions of Gn protein from several aspects: synthesis,
degradation and interaction with N protein. Gn protein was reported to inhibit interferon
induction and amplication. For this reason, we also carried out projects studying the
mechanisms of IFN induction and evasion by hantavirus.
We first showed degradation and aggresome formation of the Gn-CT of the apathogenic
TULV. It was reported earlier that the degradation of Gn-CT is related to the pathogenicity of
hantavirus. We found that the Gn-CT of the apathogenic hantaviruses (TULV, Prospect Hill
virus) was degraded through the ubiquitin-proteasome pathway, and TULV Gn-CT formed
![Page 9: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/9.jpg)
9
aggresomes upon treatment with proteasomal inhibitor. Thus the results suggest that
degradation and aggregation of the Gn-CT may be a general property of most hantaviruses,
unrelated to pathogenicity.
Second, we investigated the interaction of TULV N protein and the TULV Gn-CT. The
Gn protein is located on the Golgi membrane and its interaction with N protein has been
thought to determine the cargo of the hantaviral ribonucleoprotein which is an important step
in virus assembly, but direct evidence has not been reported. We found that TULV Gn-CT
fused with GST tag expressed in bacteria can pull-down the N protein expressed in
mammalian cells; a mutagenesis assay was carried out, in which we found that the zinc finger
motif in Gn-CT and RNA-binding motif in N protein are indispensable for the interaction.
For the study of mechanisms of IFN induction and evasion by Old World hantavirus, we
found that Old World hantaviruses do not produce detectable amounts of dsRNA in infected
cells and the 5’-termini of their genomic RNAs are monophosphorylated. DsRNA and
tri-phosphorylated RNA are considered to be critical activators of innate immnity response
by interacting with PRRs (pattern recognition receptors). We examined systematically the
5 -́termini of hantavirus genomic RNAs and the dsRNA production by different species of
hantaviruses. We found that no detectable dsRNA was produced in cells infected by the two
groups of the old world hantaviruses: Seoul, Dobrava, Saaremaa, Puumala and Tula. We
also found that the genomic RNAs of these Old World hantaviruses carry
5 -́monophosphate and are unable to trigger interferon induction.
The antiviral response is mainly mediated by alpha/beta interferon. Recently the
glycoproteins of the pathogenic hantaviruses Sin Nombre and New York-1 viruses were
reported to regulate cellular interferon. We found that Gn-CT can inhibit the induction of
IFN activation through Toll-like receptor (TLR) and retinoic acid-inducible gene I-like
RNA helicases (RLH) pathway and that the inhibition target lies at the level of
TANK-binding kinase 1 (TBK-1)/ IB kinase-IKK complex and myeloid
differentiation primary response gene (88) (MyD88) / interferon regulatory factor 7 (IRF-7)
complex.
![Page 10: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/10.jpg)
10
4 Review of the literature
4.1 Overview of hantaviruses
Hantaviruses are RNA viruses within the family Bunyaviridae (Nichol, 2005).
They are found worldwide and are associated with two severe disease syndromes:
hemorrhagic fever with renal syndrome (HFRS) and hantavirus (cardio) pulmonary
syndrome (HCPS) (Heyman et al., 2009; Vapalahti et al., 2003).
Unlike the rest of the family Bunyaviridae, which are arthropod-borne, the
carriers of hantaviruses are rodents and insectivores (Heyman et al., 2009; Vaheri et
al., 2011). These viruses are transmitted directly or indirectly between hosts through
aggressive interactions or the inhalation of infectious aerosols released in saliva, urine
and feces (Plyusnin and Morzunov, 2001). In insectivores, recently, new hantaviruses
have been detected in shrews (Klempa et al., 2007; Song et al., 2007). In rodents,
hantaviruses are found in the Cricetidae family (subfamilies Arvicolinae, Neotominae
and Sigmodontinae) and in the Muridae family (subfamily Murinae). Each hantavirus
type is carried primarily by a specific rodent host species and they are co-evolving
with their hosts (Khaiboullina et al., 2005; Plyusnin et al., 1996).
In Europe, HFRS is caused by three hantaviruses: Puumala virus (PUUV)
(Brummer-Korvenkontio et al., 1982), Dobrava virus (DOBV) (Avsic-Zupanc et al.,
1992) and Saaremaa virus (SAAV) (Plyusnin et al., 1997). In Finland, a total of
22, 681 cases of PUUV-caused mild HFRS were reported from 1995 to 2008 (average
annual incidence 31/100 000 population). There has been an increasing trend in
incidence, and the rates have varied widely by season and region (Makary et al., 2010;
Vaheri et al., 2008).
![Page 11: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/11.jpg)
11
4.2 History
Before the identification of the causative agent of HFRS in 1976 by Dr. Ho Wang
Lee (Lee et al., 1978), the human diseases of HFRS type had already been described
long time ago. In A.D. 960, a Chinese medical account described a similar disease
(Lee et al., 1982). In 1934, Japanese physicians first encountered HFRS in Manchuria
during troop field maneuvers, and in the same year the milder form of hantavirus
disease, nephropathia epidemica (NE), was first described in Sweden (Myhrman,
1951). During World War II, 10,000 German and Finnish soldiers were infected in
Finnish Lapland. In the 1950s, HFRS was recognized in countries of Eastern Europe
including former Yugoslavia, Bulgaria, former Czechoslovakia, and Hungary
(Gajdusek, 1962). Also during the 1950s, American soldiers met HFRS during the
Korean War: over 3,000 American and Korean soldiers fell severely ill with a lethality
of more than 10% (Earle, 1954). In the attempt to identify the causative agent in the
Korean War, Ho Wang Lee developed a sensitive diagnostic test for clinical HFRS by
using lung sections from infected wild mice (Lee and Lee, 1976). In the meantime,
several groups failed to find a susceptible laboratory host or cell system. After Lee
adapted the infectious agent to mice belonging to the subspecies jejudoica, he
successfully isolated the first hantavirus, Hantaan virus (HTNV) (Lee et al., 1978).
Since then more and more HFRS-causing viruses have been identified. Soon in 1980,
the first hantavirus found in Europe PUUV was identified by Finnish scientists in the
lungs of infected bank voles (Brummer-Korvenkontio et al., 1980). A number of
hantaviruses were identified soon after, including Seoul (SEOV) and Prospect Hill
virus (PHV) in the early 1980s (Lee et al., 1982), Thailand virus in 1985, Dobrava
(DOBV) in 1992 and Tula (TULV) in 1994 (Avsic-Zupanc et al., 1992; Elwell et al.,
1985; Plyusnin et al., 1994).
Another important event in hantavirus history was the outbreak in southwestern
USA in 1993 which initially killed up to 50% of the infected patients. The causative
agent was soon identified and later named Sin Nombre virus (SNV). Since then, more
New World hantaviruses have been discovered in North and South America. At
![Page 12: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/12.jpg)
12
present, nearly 50 hantaviruses have been identified including over 20 hantaviruses
causing human disease (Heyman et al., 2009; Vaheri et al., 2011).
4.3 Virus structure and genome
Hantaviruses are negative-stranded RNA viruses with a tripartite genome. The
large (L) segment ( 6.5 kb) encodes the viral RNA-dependent RNA polymerase (L
protein), the medium (M) segment (3.6-3.7 kb) two surface glycoproteins, Gn and Gc,
and the small (S) segment (1.7-2.0 kb) the nucleocapsid (N) protein (Plyusnin et al.,
1996). A nonstructural protein (NSs) was found recently in some (e.g. TULV and
PUUV) but not all hantaviruses, and it is encoded by an overlapping (+1) ORF of the
S segment (Jääskelainen et al., 2007; Virtanen et al., 2010). Both the 5' and 3' ends
of each genomic segment contain non-coding sequences (NCR) (Plyusnin, 2002). Due
to the conserved, complementary terminal nucleotides on the L, M, and S segments,
hantavirus RNA segments can form closed circular structures called panhandles
(Plyusnin et al., 1996).
The hantavirus virion has a varying morphology (Martin et al., 1985). Taking
TULV as an example, the structure has been recently revealed by electron
cryotomography: generally they are large spherical particles with a diameter of
120-160 nm, occasionally smaller particles with a diameter of 60 nm, but there are
also tubular particles 350 nm long and 80 nm in diameter (Huiskonen et al., 2010).
The virion surface is covered by Gn and Gc proteins. Only small areas of membrane
are exposed. The Gn and Gc were recently reported to favor homo-oligomers over
hetero-oligomers, and Gn and Gc proteins are presented in heterocomplexes that
include tetramers of Gn protein interconnected by Gc protein dimers forming a unique,
four-fold grid-like structure on the surface of viral particles (Hepojoki et al., 2010a).
The virions contain viral ribonucleoprotein complexes (vRNP), which consist of the
genomic S, M, L vRNA encapsidated by N protein. It has been suggested that the
bunyavirus vRNPs can interact directly with the viral glycoprotein thus facilitating
![Page 13: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/13.jpg)
13
virus assembly (Hepojoki et al., 2010b; von Bonsdorff and Pettersson, 1975; Wang et
al., 2010).
4.4 Virus life cycle
4.4.1 Entry
Both pathogenic and non-pathogenic hantaviruses can replicate in endothelial
cells but there is little if any damage to the infected endothelium (Yanagihara and
Silverman, 1990; Zaki et al., 1995). HTNV and PUUV enter cells from the apical
surface of polarized endothelial cells (Krautkramer and Zeier, 2008), while the entry
of Andes hantavirus (ANDV) occurs via both apical and basolateral membranes of
epithelium cells (Rowe and Pekosz, 2006). Virus entry is initiated by attachment to
cells. The hantavirus first has to interact directly with host cell receptors. Integrins act
as host cell receptors mediating the hantavirus entry.
Integrins are heterodimeric transmembrane receptors composed of a combination
of α and β subunits, and they can mediate cell-cell adhesion, cell migration and
extracellular matrix protein (ECM) recognition (Sugimori et al., 1997). Pathogenic
hantaviruses like SNV, NY-1, PUUV, HTNV and SEOV use β3 integrin whereas
non-pathogenic hantaviruses such as PHV use β1 integrin (Gavrilovskaya et al., 2002;
Gavrilovskaya et al., 1998).
After cell attachment, receptor-mediated endocytosis occurs. During this step, the
hantavirus enters the cell through the dynamin-regulated clathrin-mediated
endocytosis pathway (Jin et al., 2002). Hantaviruses are transported to early
endosomes, and subsequently to late endosomes or lysosomes. Within endosomes, the
low pH induces the fusion activity of Gc protein, the viral and endosomal membranes
fuse with each other, and then the ribonucleocapsids are released into the cytoplasm
(Cifuentes-Munoz et al., 2010; Ogino et al., 2004; Tischler et al., 2005).
Now, the hantavirus starts to reproduce itself. This process is exclusively
cytoplasmic and includes several steps: transcription (mRNA synthesis), translation
![Page 14: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/14.jpg)
14
(virus protein synthesis) and replication (vRNA synthesis).
4.4.2 Transcription
During this step, the positive-strand mRNA is synthesized. For the initiation of
transcription, two mechanisms are involved: cap-snatching and primer-realign.
The 5'termini of synthesized mRNAs contain a 5'm7G cap structure. This
5'm7G cap has important biological functions as it is required by the RdRp to initiate
the transcription (Braam et al., 1983; Dhar et al., 1980; Plotch et al., 1981) and is
recognized by the cap-binding complex, eIF4F, for the initiation of translation
(Richter and Sonenberg, 2005; von der Haar et al., 2004).
The capped RNA primer is generated from the 5'terminus of host cell mRNA by
the “cap-snatching” process. This process has been well characterized for influenza
virus. Based on this knowledge, the PB2 subunit of heterotrimeric RdRp binds to the
5' caps of host mRNA, then the 5'm7G cap is cut from the host mRNA by the PB1
subunit of influenza virus RdRp (Guilligay et al., 2008; Sugiyama et al., 2009). In
contrast to the RdRp of influenza virus which has three subunits, the hantavirus RdRp
is a large single protein. The La Crosse orthobunyavirus (Bunyaviridae) polymerase
protein contains endonuclease domain (Reguera et al., 2010), whether the hantavirus
RdRp also has endonuclease activity is unknown.
In hantavirus, the 5' and 3' end of vRNA has a triplet of repeats
(3'-AUCAUCAUC) which is indispensable for the 5'cap to bind and initiate
transcription (Garcin et al., 1995; Mir and Panganiban, 2010). The 3'terminus of
5'caps from the host cell mRNA is a “G”residue which is supposed to basepair with
one of the C residues at the 3'termini of vRNA template during transcription
initiation (Garcin et al., 1995). The 5'cap is elongated by RdRp using a
“primer-realign”mechanism (Garcin et al., 1995). In this model 5' caps aligns
3'terminus of the viral template through G-C basepairing. Following elongation of a
few nucleotides, the extended primer realigns with viral RNA so that the G residue of
![Page 15: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/15.jpg)
15
3'termini of 5' caps would be at position -1 (Garcin et al., 1995). The binding of N
protein to 5' caps may facilitate the G-C basepairing (Mir et al., 2008; Mir and
Panganiban, 2010).
4.4.3 Translation
In cells, during the initiation of translation, the mRNA 5' cap interacts with the
cap-binding complex (eIF4F) and then recruits the 43S pre-initiation cmplex which
contains the small ribosomal subunit, eIF3 cluster of peptides and initiator methionine
transfer RNA, eIF2 and GTP (Richter and Sonenberg, 2005; von der Haar et al., 2004).
The cap-binding complex eIF4F comprises eIF4E, which directly binds to the mRNA
cap (Richter and Sonenberg, 2005; von der Haar et al., 2004), and eIF4A, which
contains a DEAD box RNA helicase (Rogers et al., 2002), and eIF4G, which acts like
a bridge between eIF4E and eIF4A (Mader et al., 1995). The mRNA 5'cap together
with eIF4F and 43S pre-initiation complex proceed to scan for the start codon AUG.
When the start codon is recognized, 60S large ribosomal subunit and additional
factors are recruited and translation begins (Kozak, 1991; Kozak, 1992).
Viruses use cellular machinery for the translation of viral mRNA. However, there
are still some differences between the mechanisms adopted by different viruses. Take
picornaviruses as an example, which contain a cis-acting internal ribosomal entry site
(IRESs) to enable translation initiation without a cap (Hellen and Sarnow, 2001; Jang,
2006). In the case of hantavirus genome translation, it was recently reported that the N
protein may replace the cap-binding complex (eIF4F) during the initiation of
translation (Mir and Panganiban, 2008).
4.4.4 Replication
The complementary copy of vRNA, antigenomic RNA (cRNA) is synthesized
![Page 16: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/16.jpg)
16
from the vRNA. Then the new vRNA is synthesized from the cRNA. The initiation
mechanisms of cRNA/vRNA and viral mRNA are similar, both utilize a primer-
realign mechanism (Garcin et al., 1995). But there are some differences between viral
mRNA and cRNA/vRNA. The 5'termini of cRNA and vRNA are not capped because
they are initiated by GTP, while the termini of viral mRNA contain a 5'capped
structure.
The HTNV genome RNA contains a 5'monophosphate (Garcin et al., 1995;
Habjan et al., 2008). According to the finding made by Garcin 1995, the genome
chain is initiated with GTP and a cleavage step occurs after realignment to remove the
initiating GTP, leaving a monophosphate uridine (Garcin et al., 1995). The enzyme
which has the ability to remove GTP may be the RdRp of hantavirus.
4.4.5 Virus maturation
4.4.5.1 Encapsidation
After the viral genome transcription and replication, the viral mRNA and the
vRNAs of S, L, M exist in the cytoplasm. The newly synthesized N protein starts to
encapsidate the cRNA and vRNA, but not the viral mRNA (Hacker et al., 1989; Jin
and Elliott, 1993). The mechanism for selective encapsidation of vRNA and some
cRNA by the N protein remains unknown. The viral mRNA is quite different from the
vRNA in structure and sequence, as vRNAs have panhandle structures, but mRNA not.
Additionally, vRNA has 5'monophosphate, but mRNA has a 5'm7G cap (Raju and
Kolakofsky, 1989). These specific sequences or structures have been suggested to
provide the signal for the N protein to encapsidate the cRNA or vRNA but not the
mRNA (Severson et al., 1999; Severson et al., 2001; Severson et al., 2005). It has
been reported that HTNV N protein has a binding preference for its S segment vRNA
as compared to its binding with the S segment open-reading frame (ORF) or
nonspecific RNA, thus suggesting that the N protein recognition site resides in the
non-coding region of HTNV vRNA (Severson et al., 1999). Later, it was reported that
![Page 17: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/17.jpg)
17
the 5' end of the S segment vRNA is necessary and sufficient for the binding reaction
to occur (Severson et al., 2001).
4.4.5.2 Assembly
The virion should be assembled after the N protein encapsidates the vRNA.
Bunyaviruses lack a matrix protein, which in other negative-stranded RNA viruses,
such as ortho-, paramyxo- and rhabdoviruses, plays a key role in virus assembly
(Harrison et al., 2010; Schmitt and Lamb, 2004; Ye et al., 1999). Therefore it was
suggested that bunyavirus vRNPs can interact directly with the membrane-associated
viral glycoprotein(s) thus helping the virus assembly (von Bonsdorff and Pettersson,
1975). For Uukuniemi virus (genus Phlebovirus), the interaction between vRNPs
and Gn/Gc proteins was first demonstrated by immunoprecipitation (Kuismanen,
1984). Later, it was shown that it is the glycoprotein cytoplasmic tail (Gn-CT) of
Uukuniemi virus that interacts with the vRNP (Overby et al., 2007). For Bunyamwera
virus (genus Orthobunyavirus) the interaction between RNP and Gn glycoprotein has
been shown in infectious virus-like particles (Shi et al., 2006). Similarly, in tomato
spotted wilt virus (genus Tospovirus) direct interaction of the N protein, a key
component of the vRNPs, and Gn glycoprotein was demonstrated by co-localization
assay (Ribeiro et al., 2009; Snippe et al., 2007). Recently it has been reported that the
Tula hantavirus Gn glycoprotein interacts with N protein which might facilitate the
virus assembly (Hepojoki et al., 2010b; Wang et al., 2010). Also in Tula virion
tomogram slices, connections from the RNP to the membrane, where the cytoplamic
tail of Gn protein is located, were occasionally observed (Huiskonen et al., 2010).
Most recently, the Gn glycoprotein of Crimean Congo Hemorrhagic Fever
(CCHF) virus, Nairovirus genus Bunyaviridae, was found to interact with RNA,
which may facilitate the assembly of virus RNP (Estrada and De Guzman, 2011).
![Page 18: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/18.jpg)
18
4.4.5.3 Budding
The hantavirus M segment encodes two viral glycoproteins Gn and Gc. Gn and
Gc glycoproteins are co-translationally cleaved from a single precursor at the
conserved WAASA motif and targeted to Golgi compartment where they are
processed and transported to the virus assembly site (Lober et al., 2001; Shi and
Elliott, 2002; Spiropoulou et al., 2003). The maturation of bunyaviruses is thought to
occur intracellularly in the Golgi complex (Matsuoka et al., 1991; Pettersson, 1991),
as the glycoproteins of bunyavirus are retained in the Golgi complex, which may
determine the site of virus assembly. In the case of hantaviruses, there exists a
discrepancy. It has been reported that the glycoproteins of HTNV (representing Old
World hantaviruses), SNV and ANDV (New World hantaviruses) accumulate in the
Golgi complex (Shi and Elliott, 2002; Spiropoulou et al., 2003). For Old World
hantaviruses, intracellular maturation was observed and the viral envelope was
derived from budding into the Golgi (Schmaljohn and Nichol, 2007), but according to
electron microscopy studies the maturation site of SNV and Black Creek Canal
hantavirus is the plasma membrane (Goldsmith et al., 1995; Ravkov et al., 1997).
4.5 Viral proteins
4.5.1 L protein
The L protein is the RNA polymerase, which transcribes and replicates the
genomic RNA. The L segments are of similar size among hantaviruses, varying from
6530 to 6562 nucleotides (Kukkonen et al., 2005). The transcript of hantavirus L
segment has a single large open reading frame (ORF) to encode L protein with a
predicted molecular mass of approximately 250 kDa. The size of L protein of HTNV
and SEOV has been measured by radiolabeling infected cells and running on 12%
SDS-PAGE gels to be approximately 200 kDa (Elliott et al., 1984). Later on, by using
![Page 19: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/19.jpg)
19
specific antibody against L protein of TULV and PUUV, the size of L protein was
measured to be 250 kDa (Kukkonen et al., 2004).
In hantavirus, the L and N proteins are the only viral proteins required for RNA
synthesis (Flick et al., 2003). The site of RNA synthesis is localized in the cytoplasm
(Rossier et al., 1986), but whether this site is associated with membrane is unknown.
It is well known that the RNA synthesis of all plus-strand RNA viruses is associated
with membranes (Salonen et al., 2005). Since the N protein is localized in the
perinuclear region (Kariwa et al., 2003; Kaukinen et al., 2003; Ravkov and Compans,
2001) and associated with membrane (Ravkov and Compans, 2001), and similarly to
the L protein (Kukkonen et al., 2004), hantavirus RNA synthesis may also be
membrane associated.
4.5.2 N protein
N protein which is encoded by the S segment contains 429-433 aa residues. It
contains of an N terminal coiled-coil region, central conserved region and C-terminal
helix-loop-helix region (Alfadhli et al., 2002; Kaukinen et al., 2005) (Fig 1). The N
terminal and C-terminal region are involved in the N protein oligomerization
(Alminaite et al., 2006; Kaukinen et al., 2005). The central region contains an
RNA-binding domain and interacts with cellular proteins such as SUMO and Ubc9
(Kaukinen et al., 2003; Maeda et al., 2003; Xu et al., 2002). The central domain of N
protein also binds to the 5'caps of mRNAs (Mir et al., 2008). Furthermore, PUUV N
protein was shown to interact with Daxx protein, a Fas-mediated apoptosis enhancer,
and the interaction domain has been mapped to the C-terminus (Li et al., 2002). Yeast
and mammalian two-hybrid assays revealed that the N-terminal amino acids 100–125
of SEOV N protein, which represents a critical region for N-N oligomerization, was
responsible for the interaction with SUMO-1-related molecules such as PIAS1,
PIASxβ, HIPK2, CHD3, and TTRAP (Lee et al., 2003).
![Page 20: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/20.jpg)
20
N-termanal
domain
(coiled-coil domain) central domainC-terminal domain
(helix-loop-helix region)
N protein
amino acid (1-80) amino acid (81-248) amino acid (249-429)
Fig 1 Hantavirus N protein. The N-terminal domain, central domain and C-terminal domain are
shown.
N is involved in many aspects of the virus life cycle, including encapsidation and
packaging of viral RNA (Jonsson et al., 2001; Mir et al., 2006; Mir and Panganiban,
2005; Severson et al., 1999), N protein trafficking (Ramanathan et al., 2007;
Ramanathan and Jonsson, 2008), viral genome translation (Mir and Panganiban,
2008), viral genome replication (Flick et al., 2003; Kohl et al., 2004; Osborne and
Elliott, 2000), modulation of apoptosis (Ontiveros et al., 2010) and modulation of
immune signaling (Taylor et al., 2009a; Taylor et al., 2009b).
Some of the functions of N protein have been discussed in the above sections. To
conclude, the N protein encapsidates both cRNA and vRNA after viral genome
replication (Hacker et al., 1989; Jin and Elliott, 1993). In the transcription and
translation process, N protein binds to the 5'caps of cellular mRNAs and protects
them from degradation in cellular P bodies, replaces the cellular cap-binding complex,
eIF4F, and augments translational expression (Mir et al., 2008; Mir and Panganiban,
2008); in the viral maturation step, the N protein binds to the glycoprotein Gn to
facilitate the budding (Hepojoki et al., 2010b; Huiskonen et al., 2010).
Recently it was reported that N protein is involved in the tumor necrosis factor
alpha (TNF-activated host immune response and apoptosis. TNF- is a
multifunctional cytokine with functions including activation of NF-B and induction
of apoptosis (Wajant et al., 2003). The plasma levels of TNF- are elevated in HFRS
patients (Krakauer et al., 1995; Linderholm et al., 1996; Temonen et al., 1996) and
TNF-producing cells are found in the kidneys and lungs of HFRS and HCPS
patients (Mori et al., 1999). The N protein interacts with importin-which will
![Page 21: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/21.jpg)
21
transport NF-B to the nucleus to activate downstream immune reponse, thus N
protein can inhibit the TNF- induced NF-B pathway (Taylor et al., 2009a; Taylor
et al., 2009b). Also, the N protein interacts with NF-B, sequesters it in the cytoplasm,
and promotes the inhibitor of NF-B (Idegradation, thus N protein can facilitate
the reduction of TNF-induced caspase activity and apoptosis (Ontiveros et al.,
2010).
4.5.3 Gn and Gc proteins
The M segment of hantaviruses encodes two glycoprotein, Gn and Gc. The Gn
and Gc are co-translationally cleaved from a precursor (GPC) at the conserved
sequence WAASA (Shi and Elliott, 2002). The Gn protein consists of an external
domain, a transmembrane domain and a C-terminal cytoplasmic domain (Fig 2). Gc
consists of an external domain and a quite short C-terminal cytoplasmic domain. The
hantavirus Gn is a multifunctional protein: it is involved in many aspects such as virus
recognition by celluar receptors, virus assembly and fusion with cells. In addition, Gn
is also involved in the inhibition of both IFN-induction and signaling. Gn-CT of
NY-1V was found to coprecipitate the N-terminal domain of TRAF3 and disrupt the
formation of TRAF3-TBK1 complex, thus regulating the RIG-I and TBK-1 directed
immune response (Alff et al., 2006; Alff et al., 2008). The Gn of both ANDV and
PHV were shown to inhibit nuclear translocation of STAT-1 (Spiropoulou et al.,
2007). Most recently, it was reported that IFN-β induction is inhibited of coexpression
of ANDV N protein and GPC and is robustly inhibited by SNV GPC alone.
Downstream amplification by Jak/STAT signaling is also inhibited by SNV GPC and
by either NP or GPC of ANDV (Levine et al., 2010).
![Page 22: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/22.jpg)
22
Fig 2. Cytoplasmic tail of hantaviral Gn protein. The upper part shows the glycoproteins (Gn and
Gc). The transmembrane domains and signal domains are marked in grey. The lower part is the
alignment of Gn-CT sequences. Zinc finger motifs and immunoreceptor tyrosine-based activation
motif (ITAM) are marked.
In most RNA viruses, the non-structural proteins are involved in the inhibition of
innate immunity (Haller et al., 2006). But in the case of hantaviruses, the
glycoproteins are more likely to be involved in the inhibition of innate immunity
considering that NSs of TULV and PUUV are weak inhibitors. This unusual feature of
hantavirus glycoproteins may be related to the conserved cytoplasmic tail of Gn. The
C-terminal part of Gn-CT of hantavirues contains immunoreceptor tyrosine-based
activation motif (ITAM) which direct receptor signaling within immune and
endothelial cells (Geimonen et al., 2003). In addition, the Gn-CT tail contains highly
conserved zinc finger motifs (Estrada et al., 2009) (Fig 2).
4.6 Hantaviruses and immunity
4.6.1 Innate immunity
Immediately after virus infection, the host cell innate immunity is induced to limit
the virus replication. The host cell recognizes the virus infection through the
![Page 23: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/23.jpg)
23
interaction between pathogen recognition receptor (PRR) proteins and
pathogen-associated molecular patterns (PAMPs).
The PRRs are comprised of several groups: Toll-like receptors (TLRs), retinoic
acid-inducible gene I-like RNA helicases (RLHs), NOD-like receptors (NLRs),
C-type lectin receptors (CLRs) and AIM2-like receptors (ALRs).
TLRs are expressed by various tissues and cell types, including macrophages,
dentritic cells, lymphocytes and tissue parenchymal cells (Kumar et al., 2011). Of the
13 mammalian TLRs discovered so far, TLR2 and TLR4 are expressed on the cell
surface while TLR3, TLR7, TLR8 and TLR9 are intracellular and endosomal (Kumar
et al., 2011). TLR2 and TLR4 recognize viral envelope components, TLR3 recognizes
dsRNA, TLR7 and TLR8 recognize ssRNA rich in G and U residues, and TLR9
recognizes dsDNA (Kopp and Medzhitov, 2003; Kumar et al., 2011). TLRs recruit
TIR domain containing adaptor molecules, like MyD88 and TRIF, and thus activate
the IRF-3, IRF-7 and NF- B, leading to expression of type I IFNs and cytokines
(Kumar et al., 2011; Yamamoto et al., 2003).
RLHs include RIG-I, MDA5 and LGP2 and function independently of TLRs
(Andrejeva et al., 2004; Yoneyama et al., 2004). RIG-I and MDA5 contain two
caspase-recruitment domains (CARDs) and a DExD/H-box helicase domain. The
helicase domains recognize viral RNAs, and CARDs then interact with IPS-I (also
called MAVS, VISA, and Cardif) which are located in the outer mitochondrial
membrane (Kawai et al., 2005; Meylan et al., 2005; Seth et al., 2005; Xu et al., 2005).
This interaction then activates IRF-3, IRF-7 and NF-B for the induction of type I
IFNs and cytokines (Kumar et al., 2011; Sato et al., 2000). LGP2, which lacks the
CARDs, functions as a positive regulator of virus recognition and subsequent antiviral
responses as recently been identified (Satoh et al., 2010) .(Fig. 3)
![Page 24: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/24.jpg)
24
Fig 3. Endosomal and cytoplasmic pathways for virus recognition and IFN production. TLR7 and
TLR8 recognize viral ssRNA and signals through MyD88 thus activating IFN response. TLR3
recognize dsRNA and through TRIF activates IFN response. RIG-I and MDA-5 recognize
ssRNA, dsRNA and via TBK-1 thereby also activating IFN response. Modified from Baum and
Garcia-Sastre et al., 2010.
The PAMPs include various viral inducers. Nucleic acids derived from virus,
including dsRNA, ssRNA and DNA, serve as the major PAMPs. From the study of
chemically synthesized nucleotides, long dsRNA activates MDA5 (Gitlin et al., 2006;
Kato et al., 2006), and short poly I:C (200-1000 nt) has been reported to trigger RIG-I
(Kato et al., 2008), and 25 nt to 70 nt long synthetic double-strand RNA lacking
5'ppp can activate RIG-I (Kato et al., 2008; Takahasi et al., 2008). Another effector is
5'ppp RNA. The genomic RNA of influenza or rabies viruses bearing 5'ppp, but not
genome of viruses that have a 5'monophospate, can activate the RIG -I dependent
IFN induction (Habjan et al., 2008; Hornung et al., 2006; Pichlmair et al., 2006). Also
it has been reported that the recognition of 5'ppp by RIG-I requires short blunt
double-stranded RNA which is inconsistent with other reports (Schlee et al., 2009;
Takahasi et al., 2008).
Although the activity of natural RNAs after infection is largely unknown, there is
evidence that the antigenomic RNA of negative-stranded viruses, which bears 5'ppp,
contributes only minimally to RIG-I activation compared to the genomic RNA also
bearing 5'ppp (Rehwinkel et al., 2010). The mRNA transcripts of measles and
Epstein-Barr viruses bearing 5'ppp termini are reported to activate RIG-I (Plumet et
![Page 25: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/25.jpg)
25
al., 2007; Samanta et al., 2006). A viral mRNA, with 5'-cap and 3'-poly (A) was
found to activate IFN expression through the RNase L-MDA5 pathway (Luthra et al.,
2011). The panhandle structure of negative-stranded RNA virus genome is also
thought to be a RIG-I inducer (Schlee et al., 2009).
Except the viral RNA, the PAMPs include viral proteins and ribonucleoprotein
(RNP) complex. The RNPs of the negative-stranded vesicular stomatitis and measles
viruses were found capable of triggering IFN induction (tenOever et al., 2002;
tenOever et al., 2004). Hepatitis C virus (HCV) NS5A protein has been shown to
activate NF-B when expressed in cells (Waris et al., 2002).
4.6.1.1 Hantaviruses and innate immunity
4.6.1.2 Induction of innate immunity by hantaviruses
In the 1990s, it was reported that PUUV-infected monocyte/macrophages
produce significantly increased amount of MxA, suggesting IFN- production
(Temonen et al., 1995). In microarray assay, upregulated interferon regulatory factor
(IRFs) gene expression level was observed in both SNV-infected cells and
PHV-infected cells, no changes of IFN- gene expression were observed
(Khaiboullina et al., 2004). In another mircroarray screening, it was found that PHV
induced much higher expression of MxA and 24 IFN-specific genes 24 h post
infection than NY-1V and HTNV, but at late times MxA was induced about 200 fold
by all three hantaviruses (Geimonen et al., 2002). A study comparing innate immunity
induction of HTNV and TULV-infected HUVEC cells showed that HTNV induced a
higher interferon response than the non-pathogenic TULV hantavirus, while TULV
showed an early onset of MxA expression compared to HTNV (Kraus et al., 2004). A
comparison between PHV and ANDV disclosed that PHV, but not ANDV, induced a
robust interferon (IFN- response early after infection, and IRF-3 dimerization and
nuclear translocation was detected in PHV but not ANDV infection (Spiropoulou et
al., 2007). ANDV and SNV infection elicited minimal or delayed expression of
![Page 26: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/26.jpg)
26
ISG56 and MxA in A549 and Huh-TLR3 cells (Levine et al., 2010). Recently, it has
been reported that the activation of complementary system is in correlation with the
disease severity in PUUV infection patients (Sane et al., 2011).
Although there are inconsistences in the above reports, we can conclude that most
hantaviruses can activate the innate immunity, however, pathogenic HTNV, NY-1
and ANDV may lead to a lower induction probably due to the fact that the pathogenic
hantaviruses can evade the innate immunity.
Several groups have studied the mechanism of the induction of IFN innate
immune response to hantaviruses.
It has been reported that the IFN innate immune responses to SNV are
independent of virus entry, IRF-3, TLRs, and other known PRRs in infected Huh7
cells (Prescott et al., 2007). In contrast to the results, recently the same group reported
that the intial activation of innate immunity in SNV infected Huh7 cells was due to
the IFN- contained in the SNV virus stock, and Huh7 cells lack the innate immune
responsiveness to SNV (Prescott et al., 2010). Also, UV-inactivated PHV, ANDV and
HTNV were unable to induce innate immunity, and TLR3 was needed for HTNV to
trigger innate immunity induction (Handke et al., 2009; Spiropoulou et al., 2007). But
interestingly, UV-inactivated SNV can still activate the innate immunity response at
early time points post infection in HUVEC cells and the initial immnunity response in
SNV-infected HUVEC was not due to IFN- contained in the SNV stock (Prescott et
al., 2010; Prescott et al., 2005). It has been reported that dsRNA is not detectable in
negative-stranded RNA viruses, and RIG-I is unable to detect genomic RNA derived
from HTNV (Habjan et al., 2008; Weber et al., 2006). In conclusion, what PAMPs
and PRRs are involved still remains unknown; different hantaviruses may use
different PAMPs to activate the innate immunity.
![Page 27: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/27.jpg)
27
4.6.1.3 Inhibition
While host cells utilize the innate immune response to limit virus replication,
viruses have evolved numerous ways to escape the interferon response. The Gn-CT of
NY-1, but not PHV, blocks RIG-I and TBK-1 directed IFN- responses by interacting
with TRAF3 and thus disrupting TBK-1-TRAF3 complex formation (Alff et al., 2006;
Alff et al., 2008). In contrast to this result, the full-length glycoprotein of ANDV and
PHV was found unable to inhibit IRF-3 activation by Sendai virus, but instead
inhibited the Jak/Stat interferon signaling pathway (Spiropoulou et al., 2007). In line
with this, another group reported that the N protein and GPC of ANDV did not result
in inhibition of IFN induction seperately, but when N and GPC of ANDV were
expressed together there was an inhibitory effect on IFN induction (Levine et al.,
2010). IFN induction was inhibited robustly by GPC of SNV alone, and the IFN
amplication by Jak/Stat signaling was inhibited by SNV GPC and by either N or GPC
of ANDV (Levine et al., 2010). Moreover, the NSs of TULV and PUUV was found to
act as a weak inhibitor of IFN response (Jääskelainen et al., 2007; Jääskelainen et al.,
2008). In conclusion, different hantaviruses may use different mechanisms to inhibit
the innate immunity response, and this mechanism appears to be independent of virus
pathogenicity in humans.
4.6.2 Adaptive immunity
While the innate immunity serves as a first line defense system in nearly all
multicellular organisms, the adaptive immunity functions as a more sophisticated,
specific and longer-lasting immune system. The adaptive immunity consists of
humoral immune response which involves antibody secretion by B cells and the
cellular immune response including the T lymphocyte recognition system.
![Page 28: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/28.jpg)
28
4.6.2.1 Humoral immune response and diagnostics
Antibodies produced by B lymphocytes include IgA, IgG, IgE, IgM and IgD.
These antibodies circulate around the body in the blood and are present in other body
fluids, where they can recognize and eliminate antigens or pathogens.
After hantavirus infection, the virus elicits a stable and long-lasting humoral
immune response involving all Ig classes. IgA is an antibody produced in the mucosa.
In ANDV- and PUUV- infected patients the level of total and specific IgA has been
reported to be elevated (de Carvalho Nicacio et al., 2001; Padula et al., 2000). IgE
triggers the immediate allergic reations. The total IgE level was increased in patients
with HFRS (Alexeyev et al., 1994). The virus-specific IgM directed against all three
structure proteins (N, Gn, Gc) are present during the early phase of the disease and at
decreasing levels during convalescence (Lundkvist et al., 1993). ELISA test based on
recombinant N protein to detect hantavirus specific IgM is the most commonly used
technique in diagnostics (Kallio-Kokko et al., 1998; Sjolander et al., 1997; Vapalahti
et al., 1996). For PUUV diagnosis, besides the traditional immunofluorescence assay,
a -capture enzyme immunoassay for IgM has been used routinely, and a
point-of-care test for acute PUUV has been developed based on IgM detection
(Hujakka et al., 2001; Vapalahti et al., 1996). IgG is the major class of circulating
antibodies, and N proteins are the major target antigens followed by Gn and Gc
(Kallio-Kokko et al., 2001; Vapalahti et al., 1995).
Different hantaviruses have different epitope patterns, the cross-reactive epitope
of HFRS virus N proteins was located within the first 118 amino acid N-terminal
residues and the serotype-specific epitopes were located in the middle of the protein
(Gott et al., 1997; Yoshimatsu et al., 1996). The Gn and Gc proteins also contain
epitope regions, e.g. in SNV there is a serotype-specific epitope located at 59-89 aa
from N termninus (Jenison et al., 1994). Both PUUV Gn and Gc contain at least one
neutralizing epitope unique for PUUV (Lundkvist and Niklasson, 1992).
![Page 29: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/29.jpg)
29
4.6.2.2 Cellular immune response
T lymphocytes together with natural killer cells, dendritic cells and macrophages
can produce various cytokines or directly act on the pathogens. T lymphocytes play an
important role in the pathogeneses of HFRS and HCPS. Upon hantavirus infection,
the levels of IFN-, TNF-, IL-2 and IL-6 are increased, the amount of CD8+ cells is
also increased, and a reversed CD4+/CD8
+ ratio was detected (Linderholm et al.,
1996). Also higher frequencies of SNV-specific T cells were found in patients with
severe HCPS (Maes et al., 2004) which indicates that a higher amount of CD8+
correlated with more severe symptoms of the disease. Interestingly, human CD8+ T
cells are generated during the acute phase of PUUV-HFRS, and these memory C8+
cells persist for 15 years after the acute phase without virus persistence (Tuuminen et
al., 2007; Van Epps et al., 2002). These reports suggest that immunopathogenesis may
have a role in the clinical syndrome caused by hantavirus infection. The natural killer
(NK) cells also take part in the innate and adaptive immunity. After hantavirus
infection changes in NK cells population were observed according to several reports,
but the results are controversial. Significantly higher numbers of NK cells were
observed in NE and HCPS patients (Linderholm et al., 1993; Nolte et al., 1995),
whereas another group found no changes or decreased numbers (Lewis et al., 1991).
Most recently it was reported that the NK cells expanded rapidly and remained at
significantly elevated numbers for over two months (Bjorkstrom et al., 2011).
Dendritic cells are the most important antigen-presenting cells. These cells can be
infected by hantaviruses and the infection can upregulate the MHC (HLA),
costimulatory and adhesion molecules (Raftery et al., 2002). HLA is expressed as a
cell-surface antigen presenting protein, and is composed of two classes. HLA I is
expressed in most cells and presents peptides from inside cells, thus directing CD8
cells to destroy the presenting cell. HLA II is expressed only by antigen-presenting
cells and can attract CD4 cells. Several groups reported the association of HLA with
susceptibility to hantavirus infection. HLA-B*3501 and B8-DRB1*03 were
associated with severe symptoms of HCPS and NE while HLA-B27 was linked to
![Page 30: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/30.jpg)
30
mild course of PUUV infection (Kilpatrick et al., 2004; Makela et al., 2002;
Mustonen et al., 1996; Mustonen et al., 1998). Like the B cell epitopes, the N protein
is the major viral target antigen for T cells, but Gn and Gc also have epitope regions
recognized by T- cells.
![Page 31: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/31.jpg)
31
5 Aims of the study
Hantaviruses have four structural proteins Gn, Gc, L and N. Each protein has its
unique functions during virus replication. Our aim was to study the functions of Gn
protein from different aspects, synthesis and degradation (I), interaction with N
protein (II), and role in innate immunity (IV). In addition, we were interested in how
the hantavirus activate IFN innate immunity.(III). The specific aims of each study
were:
I To study the degradation and aggresome formation of Gn protein.
II To study the interaction between hantavirus Gn protein and N protein.
III and IV To study the mechanisms of IFN immune response induction and evasion
by Old World hantaviruses
![Page 32: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/32.jpg)
32
6 Materials and Methods
Cell cultures and reagents (I - IV)
Human embryonic kidney cells (HEK-293), African green monkey kidney
epithelial cells (Vero E6) and human lung adenocarcinoma epithelial cells (A549)
were maintained in modified Eagle's medium (MEM). 10% fetal bovine serum, 2 mM
glutamine, 100 IU penicillin/ml and 100 µg streptomycin/ml were added into the
medium. All cultures were grown at 37℃ in a humidified atmosphere containing 5%
CO2.
Virus infection and purification (III)
Different viruses have been used including PUUV, TULV, DOBV, SEOV,
SAAV and Semliki forest virus (SFV). All handling of live virus was performed in a
laboratory of biosafety level 3 or 2. For infection, desired amounts of viruses were
added to cell monolayers for absorption for 1 hour at 37℃, virus inocula were then
removed and replaced with complete medium.
For virus purification, growth medium collected 7-14 days after infection was
cleared through a 0.22-m pore-size filter (Millipore), and virus particles were
concentrated by pelleting through a 3-ml 30% (wt/vol) sucrose cushion (Beckman
SW28 rotor; 27,000 rpm for 2 h at 4°C) in 10 mM HEPES, 100 mM NaCl, pH 7.4
buffer.
Plasmid constructions and transfections (I, II, IV)
By using different programs (HMMTOP, TMHMM, SOSUI AND TMPRED)
(Hirokawa et al., 1998; Hofmann and Stoffel, 1993; Krogh et al., 2001; Tusnady and
Simon, 2001), the region of Gn-CT was chosen (aa residues 521 to 653). TULV,
PUUV and PHV Gn-CT were fused in-frame with enhanced GFP (eGFP) in the
peGFP-C1 (Clontech) vector. The TULV Gn-CT was also fused with pCMV-HA
![Page 33: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/33.jpg)
33
(Clontech). The TULV Gn-CT proteins, lacking 21 or 34 residues from the C
terminus, were fused to eGFP in the peGFP-C1 vector. The expression plasmids for
GST-tagged TULV Gn-CT and truncated TULV Gn-CT were constructed by inserting
PCR fragments into the pGEX-4T-3 vector (GE Healthcare). The N protein of TULV
was cloned into pcDNA3 (Invitrogen) plasmid and pCMV-HA plasmid. Point
mutations were introduced into pGEX-4T-3-CT and pcDNA3-TULV-N plasmids
using a site-directed mutagenesis kit (Stratagene) according to the manufacturer's
instructions. Lipofectamine 2000 (Invitrogen) and TranIT (Mirus) transfection reagent
were used to transfect vectors into cells according to the manufacturer's instructions.
Immunoblotting (I, II,IV)
Cells were collected and lysed in radioimmunoprecipitation buffer (150 mM
sodium chloride, 50 µM Tris/HCl pH 7.5, 0.2% SDS, 0.5% deoxycholate, 1% NP-40).
Ten micrograms of total protein from each sample were run on 12% SDS-PAGE and
electroblotted on to a nitrocellulose membrane. Proteins were probed with a primary
antibody followed by three washes with TENT buffer (0.05% Tween 20; 20 mM
Tris-HCl; pH 8, 1 mM EDTA; 50 mM NaCl). Then the secondary antibody was used
to blot the proteins. After three washes with TENT buffer the proteins were detected
by enhanced chemiluminescence.
Immunofluorescence and confocal microscopy analysis (I, III)
Cells were grown on coverslips in 24-well plates and transfected with different
constructs. Later, the cells were washed and fixed with 3.5% paraformaldehyde in
PBS for 20 min at room temperature, permeabilized and blocked with 3% BSA and
0.1% Triton X-100 in PBS. The cells were stained with primary antibody for one hour,
then washed three times with PBS, stained with fluorescein-conjugated secondary
antibodies, and observed under a fluorescence or confocal microscope (Leica SP2).
Antibodies and reagents (I, II, III)
![Page 34: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/34.jpg)
34
Primary antibodies: Anti-green fluorescent protein (GFP) (Sigma); anti-β-actin
primary antibody (Sigma); anti-hemagglutinin (HA) (Abcam); mouse anti-vimentin;
mouse anti--tubulin (from Erkki Hölttä, University of Helsinki); TULV N specific
monoclonal antibodies (MAb) 1C12 (from Ake Lundkvist, Stockholm); anti-FLAG
antibodies (Sigma); mouse monoclonal antibody J2 (Scicons); patient serum against
PUUV (local); antibody against SFV (anti-SFV) (from Ari Hinkkanen, University of
Kuopio).
Secondary antibodies: anti-mouse IgG red-fluorescent Alexa Fluor 555
(Invitrogen); anti-mouse HRP (DAKO); anti-mouse Dylight680 conjugate (Pierce
Biotechnology); FITC-labeled anti-human IgG (DAKO); FITC-labeled anti-rabbit
IgG (DAKO).
Reagents: proteasomal inhibitors MG-132, ALLN, lactacystin and protein
synthesis inhibitor cycloheximide (CHX) (Sigma); Sepharose 4B glutathione beads
(GE Healthcare); calf intestinal alkaline phosphatase (CIP) (Finzyme);
5'-phosphate-dependent exonuclease (Epicentre Biotechnologies).
Flow cytometry protocol (I).
Cells were transfected with eGFP-TULV-Gn-CT and treated overnight with 25
µM ALLN. Cells were collected, fixed with 3% paraformaldehyde (PFA) and washed
with PBS. The percentage of GFP-positive cells after various treatments was
calculated using flow cytometry (The Flow Cytometry Facility, Haartman Institute,
University of Helsinki).
GST pull-down assay (II)
E. coli (BL21) transformed with GST-tagged Gn-CT constructs were grown in
300 ml of LB medium containing 0.1 mg/ml ampicillin. When the value of A600
reached 0.6, the bacteria were induced with 1 mM
isopropyl--D-1-thiogalactopyranoside (IPTG) for 5 h and then harvested by
centrifugation at 7000 × g for 10 min and resuspended in lysis buffer (10 mM Tris pH
![Page 35: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/35.jpg)
35
8.0, 150 mM NaCl, 50 mg/ml lysozyme, with or without 1 mM EDTA). After addition
of 5 mM dithiothreitol and 1.5% N-lauroylsarcosine, cells were sonicated briefly and
lysates were cleared by centrifugation at 10,000 × g for 5 min at 4°C. Supernatant was
adjusted to 2% Triton X-100, incubated at 4°C for 1 h and bound to Sepharose 4B
glutathione beads (GE Healthcare). Beads were washed three times for 10 min with
cold STE buffer (10 mM Tris pH 8.0, 150 mM NaCl with or without 1 mM EDTA).
Precleaned HEK 293-cell lysates which express the N protein were incubated
with slurry of GST-bound Sepharose 4B glutathione beads overnight at 4°C with
end-over-end mixing and the beads were washed five times with 1 ml of ice-cold ST
buffer (10 mM Tris pH 8.0, 150 mM NaCl). Supernatants and beads were then mixed
with SDS-PAGE gel-loading buffer, boiled and analyzed by SDS-PAGE followed by
immunoblotting.
RT-PCR (III)
Primer Nucleotide sequence Target gene, and
expected size (bp)
SEOMF1936 GTGGACTCTTCTTCTCATTATTG SEOV, M gene, 417
SEOMR2353 TGGGCAATCTGGGGGGTTGCA
DOBV/SAAVMM1674F TGTGAI(A/G)TITGIAAITAIGAGTGTGA DOBV, SAAV, M
gene, 316
DOBV/SAAVMM1990R TCIG(A/C)TGCI(G/C)TIGCIGCCCA
PUUVSF532 TCATTTGA(A/G)GA(G/T)ATCAATGGCAT PUUV, S gene, 665
PUUVSR1197 CCCATTCCAACATAAACAGTAGG
TULVSF894 GATTGATGACTTGATTGATCTTGC TULV, S gene, 473
TULVSR1367 ATGTGTRTGTGTGTATGCAGGAAC
FLUMF25 AGATGAGTCTTCTAACCGAGGTCG Influenza A, M gene,
349
FLUMR324 TGCAAAAACATCTTCAAGTCTCTG
Table 1. Primers used RT-PCR.
![Page 36: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/36.jpg)
36
Reverse transcription was performed with 1 l RevertAid M-MuLV Reverse
Transcriptase (Fermentas) and 0.5 g random hexanucleotides in 20 l reaction
mixture include 0.5 l RNase inhibitor and 1mM dNTP. The resulting cDNA was
amplified by 30 cycles of PCR, with each cycle consisting of 1 min at 95℃, 1 min at
50℃, and 1 min at 72℃, followed by a final step for 10 min at 72℃.
Reporter gene assay (III, IV)
Subconfluent HEK-293 cell monolayers grown in 24-well dishes were transfected
with 0.15 g of IFN-promoter luciferase reporter construct (p125-Luc) and 0.5 ng
of constitutively active Renilla luciferase expression vector (pRL-SV40) in 50 l
OptiMEM (Gibco-BRL) using 3 l Lipofectamine 2000 (Invitrogen) per g DNA.
After 6 h at 37°C, cells were transfected either with 0.5 g of viral RNA or with 0.5 of
g poly I:C using 3 l Lipofectamine 2000 (Invitrogen) per g RNA prepared in 50 l
OptiMEM. At 18 h post transfection, the luciferase activities were determined using
the Dual-Luciferase Reporter Assay System (Promega) and multilabel reader (Wallac).
(III)
HEK-293 cells (20,000 cells/well) were seeded in 96-well plate and were
cotransfected on the following day with p125-Luc60 ng), pRL-SV40 (60 ng),
indicated amount of viral protein expression vectors and also 60 ng of expression
construct which can activate innate immune pathway including TBK-1 construct,
RIG-I construct, MyD88 and IRF-7 constructs, TRIF construct, IKK and IRF-3
constructs (from Illka Julkunen, KTL). The transfection was done following the
manufacturer's instructions of TransIT tranfection reagent (Mirus). The total amount
of plasmid transfected was kept constant by using empty vector (peGFP-C1 or
pCMV-HA). At 24 hours posttransfection luciferase activities were determined using
the Dual-Luciferase Reporter Assay System (Promega) and multilabel reader (Wallac).
(IV)
![Page 37: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/37.jpg)
37
7 Results
7.1 Fate of Gn-CT of the apathogenic Tula hantavirus and its role in virus
assembly
7.1.1 Degradation and aggresome formation of Gn-CT (I)
The Gn-CT of TULV is proteasomally degraded
To determine whether the Gn-CT of TULV is proteasomally degraded, TULV
Gn-CT (residues 521 to 653) was fused to the C-terminus of enhanced green
fluorescent protein (eGFP). HEK-293 cells, transfected with this construct, were
treated with proteasome inhibitors (ALLN, lactacystin, MG-132) separately.
Proteasome inhibition is known to stabilize proteins that are destined for degradation
by the proteasome (Coux et al., 1996). The expression level of eGFP-TULV-Gn-CT
was nearly undetectable when the cells were treated with DMSO, but increased after
treatment with proteasomal inhibitors (I, Fig. 2A).
To define whether the TULV Gn-CT colocalizes with ubiquitin which is known to
be associated with degrading proteins, eGFP-TULV-Gn-CT and hemagglutinin
(HA)-tagged ubiquitin were cotranfected into HEK-293 cells. Twenty-four hours later
the cells were treated with DMSO or proteasome inhibitor ALLN overnight. Ubiquitin
was detected by staining with anti-HA antibody. Confocal microscopy was used to
study the colocalizaton of the these two proteins. Colocalizaton was observed when
the cells were treated with the proteasomal inhibitor, while partial colocalization was
seen when they were DMSO treated (I, Fig. 2B).
To check whether the degradation signal resides within the C-terminus of TULV
Gn-CT, TULV Gn-CT protein lacking 21 or 34 residues from the C-terminus were
fused to eGFP. HEK-293 cells were transfected with these constructs or the full-length
eGFP-Gn-CT. 24 hours after transfection, the cells were treated either with 25M
ALLN or DMSO overnight. The deletion of 21 or 34 residues from the C-terminus
![Page 38: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/38.jpg)
38
completely stabilized the protein expression (I, Fig. 2C).
These results suggest that the Gn-CT of TULV is directed to degradation through
the ubiquitin-proteasome pathway and that the C-terminal 21 residues of TULV
Gn-CT are required for the proteasomal degradation.
The Gn-CT of other apathogenic and pathogenic hantaviruses is degraded by
proteasomes
HEK-293 cells were transfected with eGFP-PHV Gn-CT and eGFP-PUUV
Gn-CT, and treated with MG132 or ALLN separately as described above.
Unexpectedly, the PHV hantavirus Gn-CT was also degraded (I, Fig. 3), which
contradicts a previous reports (Sen et al., 2007) while the PUUV Gn-CT was
degraded, as expected (I, Fig. 3).
Furthermore, another cell line was used to test the degradation property of TULV,
PHV and PUUV Gn-CT. Vero E6 cells were transfected with eGFP-TULV-Gn-CT,
eGFP-PHV-Gn-CT and eGFP-PUUV Gn-CT, and the cells treated with DMSO, CHX,
MG132, or MG132+CHX. Similarly, the Gn-CT of PHV, TULV and PUUV were
degraded in VeroE6 cells and the tail protein level was maintained by continuous
synthesis and rapid degradation (I, Fig. 4).
In addition, we compared the results from the two different cells described above
by performing FACS assay. Vero E6 and HEK-293 cells transfected with eGFP-TULV
Gn-CT and were treated overnight with 25 M ALLN. The percentage of
GFP-positive cells calculated using flow cytometry further confirmed our previous
result that the Gn-CT of TULV was not degraded when treated with proteasome
inhibitors (I, Fig. 5).
TULV Gn-CT forms aggresomes upon treatment with proteasomal inhibitor
fter treatment with proteasomal inhibitor, we found that TULV Gn-CT formed
aggresome-like structure. Further, we found that the TULV Gn-CT protein colocalized
with -tubulin, an microtubule-organising centre (MTOC) marker, after treatment with
ALLN (I, Fig. 6A). Since aggresome formation is dependent on transport along
![Page 39: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/39.jpg)
39
microtubules, nocodazole can inhibit the formation of aggresomes leading to the
dispersion of aggregates throughout the cytoplasm. HEK-293 cells transfected with
eGFP-Gn-CT were treated overnight with DMSO, 25 M MG-132 and/or 1g/ml
nocodazole (NOC). Cells were observed under a fluorescence microscope. The
treatment of transfected HEK-293 cells with nocodazole together with MG-132
prevented the formation of MG-132-induced accumulation of TULV Gn-CT protein
into aggresomes and instead induced the dispersion of these structures diffusely to the
cytoplasm (I, Fig. 6B). The percentage of large aggresome-containing cells in
nocodazole and MG-132 treated samples was lower than in cells treated only with
MG-132 (I, Fig. 6C). These results showed that, when overexpressed, TULV Gn-CT
translocated to the aggresomes formed.
7.1.2 Interaction between Gn tail and N protein (II)
First, the interaction between Gn-CT and N protein was studied. The Gn-CT was
expressed as a GST-fusion protein in E. coli and bound to glutathione beads (II, Fig. 2 A).
The N protein was expressed in HEK-293 cells (II, Fig. 2 B). To establish the GST
pull-down assay, we observed the pull-down of N protein with the Gn-CT in different
dilutions of the initial N protein-fractioning lysate (II, Fig.3). Notably, the treatment of
the N protein-containing lysates with RNase (that left no cellular RNA of any substantial
length intact) did not influence the efficiency of pull-down assay (II, Fig. 4 A, 4 B). This
suggested that, to interact with the Gn-CT in these experimental settings, the N protein
does not need to be a part of long RNP structures formed via nonspecific encapsidation of
cellular RNA.
Analysis of the Gn-CT/N interaction: cytoplasmic tail of the Gn protein
We analyzed the two structure-functional elements within the Gn-CT: zinc finger
motifs and ITAM motifs. As known, EDTA can chelate Zn2+
cations thus disrupting the
structure of zinc fingers. The standard buffer used in experiments described in II, Fig. 3
![Page 40: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/40.jpg)
40
contained 1 mM EDTA. Therefore, in subsequent experiments EDTA was omitted from
all buffers and the beads with attached Gn-CT were treated with 100 M ZnSO4. We
found that the amount of pulled-down N protein in ZnSO4-treated samples was
substantially higher than in EDTA-treated samples thus suggesting that the concentration
of Zn2+
cations is important for the Gn-CT/N interaction (II, Fig. 5 A).
Next, zing finger motifs were destroyed by point mutations, and the resulting
constructs were analyzed in the modified pull-down assay (EDTA omitted and the
Gn-CT-beads treated with ZnSO4). The results showed that both zinc fingers should stay
intact for successful pull-down (II, Fig. 5 B). Introduction of H->Q and C->S mutations
in two HxxxC motifs (H566Q,C570S); (H592Q,C596S) totally abolished the Gn-CT/N
interaction, and the double hit (C575S,C578S,H592Q,C596S) abolished the interaction as
well.
Two deletion mutants were made to partially/totally destroy the conserved ITAM
motifs in the Gn-CT. In one of the mutants 21 C-terminal aa residues, which included the
second YxxL-sequence, were deleted. In another mutant, GST-CTΔ34, both ITAMs were
deleted. Both mutants with deletions retained the capability to pull-down the N protein
(Fig. 5 C). Taken together, these results indicated that zinc finger motfs but not ITAM
motifs are crucial for its interaction with the N protein.
Analysis of the Gn-CT/N interaction: the N protein
The N-terminal domain (aa 1-79) and C-terminal domain (aa 370- 429) of hantaviral
N protein are involved in oligomerization. The central part of the N protein is thought to
carry the RNA-binding domain (Fig 1). To find out which domain in the N protein is
involved in the interactions with the Gn-CT, several N protein mutants were tested in the
pull-down assay (II, Fig. 1 B). First, several mutations and deletions were made to
evaluate the role of the C-terminus of N protein in the Gn interaction (NΔC25 (N1-404),
NΔC31 (N1-398), NΔC100 (N1-329), and two point mutants, I380A,I381A and W388A).
None of the deletions and mutations affected the ability of the N protein to be
pulled-down (II, Fig. 6 A; only some of the results are shown).
Another three deletions were made to evaluate the possible contribution of the
![Page 41: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/41.jpg)
41
N-terminal and central N protein domains; three more constructs were created (N(D1),
N(D2), N(D1D2)) (II, Fig. 2 B). Of these three proteins, only D1 (aa 1-79) could not be
pulled-down (II, Fig. 6 B).
These results showed that the D2 (aa 80-248) domain which is the central domain of
N protein is both critical and sufficient for the interaction with Gn-CT.
7.2 Regulation of interferon response by Old World hantaviruses
7.2.1 Viral dsRNA production and genomic RNA of hantavirus (III)
There are no detectable amounts of dsRNA in cells infected with hantaviruses
The presence of dsRNA in hantavirus-infected Vero E6 cells was detected by
dsRNA-specific mouse monoclocal antibody J2. Cells infected with different
hantaviruses (SEOV, DOBV, SAAV, PUUV, TULV) or Semliki forest virus (SFV)
were stained with J2 antibody and virus specific antibody. Strong dsRNA signals were
observed in the cells transfected with poly I:C and also in the cells infected with SFV.
In contrast no dsRNA was detected after SEOV, DOBV, SAAV, PUUV or TULV
infection (III, Fig. 1). Meanwhile, all these viruses replicated efficiently as shown by
the expression of viral protein. Thus, hantavirus-infected cells did not produce any
detectable amounts of dsRNA.
Hantavirus genomic RNAs contain 5'monophosphate and can not activate
RIG-I-dependent IFN- induction
SEOV, DOBV, SAAV, PUUV and TULV viruses were purified and their viral
genomic RNAs were isolated. The viral RNAs were incubated with exonuclease for
four hours or were mock treated. This 5'-3'-exonuclease specifically digests ssRNA
bearing 5'-monophosphate. RT-PCR was performed to detect viral RNAs with and
without exonuclease treatment. We found that the genomic RNA of influenza A virus
could still be detected after digestion while the genomic RNAs of SEOV, DOBV,
SAAV, PUUV and TULV were degraded which suggested that the 5’-termini of all
![Page 42: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/42.jpg)
42
hantaviruses tested are 5’-monophosphorylated (III, Fig. 2).
The IFN-promoter reporter gene assay was also used in the experiments. The
transfection of genomic RNAs of SEOV, DOBV, SAAV, PUUV and TULV did not
cause any IFN-induction (III, Fig. 3).
7.2.2 Hantavirus Gn-CT inhibits the activation of IFN- immune response (IV)
TULV Gn-CT but not N protein inhibits TBK-1-directed IFN activation.
HEK-293 cells grown in 96-well plates were cotransfected with constitutively
active TBK-1 construct and IFN- promoter reporter construct. Cotransfection with
pCMV-N expressing HA-tagged N protein had no effect on TBK-1 directed
IFN-transcriptional activation, while the expression of GFP tagged Gn-CT inhibited
IFN-transcription and increasing amounts of Gn-CT protein resulted in decrease in
IFN-transcription (IV, Fig. 1). These results indicate that the TULV Gn-CT but not
the N protein can inhibit the TBK-1 directed IFN-activation. In addition, the Gn-CT
fused with different tags was tested. Cotransfecting cells with constitutively active
TBK-1, RIG-I construct and pCMV-CT resulted in a decrease in TBK-1 and RIG-I
directed IFN-activation (IV, Fig. 2 A and 2 B)
TULV Gn-CT can inhibit TRIF-, MyD88/IRF-7- and IKK-directed IFN activation but
not IRF-3-directed IFN activation
The PRRs are comprised of two main groups: the Toll-like receptors (TLRs) and
retinoic acid-inducible gene I-like RNA helicases (RLHs). The above results showed
that the RLH pathway was inhibited by Gn-CT. Most TLRs recruit MyD88 to transmit
the immunity response while TLR3 signaling is through the recruitment of TRIF. To
investigate whether Gn-CT is involved in the inhibition of the TLR pathways,
MyD88/IRF-7 expression construct or TRIF construct were cotransfected with
pCMV-CT. As shown (IV, Fig. 3a and 3b), the expression of pCMV-CT inhibited IFN
activation in a dose dependent way. These results suggest that Gn-CT is not only
![Page 43: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/43.jpg)
43
involved in the inhibition of RLH pathway but also TLR pathway.
To further identify the downstream target of Gn-CT, we used constitutively active
IKKand IRF-3 constructs. IKKtogether with TBK-1 are two kinases that have
been demonstrated to directly phosphorylate and activate IRF-3 and IRF-7. As shown
(IV, Fig. 3c and 3d), Gn-CT inhibited the IKKdirected but not IRF-3 directed IFN
activation. Taken together, these results suggest that TULV Gn-CT inhibit IFN
transcriptional activation upstream of IRF-3 phosphorylation and at the level of
TBK-1/IKK and MyD88/IRF-7 complex.
![Page 44: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/44.jpg)
44
8 Discussion
8.1 Analysis of the Gn protein sequence alignment and the selection of Gn-CT
region
Based on the sequence analysis of hantavirus Gn protein (Fig 2), the region 521-653
aa was selected as the Gn-CT and used in projects I, II, IV. As shown in Fig 2, the pairs
TULV/ PUUV, SNV/ANDV, and HTNV/SEOV represented three major groups of
hantaviruses associated, respectively, with Cricetid/Arvicoline,
Cricetid/Neotomine-Sigmodontine, and Murid/Murine rodents. Gn-CT protein is highly
conserved among different hantaviruses with >40% sequence conservation, and most of
the aa residues important for maintaining the 3D structure such as cysteines, bulk
aromatic, hydrophobic and charged residues, as well as glycines and prolines are identical
in all hantavirus sequences. The two zinc finger motifs are conserved in all hantaviruses
while the ITAM is conserved in Tula and Sin Nombre- and Andes-like viruses. Such a
conservation suggests a similar mode of folding, and hence similar or even identical
function, of the Gn-CT in different hantavirus species.
8.2 Degradation and aggresome formation of Gn-CT may be a general property
of most hantaviruses
As described in the results section, we observed degradation of TULV and PHV
Gn-CT both in human HEK-293 and simian Vero E6 cells and the hantavirus Gn-CT
had a tendency to self-associate into large protein aggregates. It was reported that
when SNV Gn full-length protein expressed in the absence of Gc it has the tendency
to form SDS-stable oligomers (Spiropoulou et al., 2003). Such multimers could also
be seen in immunoprecipitation experiments of the HTNV Gn (Antic et al., 1992;
![Page 45: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/45.jpg)
45
Hooper et al., 2001; Pensiero and Hay, 1992), and the SNV Gn protein was found in
aggresomes when overexpressed (Spiropoulou et al., 2003). Taken together the results
and other reports, however, suggest that the degradation and aggregation of the
envelope protein Gn may be a general property of most hantaviruses and is unrelated
to pathogenicity.
8.3 The role of ITAM and zinc finger motifs in the interaction of N and Gn-CT
We found that the ITAM motifs carried by Gn-CT can be removed without
affecting the capability of the tail to interact with N (II). In contrast, zinc fingers
appeared to be crucial for the interaction. The mutations of either of the two zinc
fingers totally abolished the Gn-CT/N interaction. These results supported the idea
that, unlike other type zinc fingers forming a "beads-on-a-string" configuration, the
hantavirus Gn-CT zinc fingers fold into unique, compact stucture (Estrada et al.,
2009). The data on the modeling of Gn-CT (II, Fig. 6) also supported this notion: two
quartets of Zn-coordinating aa residues are located in close proximity. The tight fold
of the whole zinc finger domain could explain the results of experiments with EDTA
treatment (II, Fig. 4) in which the interacting capability of the Gn-CT was not totally
abolished; it seemed that a portion of Zn2+
cations remained in contact with cysteine
and histidine residues thus helping to maintain correct folding of at least some Gn-CT
molecules.
8.4 The role of hantavirus RNA in the induction of innate immunity
As shown in results section, we found that Old World hantaviruses do not
produce detectable amounts of dsRNA in infected cells and the 5’-termini of their
genomic RNAs are monophosphorylated. These results suggest that the hantavirus
RNA may be only minimally involved in the induction of innate immunity. In
accordance with this presumption, UV-inactivated Sin Nombre virus can activate the
![Page 46: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/46.jpg)
46
innate immunity response at early time points post infection in HUVEC cells
considering that the UV irradiation could dramatically destroy the integrity of RNA
(Prescott et al., 2010; Prescott et al., 2005). However, there are also several
contradictory reports: UV-inactivated PHV, ANDV and HTNV viruses were reported
to be unable to induce the innate immunity; and the TLR3 was needed for HTNV to
trigger IFN innate immunity induction (Handke et al., 2009; Spiropoulou et al., 2007).
In addition, we can not exclude the possibility that the amounts of dsRNA produced
by hantaviruses are below our detection limit since one molecule of dsRNA per cell
can activate IFN production (Marcus and Sekellick, 1977). Therefore, whether
hantavirus RNAs are actually involved in the innate immunity induction needs further
characterization.
8.5 The role of Gn-CT of TULV in inhibition of innate immunity
Hantavirus Gn are reported to be involved in the inhibition of both
IFN-induction and signaling. Gn-CT of NY-1V was found to coprecipitate the
N-terminal domain of TRAF3 and disrupt the formation of TRAF3-TBK1 complex,
thus regulating the RIG-I and TBK-1 directed immune response (Alff et al., 2006;
Alff et al., 2008). The Gn of both ANDV and PHV were shown to inhibit nuclear
translocation of STAT-1 (Spiropoulou et al., 2007). Most recently, it was reported that
IFN-β induction is inhibited of coexpression of ANDV N protein and GPC and is
robustly inhibited by SNV GPC alone. Downstream amplification by Jak/STAT
signaling is also inhibited by SNV GPC and by either NP or GPC of ANDV (Levine
et al., 2010). In addition, it has been reported that the TLR3 and TLR4 are involved in
the HTNV-induced innate immunity, but the mechanism remains unknown (Handke et
al., 2009; Jiang et al., 2008). TLRs mediate the signal transduction through two
possible ways, Myd88 and TRIF. TLR4 operates both through the MyD88 and TRIF
pathways, TLR3 signals through TRIF and all the other TLRs mediate through the
MyD88 pathway (Amati et al., 2006; Foster et al., 2007; O'Neill, 2006; Pandey and
![Page 47: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/47.jpg)
47
Agrawal, 2006) (Fig. 3). TRIF and RLH pathways converge on the formation of
TBK1/IKKϵ complex thus catalyzing the phosphorylation of IRF-3 and IRF-7.
MyD88 activates IFN through another pathway: it interacts directly with IRF-7 to
activate the signaling pathway (Fig 3). Cotransfection of expression plasmids for
MyD88 and IRF-7 together with the IFN- promoter-driven reporter gene would
strongly induced the reporter gene. In our study these two major pathways,
TBK1/IKK and MyD88/IRF-7, were assessed. We found that TULV Gn-CT can
inhibit the signaling transduction through these two major pathways.
![Page 48: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/48.jpg)
48
9 Concluding remarks
Recently the hantavirus Gn protein has been studied extansively by several groups,
but still many questions remain unknown. Our study on Gn protein included different
aspects, synthesis and degradation (I), interaction with N protein (II), and role in innate
immunity (IV). Also we carried out a project to study how the hantavirus induces innate
immunity (III).
In this thesis, we first found the Gn-CT of the apathogenic hantaviruses (TULV,
PHV) are degraded through the ubiquitin-proteasome pathway both in human
HEK-293 and simian Vero E6 cells and TULV Gn-CT formed aggresome upon
treatment of proteasomal inhibitors. Second, we found that the TULV Gn-CT fused
with GST tag expressed in bacteria could pull-down the N protein expressed in
mammalian cells and that the zinc finger motifs in Gn-CT and RNA binding motif in N
protein are indispensable for the interaction. Third, we found that Old World
hantaviruses do not produce detectable amounts of dsRNA in infected cells and the
5’-termini of their genomic RNAs are monophosphorylated. The hantavirus RNA may
be only minimally involved in the induction of innate immunity. Finally, we found
that the Gn-CT of TULV inhibits the IFN transcriptional activation through TLR and
RLH pathway and that the inhibition target lies at the level of TBK-1/IKK complex
and MyD88/IRF-7 complex.
![Page 49: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/49.jpg)
49
10 Future prospects
As the mechanism hantaviruses use to activate innate immunity remains unknown, in
the future studies, this should be investigated in more detail. It has been reported recently
that short double-stranded RNA/DNA without tri-ppp can activate the RIG-I response,
thus whether the panhandle structure of hantavirus genomic RNA may activate the innate
immunity is an open question and needs to be studied later. In addition, the viral transcript
(mRNA) has been reported to be able to activate innate immunity after RNase L digestion
(Luthra et al., 2011). Does the hantavirus mRNA also have a similar effect? This also
should be investigated in more detail. Furthermore, currently there are no unified
conclusions on the inhibitory effect of different hantavirus glycoproteins. Is the inhibitory
effect related to the pathogenesis? How is the difference generated? Studies comparing all
the known hantavirus glycoproteins should be carried out to create a comprehensive
picture.
![Page 50: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/50.jpg)
50
11 Acknowledgements
The work was carried out in the Department of Virology, Haartman Institute,
University of Helsinki. I would like to thank the head of Haartman Institute, Professor
Seppo Meri for your most kind support and the head of Department of Virology
Professor Kalle Saksela for providing an excellent environment for research. I thank
Docent Tero Ahola and Docent Sampsa Matikainen for reviewing the manuscript of
this thesis and providing valuable comments to improve it.
I thank my supervisor Professor Antti Vaheri for his great support. You recruited
me to your research team five years ago, and during these five years, your wealth of
knowledge, your constant support, your sense of humor, your generosity, your
immense patience guide me through. I really appreciated that. I thank docent
Alexander Plyusnin, you helped me when the most difficult time. There is a Chinese
proverb: “Send coal in snowy weather”, thanks for your generous support. I thank
docent Hilkka Lankinen for your constant support, critical comments and valuable
suggestions. I thank for the collaborators: Maarit Sillanpää and Professor Ilkka
Julkunen for your valuable contributions. I thank Professor Olli Vapalathi for the
discussion and suggestions.
I thank Tomas and Jussi H. We shared so much time together, did experiments,
discussed and had fun. Really appreciate your company through all these years. With
that wish both of you have a wonderful career and a sweet family.
I thank all my colleagues: Agne, Angelina, Anna, Anu, Jussi S, Pertteli, Lev, Kirsi,
Maria, Erika, Suvi, Satu, Tarja…..
I thank all my Chinese friends, especially Miao Yin. You are the first Chinese I met
in Helsinki, and I have to say that you are just like my brother although actually I don’t
have one. Wish you good luck for everything. And all my Chinese friends. Sorry I can not
list you all. Thank you all, my friends.
I would like to thank my parents, I finally realize your love after all these years living
in another country.
![Page 51: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/51.jpg)
51
12 References
Alexeyev, O.A., Ahlm, C., Billheden, J., Settergren, B., Wadell, G. and Juto, P. (1994) Elevated levels of
total and Puumala virus-specific immunoglobulin E in the Scandinavian type of hemorrhagic
fever with renal syndrome. Clin Diagn Lab Immunol 1(3), 269-72.
Alfadhli, A., Steel, E., Finlay, L., Bachinger, H.P. and Barklis, E. (2002) Hantavirus nucleocapsid protein
coiled-coil domains. J Biol Chem 277(30), 27103-8.
Alff, P.J., Gavrilovskaya, I.N., Gorbunova, E., Endriss, K., Chong, Y., Geimonen, E., Sen, N., Reich, N.C.
and Mackow, E.R. (2006) The pathogenic NY-1 hantavirus G1 cytoplasmic tail inhibits RIG-I-
and TBK-1-directed interferon responses. J Virol 80(19), 9676-86.
Alff, P.J., Sen, N., Gorbunova, E., Gavrilovskaya, I.N. and Mackow, E.R. (2008) The NY-1 hantavirus Gn
cytoplasmic tail coprecipitates TRAF3 and inhibits cellular interferon responses by disrupting
TBK1-TRAF3 complex formation. J Virol 82(18), 9115-22.
Alminaite, A., Halttunen, V., Kumar, V., Vaheri, A., Holm, L. and Plyusnin, A. (2006) Oligomerization of
hantavirus nucleocapsid protein: analysis of the N-terminal coiled-coil domain. J Virol 80(18),
9073-81.
Amati, L., Pepe, M., Passeri, M.E., Mastronardi, M.L., Jirillo, E. and Covelli, V. (2006) Toll-like receptor
signaling mechanisms involved in dendritic cell activation: potential therapeutic control of T
cell polarization. Curr Pharm Des 12(32), 4247-54.
Andrejeva, J., Childs, K.S., Young, D.F., Carlos, T.S., Stock, N., Goodbourn, S. and Randall, R.E. (2004)
The V proteins of paramyxoviruses bind the IFN-inducible RNA helicase, mda-5, and inhibit its
activation of the IFN-beta promoter. Proc Natl Acad Sci U S A 101(49), 17264-9.
Antic, D., Wright, K.E. and Kang, C.Y. (1992) Maturation of Hantaan virus glycoproteins G1 and G2.
Virology 189(1), 324-8.
Avsic-Zupanc, T., Xiao, S.Y., Stojanovic, R., Gligic, A., van der Groen, G. and LeDuc, J.W. (1992)
Characterization of Dobrava virus: a Hantavirus from Slovenia, Yugoslavia. J Med Virol 38(2),
132-7.
Bjorkstrom, N.K., Lindgren, T., Stoltz, M., Fauriat, C., Braun, M., Evander, M., Michaelsson, J.,
Malmberg, K.J., Klingstrom, J., Ahlm, C. and Ljunggren, H.G. (2011) Rapid expansion and
long-term persistence of elevated NK cell numbers in humans infected with hantavirus. J Exp
Med 208(1), 13-21.
Braam, J., Ulmanen, I. and Krug, R.M. (1983) Molecular model of a eucaryotic transcription complex:
functions and movements of influenza P proteins during capped RNA-primed transcription.
Cell 34(2), 609-18.
Brummer-Korvenkontio, M., Henttonen, H. and Vaheri, A. (1982) Hemorrhagic fever with renal
syndrome in Finland: ecology and virology of nephropathia epidemica. Scand J Infect Dis
Suppl 36, 88-91.
Brummer-Korvenkontio, M., Vaheri, A., Hovi, T., von Bonsdorff, C.H., Vuorimies, J., Manni, T., Penttinen,
K., Oker-Blom, N. and Lahdevirta, J. (1980) Nephropathia epidemica: detection of antigen in
bank voles and serologic diagnosis of human infection. J Infect Dis 141(2), 131-4.
Cifuentes-Munoz, N., Barriga, G.P., Valenzuela, P.D. and Tischler, N.D. (2010) Aromatic and polar
![Page 52: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/52.jpg)
52
residues spanning the candidate fusion peptide of the andes virus Gc protein are essential for
membrane fusion and infection. J Gen Virol.
Coux, O., Tanaka, K. and Goldberg, A.L. (1996) Structure and functions of the 20S and 26S
proteasomes. Annu Rev Biochem 65, 801-47.
de Carvalho Nicacio, C., Sallberg, M., Hultgren, C. and Lundkvist, A. (2001) T-helper and humoral
responses to Puumala hantavirus nucleocapsid protein: identification of T-helper epitopes in
a mouse model. J Gen Virol 82(Pt 1), 129-38.
Dhar, R., Chanock, R.M. and Lai, C.J. (1980) Nonviral oligonucleotides at the 5' terminus of cytoplasmic
influenza viral mRNA deduced from cloned complete genomic sequences. Cell 21(2), 495-500.
Earle, D.P. (1954) Symposium on epidemic hemorrhagic fever. Am J Med 16, 617-709.
Elliott, L.H., Kiley, M.P. and McCormick, J.B. (1984) Hantaan virus: identification of virion proteins. J
Gen Virol 65 ( Pt 8), 1285-93.
Elwell, M.R., Ward, G.S., Tingpalapong, M. and LeDuc, J.W. (1985) Serologic evidence of Hantaan-like
virus in rodents and man in Thailand. Southeast Asian J Trop Med Public Health 16(3), 349-54.
Estrada, D.F., Boudreaux, D.M., Zhong, D., St Jeor, S.C. and De Guzman, R.N. (2009) The Hantavirus
Glycoprotein G1 Tail Contains Dual CCHC-type Classical Zinc Fingers. J Biol Chem 284(13),
8654-60.
Estrada, D.F. and De Guzman, R.N. (2011) Structural characterization of the Crimean-Congo
hemorrhagic fever virus Gn tail provides insight into virus assembly. J Biol Chem.
Flick, K., Hooper, J.W., Schmaljohn, C.S., Pettersson, R.F., Feldmann, H. and Flick, R. (2003) Rescue of
Hantaan virus minigenomes. Virology 306(2), 219-24.
Foster, S.L., Hargreaves, D.C. and Medzhitov, R. (2007) Gene-specific control of inflammation by
TLR-induced chromatin modifications. Nature 447(7147), 972-8.
Gajdusek, D.C. (1962) Virus hemorrhagic fevers. Special reference to hemorrhagic fever with renal
syndrome (epidemic hemorrhagic fever). J Pediatr 60, 841-57.
Garcin, D., Lezzi, M., Dobbs, M., Elliott, R.M., Schmaljohn, C., Kang, C.Y. and Kolakofsky, D. (1995) The
5' ends of Hantaan virus (Bunyaviridae) RNAs suggest a prime-and-realign mechanism for the
initiation of RNA synthesis. J Virol 69(9), 5754-62.
Gavrilovskaya, I.N., Peresleni, T., Geimonen, E. and Mackow, E.R. (2002) Pathogenic hantaviruses
selectively inhibit beta3 integrin directed endothelial cell migration. Arch Virol 147(10),
1913-31.
Gavrilovskaya, I.N., Shepley, M., Shaw, R., Ginsberg, M.H. and Mackow, E.R. (1998) beta3 Integrins
mediate the cellular entry of hantaviruses that cause respiratory failure. Proc Natl Acad Sci U
S A 95(12), 7074-9.
Geimonen, E., LaMonica, R., Springer, K., Farooqui, Y., Gavrilovskaya, I.N. and Mackow, E.R. (2003)
Hantavirus pulmonary syndrome-associated hantaviruses contain conserved and functional
ITAM signaling elements. J Virol 77(2), 1638-43.
Geimonen, E., Neff, S., Raymond, T., Kocer, S.S., Gavrilovskaya, I.N. and Mackow, E.R. (2002)
Pathogenic and nonpathogenic hantaviruses differentially regulate endothelial cell responses.
Proc Natl Acad Sci U S A 99(21), 13837-42.
Gitlin, L., Barchet, W., Gilfillan, S., Cella, M., Beutler, B., Flavell, R.A., Diamond, M.S. and Colonna, M.
(2006) Essential role of mda-5 in type I IFN responses to polyriboinosinic:polyribocytidylic
acid and encephalomyocarditis picornavirus. Proc Natl Acad Sci U S A 103(22), 8459-64.
Goldsmith, C.S., Elliott, L.H., Peters, C.J. and Zaki, S.R. (1995) Ultrastructural characteristics of Sin
![Page 53: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/53.jpg)
53
Nombre virus, causative agent of hantavirus pulmonary syndrome. Arch Virol 140(12),
2107-22.
Gott, P., Zoller, L., Darai, G. and Bautz, E.K. (1997) A major antigenic domain of hantaviruses is located
on the aminoproximal site of the viral nucleocapsid protein. Virus Genes 14(1), 31-40.
Guilligay, D., Tarendeau, F., Resa-Infante, P., Coloma, R., Crepin, T., Sehr, P., Lewis, J., Ruigrok, R.W.,
Ortin, J., Hart, D.J. and Cusack, S. (2008) The structural basis for cap binding by influenza virus
polymerase subunit PB2. Nat Struct Mol Biol 15(5), 500-6.
Habjan, M., Andersson, I., Klingstrom, J., Schumann, M., Martin, A., Zimmermann, P., Wagner, V.,
Pichlmair, A., Schneider, U., Muhlberger, E., Mirazimi, A. and Weber, F. (2008) Processing of
genome 5' termini as a strategy of negative-strand RNA viruses to avoid RIG-I-dependent
interferon induction. PLoS One 3(4), e2032.
Hacker, D., Raju, R. and Kolakofsky, D. (1989) La Crosse virus nucleocapsid protein controls its own
synthesis in mosquito cells by encapsidating its mRNA. J Virol 63(12), 5166-74.
Haller, O., Kochs, G. and Weber, F. (2006) The interferon response circuit: induction and suppression by
pathogenic viruses. Virology 344(1), 119-30.
Handke, W., Oelschlegel, R., Franke, R., Kruger, D.H. and Rang, A. (2009) Hantaan virus triggers
TLR3-dependent innate immune responses. J Immunol 182(5), 2849-58.
Harrison, M.S., Sakaguchi, T. and Schmitt, A.P. (2010) Paramyxovirus assembly and budding: building
particles that transmit infections. Int J Biochem Cell Biol 42(9), 1416-29.
Hellen, C.U. and Sarnow, P. (2001) Internal ribosome entry sites in eukaryotic mRNA molecules. Genes
Dev 15(13), 1593-612.
Hepojoki, J., Strandin, T., Vaheri, A. and Lankinen, H. (2010a) Interactions and oligomerization of
hantavirus glycoproteins. J Virol 84(1), 227-42.
Hepojoki, J., Strandin, T., Wang, H., Vapalahti, O., Vaheri, A. and Lankinen, H. (2010b) Cytoplasmic tails
of hantavirus glycoproteins interact with the nucleocapsid protein. J Gen Virol 91(Pt 9),
2341-50.
Heyman, P., Vaheri, A., Lundkvist, A. and Avsic-Zupanc, T. (2009) Hantavirus infections in Europe: from
virus carriers to a major public-health problem. Expert Rev Anti Infect Ther 7(2), 205-17.
Hirokawa, T., Boon-Chieng, S. and Mitaku, S. (1998) SOSUI: classification and secondary structure
prediction system for membrane proteins. Bioinformatics 14(4), 378-9.
Hofmann, K. and Stoffel, W. (1993) TMBASE-a database of membrane spanning protein segments. Biol.
Chem. Hoppe-Seyler 374(166).
Hooper, J.W., Custer, D.M., Thompson, E. and Schmaljohn, C.S. (2001) DNA vaccination with the
Hantaan virus M gene protects Hamsters against three of four HFRS hantaviruses and elicits a
high-titer neutralizing antibody response in Rhesus monkeys. J Virol 75(18), 8469-77.
Hornung, V., Ellegast, J., Kim, S., Brzozka, K., Jung, A., Kato, H., Poeck, H., Akira, S., Conzelmann, K.K.,
Schlee, M., Endres, S. and Hartmann, G. (2006) 5'-Triphosphate RNA is the ligand for RIG-I.
Science 314(5801), 994-7.
Huiskonen, J.T., Hepojoki, J., Laurinmaki, P., Vaheri, A., Lankinen, H., Butcher, S.J. and Grunewald, K.
(2010) Electron cryotomography of Tula hantavirus suggests a unique assembly paradigm for
enveloped viruses. J Virol 84(10), 4889-97.
Hujakka, H., Koistinen, V., Eerikainen, P., Kuronen, I., Mononen, I., Parviainen, M., Lundkvist, A., Vaheri,
A., Narvanen, A. and Vapalahti, O. (2001) New immunochromatographic rapid test for
diagnosis of acute Puumala virus infection. J Clin Microbiol 39(6), 2146-50.
![Page 54: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/54.jpg)
54
Jääskelainen, K.M., Kaukinen, P., Minskaya, E.S., Plyusnina, A., Vapalahti, O., Elliott, R.M., Weber, F.,
Vaheri, A. and Plyusnin, A. (2007) Tula and Puumala hantavirus NSs ORFs are functional and
the products inhibit activation of the interferon-beta promoter. J Med Virol 79(10), 1527-36.
Jääskelainen, K.M., Plyusnina, A., Lundkvist, A., Vaheri, A. and Plyusnin, A. (2008) Tula hantavirus
isolate with the full-length ORF for nonstructural protein NSs survives for more consequent
passages in interferon-competent cells than the isolate having truncated NSs ORF. Virol J 5, 3.
Jang, S.K. (2006) Internal initiation: IRES elements of picornaviruses and hepatitis c virus. Virus Res
119(1), 2-15.
Jenison, S., Yamada, T., Morris, C., Anderson, B., Torrez-Martinez, N., Keller, N. and Hjelle, B. (1994)
Characterization of human antibody responses to four corners hantavirus infections among
patients with hantavirus pulmonary syndrome. J Virol 68(5), 3000-6.
Jiang, H., Wang, P.Z., Zhang, Y., Xu, Z., Sun, L., Wang, L.M., Huang, C.X., Lian, J.Q., Jia, Z.S., Li, Z.D. and
Bai, X.F. (2008) Hantaan virus induces toll-like receptor 4 expression, leading to enhanced
production of beta interferon, interleukin-6 and tumor necrosis factor-alpha. Virology 380(1),
52-9.
Jin, H. and Elliott, R.M. (1993) Characterization of Bunyamwera virus S RNA that is transcribed and
replicated by the L protein expressed from recombinant vaccinia virus. J Virol 67(3),
1396-404.
Jin, M., Park, J., Lee, S., Park, B., Shin, J., Song, K.J., Ahn, T.I., Hwang, S.Y., Ahn, B.Y. and Ahn, K. (2002)
Hantaan virus enters cells by clathrin-dependent receptor-mediated endocytosis. Virology
294(1), 60-9.
Jonsson, C.B., Gallegos, J., Ferro, P., Severson, W., Xu, X. and Schmaljohn, C.S. (2001) Purification and
characterization of the Sin Nombre virus nucleocapsid protein expressed in Escherichia coli.
Protein Expr Purif 23(1), 134-41.
Kallio-Kokko, H., Leveelahti, R., Brummer-Korvenkontio, M., Lundkvist, A., Vaheri, A. and Vapalahti, O.
(2001) Human immune response to Puumala virus glycoproteins and nucleocapsid protein
expressed in mammalian cells. J Med Virol 65(3), 605-13.
Kallio-Kokko, H., Vapalahti, O., Lundkvist, A. and Vaheri, A. (1998) Evaluation of Puumala virus IgG and
IgM enzyme immunoassays based on recombinant baculovirus-expressed nucleocapsid
protein for early nephropathia epidemica diagnosis. Clin Diagn Virol 10(1), 83-90.
Kariwa, H., Tanabe, H., Mizutani, T., Kon, Y., Lokugamage, K., Lokugamage, N., Iwasa, M.A., Hagiya, T.,
Araki, K., Yoshimatsu, K., Arikawa, J. and Takashima, I. (2003) Synthesis of Seoul virus RNA and
structural proteins in cultured cells. Arch Virol 148(9), 1671-85.
Kato, H., Takeuchi, O., Mikamo-Satoh, E., Hirai, R., Kawai, T., Matsushita, K., Hiiragi, A., Dermody, T.S.,
Fujita, T. and Akira, S. (2008) Length-dependent recognition of double-stranded ribonucleic
acids by retinoic acid-inducible gene-I and melanoma differentiation-associated gene 5. J Exp
Med 205(7), 1601-10.
Kato, H., Takeuchi, O., Sato, S., Yoneyama, M., Yamamoto, M., Matsui, K., Uematsu, S., Jung, A., Kawai,
T., Ishii, K.J., Yamaguchi, O., Otsu, K., Tsujimura, T., Koh, C.S., Reis e Sousa, C., Matsuura, Y.,
Fujita, T. and Akira, S. (2006) Differential roles of MDA5 and RIG-I helicases in the recognition
of RNA viruses. Nature 441(7089), 101-5.
Kaukinen, P., Vaheri, A. and Plyusnin, A. (2003) Non-covalent interaction between nucleocapsid
protein of Tula hantavirus and small ubiquitin-related modifier-1, SUMO-1. Virus Res 92(1),
37-45.
![Page 55: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/55.jpg)
55
Kaukinen, P., Vaheri, A. and Plyusnin, A. (2005) Hantavirus nucleocapsid protein: a multifunctional
molecule with both housekeeping and ambassadorial duties. Arch Virol 150(9), 1693-713.
Kawai, T., Takahashi, K., Sato, S., Coban, C., Kumar, H., Kato, H., Ishii, K.J., Takeuchi, O. and Akira, S.
(2005) IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I interferon induction. Nat
Immunol 6(10), 981-8.
Khaiboullina, S.F., Morzunov, S.P. and St Jeor, S.C. (2005) Hantaviruses: molecular biology, evolution
and pathogenesis. Curr Mol Med 5(8), 773-90.
Khaiboullina, S.F., Rizvanov, A.A., Otteson, E., Miyazato, A., Maciejewski, J. and St Jeor, S. (2004)
Regulation of cellular gene expression in endothelial cells by sin nombre and prospect hill
viruses. Viral Immunol 17(2), 234-51.
Kilpatrick, E.D., Terajima, M., Koster, F.T., Catalina, M.D., Cruz, J. and Ennis, F.A. (2004) Role of specific
CD8+ T cells in the severity of a fulminant zoonotic viral hemorrhagic fever, hantavirus
pulmonary syndrome. J Immunol 172(5), 3297-304.
Klempa, B., Fichet-Calvet, E., Lecompte, E., Auste, B., Aniskin, V., Meisel, H., Barriere, P., Koivogui, L.,
ter Meulen, J. and Kruger, D.H. (2007) Novel hantavirus sequences in Shrew, Guinea. Emerg
Infect Dis 13(3), 520-2.
Kohl, A., Hart, T.J., Noonan, C., Royall, E., Roberts, L.O. and Elliott, R.M. (2004) A bunyamwera virus
minireplicon system in mosquito cells. J Virol 78(11), 5679-85.
Kopp, E. and Medzhitov, R. (2003) Recognition of microbial infection by Toll-like receptors. Curr Opin
Immunol 15(4), 396-401.
Kozak, M. (1991) Structural features in eukaryotic mRNAs that modulate the initiation of translation. J
Biol Chem 266(30), 19867-70.
Kozak, M. (1992) Regulation of translation in eukaryotic systems. Annu Rev Cell Biol 8, 197-225.
Krakauer, T., Leduc, J.W. and Krakauer, H. (1995) Serum levels of tumor necrosis factor-alpha,
interleukin-1, and interleukin-6 in hemorrhagic fever with renal syndrome. Viral Immunol
8(2), 75-9.
Kraus, A.A., Raftery, M.J., Giese, T., Ulrich, R., Zawatzky, R., Hippenstiel, S., Suttorp, N., Kruger, D.H. and
Schonrich, G. (2004) Differential antiviral response of endothelial cells after infection with
pathogenic and nonpathogenic hantaviruses. J Virol 78(12), 6143-50.
Krautkramer, E. and Zeier, M. (2008) Hantavirus causing hemorrhagic fever with renal syndrome enters
from the apical surface and requires decay-accelerating factor (DAF/CD55). J Virol 82(9),
4257-64.
Krogh, A., Larsson, B., von Heijne, G. and Sonnhammer, E.L. (2001) Predicting transmembrane protein
topology with a hidden Markov model: application to complete genomes. J Mol Biol 305(3),
567-80.
Kuismanen, E. (1984) Posttranslational processing of Uukuniemi virus glycoproteins G1 and G2. J Virol
51(3), 806-12.
Kukkonen, S.K., Vaheri, A. and Plyusnin, A. (2004) Tula hantavirus L protein is a 250 kDa perinuclear
membrane-associated protein. J Gen Virol 85(Pt 5), 1181-9.
Kukkonen, S.K., Vaheri, A. and Plyusnin, A. (2005) L protein, the RNA-dependent RNA polymerase of
hantaviruses. Arch Virol 150(3), 533-56.
Kumar, H., Kawai, T. and Akira, S. (2011) Pathogen recognition by the innate immune system. Int Rev
Immunol 30(1), 16-34.
Lee, B.H., Yoshimatsu, K., Maeda, A., Ochiai, K., Morimatsu, M., Araki, K., Ogino, M., Morikawa, S. and
![Page 56: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/56.jpg)
56
Arikawa, J. (2003) Association of the nucleocapsid protein of the Seoul and Hantaan
hantaviruses with small ubiquitin-like modifier-1-related molecules. Virus Res 98(1), 83-91.
Lee, H.W., Baek, L.J. and Johnson, K.M. (1982) Isolation of Hantaan virus, the etiologic agent of Korean
hemorrhagic fever, from wild urban rats. J Infect Dis 146(5), 638-44.
Lee, H.W. and Lee, P.W. (1976) Korean hemorrhagic fever. I. Demonstration of causative agent and
antibodies. Korean J Intern Med 19, 371-384.
Lee, H.W., Lee, P.W. and Johnson, K.M. (1978) Isolation of the etiologic agent of Korean Hemorrhagic
fever. J Infect Dis 137(3), 298-308.
Levine, J.R., Prescott, J., Brown, K.S., Best, S.M., Ebihara, H. and Feldmann, H. (2010) Antagonism of
type I interferon responses by new world hantaviruses. J Virol 84(22), 11790-801.
Lewis, R.M., Lee, H.W., See, A.F., Parrish, D.B., Moon, J.S., Kim, D.J. and Cosgriff, T.M. (1991) Changes in
populations of immune effector cells during the course of haemorrhagic fever with renal
syndrome. Trans R Soc Trop Med Hyg 85(2), 282-6.
Li, X.D., Makela, T.P., Guo, D., Soliymani, R., Koistinen, V., Vapalahti, O., Vaheri, A. and Lankinen, H.
(2002) Hantavirus nucleocapsid protein interacts with the Fas-mediated apoptosis enhancer
Daxx. J Gen Virol 83(Pt 4), 759-66.
Linderholm, M., Ahlm, C., Settergren, B., Waage, A. and Tarnvik, A. (1996) Elevated plasma levels of
tumor necrosis factor (TNF)-alpha, soluble TNF receptors, interleukin (IL)-6, and IL-10 in
patients with hemorrhagic fever with renal syndrome. J Infect Dis 173(1), 38-43.
Linderholm, M., Bjermer, L., Juto, P., Roos, G., Sandstrom, T., Settergren, B. and Tarnvik, A. (1993) Local
host response in the lower respiratory tract in nephropathia epidemica. Scand J Infect Dis
25(5), 639-46.
Lober, C., Anheier, B., Lindow, S., Klenk, H.D. and Feldmann, H. (2001) The Hantaan virus glycoprotein
precursor is cleaved at the conserved pentapeptide WAASA. Virology 289(2), 224-9.
Lundkvist, A., Horling, J. and Niklasson, B. (1993) The humoral response to Puumala virus infection
(nephropathia epidemica) investigated by viral protein specific immunoassays. Arch Virol
130(1-2), 121-30.
Lundkvist, A. and Niklasson, B. (1992) Bank vole monoclonal antibodies against Puumala virus
envelope glycoproteins: identification of epitopes involved in neutralization. Arch Virol
126(1-4), 93-105.
Luthra, P., Sun, D., Silverman, R.H. and He, B. (2011) Activation of IFN-{beta} expression by a viral
mRNA through RNase L and MDA5. Proc Natl Acad Sci U S A.
Mader, S., Lee, H., Pause, A. and Sonenberg, N. (1995) The translation initiation factor eIF-4E binds to
a common motif shared by the translation factor eIF-4 gamma and the translational
repressors 4E-binding proteins. Mol Cell Biol 15(9), 4990-7.
Maeda, A., Lee, B.H., Yoshimatsu, K., Saijo, M., Kurane, I., Arikawa, J. and Morikawa, S. (2003) The
intracellular association of the nucleocapsid protein (NP) of hantaan virus (HTNV) with small
ubiquitin-like modifier-1 (SUMO-1) conjugating enzyme 9 (Ubc9). Virology 305(2), 288-97.
Maes, P., Clement, J., Gavrilovskaya, I. and Van Ranst, M. (2004) Hantaviruses: immunology, treatment,
and prevention. Viral Immunol 17(4), 481-97.
Makary, P., Kanerva, M., Ollgren, J., Virtanen, M.J., Vapalahti, O. and Lyytikainen, O. (2010) Disease
burden of Puumala virus infections, 1995-2008. Epidemiol Infect 138(10), 1484-92.
Makela, S., Mustonen, J., Ala-Houhala, I., Hurme, M., Partanen, J., Vapalahti, O., Vaheri, A. and
Pasternack, A. (2002) Human leukocyte antigen-B8-DR3 is a more important risk factor for
![Page 57: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/57.jpg)
57
severe Puumala hantavirus infection than the tumor necrosis factor-alpha(-308) G/A
polymorphism. J Infect Dis 186(6), 843-6.
Marcus, P.I. and Sekellick, M.J. (1977) Defective interfering particles with covalently linked [+/-]RNA
induce interferon. Nature 266(5605), 815-9.
Martin, M.L., Lindsey-Regnery, H., Sasso, D.R., McCormick, J.B. and Palmer, E. (1985) Distinction
between Bunyaviridae genera by surface structure and comparison with Hantaan virus using
negative stain electron microscopy. Arch Virol 86(1-2), 17-28.
Matsuoka, Y., Chen, S.Y. and Compans, R.W. (1991) Bunyavirus protein transport and assembly. Curr
Top Microbiol Immunol 169, 161-79.
Meylan, E., Curran, J., Hofmann, K., Moradpour, D., Binder, M., Bartenschlager, R. and Tschopp, J.
(2005) Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted by hepatitis C
virus. Nature 437(7062), 1167-72.
Mir, M.A., Brown, B., Hjelle, B., Duran, W.A. and Panganiban, A.T. (2006) Hantavirus N protein exhibits
genus-specific recognition of the viral RNA panhandle. J Virol 80(22), 11283-92.
Mir, M.A., Duran, W.A., Hjelle, B.L., Ye, C. and Panganiban, A.T. (2008) Storage of cellular 5' mRNA caps
in P bodies for viral cap-snatching. Proc Natl Acad Sci U S A 105(49), 19294-9.
Mir, M.A. and Panganiban, A.T. (2005) The hantavirus nucleocapsid protein recognizes specific features
of the viral RNA panhandle and is altered in conformation upon RNA binding. J Virol 79(3),
1824-35.
Mir, M.A. and Panganiban, A.T. (2008) A protein that replaces the entire cellular eIF4F complex. EMBO
J 27(23), 3129-39.
Mir, M.A. and Panganiban, A.T. (2010) The triplet repeats of the Sin Nombre hantavirus 5' untranslated
region are sufficient in cis for nucleocapsid-mediated translation initiation. J Virol 84(17),
8937-44.
Mori, M., Rothman, A.L., Kurane, I., Montoya, J.M., Nolte, K.B., Norman, J.E., Waite, D.C., Koster, F.T.
and Ennis, F.A. (1999) High levels of cytokine-producing cells in the lung tissues of patients
with fatal hantavirus pulmonary syndrome. J Infect Dis 179(2), 295-302.
Mustonen, J., Partanen, J., Kanerva, M., Pietila, K., Vapalahti, O., Pasternack, A. and Vaheri, A. (1996)
Genetic susceptibility to severe course of nephropathia epidemica caused by Puumala
hantavirus. Kidney Int 49(1), 217-21.
Mustonen, J., Partanen, J., Kanerva, M., Pietila, K., Vapalahti, O., Pasternack, A. and Vaheri, A. (1998)
Association of HLA B27 with benign clinical course of nephropathia epidemica caused by
Puumala hantavirus. Scand J Immunol 47(3), 277-9.
Myhrman, G. (1951) Nephropathia epidemica a new infectious disease in northern Scandinavia. Acta
Med Scand 140(1), 52-6.
Nichol, S.T., Beaty, B. J., Elliott, R. M., Goldbach, R., Plyusnin, A, Schmaljohn, C. S. & Tesh, R. B. (2005)
Bunyaviridae. In Virus Taxonomy VIIIth report of the International Committee on Taxonomy of
Viruses(Edited by C. M. Fauquet, M. A. Mayo, J. Maniloff, U. Desselberger & L. A. Ball.
Amsterdam, Elsevier Academic Press).
Nolte, K.B., Feddersen, R.M., Foucar, K., Zaki, S.R., Koster, F.T., Madar, D., Merlin, T.L., McFeeley, P.J.,
Umland, E.T. and Zumwalt, R.E. (1995) Hantavirus pulmonary syndrome in the United States:
a pathological description of a disease caused by a new agent. Hum Pathol 26(1), 110-20.
O'Neill, L.A. (2006) Targeting signal transduction as a strategy to treat inflammatory diseases. Nat Rev
Drug Discov 5(7), 549-63.
![Page 58: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/58.jpg)
58
Ogino, M., Yoshimatsu, K., Ebihara, H., Araki, K., Lee, B.H., Okumura, M. and Arikawa, J. (2004) Cell
fusion activities of Hantaan virus envelope glycoproteins. J Virol 78(19), 10776-82.
Ontiveros, S.J., Li, Q. and Jonsson, C.B. (2010) Modulation of apoptosis and immune signaling
pathways by the Hantaan virus nucleocapsid protein. Virology 401(2), 165-78.
Osborne, J.C. and Elliott, R.M. (2000) RNA binding properties of bunyamwera virus nucleocapsid
protein and selective binding to an element in the 5' terminus of the negative-sense S
segment. J Virol 74(21), 9946-52.
Overby, A.K., Popov, V.L., Pettersson, R.F. and Neve, E.P. (2007) The cytoplasmic tails of Uukuniemi
Virus (Bunyaviridae) G(N) and G(C) glycoproteins are important for intracellular targeting and
the budding of virus-like particles. J Virol 81(20), 11381-91.
Padula, P.J., Rossi, C.M., Della Valle, M.O., Martinez, P.V., Colavecchia, S.B., Edelstein, A., Miguel, S.D.,
Rabinovich, R.D. and Segura, E.L. (2000) Development and evaluation of a solid-phase
enzyme immunoassay based on Andes hantavirus recombinant nucleoprotein. J Med
Microbiol 49(2), 149-55.
Pandey, S. and Agrawal, D.K. (2006) Immunobiology of Toll-like receptors: emerging trends. Immunol
Cell Biol 84(4), 333-41.
Pensiero, M.N. and Hay, J. (1992) The Hantaan virus M-segment glycoproteins G1 and G2 can be
expressed independently. J Virol 66(4), 1907-14.
Pettersson, R.F. (1991) Protein localization and virus assembly at intracellular membranes. Curr Top
Microbiol Immunol 170, 67-106.
Pichlmair, A., Schulz, O., Tan, C.P., Naslund, T.I., Liljestrom, P., Weber, F. and Reis e Sousa, C. (2006)
RIG-I-mediated antiviral responses to single-stranded RNA bearing 5'-phosphates. Science
314(5801), 997-1001.
Plotch, S.J., Bouloy, M., Ulmanen, I. and Krug, R.M. (1981) A unique cap(m7GpppXm)-dependent
influenza virion endonuclease cleaves capped RNAs to generate the primers that initiate viral
RNA transcription. Cell 23(3), 847-58.
Plumet, S., Herschke, F., Bourhis, J.M., Valentin, H., Longhi, S. and Gerlier, D. (2007) Cytosolic
5'-triphosphate ended viral leader transcript of measles virus as activator of the RIG
I-mediated interferon response. PLoS One 2(3), e279.
Plyusnin, A. (2002) Genetics of hantaviruses: implications to taxonomy. Arch Virol 147(4), 665-82.
Plyusnin, A. and Morzunov, S.P. (2001) Virus evolution and genetic diversity of hantaviruses and their
rodent hosts. Curr Top Microbiol Immunol 256, 47-75.
Plyusnin, A., Vapalahti, O., Lankinen, H., Lehvaslaiho, H., Apekina, N., Myasnikov, Y., Kallio-Kokko, H.,
Henttonen, H., Lundkvist, A., Brummer-Korvenkontio, M. and et al. (1994) Tula virus: a newly
detected hantavirus carried by European common voles. J Virol 68(12), 7833-9.
Plyusnin, A., Vapalahti, O. and Vaheri, A. (1996) Hantaviruses: genome structure, expression and
evolution. J Gen Virol 77 ( Pt 11), 2677-87.
Plyusnin, A., Vapalahti, O., Vasilenko, V., Henttonen, H. and Vaheri, A. (1997) Dobrava hantavirus in
Estonia: does the virus exist throughout Europe? Lancet 349(9062), 1369-70.
Prescott, J., Hall, P., Acuna-Retamar, M., Ye, C., Wathelet, M.G., Ebihara, H., Feldmann, H. and Hjelle, B.
(2010) New World hantaviruses activate IFNlambda production in type I IFN-deficient vero E6
cells. PLoS One 5(6), e11159.
Prescott, J., Ye, C., Sen, G. and Hjelle, B. (2005) Induction of innate immune response genes by Sin
Nombre hantavirus does not require viral replication. J Virol 79(24), 15007-15.
![Page 59: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/59.jpg)
59
Prescott, J.B., Hall, P.R., Bondu-Hawkins, V.S., Ye, C. and Hjelle, B. (2007) Early innate immune
responses to Sin Nombre hantavirus occur independently of IFN regulatory factor 3,
characterized pattern recognition receptors, and viral entry. J Immunol 179(3), 1796-802.
Raftery, M.J., Kraus, A.A., Ulrich, R., Kruger, D.H. and Schonrich, G. (2002) Hantavirus infection of
dendritic cells. J Virol 76(21), 10724-33.
Raju, R. and Kolakofsky, D. (1989) The ends of La Crosse virus genome and antigenome RNAs within
nucleocapsids are base paired. J Virol 63(1), 122-8.
Ramanathan, H.N., Chung, D.H., Plane, S.J., Sztul, E., Chu, Y.K., Guttieri, M.C., McDowell, M., Ali, G. and
Jonsson, C.B. (2007) Dynein-dependent transport of the hantaan virus nucleocapsid protein
to the endoplasmic reticulum-Golgi intermediate compartment. J Virol 81(16), 8634-47.
Ramanathan, H.N. and Jonsson, C.B. (2008) New and Old World hantaviruses differentially utilize host
cytoskeletal components during their life cycles. Virology 374(1), 138-50.
Ravkov, E.V. and Compans, R.W. (2001) Hantavirus nucleocapsid protein is expressed as a
membrane-associated protein in the perinuclear region. J Virol 75(4), 1808-15.
Ravkov, E.V., Nichol, S.T. and Compans, R.W. (1997) Polarized entry and release in epithelial cells of
Black Creek Canal virus, a New World hantavirus. J Virol 71(2), 1147-54.
Reguera, J., Weber, F. and Cusack, S. (2010) Bunyaviridae RNA polymerases (L-protein) have an
N-terminal, influenza-like endonuclease domain, essential for viral cap-dependent
transcription. PLoS Pathog 6(9).
Rehwinkel, J., Tan, C.P., Goubau, D., Schulz, O., Pichlmair, A., Bier, K., Robb, N., Vreede, F., Barclay, W.,
Fodor, E. and Reis e Sousa, C. (2010) RIG-I detects viral genomic RNA during negative-strand
RNA virus infection. Cell 140(3), 397-408.
Ribeiro, D., Borst, J.W., Goldbach, R. and Kormelink, R. (2009) Tomato spotted wilt virus nucleocapsid
protein interacts with both viral glycoproteins Gn and Gc in planta. Virology 383(1), 121-30.
Richter, J.D. and Sonenberg, N. (2005) Regulation of cap-dependent translation by eIF4E inhibitory
proteins. Nature 433(7025), 477-80.
Rogers, G.W., Jr., Komar, A.A. and Merrick, W.C. (2002) eIF4A: the godfather of the DEAD box helicases.
Prog Nucleic Acid Res Mol Biol 72, 307-31.
Rossier, C., Patterson, J. and Kolakofsky, D. (1986) La Crosse virus small genome mRNA is made in the
cytoplasm. J Virol 58(2), 647-50.
Rowe, R.K. and Pekosz, A. (2006) Bidirectional virus secretion and nonciliated cell tropism following
Andes virus infection of primary airway epithelial cell cultures. J Virol 80(3), 1087-97.
Salonen, A., Ahola, T. and Kaariainen, L. (2005) Viral RNA replication in association with cellular
membranes. Curr Top Microbiol Immunol 285, 139-73.
Samanta, M., Iwakiri, D., Kanda, T., Imaizumi, T. and Takada, K. (2006) EB virus-encoded RNAs are
recognized by RIG-I and activate signaling to induce type I IFN. EMBO J 25(18), 4207-14.
Sane, J., Laine, O., Makela, S., Paakkala, A., Jarva, H., Mustonen, J., Vapalahti, O., Meri, S. and Vaheri, A.
(2011) Complement activation in Puumala hantavirus infection correlates with disease
severity. Ann Med.
Sato, M., Suemori, H., Hata, N., Asagiri, M., Ogasawara, K., Nakao, K., Nakaya, T., Katsuki, M., Noguchi,
S., Tanaka, N. and Taniguchi, T. (2000) Distinct and essential roles of transcription factors IRF-3
and IRF-7 in response to viruses for IFN-alpha/beta gene induction. Immunity 13(4), 539-48.
Satoh, T., Kato, H., Kumagai, Y., Yoneyama, M., Sato, S., Matsushita, K., Tsujimura, T., Fujita, T., Akira, S.
and Takeuchi, O. (2010) LGP2 is a positive regulator of RIG-I- and MDA5-mediated antiviral
![Page 60: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/60.jpg)
60
responses. Proc Natl Acad Sci U S A 107(4), 1512-7.
Schlee, M., Roth, A., Hornung, V., Hagmann, C.A., Wimmenauer, V., Barchet, W., Coch, C., Janke, M.,
Mihailovic, A., Wardle, G., Juranek, S., Kato, H., Kawai, T., Poeck, H., Fitzgerald, K.A., Takeuchi,
O., Akira, S., Tuschl, T., Latz, E., Ludwig, J. and Hartmann, G. (2009) Recognition of 5'
triphosphate by RIG-I helicase requires short blunt double-stranded RNA as contained in
panhandle of negative-strand virus. Immunity 31(1), 25-34.
Schmaljohn, C. and Nichol, S.T. (2007) Bunyaviridae, In "Fields virology" (D.M. Knipe, P.M. Howley, D.E.
Griffin, R.A. Lamb, M.A. Martin, R.B., and S.S.E., Eds.)
pp. 1741–1789. Vol. 2. Lippincott Williams & Wilkins, Philadelphia.
Schmitt, A.P. and Lamb, R.A. (2004) Escaping from the cell: assembly and budding of negative-strand
RNA viruses. Curr Top Microbiol Immunol 283, 145-96.
Sen, N., Sen, A. and Mackow, E.R. (2007) Degrons at the C terminus of the pathogenic but not the
nonpathogenic hantavirus G1 tail direct proteasomal degradation. J Virol 81(8), 4323-30.
Seth, R.B., Sun, L., Ea, C.K. and Chen, Z.J. (2005) Identification and characterization of MAVS, a
mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3. Cell 122(5),
669-82.
Severson, W., Partin, L., Schmaljohn, C.S. and Jonsson, C.B. (1999) Characterization of the Hantaan
nucleocapsid protein-ribonucleic acid interaction. J Biol Chem 274(47), 33732-9.
Severson, W., Xu, X. and Jonsson, C.B. (2001) cis-Acting signals in encapsidation of Hantaan virus
S-segment viral genomic RNA by its N protein. J Virol 75(6), 2646-52.
Severson, W., Xu, X., Kuhn, M., Senutovitch, N., Thokala, M., Ferron, F., Longhi, S., Canard, B. and
Jonsson, C.B. (2005) Essential amino acids of the hantaan virus N protein in its interaction
with RNA. J Virol 79(15), 10032-9.
Shi, X. and Elliott, R.M. (2002) Golgi localization of Hantaan virus glycoproteins requires coexpression
of G1 and G2. Virology 300(1), 31-8.
Shi, X., Kohl, A., Leonard, V.H., Li, P., McLees, A. and Elliott, R.M. (2006) Requirement of the N-terminal
region of orthobunyavirus nonstructural protein NSm for virus assembly and morphogenesis.
J Virol 80(16), 8089-99.
Sjolander, K.B., Elgh, F., Kallio-Kokko, H., Vapalahti, O., Hagglund, M., Palmcrantz, V., Juto, P., Vaheri, A.,
Niklasson, B. and Lundkvist, A. (1997) Evaluation of serological methods for diagnosis of
Puumala hantavirus infection (nephropathia epidemica). J Clin Microbiol 35(12), 3264-8.
Snippe, M., Willem Borst, J., Goldbach, R. and Kormelink, R. (2007) Tomato spotted wilt virus Gc and N
proteins interact in vivo. Virology 357(2), 115-23.
Song, J.W., Gu, S.H., Bennett, S.N., Arai, S., Puorger, M., Hilbe, M. and Yanagihara, R. (2007) Seewis
virus, a genetically distinct hantavirus in the Eurasian common shrew (Sorex araneus). Virol J
4, 114.
Spiropoulou, C.F., Albarino, C.G., Ksiazek, T.G. and Rollin, P.E. (2007) Andes and Prospect Hill
hantaviruses differ in early induction of interferon although both can downregulate
interferon signaling. J Virol 81(6), 2769-76.
Spiropoulou, C.F., Goldsmith, C.S., Shoemaker, T.R., Peters, C.J. and Compans, R.W. (2003) Sin Nombre
virus glycoprotein trafficking. Virology 308(1), 48-63.
Sugimori, T., Griffith, D.L. and Arnaout, M.A. (1997) Emerging paradigms of integrin ligand binding and
activation. Kidney Int 51(5), 1454-62.
Sugiyama, K., Obayashi, E., Kawaguchi, A., Suzuki, Y., Tame, J.R., Nagata, K. and Park, S.Y. (2009)
![Page 61: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/61.jpg)
61
Structural insight into the essential PB1-PB2 subunit contact of the influenza virus RNA
polymerase. EMBO J 28(12), 1803-11.
Takahasi, K., Yoneyama, M., Nishihori, T., Hirai, R., Kumeta, H., Narita, R., Gale, M., Jr., Inagaki, F. and
Fujita, T. (2008) Nonself RNA-sensing mechanism of RIG-I helicase and activation of antiviral
immune responses. Mol Cell 29(4), 428-40.
Taylor, S.L., Frias-Staheli, N., Garcia-Sastre, A. and Schmaljohn, C.S. (2009a) Hantaan virus nucleocapsid
protein binds to importin alpha proteins and inhibits tumor necrosis factor alpha-induced
activation of nuclear factor kappa B. J Virol 83(3), 1271-9.
Taylor, S.L., Krempel, R.L. and Schmaljohn, C.S. (2009b) Inhibition of TNF-alpha-induced activation of
NF-kappaB by hantavirus nucleocapsid proteins. Ann N Y Acad Sci 1171 Suppl 1, E86-93.
Temonen, M., Lankinen, H., Vapalahti, O., Ronni, T., Julkunen, I. and Vaheri, A. (1995) Effect of
interferon-alpha and cell differentiation on Puumala virus infection in human
monocyte/macrophages. Virology 206(1), 8-15.
Temonen, M., Mustonen, J., Helin, H., Pasternack, A., Vaheri, A. and Holthofer, H. (1996) Cytokines,
adhesion molecules, and cellular infiltration in nephropathia epidemica kidneys: an
immunohistochemical study. Clin Immunol Immunopathol 78(1), 47-55.
tenOever, B.R., Servant, M.J., Grandvaux, N., Lin, R. and Hiscott, J. (2002) Recognition of the measles
virus nucleocapsid as a mechanism of IRF-3 activation. J Virol 76(8), 3659-69.
tenOever, B.R., Sharma, S., Zou, W., Sun, Q., Grandvaux, N., Julkunen, I., Hemmi, H., Yamamoto, M.,
Akira, S., Yeh, W.C., Lin, R. and Hiscott, J. (2004) Activation of TBK1 and IKKvarepsilon kinases
by vesicular stomatitis virus infection and the role of viral ribonucleoprotein in the
development of interferon antiviral immunity. J Virol 78(19), 10636-49.
Tischler, N.D., Gonzalez, A., Perez-Acle, T., Rosemblatt, M. and Valenzuela, P.D. (2005) Hantavirus Gc
glycoprotein: evidence for a class II fusion protein. J Gen Virol 86(Pt 11), 2937-47.
Tusnady, G.E. and Simon, I. (2001) The HMMTOP transmembrane topology prediction server.
Bioinformatics 17(9), 849-50.
Tuuminen, T., Kekalainen, E., Makela, S., Ala-Houhala, I., Ennis, F.A., Hedman, K., Mustonen, J., Vaheri,
A. and Arstila, T.P. (2007) Human CD8+ T cell memory generation in Puumala hantavirus
infection occurs after the acute phase and is associated with boosting of EBV-specific CD8+
memory T cells. J Immunol 179(3), 1988-95.
Vaheri, A., Mills, J.N., Spiropoulou, C. and Hjelle, B. (2011) Hantaviruses. Zoonoses - biology, clinical
practice and public health, 2ed Edition(Oxford University Press. Oxford. U.K.), pp. 307-22.
Vaheri, A., Vapalahti, O. and Plyusnin, A. (2008) How to diagnose hantavirus infections and detect
them in rodents and insectivores. Rev Med Virol 18(4), 277-88.
Van Epps, H.L., Terajima, M., Mustonen, J., Arstila, T.P., Corey, E.A., Vaheri, A. and Ennis, F.A. (2002)
Long-lived memory T lymphocyte responses after hantavirus infection. J Exp Med 196(5),
579-88.
Vapalahti, O., Kallio-Kokko, H., Narvanen, A., Julkunen, I., Lundkvist, A., Plyusnin, A., Lehvaslaiho, H.,
Brummer-Korvenkontio, M., Vaheri, A. and Lankinen, H. (1995) Human B-cell epitopes of
Puumala virus nucleocapsid protein, the major antigen in early serological response. J Med
Virol 46(4), 293-303.
Vapalahti, O., Lundkvist, A., Kallio-Kokko, H., Paukku, K., Julkunen, I., Lankinen, H. and Vaheri, A. (1996)
Antigenic properties and diagnostic potential of puumala virus nucleocapsid protein
expressed in insect cells. J Clin Microbiol 34(1), 119-25.
![Page 62: Hantavirus glycoprotein GN in virion assembly and](https://reader031.vdocuments.us/reader031/viewer/2022012506/618294948313ff659d1319c5/html5/thumbnails/62.jpg)
62
Vapalahti, O., Mustonen, J., Lundkvist, A., Henttonen, H., Plyusnin, A. and Vaheri, A. (2003) Hantavirus
infections in Europe. Lancet Infect Dis 3(10), 653-61.
Virtanen, J.O., Jaaskelainen, K.M., Djupsjobacka, J., Vaheri, A. and Plyusnin, A. (2010) Tula hantavirus
NSs protein accumulates in the perinuclear area in infected and transfected cells. Arch Virol
155(1), 117-21.
von Bonsdorff, C.H. and Pettersson, R. (1975) Surface structure of Uukuniemi virus. J Virol 16(5),
1296-307.
von der Haar, T., Gross, J.D., Wagner, G. and McCarthy, J.E. (2004) The mRNA cap-binding protein eIF4E
in post-transcriptional gene expression. Nat Struct Mol Biol 11(6), 503-11.
Wajant, H., Pfizenmaier, K. and Scheurich, P. (2003) Tumor necrosis factor signaling. Cell Death Differ
10(1), 45-65.
Wang, H., Alminaite, A., Vaheri, A. and Plyusnin, A. (2010) Interaction between hantaviral nucleocapsid
protein and the cytoplasmic tail of surface glycoprotein Gn. Virus Res 151(2), 205-12.
Waris, G., Tardif, K.D. and Siddiqui, A. (2002) Endoplasmic reticulum (ER) stress: hepatitis C virus
induces an ER-nucleus signal transduction pathway and activates NF-kappaB and STAT-3.
Biochem Pharmacol 64(10), 1425-30.
Weber, F., Wagner, V., Rasmussen, S.B., Hartmann, R. and Paludan, S.R. (2006) Double-stranded RNA is
produced by positive-strand RNA viruses and DNA viruses but not in detectable amounts by
negative-strand RNA viruses. J Virol 80(10), 5059-64.
Xu, L.G., Wang, Y.Y., Han, K.J., Li, L.Y., Zhai, Z. and Shu, H.B. (2005) VISA is an adapter protein required
for virus-triggered IFN-beta signaling. Mol Cell 19(6), 727-40.
Xu, X., Severson, W., Villegas, N., Schmaljohn, C.S. and Jonsson, C.B. (2002) The RNA binding domain
of the hantaan virus N protein maps to a central, conserved region. J Virol 76(7), 3301-8.
Yamamoto, M., Sato, S., Hemmi, H., Hoshino, K., Kaisho, T., Sanjo, H., Takeuchi, O., Sugiyama, M.,
Okabe, M., Takeda, K. and Akira, S. (2003) Role of adaptor TRIF in the MyD88-independent
toll-like receptor signaling pathway. Science 301(5633), 640-3.
Yanagihara, R. and Silverman, D.J. (1990) Experimental infection of human vascular endothelial cells by
pathogenic and nonpathogenic hantaviruses. Arch Virol 111(3-4), 281-6.
Ye, Z., Liu, T., Offringa, D.P., McInnis, J. and Levandowski, R.A. (1999) Association of influenza virus
matrix protein with ribonucleoproteins. J Virol 73(9), 7467-73.
Yoneyama, M., Kikuchi, M., Natsukawa, T., Shinobu, N., Imaizumi, T., Miyagishi, M., Taira, K., Akira, S.
and Fujita, T. (2004) The RNA helicase RIG-I has an essential function in double-stranded
RNA-induced innate antiviral responses. Nat Immunol 5(7), 730-7.
Yoshimatsu, K., Arikawa, J., Tamura, M., Yoshida, R., Lundkvist, A., Niklasson, B., Kariwa, H. and Azuma,
I. (1996) Characterization of the nucleocapsid protein of Hantaan virus strain 76-118 using
monoclonal antibodies. J Gen Virol 77 ( Pt 4), 695-704.
Zaki, S.R., Greer, P.W., Coffield, L.M., Goldsmith, C.S., Nolte, K.B., Foucar, K., Feddersen, R.M., Zumwalt,
R.E., Miller, G.L., Khan, A.S. and et al. (1995) Hantavirus pulmonary syndrome. Pathogenesis
of an emerging infectious disease. Am J Pathol 146(3), 552-79.