gstm1 gene polymorphism in sporadic breast cancer patients
TRANSCRIPT
GSTM1 gene Polymorphism in Sporadic Breast Cancer Patients
Sateesh Chandra Gupta
Overview Cancer Breast cancer sporadic ,familial and hereditary breast cancer Types of Breast Cancer Stages of Breast cancer causes of breast cancer Genetic, Environmental, Life style and hormonal factor Polymorphism Classes of polymorphism Role of polymorphism in breast cancer glutathione S-transferase (GST) Glutathione S-transferase Mu1 ( GST M1) Work Flow Result Reference
BACKGROUND
Cancer
Cancer is a group of more than 100 disease that developed across time and involved the uncontrolled cell division of body.
Cancer are arise from the loss of normal growth control.
In normal tissue, the rate of new cell growth and old cell death are balance with the process known as cell division and apoptosis respectively.
In cancerous cell this balance is disrupted.
Breast cancer
Breast cancer is the most common type of cancer (29%) among women in the world
An estimated 40,730 breast cancer deaths (40,290 women, 440 men) are expected in 2015. Breast cancer ranks second as a cause of cancer death in women (after lung cancer).
The risk of breast cancer increases with age and most breast cancers occur after the age of 50.
(America Cancer Society, 2015 )
Breast Cancer is a malignant tumor that start in the cells of breast. A malignant tumor is a group of cancer cells that can grow(invade)
into surrounding tissue or spread (metastasize) nearby area of the
body.
Breast CancerThe disease occur almost entirely in the women but men also get it.
Most commonly from inner lining of milk duct or lobules that supply ducts with milk.
Cancer originating from duct are known as ductal carcinoma, while those originating from lobules are known as lobular carcinoma.
Hereditary
Breast cancer
Sporadic Familial
Approximate 10%
Clustering within family.
Not hereditary
Early onset than sporadic cancer.
Risk factor - same life style of a family.
.
Approximate 85 %
Late onset
Risk factor –age exposure to environmental carcinogens,
Hormone and Lifestyle .
Approximate 5-7 %. Same type of cancer
in the family. Early onset. Bilateral. Having strong
family history. results from same
genetic and environment or lifestyle factors.
Breast carcinoma
Invasive Breast CarcinomaNon-invasive Breast CarcinomaDuctal Carcinoma.Lobular Carcinoma. Invasive Ductal Carcinoma
Invasive Lobular CarcinomaInflammatory CarcinomaSecretary CarcinomaTubular Carcinoma
Receptor specific Breast cancer
Receptor
Hormone Receptor (HR)
Tyrosine Kinase Receptor
Estrogen Receptor(ER) Progesterone Receptor(PR) HER2 Receptor
ER Positive ER Negative PR Positive PR Negative
HER2 Positive HER2 Negative
Triple Negative Breast Cancer are Estrogen Receptor(ER), Progesterone Receptor(PR) and Human Epidermal Growth Receptor 2(HER2) negative ,Hence called as triple negative breast cancer
Causes of Breast Cancer
GENETIC The genome is susceptible to damage by both intrinsic( like Cell
division errors) and extrinsic factors(carcinogens and radiations) .
Certain genes called Tumor Suppressor genes (BRCA1, BRCA2, TP53, ATM and PTEN) are involved in maintenance of genomic stability.
Mutations that impair their function predisposes an individual to develop cancer.
Accumulation of mutations causing DNA damage transforms a normal cell to a cancerous cell.
( Emel Ergul Ali Sajki et al. 2000 )
Environmental Factor Natural or synthetic substances in environment that can cause
cancer are called environmental carcinogens.
Divided into Chemical agents - Lead, cobalt, asbestos, nitrosamine and many type
of pesticide. Physical agents – X- rays, Gamma rays and Ultraviolet rays
Light at Night (LAN Hypothesis)
May decrease the synthesis of melatonin- change in melatonin may
affect the level of estrogen and initiate the breast cancer.
(Richard G Stevens 2009)
LIFE STYLE
SMOKING and ALCOHOL DRINKING
Each cigarette contains a mixture of carcinogens including polycyclic aromatic hydrocarbons (PAHs), N-nitrosamines, NO2 and free radicals .
Cytochrome P-450 enzymes (P-450s) convert the carcinogens to more reactive forms which bind to DNA and form DNA adduct.
Alcohol in the body converts into the aldehyde. Acetaldehyde converts into the Reactive Oxygen Species (ROS),which react with DNA to form DNA adducts, which may initiate cancer.
Alcoholic beverage consumption in women also causes an increase in levels of endogenous estrogens hormone.
Smoke & alcohol carcinogens in cancer..
Metabolic Activation
Metabolic Detoxification Repair
Excretion Normal DNA
Uptake of Smoke &Alcohol
Carcinogen
DNA Adduct
Mutation in DNA repair
genes and Tumor -
suppressor genes
Loss of normal growth control
mechanism
Cancer
HORMONAL
Estrogens and progesterone are essential hormone for normal
breast development. The main estrogens are estradiol and estrone,
as well as 16-hydroxyestradiol (estriol).
Estrone and estradiol hydroxylated at positions
C2, C4 and C16
(2 hydroxyestrone, 4 hydroxyestrone 2-hydroxyestradiol, and 4-hydroxyestradiol), and 16a-hydroxyestrone.
carcinogenic potential by damaging DNA
Estrogen Catabolism... COMT GST
CYP450 CYP450 DNA
CYP450 1A2
CYP450 1B1
CYP450 CYP450 DNA
COMT GST
2-Methoxy Estrogens
2-Hydroxy estrogen
Estrogen
E,2,3 semi Q E,2,3 Q
Glutathione Conjugate
4-Hydroxy estrogen E,4,3 semi Q E,4,3 Q DNA Adduct
Glutathione Conjugate4-Methoxy estrogen
CANCER
DNA Adduct
Premenopausal Postmenopausal
Estrogen
Ovaries adipose tissue, muscle liver
ERER
Breast Cancer
Ovarian removal Aromatase Inhibitors
Tamoxifen Tamoxifen
Receptor Mediated Carcinogenesis of Estrogen
x P0LYMORPHISm polymorphism is a DNA sequence variation that seen in more than
1% in normal population. In this case no single allele is regarded as the standard sequence. There are two or more acceptable alternatives.
Classes of polymorphism
Single Nucleotide Polymorphisms (SNP): is a genetic variation when a single nucleotide (i.e., A, T, C, or G) is altered .
Variable Number of Tandem Repeats or VNTR: is a location on genome where a short nucleotide sequence organized as tandem repeat.
Microsatellites or STR or SSR: short tandem repeat (2 – 6 bp long) Minisatellites : simple sequence repeats (10 – 40 bp long)
Cont…Example of SNP
Example of STR
ATCGACTGCGATCATGCATGCATGCATGCATGC
ATGCATGCATGCATGCATGCCTACGTGACTGAC
Here sequence CATG are repeated several times.
Ex. of Minisatellit
CCATCACATATATTCCATATATTCACATATATTACCA
GACTCACATATATTCACATATATTCACATATATTCTA
Here sequence CACATATATT are repeated several times.
C T T C A T C G A T C G GC T T C A T G G A T C G G
Role of polymorphism in Development of breast cancer
Polymorphisms consist of minor changes in DNA sequence -modify the structure, expression or activity of the proteins.
Polymorphisms in xenobiotic or carcinogenic metabolic genes give rise to variable enzyme activity - differing abilities in the metabolism of xenobiotic or carcinogen.
When the activity of xenobiotic metabolizing enzyme is impaired by polymorphism it will not metabolize the Xenobiotic and carcinogenic compound.
xenobiotic or carcinogenic compounds react with DNA and form the DNA adduct - causes mutation and initiation of breast cancer.
Glutathione S-transferase(GST) Glutathione S-Transferase (GSTs), is a phase ll xenobiotic
detoxifying enzyme.
GSTs catalyses the conjugation of glutathione (GSH) to a wide variety of endogenous and exogenous electrophilic compounds .
Alpha class Mu ClassPai ClassTheta ClassZeta Class
Omega Class
Sigma Class
GSTA1, GSTA2, GSTA3, GSTA4, GSTA5GSTM1,GSTM2,GSTM3,GSTM4,GSTM5GST P1GSTT1, GST T2GST Z1GST O1, GST O2GST S1
Cytosolic
Mitochondrial
Microsomal (MAPEG)
GST
Kappa Class
MGST
GST K1
MGST1, MGST2, MGST3
Glutathione S –Transferase Mu 1 (GST M1)
Located on chromosome 1p13.3.
Having 8 exons.
Gene size is 5490 bp.
GSTM1 is polymorphically expressed, and three alleles have been
identified:GSTM1*0,GSTM1a and GSTM1b.
The GSTM1a and GSTM1b are functionally identical, but differ
by single nucleotide substitution C >G at base position 519 or
position aa173 Lys convert in the asparagine.
Homologous deletion results in the loss of this gene thus loss of
function of the enzyme.
Blood sample collection
DNA Extraction By Phenol-Chloroform Method
Genotyping By Multiplex PCR
Sample loading on 1% agarose gel
Work Flow
Lymphocytes Separation
Blood sample collection
Lymphocytes Separation
Multiplex PCR- Amplification of many desired DNA fragments.
We used two sets of primers: IFN gene primer pairs and GSTM1 primer pairs. IFN primers were used to detect that whether PCR has worked or not.
Condition for PCR
Initial Denaturation Temperature 95 0c For 5 Minutes
Denaturation Temperature 950c for 45 second
Annealing Temperature 600c for 45 second
Extension temperature 720c for 45 second
Final extension temperature 720c 5 minutes
34 cycles
Master Mix for PCR
Component 1X(for One Reaction) nX (for n reaction)MilliQ water 12.4µl 12.4n µl
10X PCR Buffer (Axygen) 2.5µl 2.5n µl
25mM dNTP 1.0µl 1.0n µl
10pmol IFN (forward Primer)5 GGCACAACAGGTAGTAGGCG 3′ ′
1.0µl 1.0n µl
10pmol IFN (Reverse Primer)5 GCCACAGGACGTACTGACAC 3′
1.0µl 1.0n µl
10pmol GSTM1 (Forward Primer)5′CTGGATAGTAGCAGATCATGC 3′
1.0µl 1.0n µl
10pmol GSTM1 (Reverse Primer)5 CTGCCCTACTTGATTGATGGG 3′ ′
1.0µl 1.0n µl
Sample DNA (20ng/µl) 5.0µl 5.0n µl
Taq. Polymerase (10U/µl) 0.1µl 0.1n µl
100 bp Ladder- 1
Result
Rrrrr
Wild Type Wells- 3, 5
1 2 3 4 5
Null Type Wells-2, 4
GST M1(273 bp) IFN
(173 bp)500 bp
1
Result
100 bp Ladder Well -1
Frequency of GST M1 Homozygous Null Genotypes in worldwide Populations
Frequency of GST M1 Homozygous Null Genotypes in ACTREC Cohort
Result contd....
GST M1 Joanne E. Curran et al.Australia (2000)
Christine B. Ambrosone et al. New York ( 1995)
Samson et al.(2007)South India
Genotype Null Type Wild Type Null Type Wild Type Null Type Wild Type
SC 56 (43% ) 73 (57% ) 84(48%) 93 (52%) 65(28.3%) 185(71.7%)
SN 57 (44% ) 72 (56% ) 116(50%) 117(50%) 110(22%) 390(78%)
Genotype Case (SC) 180
Control (SN) 188
Odds Ratio 95% CI P Value
Null 68(37.7%) 60(37.3%) 1.0235 0.6710 – 1.5611 P =0.9142
Wild 112(62.3%) 118(62.7%)
All the Analytical analysis are calculated by using online software www.medcalc.net
Correlation of different variable in development of breast cancer in case and control.
Association between Breast Cancer Risk and Food Preference among Case and Control population:
Vegetarian OR P Value Non Vegetarian OR P Value
Case Control 1.11795% CI0.506 – 2.457
P=0.784Case Control
0.93695% CI 0.556 – 1.576
0.803Null 17 26 45 42
Wild 24 41 87 76
There are no Statistical significance have been found ( OR =1.117, P =0.784 and OR =0.936, P = 0.803) between Breast cancer case and healthy control population in ,correlation with food preference Vegetarian and non Vegetarian Respectively.
Association between Breast Cancer Risk and Tobacco consumption Among Case and Control
Tobacco User OR P Value Non User OR P Value
Case Control0.795595% CI0.2362 - 2.6788
P=0.7111
case Control0.995195% CI0.5976–1.6570
P=0.9850
Null 7 11 51 41
Wild 12 15 95 76
There are no Statistical significance have been found ( OR =0.7955, P =0.7111and OR =09951, P = 0.9850) between Breast cancer case and healthy control population in ,correlation with Tobacco consumption, tobacco user and non user Respectively.
Association between Breast Cancer Risk and Menopause status among Case and Control
Premenopause OR P Value Postmenopause OR P Value
Case Control0.99795% CI0.556 – 1.789
P=0.993
Case Control0.92795% CI0.488 – 1.759
P=0.817Null 33 39 29 29
Wild 56 66 55 51
There are no Statistical significance have been found ( OR =0.997, P =0.993 and OR =0.927, P = 0.817) between Breast cancer case and healthy control population in ,correlation with Menopause status,premenopause and Postmenopause Respectively.
conclusion
The frequency of null polymorphism in breast cancer patients and healthy individual is almost similar (37%) null and wild genotype frequency (63%).
Our finding are in coherence with the previously studies worldwide.
The present study suggest that ,the null polymorphism in GSTM1 may not be involved in sporadic breast cancer susceptibility, But have the modifier effect in initiation of breast cancer in combination with other detoxifying enzyme, like GSTT1, GSTP1,CYP450,NAT and COMT.
Conclusion cont.. We also correlate breast cancer case and healthy control with
many variable ,like food preference, Tobacco consumption and menopause status, but there are no statistical significant value have been found.
Further, we need to extend our study in a larger cohort to stabilise the precise role of null polymorphism in GSTM1 in sporadic breast cancer susceptibility.
Reference Christine B. Ambrosone, Cytochrome P4501A1 and Glutathione S-Transferase
(M1) Genetic Polymorphisms and Postmenopausal Breast Cancer Risk. A Khedhaier, Glutathione S-transferases (GSTT1 and GSTM1) gene deletions
inTunisians: susceptibility and prognostic implications in breast carcinoma. Joanne E. Curran, Polymorphisms of glutathione S-transferase
genes(GSTM1, GSTP1 and GSTT1) and breast cancer susceptibility
Hamed Samavat, Estrogen metabolism and breast cancer.
Stephen S. Hecht, Tobacco smoke carcinogens and breast cancer. Ramona G. Dumitrescu, The etiology of alcohol-induced breast cancer
Alison M. Dunning, A Systematic Review Of Genetic Polymorphisms and Breast Cancer Risk
S.Zhong, Relationship between the GSTM1 genetic polymorphism and susceptibility to bladder, breast and colon cancer
THANK YOU