hadjiliadis - hindawi publishing corporationmechanism of action of the antitumor drug ci___s-platin...

ON THE MECHANISM OF ACTION OF THE ANTITUMOR DRUG cis-PLATIN(cis-DDP) AND ITS SECOND GENERATION DERIVATIVES

Vasilis Aletras, Denis Hadjiliadis2 and Nick Hadjiliadis1.University of Ioannina, Department of Chemistry, Laboratory of Inorganic and General Chemistry,

Ioannina, 45-110, Greece2 University of Toronto, Faculty of Medicine, 1 King’s College Circle,

Toronto, Ontario H4A 1W3, Canada

Abstract- The present article attempts to summarise the elements of themechanism of action of the antitumor drug ci___s-Pl ati n presented the Iast fewyears. Highlights on the discovery of the drug and the development of it’ssecond generation derivatives are presented, as well as the ways thatcis___-DDP reacts with biomolecules as DNA and proteins and their models e.g.nucleosides, nucleotides. Also the hydrolysis data are presented forci__s-DDP and its’ inactive congener trans-DDP, as well as for the secondgeneration drug carboplatin. Finally, useful l conclusions are given fromthis work, pointing out the unanswered questions about the action of cis-DDP as well as its differences in action, in comparison with trans-DDP.

TABLE OF CONTENTS

HISTORICAL BACKROUNDa. Introduction.b. Structure Activity Relationships.c. Binding sites of cis-DDP responsible for cytotoxicity and

side toxicities.d. Hydrolysis of c_]i_s and trans-DDP in aqueous solutions.

BINDING MODES OF METAL IONS WITH DNAa. Introduction (Description of DNA structures)b. Formation of a DNA intercalator "complex"c. External sphere complex formation (Ionic binding)d. Internal sphere complex formation (Covalent binding)

3, BINDING OF c is-AND trans-DDP WITH DNA AND/OR PROTEINSIntroductionIntrastrand Crosslinks (IntraSCL)Interstrand Crosslinks (InterSCL)I, 3-IntraSCLBidentate bindin of cis-DDP with one base of DNAInteraction of cis-and trans-DDP with proteins andformation of DNA-Pt-protein crosslinks.

4. ELEMENTS OF PHARMAKOKINETICS OF cis-DDP,IPROPLATIN

PARAPLATIN AND

5. CONCLUDING REMARKS

153

Vol. 2, No. 3, 1995

HISTORICAL BACKROUND

On the Mechanism ofAction ofthe Antitumor Drug cis-Platin (cis-DDP)and Its Second Generation Derivatives

(a) Introduction The compound dichloro-diamine-platinum (II), of theCl was known since 1844 in two forms, theempirical formula Pt(NH3)2

a-Pt(NH3)2C1 2 or Peyrone salt2(ci__s-platin) and the 6-Pt(NH3)212 or Reisetsalt (trans-platln). The pioneering work of Werner [I] 6n the structureand bonding of coordination compounds, led to the assignment of a squareplanar geometry for these complexes (Fig. I).

Fig. 1.o

The ststudies

P]atinPearsonatoms cha"hard" ba

Studieto the de

HN

HN3

The structure ofr tcans-DDP.

(a)

Cl Cl NH

\ /

CI H N CI(b)

(a) ci__#s-platin or cis-DDP and (b)

of trans-effect was made by the Russsian chemist Chernyaev [5].subsequently studied in depth by Basolo [6], Dra9o [7], Sadler [8]

of t rans-p at n

ructure of both isomers was elucidated by X-ray diffraction2].um (II) is classsified as a "soft" Lewis acid, according to3] or class b, and generally forms more stable bonds with donorracterized also as "soft" Lewis bas#s (e.g. N,S,P etc), while withses (e.g. Cl, H20, NO CO SO etc) it forms weaker bonds.s on ligand substitut3 3 4Ion reactions in square planar complexes ledvelopment of the kinetic trans-effect by Chatt [4]. The discovery

It wasetc and

it continues to be studied even today.Around 1965 the first publication appeared by B. Rosenber9 and his

collaborators [9] describing the unusual behavior of E.coli bacteriaculture, in the presence of platinum electrodes. This was a part of abiophysical study of the growth of bacteria under the influence of theelectric current. The bacteria were forming long filaments, about 300times longer than the normal size [9]. This filamentous growth meantinhibition of cell division, but not of cell growth. The platinumelectrodes were selected because of the inertness of the metal, while theobserved filamentous growth was starting I-2 hrs after the passage of theelectric current. It was subsequently found that for this abnormal growthof the bacteria, small amounts of metal in the form of the complex

(NH4)2PtCI_ (I-10 ppm) were necessary. The same behavior was also observedin the

4presence of similar amounts (about 8

transition metals as well, like Rh, Ir, Ru,effect observed with Rh complexes, e.g. RhCl

Later it wasel ect rode formed

NH4CI, usedgrowing, was transformed into cis-Pt(NH

ppm) of complexes of otheretc, with a more pronouncedor (NH )2RhCl_ [10],

found by Rosenber9 eta_.3 [10,1] tha the platinum

electrolytically [PtCl 6] which after reaction withas a nutrient in the medium in which E.coli bacteria were

3 )2C14" This in turn after UV154

K Aletras, D. Hadfiliadis and N. Hadfiliadis Metal Based Drugs

rrad at on was produc ng among others c s-Pt (NH3) 2 C 12" Bothcis-(NH___3_)2PtCl and cis-(NH )PtCl were the active species for the4the 3 2p o uc on , sotrans-Pt(NH ) Cl analog was inactive.

Based on3tge 2above properties of the two cis-complexes of Pt2+ and Pt4+and knowing since 1931 that ruthenium compounds and RhCl were inhibitingthe growth of adenocarcinoma and of mice sarcoma, Rosenbe9 [12] decided totest them against sarcoma-180 and mice lymphocytic leukemia 1210 andobtained the first satisfactory results. In 1973 Rosenberg [13] presentedthe results of clinical trials (phase I and phase II) for cis-(NH3)- 2PtCl 2(ci___s-platin, or cis-DDP) started in 1972, as well as in vitro tesls ofvarious platinum complexes against a broad spectrum of tumors. Thus, froma broad spectrum of 28 tumor types with 50 to I00% cures (phase I clinicaltrials), 7 types of toxicity effects were discovered, with as more seriousones, nephrotoxicity, nausea and vomiting. Nephrotoxicity was determiningthe limiting dose of the drug. The best results of cis-DDP were foundagainst testicular and ovarian cancers. The problem of nephrotoxicity onthe other hand, was solved by the idea of Cvitkovic and Krakoff at theSloan Ketterin9 Institute, to use extensive hydration and mannitol prior todrug administration. Cis-DDP was subsequently used in combinationaltherapy with vinblastine and bleomycine against testicular cancer with >95;cures.

Analogs of cis-DDP exhibitini antitumor activity were also presented byRosenber9 in 1978 [14] (Fig. 2).

R XR NH- NH- MeNH

2 2

EtNH i-PrNH 2

R X 2 2-2X CI-, Br-, -OOC-COO- NI-L

Fig. 2. Analogs of cis-DDP with antitumor activity.

Finally, in 1978 the complex compound cis-(NH_)2PtCl 2 (Peyrone’s Salt)was approved for clinical use as a drug under te name "Platinol" by theF.D.A. (Food and Drug Administration) of the USA, and under the name"Neoplatin" in Great Britain in 1979 by the DHSS (Department of HealthSystem and Security).

Since 1983 the drug comes first in sales in the USA and worldwide amongall the analogous anticancer drugs. Today only the derivative of ci__s-DDP,cis-[ (NH)oPt(CBDCA) ], or ci__s-diamino-[ I, 1-cyclobutane-dicarboxylate-(2)-0,0’ latinum (II), named Paraplatin or Carboplatin, or JM-8 iscommercialy widely used (Fig. 3). Figure 3 presents a few analogs ofci__s-DDP with satisfactory antitumor activity that are presently underclinical trials in various phases, except carboplatin, which is already inuse. Carboplatin is used today in combination with other antitumor drugs

155

Vol. 2, No. 3, 1995 On the Mechanism ofAction ofthe Antitumor Drug cis-Platin (cis-DDP)and Its Second Generation Derivatives

[15] or with radiotherapy against testicular, ovarian, head and neckcancers. It has however little effect against cancers with a greatpercentage of mortality, like lung cancer and cancers of thegastrointestinal tract [16].

Today a great deal of research work is still carried out around cis-and trans-DDP and their derivatives. In particular about 2000 relevantpublications were referred, during the years 1981-1992 in the Chemical

CH

O O

H3N O HN O

/\ .o_..H N O HN O

CH

O

...\/o/\ /\

H N O H2N ClO

O

\/

(L"II)ll II2N

0CH -H N O

(H H N O

(v) (vl)

(’1 H N

/0112

(’1 II N (1

Fig. 3. Some newer antitumor complexes of Pt(II) and Pt(IV);(i) Carboplatin or Paraplatin or JM-8 or CBDCA or ci___s-diamino-[O,O’-1,1-cyclo-butanm-dicarbo-xylato] platinum (II), (ii) Zeniplatin or CL 286, 588 or [N,N’-2,2-bis(aminomethyl)-l,3-pro-panodiole] [O,O’-l.l-cyclobutane-di-carboxylato] platinum (II), (iii) Oxaliplatin (Oxalato-platinum) or..cis-(N,N-1,2-diaminocyclohexane)-(tans-l)-oxalato-platinum (II), {i_yv) DAGH-Pt

or ci__s-(N,N-1,2-diaminocyclohexane)-(trans-l)-dichloro-pl&tinum (II), (X) CHIP or Iproplatin

or cis-(bis-isopropylamins)-(tanF-I)-dihydroxy-cis-dichloro-platinum (IV),(v_ii) Enlopl&tin orCL 287,110 or [0,0’- 1,1-cyclo-butane-dicarboxylato] [N,N-tetrahydro-4H-pyrane-4,4-dimethana-

mine] platinum (II), (vii) Tstraplatin (Ormaplatin) or NBC 363812 or Tetrachloro-[N,N-(d,1-trans)-l,2-diaminocyclohexane] platinum (II) and (vii____ii) Bpiro-platin or TNO-6 or [N,N-(1,1-bis-aminomethyl)-cyclohexane] (Sulfato)(hydrato)platinum (II).

Abstracts [17]. In 1984 Rosenberg was honored with the Charles F.Ketterin9 award, sponsored by General Motors, where he presented a reviewof his work [18].The present paper is attempting to briefly review what isknown today on the mechanism of action of cis-DDP and carboplatin, whichalmost replaced the former and is the only one in use.

156

V. Aletras, D. Hadfiliadis and N. Hadfiliadis Metal BasedDrugs

(b) Structure-Activity Relationship The aquired knowledge on the activityand chemistry of cis-DDP and its inactive congener trans-DDP, even from theearly studies and the testing of many analogs of the drug against varioustumors, provided the first elements of structure-activity relationship ofthese complexes [19-2], summarized in the folllowin9 rules:(i) T compounds should be neutl and correspond to formulaecis-Pt (am) X or cis,cis,trans-Pt--(am).X^Y^, with am:amine and

9ands (9ood leav-9 groups), z(i The ligands X, shouldconsist from groups or donor atoms that make bonds with Pt(II) ofintermediate strength. For this or other reasons (e.9_ activation 2byenzymes) these are 9ood leavino roups Examples are SO. -, Cl-, C^O. -,citrates [(OOCCH ) C(OH)(CHCO0)_] or other dicarboxylates. For thecompounds of Pt(V, the igands Y are mainly OH- occupying the axial transpositions. (iii) The amine li9ands should have at least one N-H groupwhether they are mono or bidentate so that they will be able to form atleast one hydrogen bond. All the compounds with nitrogen donor l i9andscontaining no hydro9ens capable to form hydrogen bonds, do not possessantitumor activity, though they can also bind with DNA.

The possible roles of the N-H group in the biological activity of thecompounds, may either be kinetic (e.9. a possible relationship with theapproaching of the macromolecule of DNA) or thermodynamic (e.9. with theadditional (de)stabilization after binding with the biological target ofDNA) or steric (e.9. hindered rotation, due to the increase of bulkiness ofof the nitrogen donor l igand) or reasons related to the transport of thedrug within the cell. In any case, it is even today a subject of extensiveresearch [2].

It should be emphasized that the above rules are not universal and thatsome Pt(II) compounds with increased cytotoxicity or even antitumoractivity do not obey them [28]. A few examples are liven below:(i) Complexes with two diamine units bridged with a carbonate bridge of

NH )}] [29-31] with maximumformula [{cis-Pt(NH3)2Cl2}2{l-N N-(NH2(CH2) n 2activity when n=5.(ii) Dimeric or trimeric hydroxo-bridged complexes of Pt (II) of formulae,

where[Ci--s- Pt(NH^CH(CH3)2)DACH=,2-diam nocyc2-(-OH) ]2(NO-)3lohexane ].and [cis-Pt(R, R-DACH) (g-OH) ] 3 (NO3) 3(ii__i) Complexes of formula [Pt(diam)(RR’SO)C1](N03), with diam=a bidentateamine and RR’SO=a sulfoxide [33].(i_yv) Increased cytotoxicity was observed in complexes of type

trans-[PtC12(RR’SO)(quin)] and trans-[PtL2C12], here, quin=quinoline andL=pyridine, N-methyl-imidazole, thiazole, qulnoline [34-+36].(v) Compounds of formula ci--s-[Pt(NH3)2(N-Het)Cl ] with N-Het=aheterocyclic amine [37, 38] containing only one }avin9 group.(vi) Antitumor compounds of formulae, [Pt (N N-NRCH CH NR)L2] and[-(N,N-NRCH2CH2N )(py)2], R=R’=polyphenyl, L=pyridine or methyl pyridine[39].

157


(vii) The trans-[PtCl {E,E-HN=C(OR’)R} ] possesses a remarkable antitumoractivity, larger than2its cis-EE and c2s-ZZ isomers [40, 41].In conclusion, complexes with antitumor properties include cationic,compounds containing four nitrogen donor atoms around platinum, nitrogendonor ligands without hydrogenstrans geometry.(C) Binding sites of cis-DDPtoxicities From the beginningthe way that cis-DDP exhibitsmolecule and the binding siteswas of great importance for thewith reduced toxi

It was soon fotumor cells in vi(i) the productioof lysogenicity,(v) the inactivatDNA.

for hydrogen bonds, and complexes with

responsible for cytotoxicity and sideit was obvious that the understanding ofits antitumor action, i.e. the target

in the cell causing the antitumor action,development of new more effective analogs

city.und that DNA was the target molecule of ci__s-DDP within thevo, because the drug had the following biological effects-n of a filamentous growth in bacteria, (i_i) the production(iii) carcinogenicity, (iv) inactivation of viruses andion of bacteriophage viruses that contain and transport

Cis-DDP had also the following biochemical effects supporting the aboveconclusion- (i) selective inhibition of the synthesis of DNA and not of RNAor proteins, (ii) inactivation of the substrate of the enzymeDNA-polymerase, (iii) selective binding with DNA, (i_v) other analogouscomplexes are bound in a similar manner to cis-DDP with DNA and finally,(v) the relationship between the antitumor activity and inhibition of thegrowth of bacteria [42].

The fact that the nuclear DNA was the primary target of cis-DDP withinthe cell, led to extensive research of the study of the interaction of thedrug and other platinum salts with DNA and its constituents in vitro withthe aim to discover the binding sites of the metal, its general reactivityand the possible modifications of DNA caused by the binding, leading todeath of the cell. In 1971, the first publication on the interaction ofcis-DDP with DNA, studied with UV and CD spectroscopies appeared [43]. Thehypochromicity shown in the UV spectra of the double helix of DNA,indicates perturbation on the structure of the macromolecule upon platinumbinding, i.e., the disappearance of the stacking interactions between thebases (increase of ). This was interpreted as rather due to a covalentbonding of Pt(II) with the bases of DNA. At almost the same time their spectrum of the complex ci__s-Pt(ado)Cl (ado=adenosine) was studied inthe solid state, with Pt(II) bound at t.: 7 atom of the base [44].

Various techniques were employed in subsequent studies of interaction ofplatinum salts with nucleosides and nucleotides (DNA constituents), leadingto the conclusions that the metal could mainly bind at the N7 and NI sitesof purines and the N3 site of pyrimidines [45-53]. Later similar studiesof nucleobases showed additional binding sites the N3 and 06 of purines andthe exocyclic amino group (-NH) of pyrimidines [54, 55] (Fig. 4).(d) Hydrolysis of cis- and t2rans-DDP in aqueous solutions In aqueoussolutions the two isomers, cis- and trans_-(NH3) PtCl are hydrolyzed asshown in Fig.5 and Fig.6 [56-61]. The concentrat2on the various speciesformed depe in each case on the pH and the ionic strength of theI-5solution. Pt and N-NMR [60, 62, 63] have been used in many cases to

158

V. Aletras, D. Hadjiliadis and N. Hadfiliadis Metal Based Drugs

identify the species formed, while many hydroxo-complexes were isolated inthe solid state and their structure was solved by X-ray diffraction [17,64-66].

Fig. 4.

Fig. 5.

i,,,i\ \ \

Structures and bondin9 sites of (a) 9-Alkyl-Guanine, (b) 1-Alkyl-Cytosine, (c) 9-Alkyl-denne, (d) 1-Alky]-Uracl and 1-Alky]-Thymine.

IN

Hydrolysis of cis-DDP in aqueous solution.

159

Vol. 2, No. 3, 1995

pK

CI/

NII3_j-CI"


-ci

il20 NIi3J

Fig. 6. Hydrolysis of trans-DDP in aqueous solution.From Figs. 5 and 6, it is seen that the concentrations of the

monohydro-monochloro-diamine complexes in aqueous solutions, withstrength 1=0.1 and temperature 25, are 88 for the cis- and 54 fortrans-analo9, calculated as percentages of the starting compounds.

The lower activity of trans-DDP compared to cis-DDP may be explainedthe smaller value of pka of the former (5.63 compared to 6.85 forcis-analog), for the equilibrium,

+ +(NH )2Pt(H^O)Cl] [(NH3)2Pt(OH)C1] + HZ

As a result under physiological conditions and since the OH group

activeionicthe

bythe

Thewithintake platoms othan Ptplace t

Its

isnot a 9ood leaving group as compared to H O, the concentration of thetrans-mono-hydro-complex available is considSrably reduced, consequently,its reaction with DNA is also reduced [56].

blood plasma has pH=7.4 with chloride concentration of 100mM, whilethe cell it is only 4 mM. Consequently, the hydrolysis reactionsace in the cell plasma, by the hydrated species with the properf the biomolecules. It is noted that Pt(II) is hydrolyzed faster(IV) and that the l igand substitution reactions in the former takehrough a pentacoordinated intermediate [57].hould also be noted that the species distribution of Figs. 5,6 is

not strictly followed in vivo, since it is possible for the complexes toreact with the various biomolecules, e.g. proteins of blood serum, insulfur containing sites (glutathione, methionine etc) [67-70], prior toreaching thermodynamic equilibrium.

The hydroxo bridged species, that may also be formed in regions withhigh platinum concentration [71], are inert and believed to be related tothe neurotoxicity of the drug. The release of ammonia from cis-DDP whenthe drug reacts with sulfur donors, like methionine [72], rises thequestion whether this release contributes to its cytotoxicity [72, 73].

160

K Aletras, D. Hadjiliadis and N. Hadjiliadis Metal Based Drugs

2. BINDING MODES OF METAL IONS WITH DNA

(a) Introduction (_Description of DNA structures) The secondary structureof the B-form of DNA is shown in Fig. 7. Part of its primary structurewith the possible sites on the bases for coordination with platinum is alsogiven in Fig. 8.

,3Q

(a)

H

N--H O

N N H-N

N NH O H

ADENINE THYMINE

H

O

,N N H- N

N N N-H OH

H

GUANINE CYTOSINE

Fig. 7. (a) Structure of B-DNA ( Reproduced by permission from ref.[74] )and (b) hydrogen bonds between base pairs, according to Watson-Crick.

Useful parameters of the DNA structure [74] are,(i) Translation per" residue- The distance in the DNA axis, between twosuccessive base pairs (in B-DNA it is 340 pm, or 3.4 ).(.ii) Base pairs per turn- It is a measure of the magnitude of the helixand represents the total number of bases after a complete turn of thehelix, i.e. after arriving again to the origin where it was startedfrom (For B-DNA we have 10 pairs per turn, i.e., per 10 X 340 = 3400 pm).(iii) Helical pitch Distance run from the origin of the helix, requiredfor a complete turn (in B-DNA is 3400 pm or 34 ).(iv) Base tilt Angle of the plane of base pair with the perpendicular to

00the axis of the helix plane at the same point (In B-DNA it is i.e.,every base pair determines a plane perpendicular to the helix axis orotherwise the planes determined by the bases are perpendicular to theaxis).(v) Base displacement Distance of the centre of the base pairs from thehelix axis (0 pm in B-DNA).

The B-form is the most common in solution. There are also the righthand side A-helix, that has a total number of 11 base pairs per turn, basetilt of 20 and the left hand side, Z-form (zig-zag tpe), which is morescarce. On a B-helix, the axis of every base pair (i.e., the straight lineconnectin the centre of the bases) is turned in relation to the previouspair by 36 (e.9. the angle of the two axes is 36). In this way a majorgroove and a minor groove are finally formed in the macromolecule. The

161

Vol. 2, No. 3, 1995 On the Mechanism ofAction ofthe AntitumorDrug cis-Platin (cL-DDP)and Its Second Generation Derivative,

ofirst (major groove) is 24 A wide and it is considered as the primaryrec_ognition site of the proteins, while the second (minor groove) is onl10 wide with smaller depth and interacting onlM with small proteins, Inthe B-helix the minimum distance for two bases belonging to two differenthelixes is 7 [75],

(b) Formation of a DNA-intercalator "complex" Intercalators are planarmolecules, mainl organic polyaromatic systems, havin the abilit tointercalate between two successive base pairs kept near, b9 stackinginteractions. A DNA-intercalator "complex" is thus formed. This possiblitof course exists on Iw for a ds DNA and not for ss DNA. The effect of inter-calation in the geometr of the molecule is the lengthening of the helix[70], so that the distance between the base pais in the two sites of theintercalato is increased to 7-8 from 3,4 initially, resultin tobiochemical chanes, e.g. inhibition of enzymes like RNA polmerase and/ortopoisomerase II [75].

Several structures of such complexes were solved with X-ra diffraction[77,78]. Proper experimental methods for the detection of this tgpe ofinteraction, were developed based on changes of the structure of the macro-+molecule [79-81]. The structure of the complex [(trp)Pt($CH2OH2OH)](trpy-tripyridyl) with the dinucleotide dCpG (Fig. 9), which opens +up thedouble helix of B-DNA b 23 [82] or the structure of [(trpy)PtCl] withAMP [78] are among the most characteristic ones.

ADENINE

Fig. The structure of the tetranucleotide model of a part of singlehelix (primar structure) of B-DNA, d(TpGpCpA), where the bondingsites with platinum are indicated.

162

K Aletras, D. Hadjiliadis and N. Hadfiliadis Metal BasedDrugs

Fig. 9. (a)(b)d(CpG)

:5’ C2" endo

CY endo

C2’ endoCH CH OH 3"2 2 b

(a) [--c

C3’ endo

)+

Structure of the complex [(trpy)Pt(S-CH2CH OH)] andstructure of its interca]ator comp]ex w]th2the dinuc]eotide

( Reproduced by permission from ref.[82] ).

+Others include the complex [(trpy)PtC]] which reacts with regions rich

in G-C of ds DNA and is used for se]ective protein ]abe]ing, since it has a9rear affinity for cysteine, much sma]ler for histidine and not at a]] formethionine [83], a]so of the "comp]ex" [(en)Pt(bpy)]2+ (en-ethy]enediamine,bpy=bipyridy]) with ANP [84,85]. The interaction between these twomo]ecu]es in so]ution was a]so studied by CD and H NNR [86]. The ang]e ofunwinding of DNA in these comp]exes was found to be 6-19, depending a]soon the presence of a coordination binding [87].

Fina]]y, the so ca]]ed "bis-interca]ators" sou]d a]so be mentioned.For examp]e, in the comp]ex [{(trpy)}Pt}2(can)] (can-canavarine) (Fi910), the aminoacid (canavarine) bridges two Pt(I) atoms as a "bisinterca]ator", most probab]y through the minor groove of DNA [88]. Severe]ana]ogs to these comp]exes with peptide bridges were a]so synthesized, insearching for compounds with se]ective binding with DNA 89].

A]so, comp]exes of the type A, A- [N(phen)3

(o-phen= 1,10-phenanthro]ine, n-2,3, N=Zn, Ru, Cu, Co, etc) may react_simi]ar]y. Withmeta]s with more than one stab]e oxidation states ]ike Co3+, free radica]smay be produced near their binding region with DNA, resu]tn9 to oxidativebreaking of the macromo]ecu]e [42].

(c) Externa] sphere comp]ex formation (onic binding) The counter ions ofthe negative charges of the phosphate groups in ds DNA that partia]]y

+neutra]ize its charge are usua]ly Na or other sma]] mete] cations. Theymay of course be the positive parts of other biomo]ecu]es, ]ike proteins.For examp]e Au(TT), in the form of AuC] at ]ow concentrations is boundto the phosphate oxygens, while at igher ncentrations wit+ thenucleobases [42]. Also, the complex [Co(NH3) 6] or the Mg(H_O)6__ areknown to stabilize the Z-form of DNA through a B->Z transition [90].Greater stabilization is achieved with the first complex, because (a) ithas a larger charge, (b) it contains igands forming hydrogen bonds and (c)igands that are not readily exchanged with solvent molecules.

163

Vol. 2, No. 3, 1995

It should also be noted that the complex [Co(NH ) ]today as a reagent for the B Z transformation of INXthan the previously used methods for this purpose,

+concentration (2.5 M Na ) or ethanol (60%) etc.

Concerning the binding of platinum salts with DNAmolecular mechanics calculations showed that cis-DDP maydirectly or through water molecules with the phosphatemacromolecule [91,92].

On the Mechanism ofAction ofthe AntimmorDrug cis-Platin (cis-DDP)and Its Second Generation Derivatives

3+is widely used

with better resultsi.e., high salt

in this manner,interact eithergroups of the

(d) Internal sphere complex formation (Covalent bindin).. Many metalare covalently bound with the bases of DNA. Extensive reviews onsubject exist [49, 51, 53], tosether with X-ray crystaland formation constants determinations in solution [94].for conclusions).

structures [50,(See Sect on

Fig. t0. Molecular structure of the intercalator compound {[Pt(trp)]2

( Reproduced by permission from ref.[88] ).3. BINDIN( OF cis- AND trans-DDP WITH DNA AND/OR PROTEINS.

ionsthe93]lc,

3+Can}

(a) Introduction Both cis- anddonor atoms of the DNA bases, [26,of cis-DDP are given in Fig. 11.

More particularly, cis-DDP can bind withways (Fig. 11).(i) Monodentate binding w(ii) Formation of "intebelonging to different st

trans-DDP form covalent bonds with the95-97]. The various ways of DNA binding

DNA in one of the following

ith only one base of DNA.rstrand crosslinks" (InterSCL)rends of DNA

(ii___i) Formation of "intrastrand crosslinks" (Intra$CL)similar or not, bases of the same strand of DNA(i_v) Formation of DNA-Pt-protein crosslinks, and(v) Bidentate binding with onl one DNA base.

with two bases

with two successive,

164

V. Aletras, D. Hadjiliadis and N. Hadjiliadis Metal Based Drugs

Fig. 11.

1.2 1.3 1.3 1.4cisplatin (b) transplatin

Various ways of (_a_a) DNA binding of cis-DDP or/and proteins and(b) differences in the conformation of the macromolecule from theformation of 1,2- or" 1,3-TntraSCL by cis-DDP and 1,3- or 1,4-IntraSCL by tr’ans-DDP.

The percentage formation of each type of bonding were quantitativelycalculated [98,99,100]. Thus the percentage of the intrastrand crosslinkbetweeen two successive bases of guanine of the same strand of DNA(1,2-IntraSCL) formed by cis-DDP on the d(GpG) part of the macromolecule,varies from 50-60%, whereas IntraSCL between successive guanine and adeninebases (d(ApG)type) by 20-30 percentage. About 10% of cis-DDP forms1,3-InstraSOL with two guanine bases separated by a third base of the typed(GpXpG). More scarce are the InterSCL between guanine bases belonging todifferent strands of DNA (


ratethe

for attack [I02]. The hydrolysis of the second chloride is again thedetermining step, t/-2.1 hrs for the cis- and tl/2 3.1 hrs fortrans-isomer, at pH=Z. [101].

Experimental evidence for the formation of intraSCL in DNA between twoN7 atoms of neighboring G molecules, also referred as a 1,2-1ntraSCL, areprovided by the following series of experiments:(_i) A large increase is observed in the value of the flotation density forthe polynucleotide, poly(dG)poly(dC) that was treated with cis-DDP,compared to the corresponding increase of the platinated poly(dG.dG) andthe platinated monomers.

Both poly(dG.dC) and poly(dG).poly(dC) are synthetic polymers with knownPoly(dG.dC) contains G:C=I:I

helix structure with the

M.W57% dC.sugar

in a strict sequence and itguanine bases taking the

homopolymer of double helixThe first helix is poly(dG)in the former adopting a

base sequences.has a doubleant i-conformat on.

The poly(d).poly(dC) is a highstructure and it contains 43 dG andand the other poly(dC), with thesyn-conformation [03].

The fact that only poly(dG).poly(dC) contains adjacent guanine bases,shows the importance of the ,2-IntraSCL (large increase upon platinationin the flotation density value). Trans-DDP increases the flotationdensity of DNA proportionally to its G- content, but it does not increaseit so much for poly(dG).poly(dC), in contrast to cis-DDP, i.e., it is notshowing any selectivity in the formation of IntraSCL, in neighboring bases[104].(j_i) The breaking of platinated DNA with enzymes possessing selectivity,e.g., restriction endonucleases. This selective breaking is inhibited bycis-DDP when the sites cut by the enzyme, have nearby the sequence, oligo(dG).oligo(dC) [105-107].

Also in experiments with exonucleases and with the use of techniques forsequence analysis of DNA, it is seen that the breaking of the platinatedDNA is inhibited in oli9o(dG) sites, most probably due to the formation ofIntraSCL with cis-DDP [106-109].(iii) NMR spectroscopic techniques on the interactions of di- and oli9o-nucleotides with cis- and trans-DDP show the formation of IntraSCL.(i_zv) Binding of the two isomers cis- and trans-DDP with DNA followed byhydrolysis (mainly enzymatic or other) and identificatio9 of the obtainedproducts with chromatographic HPLO and FPLO analysis and HNMR, showed for

1

cis-DDP the existence of only 1,2-IntraSCL of the GG and AG but not of the6A (5’----3’) type [99, 110, 111].

Thus, HNMR and chromatographic methods of the reaction products ofcis-DDP with various homo- and hetero- dinucleotides showed that there is akinetic selectivity in the reaction with d(GpG), while the reaction withd(ApA) was very slow [112].

166

V. Aletras, D. Hadfiliadis and N. Hadfiliadis Metal BasedDrugs

In the case of the reaction of ci__s-DDP with d(GpC), a 1-2 complex of themetal with the ligand is formed, bound only through N of G. Cytosine isnot taking part in the complexation, under the conditions of the reaction,showin the lack of selectivity for a 1,2-Intra$CL with d(GpC).

Studies on interactions of cis-DDP with the autocomplementaryhexanucleotide d(ApGpepCpCpT) followed by HPL chromatographicseparation and characterization of the products with 2D- HNMR spectroscopy,showed the formation of almost exclusively of a 17-membered chelate ring oran 1,2-IntraSCL between the metal and G(2), 8(3) through N7 [113, 114].

The same hexanucleotide reacting with trans-DDP produces mainly1,3-IntraSCL, forming a 23-membered chelate ring, involvin the N7 of A(1)and N7 of G(3) [115] (Fig. 12). o o

H HO ....HoH NH.H H

HNH O H

Fi9. 12. Bindin9 of trans-DDP ith the nuc]ootide d(ApGpGpCpCpT)( Reproduced by permission from tel. Ill5] ).

Trans-DDP on ghe other hand after reacgion ith DNA and enzymehydrolysis separation of ghe products ith HPLC and identification of themwith atomic absorption and H ffR spectroscopies, formed intrastrandcross]inks ith single stranded DNA of the dG-Pt-dG type (aboug 60g), ofthe dG-Pt-dA type (about 35g) and dG-Pt-dC (about 5). ith doublestranded NA ghe correspondin9 amounts ere dG-Pt-dG (50), dG-Pt-dA (40g)and d6-Pt-dC (10). The differences have been attributed to the 9rearerlability of the single than the double stranded DNA [116].

The difference between c is-BBP and trans-OP seem to be related to theirIntraSeL type that they form wgh DNA. h]e cis-DDP forms a chelate tin9wgh two successive 9uanine bases (1,2-IntraSCL), trans-DP seem to prefera 1,3-IntraSCL ith to non ad3acent 9uanine bases of the type d(pXp)(X=any nuc]eobase). Boh IntraSCL however, inhibit the synthesis of OA,+while a monodengate binding, e.9. of [(dien)PtC]] (dien=diethy]enetriamine) does not [117].

The similar tl2

of the monodentate complexes with A of both isomers,show that the bioSo91ca] nactivity of trans-DDP cannot be due o the rateof the formation of a bidentate complex [116]. It can however be relatedto the reaction rate of su]fydry] (SH) 9roups with the monodenta]]y boundto DA trans-DOP, which is faster in comparison ,ith the ones of cis-DDP,as it is seen ith reactions of both ,ith 9]utathione (6SH) [118]. 167

Vol. 2, No. 3, 1995 On the Mechanism ofAcn’on ofthe AntitumorDrug cis-Platin (cis-DDP)and lts Second Generation Derivatives

Further studies with H NMR [119] on the interaction of cis-DOP with theoligonucleotide d(TCTCGTCTC)d(AACCAA) show chelation with the twoadjacent guanine bases at the center of the one strand. The results alsoshowed th

Crystathe reactimportantproduct oThere areThe 9uanvary fromC3’-endo conformat on.

- _ ..03 ’B

Fi. 13. Crystal strucuro of the complex !-[(NH)Pt(N/,N/-d(ppG)]( Reproduced b permission from ref.[12

at the double helix structure was present after platination [119].structure determinations have also been carried out on some of

ion products of cis- and trans-DDP with ol ilonucleotides. Verywas the elucidation of the crystal structure of the reaction

f cis-DDP with d(pGpG) forming a 1,2-IntraSCL [120,121] (Fig. 13).four crystallographically independent molecules in the unit cell.

ne planes are in a head to head arrangement and their angle76.2 to 86.8 in each one of them. The sugars adopt the

This corresponds to the type of bonding that cis-DDP is expected to makein majority with DNA. It implies a bendin of the double helix axis of DNAby 32-34 It can not be given b trans-DDP, since the distance betweenits two chlorines is 4.64 X, compared to the 3.34 X in cis-DDP, comparableto the distance of the two adjacent uanine bases in B-DNA [215].

The elucidation of this structure was confirmin previous H NMR studieson the interactions of cis-DDP with the d(epG) forming 1,2-Intra$CL insolution [122].

Similar 1,2-Intra$CL was also found in the structure of the complexci s- [ (NH3)2Pt (d(GppG)-N (2), NT. (3)) ] [123].

Other crystallographi studies include the structures of cis- andtrans-DDP with t-RNA

pnefrom brewer yeast with 6 and 3 resolution,

respectively [124, 125]. Cis-DDP formed 1,2-IntraSCL of the type d(GpG)and d(ApG) [124], while trans-DDP [125] is monodentally bound at G(34)[125]. Also in the structure of [(dien)Pt[d(ApGpA)-NT(2)], complexationtakes place only through N7 of G(2) (Fig. 14).

168


Fig. 14. Crystalo structure of the complex (dien)Pt[NT(2)-d(ApGpA)],].5 A resolution ( Reproduced by permission from ref.[23]

with).

Molecular mechanics calculatds oli9onucleotide of B-DNA tmainly 1,2-IntraSCL with the Npossibilities of the double heangles of 50 and 60. The a63.2 and 58.4 correspondingl

ion studies [126] on the ci__s-DDP adduct ofype d(TCTCGGTCTC).d(GAGACCGAGA) containing7 of G(5) and G(6) showed that two bendinglix axis in the major groove exist,ngles of the two complexed bases arey [127]. The hydrogen bondin between

two complexed guanine bases with their complementary cytosines ismodified. The sugar conformation is changed to C3’-endo from C2’-endo

withthenthe

alsofor

the platinated 9uanosines and a hydrogen bonding exist between the ammoniamolecules of cis-DDP and the 5’-phosphate group. Of the two bending modelsfor the structure of B-DNA in the presence of cis-DDP, the one

ocorresponding to 63.2 is more stable by 19.3 kcal/mol under high ionicstrength conditions (i.e., with maximum neutralization of charge of DNA),called "model of high salt concentration", while in lower ionic strengththe 58.4 model is more stable, called "model of low salt concentration"[126].

Similar molecular mechanics calculations for the binding of cis-DDP withnucleotides of the type XpG and GpX, (X-base), show selectivity forplatination when X=G [128].

The calculated bending angles of the double helix of DNA with molecularmechanics may however differ considerably from the real values, if factorslike interactions with the solvent etc are not taken into account. For

169

VoL 2, No. 3, 1995 On the Mechanism ofAction ofthe AntitumorDrug cis-Platin (cis-DDP)and Its Second Generation Derivatives

the typeexample, when the part of B-DNA containing 22 base pairs of(Scheme I), representing 2.5 turns of the helix, is treated

TCTCCTTCTTGGTTCTCTTCTCAGAGGAAGAACCAAGAGAAGAG

Scheme Iwith cis-DDP followed by gel electrophoresis and comparison with a part ofDNA with bending angle of 20, it is found that the bending angles in the

oformer with 1,2-IntraSCL vary from 35-40 differing considerably from the

oones calculated by molecular mechanics of 50-61 [I9,130].

Combined molecular mechanics and ID- and 2D- H NMR studies, on thereaction of cis-DDP with the double hel ix type 10-nucleotided(GCCGGATCGC).d(GCGATCCGC) showed a bending angle of the helix by 55-62after the formation of 2-IntraSCL of the metal with G(4) and G(5) and anunwinding of it by 12-19

$[131].

Recent studies on the cytotoxicity of the 1,2-IntraSCL if d(GpG) typecaused by cis-DDP on the DNA of E.coli, using as a model the 12-nucleotided(TCTAGGCCTTCT) [132], in combination with previous work on thecytotoxicity of the 1,2-IntraSCL of d(ApG) type [133] show that this lattertype of binding should be about 5 times more toxic than the former one.

This indicates that we have to be cautious in determining the morecytotoxic IntraSCL of the drug.During the replication of platinated DNA, the 5-position of the sugarpresents the larger distortion, mainly due to the structural change to theC3’-endo conformation of the latter. As a consequence mutation may occurat this position (replacement of C by A) and not at the 3’ where the

smaller (maintenance of the C2’-endo configuration) [132]distortion is(Fig. 15).

Mutation at the 5’position of guo with C3’-endo sugarconformation (Reproduced by permission from ref.[1321

Fi9. 15.

A comparison of the effects caused by platination (cis-DDP) andmethylation at the N7 position of dGuo and dGpG, shows that the formerstabilizes more than the latter the N-glycosidic bonding towards acid

170


hydrolysis and does not cause the opening of the imidazole ring [134].This means that the N7 platinated 9uanines are slower hydrolizin9 theN-91ycosidic bonding than the methylated ones, e.9. slowly apopurinate fromDNA. Also the difference from a nucleoside (dGuo) and a dinucleotide (GpG)upon platination consists to the easier breaking of the N-glycosidicbonding in the former and of the Pt-N7 bonding in the latter [134].

It was finally proposed that for the formation of the 1,2-IntraSCL atthe d(GpG) section of DNA, the cis-DDP is initially accidentally bound withone guanine base monodentally through N7 in a reversible fashion. In thisway, ci__s-DDP may "march" on the double helix until it is able to form apermanent 1,2-IntraSCL when it "finds" two adjacent guanine bases [135].

(c) In.terstrand Crossl inks (InterSCL) Usual ly the percentage of InterSCLis less than I; of the amount of cis-DDP bound with DNA, though it seems toincrease with time up to 3% [136] or even up to 5% according to others[137]. Both isomers cis- and trans-DDP form such bonds in comparableamounts [106].

It should be noted that the covalent binding of cis-DDP with the DNAbases creates local unwinding of the double helix, resulting to regions ofsingle stranded structures within the macromolecule and to a finalshorternin9 of the active length of it [97].

In DNA rich in G,C, it was proposed [138] that the initial formation ofa N706 chelate with cis-DDP of guanine has as a result the breaking of thehydrogen bondings between the two bases G,C in opposite strands. This wasfollowed by the formation of interstrand crosslinks between thedeprotonated NI atom of guanine and the N3 of cytosine [138]. This washowever, never confirmed.

The formation of InterSCL between two guanine bases of opposite strands,bound to Pt(II) through their N7 atoms create an important distortion ofthe secondary structure of DNA, as molecular three dimensional models show.More particularly the two helixes are turned in opposite directionsapproaching each other and the distance between the 91ycosidic bonds isreduced to 10 from 12 X.

It was also proposed that such InterSCL are formed between G-C(5’----)3’)pairs, though this was not confirmed [139].

When cis-DDP reacts with the oligonucleotide d(CTTCTCCTTGCCTCTCCTTCTTC)and after isolation and indentification of the products with gelelectrophoresis and molecular models, it was found that the sequenced(GC/CG) which was platinated was distorted and a bending of 55 wasobserved in the direction of the major groove. The average angle of turnof the bases is kept constant however. This occurs, because for the

0formation of the InterSCL the two guanine bases should approach to 3.4 A(bite distance in cis-DDP) from the 7 X, which is their normal distance inB-DNA [140].

The InterSCL may not play a very important role in the cytotoxicity ofcis- and trans-DDP [141] or of ci__s- and trans-diamino-tetrachloro-platinum(IV) [142], since it is only formed in a very small percentage, though morerecent results show the opposite [143, 144].

171

Vol. 2, No. 3, 1995 On the Mechanism ofAction ofthe AntimmorDrug cis-Platin (cis-DDP)and Its Second Generation Derivatives

(d) 1,3-IntraSCL As already mentioned, both cis- and trans-DDP can1,3-IntraSCL. More details of the 1,3-IntraSCL formed by cis-

rans-DDP are given here.H NMR studies on the interaction of the trinucleotide d(GpCpG)

trans-DDP showed complete unstacking of the bases, while the sugar ofchanges conformation from C2’-endo to C3’-endo[145]. This is similarthe change caused to the sugar at the 5’-position, in the 1,2-IntraSCLci__s-DDP with d(Gp6), but differs from the 1,3-IntraSCL of cis-DDP withd(GpCpG) [146] favoring the C2’-endo conformation. This may be relatedthe lack of antitumor properties of trans-DDP.

formnd

withG(1)

toof

to

Also the reaction of trans-DDP with the oligonucleotide d(CCTCGAGTCTCC)(12-bases) gave products that were characterized after enzymatic digestionand HPLC chromatographic separation, by H NMR spectrosopy [147]. The

I

reaction had taken place at pH=3, so that complexation at NI of A(6)(pK=3.8) was avoided and resulted in the formation of the 1,3-IntraSCL[147]. Monodentate intermediates of trans-DDP through the N7 of G(5) or(7) can be detected.

When the double stranded 12-nucleotide d(CCTCGAGTGTCTCC).d(GGAGACTCGAGG)is used instead, it is seen from the molecular models of the free andplatinated nucleotide (Fig. 16) that because of the 1,3-1ntraSCL, the A(6)at the middle is not anymore stacked with the complexed guanine bases

Ca)

(b)

Fig. 16. Molecular models of (a) free and (b) bound with trans-DDP,polynucleotide d(CCTCGAGTTCTCC).d(GGAGCTCAGAGG) (Reproduced bypermission from ref.[147] ).

surrounding it and its sugar takes the C3’-endo conformation [14]. Thedifference from cis-DDP [127] is due to the fact that this causes aconsiderable bending of the double helix in the main groove of B-DNA, by400-70 because of the 1,2-IntraSCL, while the trans-DDP bending angle isonly 185, because of the 1,3-IntraSCL.172


The rate constant of the formation of t_h 1_,-Intra$CL, with thenucleotide of trans-DDP was, k:(12.5+0.4)

_10_ISeC while with DNA had

comparable value of k=(9.6+0.4) X 10 sec [115], as measured withPt NMR spectroscopy.

-5 -1Atomic absorption spectroscopy 9ave the value k=(5.4+_0.4) XlO sec

[115], for the rate constant of the reaction of DNA with trans-DDP [148],while it is reminded that the rate constant for the replaemen of thefirst chlorine by a water molecule (Fig. 6) was k.’=1.9 X 10 sec This

lindicates that trans-DDP binds to DNA in two pseudofirst order steps, thefirst being the chlorine replacement and the formation of a monodentatecomplex with the N7 of guanine and the second, which is faster, theformation of the 17-membered chelate through the N7 atoms of e(5) andof the nucleotide [148]. The rate of the total reaction seems to bedetermined from the replacement of chlorine by water.

The formation of a bidentate complex by the two isomers was considereduntil today as non reversible.the reaction o.f the 12-nucleotpH and after enzyric hydrolyHPLC and H and Pt NMR speG{6) and G(8) was formed in1,4-IntraSCL between the N3 ofsolutions [149]. The equilibrwas found to be 3, with prefehalf life tim. of the 1,3-Int62C, with AH-91_+2 kj/mol and

In conclusion, the 1,3-Intt rans-DDP does not seem to be

Recently however, it was found that duringide 5’-d(TCTACGCGTTCT) with trans-DDP at lowsis of the products and characterization withctroscopy, a 1,3-!ntraSOL between the N7 ofitially, followed by a rearrangement of aC(5) and the N7 of G(8), in neutral aqueousium constant of this rearrangement reaction

Theat

fence to the formation of 1,3-IntraSOL.

raSL was 1.29 hrs at 30C and 3.6 hrsAS =-58+8 J/mol K [149].raSCL type bonding formed by both cis-responsible for the antitumor action of

former, although it partially inhibits the DNA synthesis. Also,formation of the IntraSCL should not be considered as non reversible,in the case of theimportance of theinvestigatioon [149].

andthethelike

1,3---1,4 rearrangement, although the biologicallatter is not as yet understood and is under

(e) Bidentate binding of cis-DDP with one base of DNA The formation of aN706 chelate of Pt(II) with the same base of guanine was proposed in thepast, both with DNA [138, 150] and with simple 9uanosine [48] based onspectroscopic data and chemical reactions.

Similar chelates with Pd(II) were also proposed [151-153].The importance of the possible formation of such a chelate by cis-DDP is

immediately obvious, since trans-DDP is unable to formexplain the antitumor properties of the former and thelatter.

Various oopurines can form suchcomplex [(n -Cp)o(Theoph)Ti] [154],through N706 wit Ti(!V). Similarcomplexes [(n -CP)2Ti]3 (Han)]c]’

it. This mightinactivity of the

N706 chelates. For example, in thetheophylline is bound bidentallychelates were also found in the

(Xan-Xanth ne) 155 and

173


(8-MeS-Theoph)sCU (py) 2 J, (8-MeS-Theoph=8-methyl thi o-theophyl ne) [1561.containsThe hexameric ructure of the complex [(CH3)^Pt-(theoph-2HCl)3also such el ates 157] Also, when the comp met,itrans-[(dien)Ptequivalens(OH)2(N7-9-MeGDcl, ](Cl04)2r’-2H-Omeisleft for one day a+with 2 of the (u ien) Pt (OH) Cl (9-MeGH-NT) is

5Hobtained. In t e H NMR, it is 2 (8) 8.37 ppm. After 12 more days newproducts with u = 8.50 and 5 u = 8.54 ppm are observed, which may bedue eii:her to NTlhelates or NI’,’( bridged complexes [158].

Cytosine, a pyrimidine base, can also form a four membered chelate ringbetween the N3 atom of the ring and the exocyclic amino group at 4 [159].Macrocycle chelates may also be formed bween the N7 of 9uo and thephosphate group and cis-DDP in DNA as P NMR studies showed. Thephosphorous signal is shifted downfield by 1.4 ppm and this is not observedwith trans-DDP 160]. This result was also more recentlyinterpreted as due to a particular conformation of the oligonucleotidescalled hairpin-like [161, 162].

Indications for the formation of such bonds have also been 91ven for thereaction of cis-DDP with GMP, with fast atom bombardement massspectroscopic techniques, on the products of the reaction of 1:1stoichiometry [163].

In conclusion, the N706 chelate of guanine or any other oxopurine withcis-DDP has never been found yet in any crystal structure solved withX-rays, that unequivocally would prove its existence. Therefore theformation of such a chelate in vivo seems unlikely [164].

.(f) Interactions of cis- and trans-DDP with p.roteins and formation of DNA-Pt-protein crosslinks Cis-DDP reacts with plasma proteins and about 50%of the drug is bound there one hour after administration [24]. The mainbinding site of the drug is the sulfur of 91utathione [165-167] or thesulfydryl group of cysteine. This binding was correlated with the highernephrotoxicity of the drug compared to Iproplatin and Paraplatin [167].Due to the high trans-influence of PIII), ammonia liberation is observedin such reactions in the plasma, by N NMR spectroscopy [72]. Trans-DDPis bound to a larger extent than cis-DDP by histone proteins [168], whilecis-DDP reacts faster with non-histone proteins [169].

Both cis- and trans-DDP are bound to chromatine forming DNA-Pt-proteincrosslinks or IntraSCL of proteins [170-172]. Trans-DDP reacts mainly withthe S atoms of Cys, Meth, or with the nonprotonated His, at physiologicalpH 173-175].

More specifically, it was proposed that cis-DDP is forming selectivelycrosslinks between the low molecular weight and high mobility groupproteins HMG1 and HMG2 and DNA and that the bonding with the latter takesplace on the main groove, while the proteins retain an e-helix structure[175].

Cross]ink bonds are also foraed by both isomers wit.h non-histoneprot.eins of HeLa ce]]s, t.hough l:rans-DDP t.o a larger exl;ent,. Both isomersbind 1;o a larger proport.ion t,han in hist,one prot.eins due t.o the 9reat,er

174


methionine content of the latter [176, 177]. Such crosslinks have beencorrelated with the antitumor or cytooxic action of he drug [178-180].Since heir percentage is small however, this seems unlikely today [95].

Also, the DNA-Pt,-proein cross]inks for cis-DDP are more resisan orepairing enzymes than those for trans-DDP [181]. Furthermore, theformation of more DNA-Pt-g]uahione cross]inks of cis-DDP than oftrans-DDP, was explained wih the lower toxicity of the drug, since in hisway it forms a smaller number of 1,3-[ntraSCL with DNA [182].

Due to the easier formation of DNA-P-protein cross]inks by trans-DDP,the latter was used o map regions of t-RNA in he vicinit,aith,, a protein.For example, such a cross]ink is formed between the t-RNA of the yeastof Saccharomyces cereviase (G) and of the protein aminoacy]o-t-RNA-nva]--synthetase [183]. The sites of the cross]inks of trans-DDP are the onesof t-RNA

vathat strongly interac with the protein and in this way they

are determined [183].Proteins play an important role in he formation ot’ a "complex" with

DNA, once the IntraSCL ot 1,2-type wih cis-DDP are formed. For example,it is known that the tripeptide LysTrpLys form a stacking complex only withDNA treated with cis-DDP but not with trans-DDP. This was attributed tothe formation of certain parts with primary structure in the macromolecule[184].

In 1990 L ippard e a] [185] discovered a group of proteins, named DNADamage Recognition Proteins-DRP’s. These "recognize" i.e., form selectivecomplexes only with the 1,2-d(GpG) and d(ApG) IntraSCL of cis-DDP wih DNAand not with the 1,3-IntraSCL. They are also unable to recognize thecorresponding 1,3-IntraSCL of rans-DDP [185]$

The action of these proteins (NW=IXIO) as correlated with theunwinding of he DNA double helix, which in the case of 1,2-IntraSCL is

0 o13 while in he case of he 1,3-IntraSCL wih cis-DDP is 23 also o thebending of the helix axis in the 1,2-IntraSCL, being 35 [186].

Extensive work was done afterwards for determination of the structure ofthese proteins. :r was found [187-190] that hey be]on9 o he group ofhe non-hisone proteins and ca]led High Nobility Group, HNG1,2. HNG1 andHNG2 consist of 214 and 209 aminoacids respectively with N-terminalaminoacid 9]ycine and differ in 43 positions (about 20), e.g. in 6, 33,38, 56, 65, 71 etc. They are consisting of hree parts; one very acidic(C-terminal par) involving a]mos exclusively aspartic and 9]uamic acids,while the wo others are consisen of wo homogenic parts of 80 aminoacidseach.

The proteins have a spheric structure with a positively charged nucleusable to "bind" with DNA, through its negative charges, with electrostaticinteractions [187]. They have the ability (i) to bind strongly with theprimary rather than the secondary structure of DNA [191, 192], (ii) todestabilize or to unwind the DNA double helix [193], (iii) to promotesuperhelix formation of plasmids and (.i_yv) to replace histone proteins whenthey "bind" with DNA [187].

Vol. 2, No. 3, 1995

It was further proposed [187,crossed in a "X" shape, whichtype, They are formed during[187-189].


189] that they are forming two -helixesselectively also recognize DNA of crossedthe superhelix formation of natural DNA

It is believed that the 1,2-1ntraSCL of cis-DDP are protected by theseproteins and in this way are not "recognized" by cell enzymes leading tothe final death of the cell. This theory is under extensive investigation[190]. To this behavior of the proteins, the negative charge of theirterminal carboxylate groups, at physiological pH, may play an importantrole in the ability to form hydrogen bonds [187-189].

The 26 first aminoacids of two such proteins have been coded, with MW25.6 and 28 kiloDaltons and correspond to HM-I and HMG-2, respectively[194].

4. ELEMENTS OF PHARMOKOKINETICS OF cis-DDP PARAPLATIN AND IPROPLATIN.

Cis-DDP and carboplatin are administered intravenously in maximum dosesof I00 and 400 mg/m2 respectively, every 4 weeks. The first isadministered in a freshly prepared solution in distilled water withmannitol in 1-I stoichiometry. Paraplatin is diluted with a 5% dextrosesolution in water or with a 0.9 NaCl or with distilled water. After 3 hrsfrom the administration of cis-DDP, about 90% of the drug is bound with theplasma proteins, while in hr, 50% of it is bound [195]. Paraplatin onthe other hand is bound 50% only after about 6 hrs (Table I).

Table I. Comparison of pharmakokinetics of cis-DDP and Paraplatin

Half LifeFree Pt, non bound to proteinsPrecursor compoundUrine Excretion24 hrs3 days5-6 days

Parapl at n Ci s-DDP6 hrs lhr1.5 hrs 0.3-0.5 hrs

70% 30%8O%

40-50%

In conclusion, in the case of cis-DDP a prohydration of the patient isneeded and the intravenous administration is slow (solubility I mg/mol in0.9% NaCl solution), requirino often admission of the patient in hospitaland consequently, increasing the cost. Toxicity, nausea and vomitingtendency appear and are treated with the administration of high doses ofantiemetic agents. On the contrary, with Paraplatin there is no need ofprohydration. Owed to higher solubility, the administration is fast andthe patient is not staying in hospital. Most important, its toxicity issmaller, with myelosuppression the dose limiting toxicity, while nausea andvomiting are treated with lower doses of antiemetics.

Therefore paraplatin or carboplatin shows comparative advantages thancis-DDP having lower toxicity, thus allowing increase in dose up to 400m9r/m2 and lower cost of therapy. Also, its aqueous solutions (0.9 NaCl)

176

V. Aletras, D. Hadfiliadis and N. Hadfiliadis Metal Based Drugs

are stable for a long time and they should not be freshly prepared beforeuse, like cis-DDP.

The mechanisms, of action of cis-DDP and carboplatin are similar, i.e.,carboplatin like cis-DDP react with DNA and form InterSCL and IntraSCL, aswell as lntraSCL of DNA-Pt-protein type [196]. In aqueous solutions, the1,1-cyclobutane dicarboxylic anion is liberated in two steps, with breakingfirst of one Pt-O bonding and simoultaneous nucleoph]lic addition of water

41 c I owe (or of other ligands, in vivo) wit+k1:8.0X10- sec- a 2 1 byits complete release with k^=k[ and k=1.BIX10- dm mol s (acidcatalyzed). The inverse reactions (formation of the chelate) s not takingplace in the presence of acid [197].

The rate constant 7fo the overall hydrolysis of carboplatin was0estimated to be 7.2XI0 s in phosphate buffer solution of pH-7 at 37 .As exposed, it seems that the reaction of carboplatin with DNA proceeds intwo steps, i.e., formation of a monodentate complex first and a bidentateafterwards. Based on the hydrolysis constants, the quantity of carboplatinrequired to achieve the same percentage of binding with DNA, as cis-DDP,was calculated to b aout 100 times larger than the latter (under similarconditions, k-8X10- s- ), although in vivo a 20-40 fold excess seems to beenoulh [198].

In summary carboplatin, (i) is about 45 times less toxic than cis-DDP,(i__i) the IntraSCL that it forms with DNA appear 12 hours later than thoseof cis-DDP and (iii) the IntraSCL DNA-proteins that it forms show theirmaximum quantity 6 hours later than the corresponding ones with cis-DDP[ ].19"H NMR studies show that cyclobutane is rotating fast around thecarboxylate groups, bonded to Pt(11), in carboplatin [200]. lt6wa alsoshown [201] that carboplatin reacts faster with 5’-GMP (k=4.1X10- s- ) thanthe phosphates (k=4,alO-Ts-1) and chloride (k=1,210

-6 -1s ) or water (k

Vol. 2, No. 3, 1995

5. CONCLUDING REMARKS.

On the Mechanism ofAction ofthe AntitumorDrug cis-Platin (eis-DDP)and Its Second Generation Derivatives

Despite the great deal of work performed on the subject, there is nodefinitive conclusion concerning the mechanism of action of cis-DDP, sincethere are still unanswered questions e.g., the non recognition of the1,2-1ntraSCL by cell repairing mechanisms, while they are related with DNAreplication. It can however be argued that the 1,2-IntraSCL may consitutethe main damage caused by cis-DDP to DNA, thereby leading to antitumoraction.

The ability of cis-DDP to form 1,2-IntraSCL with d(ApG) and d(GpG) andthe inability of trans-DDP to act similarly and form only 1,3-IntFaSCL withd(GpXpG) as well as InterSCL, may also be the main difference of the twoisomers, leading to antitumor action for the former and to toxicity onlyfor the latter. Cis-DDP causes a greater distortion to the secondarystructure of DNA, while trans-DDP causes a greater local distortion, i.e.,near the platination site.

The conformation of the sugar at 5’ may also play an important role inthe mutagenic and toxic dose of the drug during the formation of theI, 2- I r’Ft raSCL.

REFERENCES

1. A. Werner, Z. Anorg. All9. Chemie, 3, 267 (1893).2. G.H.W. Milburn and M.R. Trutter, J.Chem. Soc.(A), 1608(1966)3. R.G. Pearson, J. Chem. Educ., 45, 581 (1968)4. J. Chatt, L.A. Duncanson and L.M. Venanzi, J. Chem. Soc., 4456 (1955)5. I.I. Chernyayev, Ann. Inst. Platine SSSR, 4, 261 (1926)6.a.D. Banerjea, F. Basolo and R.G. Pearson, J.Am. Chem. Soc., 7_9, 4055

(1957)b. F. Basolo and R.G. Pearson, Progr. Inor9. Chem., 4, 381 (1962)

7. S.S. Zumdahl and R.S. Drago, J.Am. Ohem. Soc., 9__0, 6669 (1968)8. S.J.S. Kerrison and P.J. Sadler, J. Chem. Soc. Dalton Trans., 2363

(1982)B. Rosenber9, L. van Camp and T.Krigas, Nature, 20___5, 698 (1965)B. Rosenberg, E. Reinshaw, L.van Camp, J. Hartwick and J. Drobnik, J.Bacteriol, 93, 716 (1967)B. Rosenberg, L. Van Camp, E.B. Gringley and A.J. Thomson, J. Biol.Chem, 24___2, 1347 (1967)B. Rosenber9, L. van Oamp, J.E. Trosko and V.H. Mansour, Nature, 22___2,385 (1969)B. Rosenber9, Die Natu.rwiss, 60, 399 (1973)B. Rosenber9, Biochimie; 60, 859 (1978)See for example, "6th International Symposium on Platinum and OtherMetal Coordination Compounds in Cancer Chemotherapy", eds UCSD, SanDiego, California, USA, Jan 23-26, 1991, pp. 118,119,126,138,144,146,148and references sited there in.M.W. Fiorentino and G. Ghiotto, Inorg. Ohim. Acta, 13__Z7, 59 (1987)M. Green, M. Garner and D.M. Orton, Trans. Met. Chem, 1_Z7, 164 (1992)B. Rosenberg, Cancer (Phil.), 5_5, 2303 (1985)

13.14.15.

16.17.18.

178

K Aletras, D. Hadfiliadis and N. Hadjiliadis Metal Based Drugs

19. M.J. C]eare and J.D. Hoesche]e, Bioinorg. Chem., _2, 187 (1973)20. T.A. Connors, M. Jones, W.C.J. Ross, P.D. Braddock, A.R. Khokhar and

M.L. Tobe, Chem.-8io]. [nteractions, 5:4!5 (1972)21. K.P. Beaumont, C.A. Mc Au]]iffe and M.J. C]eares, Chem.- Biol.

Interactions, 14, 179 (1976)22. M.J. C]eare, P.O. Hydes, B.W. Ma]ebi and P.M. Watkins, Biochimie, 60,

835 (1978)23. J.J. Roberts and A.J. Thomson, Progr. Nuc]. Acids Res., 2_2, 71 (1979)24. M.J. C]eare, P.C. Hydes, D.R. Hepborn and B.W. Ma]erbi, in "CISPLATIN-

Current Satus and New Developments", A.W. Prestayko, S.T. Crooke andS.K. Carter eds, N.Y. Academic Press, pages 149-170 (1980).

25. A.J. Thomson, R.J.P. Williams and S. Reslova, Struct. and Bonding, I__LI,(1972)

26.a.J. Reedik, A.M.J. Fichtinger Shepman, A.J. van Oseroom and P.van de Pue, Struct. and Bonding, 67, 53 (1987)

b. A.I. Stesenko, M.A. Presnov and A.L. Konova]ova, Russ. Chem. Rev.,50, 353 (1983)

27. J. Reedijk, Inorg. Chim. Aca, 1_9_8, 873 (1992)28. P. K6uf-Maier and H. Kbpf, Die Naturwiss., 73, 239 (1986)29. N. Fare]], S.G. de A]meida and K.A. Skov, J.Am. Chem. Soc., 11__0, 5018

(988)30. N. Farell and Y.Qu, Inorg. Chem, 28, 3416 (1989)31. N. Farell, Y.Qu.and N.P. Hacker, J. Med. Chem., 33, 2179 (1990)32. A.Peritz, S.A1.Baker, J.F. Vollano, J.E. Schurig, W.T. Brudner and

J.C. Dabrowiak, J. Med. Chem., 33, 2184 (1990)33. N. Farell, D.M. Killey, W.Schmidt and M.P. Hacker, Inorg. Chem., 29,

397 (990)34. N. Farell, T.T.B. Ho, J.P. Souchard, F.L. Wimmer, S.Cros and N.P.

Johnson, J. Med. Chem., 3_2, 2240 (1989)35. N. Farell and M.V. van Beusichem, Inorg. Chem., 3_1, 634 (1992)36. N. Farell, L.R. Kelland and M.V. Beusichem, Cancer Res., 5_2, 5065

(1992)37. L.S. Hollis, A. R. Amundsen and E.W. Stern, J. Ned. Chem., 32, 128

(1989)38. L.S. Hollis, W.J. Sundquist, J.W. Burstyn, W.J. Heiger- Bernays, S.F.

Bella, K.J. Ahmed, A.R. Amundsen, G.W. Stern and S.J. Lippard, CancerRes, 5__1, 1866 (1991)

39. L.K. Webster, E.B. Deacon, D.P. Buxton, B.L. Hiicoat, A.M. James,J.A.G. Roos, R.J. Thomson, L.P.G. Wakelin and T.L. Williams, J. Med.Chem., 35, 3349 (1992)

40. P. Caputo, F.P. Intini, G. Natile, M. Coiuccia, F. Loseto and A. Nassiin Greek- Italian Meeting on Chemistry of Biological Systems andMolecular Chemical Enginneering Cetraro, Italy, October 6-9, 1992,Proceedings, pages 11-12.

41. M. Colucia, A. Nassi, F. Loseto, A. Boccarelli, M.A. Mariggio, D.Giordano, F.P. InLini, P. Caputo and G. Natile, J. Med. Chem., 36, 510(1993)

42. N. Farell, Transition Metal Complexes as Drugs and ChemotherapeuticAgents 1st Eds, London, kiuwer Publ., 1989, chapt. 2.4.1.

43. P. Horace and J. Drobnik, Biochim. Biophys. Acta, 254, 341 (1971)4. N. Hadjiliadis and T. Theophanides, Can. J. Spectrosc., 1__6, 135 (1971)45. N. Hadjiliadis, P. Kourounakis and T. Theophanides, Inorg. Chim. Acta,

7, 226 (1973)

179

Voi. 2, No. 3, 1995 On the Mechanism ofAction ofthe Antitumor Drug cis-Platin (cis-DDP)and Its Second Generation Derivatives

47.48.49.50.51.

52.53.54.55.56.

71.72.73.

75.76.77.78.

A. Terzis, N. Hadjiliadis, R. Rivest and T. Theophanides, Inorg. Chim.Acta, I2, L_ (1975)N. Hadjiliamis, and T. Theophanides, Inorg. Chim. Acta, I6, 67 (1976)N. Hadjiiiadis, and T. Theophanides, Inorg. Chim. Acta, I__6, 77 (1976)L. G. Marzilli, Progr. Inorg. Chem., 23 255 (1976)D. J. Hodgson, Progr. .norg. Chem., 23, 211 (1976)R. B. Martin, Frontiers in Bioinor9anic Chemistry ", eds. AntonioXavier, Verla9 eds., Weinheim, Germany, (1986), pages 71-79.N. Hadjiliadis, Chim. Chron. (Gen. Eds.), 5_2, 148 (1987)R.B. Martin, Acc. Chem. Res., I__8, 32 (1985)B. Lippert, Gazz. Chim. Itai. 118, 153 (1988)B. Lippert, Comments Inorg. Chem., 3__Z7, (1989)S.E. Miller, K.J. Gerard and D.A. House, Inorg. Chim. Acta, 19___0, 135(1991)D.S. Martin and R.J. Adams in "Advances in the Chemistry of theCcordination Compounds", Macmillan eds, N.Y., 1961, pages 579-589.N.C. Lira and R.B. Martin, J. Inorg. Nuc]. Chem., 3__8, 1911 (1976)D.N. Orton, V. Gretton and N. Green, Inorg. Chim. Acta, 20, 265(1993)T.G. Appleton, A.J. Bailey, K.J. Barnham and J.R. Hail, Znorg, Chem.,3_!, 3077 (1992)C.J. Abraham, K.J. Gerard and D.A. House, Inorg Chim Acta, 209, 149(1993)C.J. Boreham, J.A. Broomhead and O.P. Fair]ie, Aust. J. Chem, 3_4, 659(98)T.G. Appleton, R.D. Berry, C.A. Oavis, J.R. Ha]] and H.A. Kim]in,Inorg Chem., 23, 3514 (1984)R. Faggiani, B. Lipper, C.J.L. Lock and B. Rosenberg, [norg. Chem.,1_Z7, 1941 (1978)R.Faggiani, H.E. Howard Lock, C.J.L. Lock, B. Lipper and B.Rosenberg, Can. J. Chem., 6_QO, 529 (1982)R. Kuroda, S. Neid]e, I.N. T_smai] and P.J. Sad]er, Inorg. Chem., 22,3620 (1983)P.P. Gate]y and S.B. Howell, Br. J. Cancer, 67, 1171 (1993)H. Timmer- Bosscha, N.H. Nu]der and E.G.E. de Vries, Br. J. Cancer,6__6, 227 (1992)S.J. Berners- Price and P.W. Kuche], J. Inorg Biochem., 38, 305(1990)S.J. Berners- Price and P.. Kuche], J. Inorg Biochem., 38, 327(1990)R.E. Norman, J.O.Ranford and P.J. Sad]er, Inorg. Chem, 3_L1, 877 (1992)R.E. Norman and P.J. Sad]er, Inorg. Chem., .27, 3583 (1988)J.D. Bell, R.E. Norman and P.J. Sadler, J. Inorg. Biochem., 3_L1, 241(1987)R. Wing, H. Drew, T. Takano, C. Broka, S. Takano, O. Ishira and R.Dickerson, Nature 287, 755 (1980)D.E. Thurston and A.S. Thomson, Chem. Brit, 26, 767 (1990)U. Pindur, M. Haber, and K. Sattler, J. Chem. Educ., 70, 263 (1993)O. Kenn and W. Hunder, Angew. Chem. (Int. Ed. Engl) 30, 1254 (1991)S. J. Lippard, Acc. Chem. Res., 11, 211 (1978)

180

V. Aletras, D. Hadjiliadis and N. Hadjiliadis Metal Based Drugs

79. N.]:. Sundquist and S.J. Lippard, Coord. Chem. Revs., 293 (1990)80. E.C. Long and J.K. Barton, Acc. Ohem. Res., 23, 273 (1990)81. J.K. Barton, Comments [norg. Chem., 3, 321 (1985)82. A.H.J. /an9, J. Nahans, G. van der Mare], J.H. van Boom and A. Rich,

Nature, 276, 171 (1978)83. N. N. Kosic, Comments Inorg. Chem., _8 137 (1988)84. H. Nasuda and O. Yamauchi, Inorg. Chim. Acta, 13___6, L (1987)

2385. A. Odani, R. Shimada, H. Nlasuda and O. Yamauchi, Znorg. Chem., 30,

’2133 (1991)86. O. Yamauchi, A. Odani, R. Shimada and Y. Kosato, Inor9. Chem., 25,

3337 (1986)87. N.V. Keck and S.J. Lippard, J. Am. Chem. Soc., 114, 3386 (1992)88. E.O.N. Lempers, J.S. Boshkin and N.N. Kostic, Nuc]. Acid. Res., 2__L1,

1983 (1993)89. A.N. Bray, D.P. Kelly, P.O.L. Noch, R.F. Martin and L.P.G. /ake]in,

][norg. Chem., 43, 629 (1990)90. R.V. Gessner, G.J. (uig]ey, A.H.J. /ay, G.A. van der Mare], J.H. van

Boom and A. Rich, Biochemistry, 24, 237 (1985)91. M.D. Rei]y, T.W. Hamb]ey and L.G. Narzi]], J. Am. Chem. Soc., 11___0,

2999 (1988)92. N. Krauss, H. Bosch and K.J. Miller, J. Am. Chem. Soc., 11___0, 4517

(1988)93. L.G. Narzi]]i and T. Kis.enmaher, Acc. Chem. Res., 10, 146 (1977)94. H. Sige], Chem. Soc. Revs., 2;2, 213 (1993)95. S.E. Sherman and S.J. Lippard, Chem. Revs., 8_Z7, 1153 (1987)96. J.A. How]e and G.R. Gale, Biochem. Pharmaco], 1__9, 2757 (1970)97. G.L. Cohen, /.R. Bauer, J.K. Barton and S.J. Lippard, Science, 20:3,

1014 (1979)98. B. Lippert, Biometa]]s, 5, 195 (1992)99. A.N.J. Fichtinger Schepman, J.L. van der Veer, J.H.J. den Hartog,

P.H.N. Lohman and J. Reedi.jk, Biochemistry, 24, 707 (1985)100. L.A. Zwe]]in9, in "Platinum and Other Metal Chemotherapeutic Agents",

ACS Symposium Series, v. 209, Ed. S.J. Lippard, A.C.S., /ashingtonD.C., (1983), pages 2749

101. S.L. Bruhn, J.H. Toney and S.J. Lippard, Progr. ]norg. Chem., 38, 477(1990)

102. K. Hemminki and /.C. Thi]]y, Murat. Res. 202, 133 (1988)103. V. Narasimham and A.N. Bryan, FEBS Lett, 54, 49 (1975)104. P.J. Stone, A.D. Ke]man and F.N. Sinex, Nature, 251, 736 (1974)105. A.D. Ke]man and /. Buchbinder, Biochimie, 60, 901 (1978)106. J.D. Tu]]ins, H.N. Ushay, C-N. Nenke], J.P. Caradonna and S.J.

Lippard, in "Platinum and Other Metal Chemotherapeutic Agents", Ed.S.J. Lippard, A.C.S., Washington D.C., (1983), pages 51-74 andreferences sited therein.

107. J.P. Oaradonna and S.J. Lippard, in "Platinum Coordination Complexesin Cancer Chemotherapy". ed. M.P. Hacker, E.B. Doupie and I.H.Krakoff, tartinus Nijhoff Publ., Boston, (1984), pages 14-26 andreferences sited therein.

108. R. Royer Pukora, L.K. Gordan and W.A. Haseltine, Nucleic Acids Res.,_9, 4595 (1981)

109. K. Inagaki, K. Kasuyo and Y. Kidani, Inorg. Chim. Acta, 91, L (1984)13

181


110. A. Eastman, Biochemistry, _2_.1_, 6732 (1982)111. A. Eastman, Biochemistry, 2_, 3927 (1983)112. A. Forsti, R. Laatikainen and K. Hemmink., Chem. Biol. Interactions,

63, (1987)113. J.P. Caradonna, S.J. Lippard, N.J. Gai and II. Singh, J. Am. Chem.

Soc., 104, 5793 (1982)114. J.P. Caradonna and S.J. Lippard, Znorg. Chem., 2_Z7, 1454 (1988)115. C.A. Lepre, L.G.Strethkamp and S.J. Lippard, Biochemistry, _2_6, 5651

(1987)116. A. Eastman, M.M. Jemmerwein and D.L. Nage], Chem. Biol.

]:nteractions, 6_Z7, 71 (1988)117. A.L. Pinto and S.J. Lippard, Proc. Natl. Acad. Sci. (USA), 82,

4616 (1985)118. D.P. Bancroft, C.A. Lepre and S.J. Lippard, J.Am Chem. Soc., 11___2, 6860

(990)119. J.H.J. den Hartog, C. A]ona, J.H. van Boom, G.A. van der Mare],

G.A.G. Haasnoo and J. Reedik, J. Am. Chem. Soc., 10___6, 1528 (1984)120. S.E. Sherman, O. Gibson, A.H.J. Wang and S.J. Lipparu, Science, 23___0,

412 (!985)121. S.E. Sherman, D. Gibson, A.H.J. Wang and S.J. Lippard, J. Am. Chem.

Soc., 110, 7368 (1988)122. J.H.J. den Harog, G. A]tona, J.C. Chotard, J.-P. Girau], J.-Y.

La]]emand, F.A.A.M. de Leeuw, A.T.M. Marce]is and J.Reedik, Nuc].Acids Res., 10, 4715 (1982)

123. G. Admiraa], J.L. van der Veer, R.A.G. de Graaf, J.H.J. den Harog andJ. Reediik, J. Am. Chem. Soc., 10!), 592 (1987)

124. J.C. Dewan, J. Am. Chem. Soc., 10___6, 7239 (1984)125. A. Jack, J.E. Ladner, D. Rhodes, R.S. Brown and A. K]ug, J. Mo]. Bio],

111 315 1977)126. J. Koze]ka, G.A. Pesko, G.J. Quig]ey and S.J. Lippard, Znorg Chem.,

25, 1075 (1986)127. J. Koze]ka, G.A. Pesko, G.J. Quig]ey and S.J. Lippard, J. Am. Chem.,

Soc., 10___Z7, 4079 (1985)128. A. Laoui, J. Koze]ka and J.-C. Chotard, ]:norg, Chem., 27, 2751 (1988)129. J.A. Rice, D.M. Crothers, A.L. Pinto and S.J. Lippard, Proc. Nat].

Acad. Sci. (USA), 85, 4158 (1988)130. J. Koze]ka, S. Archer, G.A. Petsko, S.J. Lippard and Q.J. Quig]ey,

Biopo]ymers, 2_6, 1245 (1987)131. F. Herman, J. Koze]ka, V. Stoven, E. Gui]le, J.P. Girau]t, T. Huyn+h

Oinh, J. [go]en, J.-Y. La]]emand and J.-C. Chottard, Eur. J.Biochem.194, 119

132. L.J.N. Bradley, K.J. Yarema, S.J. Lippard and J.M. Essigman,Biochemistry, 3__2, 982 (1993)

133. D. Burnouf, C. Gouthier, J.-C. Chottard and R.P.D. Fuchs, Proc. Natl.Acad. Sci. (USA), 87, 6087 (1990)

134. A. Forsti, P. Vodicke and K. Hemminki, Chem.- Biol. Interactions, 74,253 (1990)

135. A. Eastman, Biochemistry, 25, 3912 (1986)136. J.J. Robers and F. Friedlos, Chem. Biol. Interactions, 39, 181

(1982)

182


137. V.A. Bohr, E. Reed and W. Zhen, in "Platinum and Other MetalCoordination Compounds in Cancer Chemotherapy", ed. S.B. Howell,Plenum Press eds., N.Y., (1991), pages 231-240

138. J.P. 4acquet and T. Theophanides, Bioinorg. Chem., 5, 59 (I975)139. A. Eastman, Biochemistry, 24, 5027 (1985)140. M. Sip, A. Schwartz, F. Vavelle, M. Ptal and M. Leng, Biochemistry,

31, 2508 (1992)141. J.N. Pascoe and J.J. Roberts, Biochem. Pharmacol., 23, 1345 (1974)142. J.M. Pascoe and J.J. Roberts, Biochem. Pharmacol., 2, 1359 (1974)143. L.C. Erickson, L.A. Zwelling, J.M. Ducore, W.A. Shariey and /. Kohn.

Cancer Res., 4_1, 2791 (1981)144. L.A. Zweliing, T. Anderson, and W. Kohn, Cancer Res., 39, 365 (1979)145. P. Gibson and S.J. Li.o.uard, Inorg. Chem, 2_6, 2275 (1987)146. j.H.J, den Hartog, C. Altona, J.H. van Boom, A.T.M. t4arcelis, G.A. van

tier Marei, L.J. Rinkie, G. Wiile- Hazeleger and J. Reedijk, Eur. J.Bioclem, .13. _4, 485 (1983)

t47. C.A. Lepre, L. Chassot, C.E. Castello and S.J. Lippard, Biochemistry,29, 811 (1990)

148. H.N. Ushay, T.D. Tullius and S.J. Liuuard, Biochemistry, 2__QO, 37441981

149. K.M. Comess, C.E. Castelio and S.J. Lippard, Biochemistry, 2_29, 2!02(1990)

150. J.P. Maquet and T. Theouhanides, inorg. Chim Ac%a, 18, 185 (1976)151. G. Pneumatikakis, N. Hadjiiiadis and T. Theo.uhanides, inorg. Chim

Acta, 2_2, L (1987)152. G. Pneuma]KaK]S, N. Had.jiliadis and T. Theo.han]des, inorg. Chem.,

i7, 915 (1978"!53. t’J. Hac.iqiadis and G. Pneumatikakis, J. Chem Soc. Daqton Trans.. 1691

(i978)

154. D. Oozak, A. Na.dqey, .4.J. O]iver and A.L. Beaucham.u, Znorg Chem., 25,’;600 (1986

155. A.L. 8eaucnamu and F. Beqanger-Gariepy, Znorg. Chim. Aca, 124, L..986

56. E. Coqacio, J. Suarez- Vareqa, J.N. Oominguez- Vera, J.C.Avqa-Roson, N.A. Hidaqgo and O. t4artin-Ramos, Znorg. Chim. Acta, ’_202,2!9 (1992)

157. J. Lorerth, /. Nassa, N. =. Essawi and L. Labib, Angew, Chem. (int.Ed. Er, gq.), 27, 1160 (1988)

158. G. Frommer, H. Preu and B. Lipper, Znorg. Chim. Aca: !93. 111(1992)

159. B. Li.Dper, H. Scho]]norn and U. Thewa], J. Am. Chem. Soc., 10__5,6616, (1986)

160. C.S. Fonts, M.D. Rei]y, L.G. Narzi]]i and G. Zon: Tnorg. Chim. Acta,137. (1987)

161. L.G. Narziiqi, C.S. Fonts-. T.P. K]ine and G. Zon, in "P]atlnum andOthe Meta] Coordination "r ,omuounds in Cancer ChemotherapyNico]ini and G. Bando]i, it. Chem. Soc, A]uano Terme (Padua,, italy.!987, pp. 75

183

Vol. 2, No. 3, 1995 On the Mechanism ofAction ofthe AntitumorDrug cis-Platin (cis-DDP)and Its Second Generation Derivatives

!62. P.G. Yohannes, G. Zon, P.. Doetsch aria L.G. Marzilli, J. Am. Chem.Soc., 115, 5105 (1993)

163. N1. Green and J.M. Miller, J. Chem. Soc. Chem. Commun., 1864164. A. ;tikoiaou V Theodorou and N Hadjiiiadis, inorg "him Acta

208, ’9! !993)i65..A. Arrick and C.F. Nathan, Cancer Res, _44, 4224 (1984)166. A. Eastman, Ohem.- Biol. interactions. 6__L1, 241 (1987)167. B.J. Carter-, !norg. ,Shim. Acta, 1.3___Z7, 1’25 (1987)168. B. Oden!!eimer and W. Wolf, inorg. Ciqim. Acta.. 6_.5_, L169. J. Filipski, K.W. Kohn and W.M. Bonnet, FEBS Letteri15___2, 105 (1983)170. J.J. Huyes and W.M. Scovel], Biochim. et Biophys. Acta, 1088, 413

(1991)171. L.A. Zwelling, S. Michaels, H. Schwartz, P.P. Dobson and K.W. Kohn,

Cancer Res, 4_&1, 640 (1981)172. F. Olinski, A. Nedrychowski, W.N. Schmidt, R.C. Briggs and L.S.

Hnilica, Cancer Res, 4_Z7,201 (1987)173. G.A. Petsko, Methods Enzymol., 114, 147 (1985)174. G.A. Persko, D.C. Philips, R.J.P. /illiams and I.A. Wilson J. Mol.

Biol., 120, 345 (1978)175. W.M. Scovell, N. Murhead and L.R. Kroos, Biochem. Biophys. Res.

Commun., 14___2, 826 (1987)176. Z.M. Banjar, L.S. Hnilica, R.C. 8riggs, J. Stein and G. Stein,

Biochemistry, 2, 1921 (1984)177. R.B. Ciccarelli, N.J. Solomon, A. Varsavsky and S.J. Lippard,

Biochemistry, 24, 7533 (1985)178. L.A. Zwelling, J. Filipski and K.W. Kohn, Cancer Res., 39, 4989 (1979)179. L.A. Zwelling, T. Anderson and K./. Kohn, Cancer Res., 3_9, 356 (1979)180. ACM Ploy, A. van Dijk and P.H.M. Lohmann, Cancer Res., 44, 2043 (1984)181. A.J. Fornace and P.S. Seres, Mutation Res., 94, 277 (1982)182. A. Eastman and M.A. Barry, Biochemistry, 26, 3303 (1987)183. M.A. Tukaio, M-D Kubler, D. Kern, M. Mongel, C. Ehresmann, J.-P. Ebel,

B. Ehresmann and R. Giege, Biochemistry, 2_6, 5200 (1987)184. T. Le Doan, M. Guigues, J.-J Toulme and C. Heiene, Biochim. Biophys.

Acta, 82___5, 353 (1985)185. B.A. Oonahue, M. Augot, S.F. Bellon, D.K. Treiber, J.H. Toney, S.J.

Lippard and J.M. Essigmann, Biochemistry, 29, 5872 (1990)186. S.F. 8ellon, J.H. Coleman and S.J. Lippard, Biochemistry, 3__QO, 8026

(1991)187. M.E. Bianchi, M. Beltrane and G. Paonesca, Science, 243, 1056 (1989)188. D.M.J. Lilley, Nature, 3..5..7, 282 (1992)189. R. Baum, Chem. Engineer. News, 19 (1992)190. B.L. Vallee and P.S. Auld, Acc. Chem. Res., 2_6, 543 (1993)191. J.M. Berg, Inorg Chem, 37, 144 (1989)192. B.D. Rhodes and R. Klug, in "Spectrum der Wissenschaft", p. 54 (1993)193. N.P. Pavlevitch and C.O. Pabo, Nature 25___3, 809, (1991)194. P.E. Nichen, C. Jeppeson and O. Bucharest, FEBS Lett, 23___5, 122 (1988)195. A.W. Prestayko, in "CISPLATIN- Current Status and New Developments",

Eds A.W. Prestayko, S.T. Crooke and J.K. Carter, N.Y. Academic Press,1980, pages 1-7

19.6. R.J. Knox, F. Friedlos, D.A. Lyndall and J.J. Roberts, Cancer Res.,4__#6, 1972 (1986)

184

K Aletras, D. Hadfiliadis and N. Hadjiliadis Metal Based Drugs

197. L. Canovese, L. Cattalini, G. Chessa and M.L. Tobe, J. Chem. Soc.Dalton Trans., 2135 (1988)

198. R.J. Knox, F. Friedlos, D.A. Lynda!] and J.J. Roberts, Cancer Res.,46, 1972 (1986)

199. K.C. Micetich, D. Barnes and L.C. Erickson, Cancer Res., 45, 4043(1985)

200. S. Neidle, I.M. Ismail and P.J. Sadler, J. Inorg. Biochem, 13, 205(1980)

201. U. Frey, J.O. Ranford and P.J. Sad]er, [norg. Chem., 32, 1333 (1993)202. E.E. B]at.t.er, J.F. Vo]]ano, B.S. Krishnan and J.C. Dabrowak,

Biochemistry, 23, 4817 (1984)203. D.J. Evans and N. Green, [norg. Chim. Act.a, 130, 183 (1987)204. D.J. Evans and N. Green, J. Chem. Soc. Chem. Commun., 124 (1987)205. R.J. Brandon and J.C. Dabrowiak, J. Ned. Chem., 27, 861, (1984)

Received: February 8, 1995 Accepted- February 20, 1995 Received inrevised camera-ready format: April 11, 1995

185

hadjiliadis - hindawi publishing corporationmechanism of action of the antitumor drug ci___s-platin...

Documents