1

TO PRESERVE THE NATURAL RESOURCES PLEASE PRINT BOTH SIDES OF SHEETS

i.e. (id est) = c’est à dire e.g. (exempli gratia) = par ex. vs (versus) = contre per se = en soi

PART I

DDDDDDDDEEEEEEEEFFFFFFFFIIIIIIIINNNNNNNNIIIIIIIITTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN DDDDDDDDEEEEEEEEFFFFFFFFIIIIIIIINNNNNNNNIIIIIIIITTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN

Globalization is a recent phenomenon, but its roots reach far in history, back to the times when international trade developed. In the Ancient times, the Phoenicians and the Greeks already roamed the Mediterranean and established trading harbors all around it. Later on, the Silk Road, Marco Polo’s travels (1295), the Conquista of the Americas, the German-Dutch (Hanseatic) and the Portuguese trading posts, as well as the British colonial empire in the 19th century – most through colonialism – were the beginnings of what we now call ‘globalization’. Through history, the center of gravity of the world economy used to be in the Mediterranean area, then it moved to the Atlantic area (Europe-America axis). Now it has shifted to the Pacific Rim (Asia and Indonesia). In simple words, it can be said that globalization is the interrelation of national economies, in the world market, of production and trade, through the strategies of multinational corporations and through ODI (outward direct investments, known in French as IDE, investissements

2

directs à l’étranger). Still, globalization is more than just the multiplication of international exchanges. It rests on : �� The mobility of the exchanges of goods and services, based on the comparative advantage of a product. You export/import a product or service that is better than the competitor’s to/from another country. This is the international aspect. �� The mobility of the production of goods and services, including ODIs (Outward Direct Investments), i.e. capital and production units. You team up with another country and make a product abroad or you invest money in a foreign company (including a takeover). This is the multinational aspect. �� The mobility of finance . Profitability, i.e. financial return (ROE, return on equity). You collect the results of your trade or investments. And you speculate (Stock exchange, etc.) Moving capital follows its own rules and is often not consistent with real economic situations. This is the global aspect. MMMMMMMMAAAAAAAAIIIIIIIINNNNNNNN FFFFFFFFEEEEEEEEAAAAAAAATTTTTTTTUUUUUUUURRRRRRRREEEEEEEESSSSSSSS MMMMMMMMAAAAAAAAIIIIIIIINNNNNNNN FFFFFFFFEEEEEEEEAAAAAAAATTTTTTTTUUUUUUUURRRRRRRREEEEEEEESSSSSSSS

Neoliberalism and full-blown free-trade became the rule after the fall of the Berlin Wall. It seemed the socialist economies were no longer an option. This led ultimately to the World Economic Conference in Davos, Switzerland, where major state representatives and experts meet every year to decide on the trends for the future. In this configuration, about 12 mega-groups control about 75% of the world production in key sectors ─ soon to be joined by newcomers from China, India, Russia… in the industry and energy sectors. ���� THE CREED : THE MARKET RULES. �� States must lose their grip on the economy in favor of private companies. Control over the economy shifts to a privatization of most sectors. E.g. The number of civil servants should be drastically reduced.

3

E.g. GDF was a state-owned company…and now it has become a private corporation since it merged with Suez. �� Public expenses must go down and should be taken over through private initiatives, in order to give corporations more leeway. E.g. Subsidies should be reduced to favor competition, which contradicts what France and the US do when they back up private corporations… E.g. Social welfare is no longer a priority. The business of personal insurance can take care of that. �� Liberalize regulations and bureaucracy and favor the deregulation of the economic mechanisms. Labor market becomes more flexible. E.g. Hiring and firing people should be made easier. E.g. Setting up /shutting down a business should require fewer legal obligations. ���� SO, WHO GOVERNS? Governments don’t tell financiers what to do, financiers tell governments what to do. Microeconomics prevails over macroeconomics. The Multilateral Agreement on Investment (AMI in French) is supposed to help negotiate and to arbitrate investment between countries. In fact, it is an instrument of the American Council for International Business. Their goal is to limit the leeway of governments and give full powers to trade in such a way that governments become dependent on corporations. The incompetence of governments lies in their inability to resist : when corporations need public bailouts, the governments comply... When corporations threaten politicians of economic disaster, they manipulate governments. It becomes particularly obvious when elections are drawing close. In France, the State helps private corporations as much as it supports social welfare and finances public needs. Which partly explains why the deficit, due to public debt, is so heavy (- 1,245 billion € in 2007, i.e. 66.4% of the GDP!). Added value : the difference between the value of a sold product and the value of intermediary consumptions it took to produce it. GDP (Gross Domestic Product – PIB) : the sum of added values of all productions and services, within a year, by all companies (national and foreign)

4

GNP (Gross National Product – PNB) : the added value of the whole of goods and services produced, within a year, in a country and abroad, by the national companies of that country. In addition, where governmental regulations are weakened, the law of business prevails and inequality develops. The question many opponents to liberalism ask is : who controls the boat? You can vote for a State (it has a face). You can’t act upon market except through buying or boycotting. But if the State represents people (in a Democracy), the Market represents…only those who control it. The logic of financial worth and profitability determines about everything. This is why there is a major problem when you compare public services and private services. If the public services need to be balanced financially (a basic accounting rule), it was never required to generate profit! But the private sector will require profitability: It is rule Number 1. Still, governments can react, for instance in France, when they limit the amount of severance payments that dismissed managers can get, when they try to limit the discrepancy between what shareholders earn and what big managers earn (balance of dividends) ; in the US, when they introduce the Sarbanes-Oxley Law to keep big companies under control by multiplying audits and applying harder sanctions when they go over the line and act illegally (Enron, Halliburton, WorldCom,…) This doesn’t change anything to the clout of corporations in the society, since they still run the game. But it is reassuring to see that governments can still have their say and act in terms of regulation. Another aspect is that of preconceived ideas about the current economy and their policies : many political and business players tend to think that, for instance, takeovers (OPA, in French) are necessary when most of them actually reduce added value within companies and lead to loss of jobs. Another false idea is that currencies must always be strong. The example of Europe – and France in particular – shows that a strong euro does not protect from recessions and bankruptcies. Monetary dogmas are wrong. Sometimes production models are inefficient, but if they are widespread, nobody dares to question them. In other words, what is widely accepted as true often proves to be fallacious. ���� WHAT GLOBALIZATION HAS CHANGED In 30 years, a shifting has occurred from public economy to private economy, from sedentary employees to movers, from domestic

5

companies to multinationals, from a product-oriented economy to a finance-oriented economy (added value!), from salaried people to speculators (the salaries stagnate or go down whereas the profits of shareholders and big corporation managers rocket sky-high.) Within globalization other changes are now taking place: �� Everything goes fast and people are increasingly dispensable. No one stays in the same company anymore. People are like pawns on a chessboard. They are quickly moved about. The effects produced by globalization accelerate too. But when it accelerates the wealth of some, it precipitates the impoverishment of others in equal speed (China is the perfect example of this). A faster wealth shift has taken place through speculation and rapid growth. �� Business tends to blend identities. Multinational corporations are the perfect illustration of that. Also, products tend to lose their own identity. When Levi’s closed down its last US-based jeans factory in 2004, an American legend dispersed. Now Levi’s are made in 50 different countries. Is it still an American item? With Mecca-Cola, a similar thing occurred : Arab business has used a typically American ‘institution’ and has turned it into a Muslim product. Is it now a Muslim or still an American drink? �� Globalization clearly shows that our lives here are now closely related to those of people on the other side of the planet. In other words, a globalized economic system triggers social questions. One would tend to believe that globalization brings people closer to each other through faster and easier communication and transports. But it actually does not. People are related economically, but not closer socially nor on equal terms as far as wealth is concerned. Even though people from all nationalities who work together become related – and may develop friendship – , the outcome in terms of personal exchange remains a mirage. Also, when people are moveable, they lose their roots (Philippino women work in Hong-Kong, Palestinians and Egyptians work in Saudi Arabia, Indians work in South Africa, Chinese work in Algeria and Western Canada, Mexicans work in the US, French work in London, Africans work in Europe, etc...) This may increase the feeling of being lost, which creates collective reactions of belonging to a specific community.

6

And those who don’t feel they are part of the big economic game adopt an offensive attitude through nationalism, conflict, religious fundamentalism, terrorism or political activism against Western ‘values’. Does globalization impose the Western model on the whole world? It seems so. But the Western model is, in fact, the American model. Through music, TV, fashion, lifestyle, etc., the model created by the influence of America throughout the 20th century has proven detrimental to local cultures. When Mc Donald’s settles in Russia, China, Europe, Latin America, it brings the American fast-food model to all people. Same thing with music and streetwear. Rap has taken on everywhere among suburb populations. Standardization of tastes is global : wherever you go you will hear the same music, people wear the same American casuals and they drink Coke. But even if this can be seen as one of the effects of globalization, this is mostly the effect of Americanization. Which is a different problem. Americanization started long before globalization…which merely amplified the lifestyle through economic channels. Economy is the vector of cultural spread. Culture and lifestyle follow trade routes. Let’s not forget that European colonists have imposed westernization on all continents long ago (Shanghai, Casablanca, Rio have long been western cities...) In spite of all that has been previously said, globalization is no longer the exclusive field of the American economy. As a matter of fact, the US are losing control over globalization. The sales of Coca-Cola worldwide are stagnating, General Motors is on the brink of disaster (Toyota is now Number 1), Mc Donald’s has a bad image, IBM sold its PC division to the Chinese corporation Lenovo, the leaders in steel are Mittal and Arcelor, Boeing has a hard time with Airbus and the US are heavily indebted to the rest of the world – especially to China. Globalization is soaring, Americanization of China is under way, but the American supremacy per se is declining.

7

PART II

Feature 1 : “Ma mondialisation” – Globalization from a developed nation’s standpoint

RRRRRRRREEEEEEEELLLLLLLLOOOOOOOOCCCCCCCCAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNNSSSSSSSS RRRRRRRREEEEEEEELLLLLLLLOOOOOOOOCCCCCCCCAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNNSSSSSSSS

Relocating consists in closing down production units in a country and moving them abroad in order to reimport production to the ‘mother country’. Setting up a production unit abroad as a subcontracting facility for an existing factory is not a relocation. (e.g. Peugeot factories in Brazil or Slovakia). The main motive for relocating is profitability in order to remain competitive and, in the near future, improving productivity (since emerging countries are catching up with us in this respect and better productivity is closely related to the improvement of the living standard). Looking back, one realizes that relocations have actually been with us for a long time. They began in the early 70s, when consumer products were made in Hong Kong, Taïwan and Singapore. Shipyards, steel, as well as many polluting industries, moved East. In those days, low quality products were good enough for Asian manufacturers… Then the second wave occurred, with middle-range products (house appliances, hi-fi, TV sets, optical and automobile equipment, etc.) in the 80s. When the Asian dragons found it more profitable to shift production to Malaysia, Indonesia, Philippines and China, the third wave was drawing close. In the 90s, telecommunication and computer industries, and downmarket services started to move as well. We are now in the 4th wave… with almost all of the remaining economic fields, including upmarket sectors, along with expertise and know-how. In some cases, only front office activities remain (in Great Britain, for instance). The ‘international division of labor’ is no longer an immutable economic principle. There are 4 kinds of relocating strategies : �� Market-seeking relocation. We are saturated, we need new customers in developing countries. We move only part of the production meant for foreign markets. This does not create new jobs, but it does not

8

destroy employment in the homeland. It might create a drift, though, when it turns into a total relocation. The Logan car is a good example: it is made in Eastern Europe, meant for local markets… except that it ended up being sold here, in France, as an imported car! �� Outsourcing relocation (cost-efficiency). We exploit lower-salary workers and cheaper structures in order to survive competition. It destroys jobs in the homeland. � Global relocation. A combination of the first 2 strategies. This will be the trend in the next 20 years…unless something really striking occurs (major upheaval in the Far-East, environmental disaster, political conflicts, etc.) �� Oligopolistic relocation. Everyone lines up with the first mover (leader), thus creating a fake competition and a balance : market sharing. As far as France is concerned, relocations are limited : only 4% (4.8% for Europe) of ODIs between 1997 and 2001. But this figure is soaring. In the US, the number of layoffs of over 50 workers due to relocations was only 2% of the total of layoffs between 1998 and 2003. There, the figures are up, too. One may think that western nations have never invested so much overseas. This is wrong. The investments of capital abroad were much higher before 1913. England transferred half of its savings overseas (to colonies) – and France did the same with ¼ of its assets. It bears no comparison with the present day amounts of outward investments. In terms of productivity transfer, it is easy to understand why we move abroad. The case of Benetton and its competitor speaks for itself: Benetton churns out 60% of its production in Portugal, Hungary, Croatia, Tunisia. Its competitor Stefanel : 80% in Eastern Europe, China and India. Hourly cost in Italy: ± 17.8$. Hourly cost in Slovenia : ± 6.7$. Hourly cost in China: ± 1$ No comment. Now, why is labor so expensive here? Mainly because our workers get higher salaries due to our higher living standard and because the cost of labor is higher due to social coverage. One hour of labor costs 15x less in India than in the US. But, other costs are higher in India : energy, K, raw material. Only Korea and Brazil manage lower costs than the US. Apart from labor, producing costs more

9

in India than in the US. So, a cheap hourly rate is not the only factor. But if you add a low hourly rate to some other element, you may understand why most companies relocate : to approach a new potential market, or to follow the competitors or to make more profit (as a security in case of a recession), or to leave manufacturing to a subcontractor and focus on key activities in strategy, R&D, where added value will compensate for possible higher energy expenditures. Whatever the scenario, the transferred unit is beneficial for the business. Things start going wrong when even cheap labor generates its own twist of fate : in 2008 the workers of Dacia (Renault) – which makes the cheap Logan car – went on strike in Romania. They wanted a salary raise. In Romania, labor is cheap, but production costs are higher than in high-tech Western factories. So, Renault makes profit on labor. Hence the strike! Let us bear in mind that one of the main purposes of competition is to meet the ‘strong requirements’ of customers who want prices to go down: the value is what the customers are ready to pay! The question is : are Westerners prepared to pay manufactured products made in Europe, that are 3 or 5 x more expensive than their Chinese equivalents, for the mere sake of saving European industries? When a business has reached the limits of cost-killing, the only option left is relocation. There is a contradiction here : Westerners cry over the loss of their jobs, but at the same time they always want cheaper purchasing prices. “I want a job and a Westerner’s salary, but I also want Asian prices.” That is where relocations find their justification… If we breakdown the price of a Nike Air Pegasus shoe, we soon find out that the cost of the item (the object) per se is minimum. The cost of structures + promotion + business costs is maximum. It is as expensive to bring it to the customer as to actually manufacture it. The buyer buys a concept and a brand more than a shoe. You buy air as much as a product, maybe that is why Nike uses the word ‘Air’ in most of its models…The same process applies to most apparel items. The final piece of clothing is quite affordable for the buyer in spite of the middleman’s share – the first in the line always receiving the smallest share. And when it comes to a brand, the buyer will purchase the ‘name and fame’. Between the worker and the customer, the master company is always the winner. When you buy ‘brand’ you buy ‘bland’. ���� ARE RELOCATIONS KILLING OUR INDUSTRY?

10

Interestingly enough, we should remember that in the 19th century British textile exports totally destroyed the local textile industry in India! Since 1949 France has had more employees in the service sector than industry workers. Now 85% of Americans and 75% of the French work in services. The only western nation where workers were close to half of the working population was England in the 19th century. In other words, industries have never been the major employer of western countries. This does not diminish the impact of relocations on the existing industries. But we should also remember that people lose their jobs because we produce more with fewer people, because technology requires new qualifications, because the demand from consumers changes, because companies reorganize... Relocations are just a fraction of the downsizing phenomenon. Not everybody can work in services, which leaves a lot of people on the wayside. Not everybody can (or wants) to retrain in services. Basic workers are not always able to switch over to upmarket jobs. So, the first victims are poorly qualified workers, not highly trained personnel. Yet, France has lost over 10% of its industrial jobs in the 90s. This means 1.5 million jobs gone between 1980 and 2004. Each year, about 100,000 jobs disappear, especially in the apparel industry and textile, fuel industries, appliance and consumption industries. Same thing in the chemical, automobile, printing, mechanical and electrical industries and electronics. A spectacular drain! On the other hand, we have more jobs in the agricultural and food industries, and – surprisingly – in the electrical components, as well as services (+129,000 in 2004/2005). The energy, perfume and pharma-ceutical industries are stable. Industry accounts for 15.9% of the total salaried jobs. In 1980 the industry in France accounted for 24% of the total. The loss is obvious. Another figure complements the latter : in 1990 products made in France meant 7% of world exports. In 2005, 5.1% only. There is a similar fall in Europe as a whole. Germany is doing well at exports, though. Paradoxically, in the last 10 years, productivity has gone up by 17% in the EU, by 35% in the US and… by 250% in China. In France, industrial

11

growth should be about 4%/year. And even though France exports its K and units through ODIs, it has also attracted about 50 billion € of foreign investments/year since 2001 (right behind… China with about 55 billion). If you add the ROEs from French relocations, it results in a new picture of trade returns : where exports fall dramatically, ODIs yield dividends that are 4x the amount generated by our exports (13 billion € in 2004). According to Suzanne Berger, Professor at MIT, globalization has not killed industrial jobs in all Western countries, simply because a number of companies manage to innovate and to offer products in such a way that they are doing well and do not need to move their production abroad. The Italian eyewear (glasses) industry (Safilo, Luxottica, etc.) achieves that through design and quality ; textile industries like Zara∗ (Spain) and American Apparel (California) through quick product turnover, making and delivery and proximity to the market ; Dell, Sony, Panasonic and Samsung through constant innovation. In many cases, it is cheaper to have products made in the home country rather than overseas, because workers and equipment are more efficient, which reduces the cost of productivity! In addition, most of those corporations are able to maintain excellent social policies and decent salaries. It is admitted, though, that jobs in many Western companies are paid less in order to stand the competition from low-cost manufacturing countries. Does this mean that relocations are not to be taken seriously? Certainly not. However, some resistance is taking place. A fair number of industries don’t relocate. E.g. Armor Lux (Textile) in Brittany Cristel (kitchenware), RGM (mechanical ind.), Manitou (world leader in all-terrain forklift trucks)… How do they manage that? Through innovation, anticipation (which is reminiscent of the Blue Ocean strategy), good R&D (average 5% of turnover), top-range products, a low turnover, investment in human value (they protect their workers) and hire creative designers. They are all SMEs. Now, where is the danger? Emerging countries are becoming first-rank players (China/India) �� Thanks to their low manufacturing salaries (60cents/hr against 1.5$ in Mexico.) and millions of workers ready to produce. In the race for low

∗ Even though Zara sells items made in Turkey, Bangladesh and Tunisia !

12

cost, no one will go back : salaries will be adjusted to what countries can afford. Competition means lower costs only. It is a one-way street downwards. If someone starts raising salaries, prices will go up and they will lose the competition. Meanwhile, China will swipe all the jobs in the apparel industry, thus pushing many other countries to near-bankruptcy : Maghreb, Turkey, Colombia, Sri Lanka, the Philippines, Indonesia, Viet Nam. Even Bangladesh could lose 1 million jobs to China. Let’s not even talk about Europe : the competition from China and developing countries has already wiped away 4 million jobs in textile. But Western nations have allowed that to happen. They are the ones to blame in the first place. Trying to reintroduce quotas and taxes to limit the damage seems like a poor attempt to get even. �� Transfer of services : Outsourcing now includes call centers, accounting, invoicing, translation, financial management, customer services, +engineering (India is the champ’ + India is anglophone.) Offshoring in sectors such as banking and insurance is rising dramatically. According to Deloitte Consulting, in the US about 2 million jobs in finance and insurance will have moved overseas by 2008. And in France 200,000 jobs in services may have gone offshore by 2010. �� Transfer of R&D to Shanghai or Bangalore where western IT companies hire cheap engineers. High added-value through R&D being only western asset is no longer true: emerging nations have brains too. In the near future, 1 job out of 10 will have moved from the Silicon Valley to soaring IT centers like Bangalore. �� Transfer of high-tech competence to emerging economies such as China, India and Brazil (which already has a high level of technological skills and a good aeronautic industry with Embraer). The competitive advantage of our countries used to be high-skills. It is no longer the case : for instance, a Chinese woman medical searcher made a spectacular breakthrough in genetics and she was the closest to producing a human clone. Only her sense of ethics stopped her. India has highly trained IT engineers in Bangalore and Hyderabad (the high-tech centers of India). Those people are cheaper than their western counterparts. The competitive advantage is now increasingly on their side… This has direct results : in the Silicon Valley, the level of salaries has gone down by 20% since 2001. A software engineer who earned a yearly $130,000 five years ago now receives $100,000. All of this is good news for industry buyers, but bad news for engineers.

13

When Alstom and Airbus outsource in Korea and China, they also have to share their competence and technology which are transferred into the hands of their competitors. Those countries don’t hesitate to resort to blackmail : “You want to sell us your trains and planes? You want to make them here? In that case, you must sell us the know-how that goes with it.” We are then losing our competitive advantage: our technological know-how. �� Financial speculation on added value or products and services, greed for quicker ROE (profitability) entail short-term strategies and behaviour when we need long-term view through cooperation and sustainable development, instead of competition and unstable jobs. To sum it all up, relocations result in 3 major effects, 2 negative and 1 positive: 1/ Loss of jobs in western countries. To make up for jobs losses, former industry workers have to retrain in services. Portugal, for instance, is now too expensive and recently had to relocate 9 automobile facilities to Asia and Eastern Europe... Aeronautics no longer generates new jobs in France in spite of its worldwide development : jobs are created abroad. In the IT industries, an estimated 15,000 jobs are now gone, owing to offshoring moves. 2/ Imports replace exports. Nations are in trouble when they have to import more than they export. Let’s not forget this basic principle of economics : countries export what they make to be able to import what they don’t have. When exports go down, money goes down too. And imports are costly… It then results in a deficit. In terms of market shares through exportation, France has lost quite a few points, especially to developing countries (Asia). In 2005, the market share of French products exported to China was only 1.4%. And imports have soared. Why is France so bad at exporting? Because : companies focus on the European market too much, they stick to downmarket products instead of selling high added value products, labor is expensive, the euro is too high, banks have cold feet, companies don’t take risks, promotion is weak and poorly organized, business people don’t speak English,… The overall trade deficit for the European Union reached 82.8 billion € in mid-2006 (It was ‘only’ 45 billion in 2005 – the price of energy had gone up tremendously in the meantime).

14

3/ Higher profit for businesses. Let’s go back to the Levi’s case. When the company relocated its last production unit in 2004, it was in the middle of a crisis. 2003 had been in the red with a loss of $349 million. In 2005, Levi’s had not only made up for the loss, but it had also made a $156 million profit! Relocations + drastic management + other factors may account for that. This raises a question : does the country benefit from the companies’ better financial situation thanks to relocations? It might – indirectly. But higher profit usually remains within the company and it is used to grow. The national economy does not benefit from the record profits made by successful corporations since those profits are reinvested as ODI abroad, and paid out as dividends to shareholders… 45% of whom are foreign stockholders! The outcome is clear : the massive yield generated by French companies goes away. The return on equity is in the pockets of people who do not participate in the French economy, but who take advantage of its most profitable businesses. 4/ Environmental impact. This aspect is seldom mentioned when it comes to relocations. But this is a fact : relocations take a heavy toll in energy consumption and raw material and they encourage global pollution. For each dollar spent in production, China consumes 4x as much as the US and 5x as much as Europe! It results in enormous quantities of CO2 emissions, not to mention water use, etc. When a Western company relocates in China (or elsewhere) it never takes that aspect into consideration : moving abroad has an environmental price. This is why Western corporations should require hosting countries to apply the same ecological regulations as theirs. It is widely admitted that growth in developing countries and relocations do contribute to the overall wealth of the world population. The average wealth has increased. But if one looks at the detail, the picture is rather grim : the gap between the well-off and the millions living below the poverty line has never been so big. Inequality rules despite an improving general standard of life. If everyone were a winner, the question would not even be brought up. Workers, poorly qualified employees and middle rank executives are mostly the losers wherever factories and businesses are shut down for relocation. ���� IS PROTECTIONISM THE ANSWER? Normally, free trade allows any given country to produce and sell what it is best at (known in economics as Ricardo’s ‘comparative advantage’).

15

Open market allows the economy to breathe, whereas protectionism creates inflation, since domestic competition is limited, therefore it forces companies to increase their prices. Protecting local jobs costs a lot of money : the entire society pays for that and it cannot spend that money on other products (consumption). In other words, protectionism is a costly operation that generates inflation. The disastrous results of protectionism in the US, Mexico, India, etc. are a good argument in favor of open market and international trade. Those who advocate protectionism as a solution against globalization are not realistic. Protectionism has never proved positive for countries that have applied it to solve their economic problems. Furthermore, protectionism is forbidden by the laws ratified by both the EU and the WTO. Protectionism has never been a solution : it does not harmonize with capitalism. Every time a nation turns to protectionism it is faced with economic slump and isolation. The system we are in needs and requires open market. It is a basic law of economics. Which doesn’t mean liberalism and globalization will not destroy jobs and industries in the Triad. Which is no excuse for keeping capitalism as the best system. A third way has yet to be found between fair exchanges and globalization. Anti-globalization movements advocate protectionism as a solution : “Everybody in their own country, operating their own businesses, to put an end to the ill-effects of globalization.” Is this realistic? This position does not take one fact into account : poor countries don’t want to be left alone, they want to take part in the globalization process through exportation and incoming investment. The only exception lies in the Japanese model that keeps foreign ‘invaders’ at bay. This is why Carrefour didn’t make it in Japan – and Wal Mart hardly did. They don’t need us even though they import what they don’t have. Japan is very selective in its protectionist policy. Elsewhere, re-implementing quotas and taxes on imports is a desperate and useless measure to fend off massive imports of manufactured goods. The harm is done. ���� HOW CAN WESTERN NATIONS STRUGGLE THROUGH ?

16

Mostly through innovation, R&D, drastic policies favoring top-notch expertise in the scientific and technological fields (which involves better higher education, a field where Europe is way behind Japan, Scandinavia and the US in terms of endowment and policies – which strongly affects competitiveness!). Western nations must struggle to stay in the race in high added-value products. In this respect, France is falling behind in terms of investment in R&D : only 3% of the GNP. France is the only nation that has cut down on its research budget. In pharmaceutical research and biotechnologies, France is 5 years behind. In the strategic field of technologies, there is not a single French company ahead of the world or even European game. In IT, France ranks 22nd. Airbus stands out as an exception. Tough times, as we have entered the land of ‘immaterial economy’ in the same way as intangible assets are a reality. Tangible assets are now on the other side of the planet. In the future, our economy will have to establish itself upon new values : intellectual property, brands, patents, innovation, know-how, management, organizational efficiency, competence, experience, company ethos, relations with partners and customers, etc. A new world of virtual value is opening before Western businesses – and this is where they have a chance to get ahead. But this doesn’t mean we should relinquish our industries : we still need to export goods. In addition, what’s the use of developing high-tech competence, services and R&D without our own industry to apply it on? How can a nation survive on ‘virtual assets’ only? And how could we buy goods from emerging nations if our own exports don’t yield enough? Nations and/or companies are really ensnared in what seems to be the key element of the global economic issue : competition – if not war. WWWWWWWWAAAAAAAARRRRRRRR &&&&&&&& CCCCCCCCOOOOOOOOMMMMMMMMPPPPPPPPEEEEEEEETTTTTTTTIIIIIIIITTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN WWWWWWWWAAAAAAAARRRRRRRR &&&&&&&& CCCCCCCCOOOOOOOOMMMMMMMMPPPPPPPPEEEEEEEETTTTTTTTIIIIIIIITTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN

Feature 2 : Made in Asia – Globalization from emerging countries’ standpoint

In the general picture of globalization, we often think of competition as a war between nations. But even though there is a rivalry between emerging countries (China, India, Russia, Brazil…) and the Triad (US, Japan, Europe), let’s not forget that there is also a rivalry between nations of the same side : US vs Japan, US vs Europe, for instance. And within each country, companies fight for survival or supremacy (French SMEs have to fend off other French SMEs’ assaults on the market). It

17

results in a three-level competition : global, international and ‘intranational’. A smaller number of companies control the majority of the world exchanges which entails oligopolistic competition. Through oligopoly, corporations have a strategy : instead of fighting each other in useless competition, they organize a situation where the ‘first mover’ (leader) shows the way and the others follow. They all find terms of agreement by which they share the market instead of fighting for it. Each gets a specific territory or field and they determine their policies according to what the other one does. Do you think there is real competition between Lyonnaise des Eaux and Veolia Environnement (ex-Générale des Eaux)? No. They share the market of water distribution by geographic sectors. No bloodshed. Win-win situation. That is why there can’t be many players and why companies regroup in big corporations. Oligopolies don’t refer to the law of supply and demand. They achieve balance through the anticipation of what the market is going to do. And they adjust. It is like a game. Competition is not as widespread as it seems : wolves don’t eat wolves. So, where is competition? It is where the number of players prevents them to make agreements through oligopolies : SMEs and suppliers and subcontractors… Small companies get at each other’s throat in order to survive. They work for the big guns of global business who put the pressure on them. Boeing and Airbus look and sound like heavyweight contenders. But the competition between them really plays at the lower level, that of outsourcing and supplying. The hundreds of small companies that struggle to stay in the race are those who carry the burden of competition. Another question is important : does competition have a positive impact on the economy? Let’s take the example of German companies : the most competitive in Europe, with a surplus in the trade balance of 157 billion € in 2004-2005 (when France scored a 7.8 billion € in deficit). How did Germany achieve that? By reducing salaries by 2.8% (when they were raised by 8% in France and 14% in UK), by laying off workers, by increasing the public debt. When wages are compressed and unemployment goes up, domestic demand and consumption collapse. In other words, the 130 billion € of sacrificed salaries have allowed to produce 125 billion € in surplus, only 30 billion of which have benefited Europe as a whole. The problem is that other countries are now ready to follow the German example to create a surplus and be more competitive.

18

This is called social dumping. And this shows how competitiveness can cause a lot of collateral damage: what is good for companies may be harmful to society. ���� A NEW BUSINESS APPROACH : THE BLUE OCEAN STRATEGY There is a widespread preconception about business : it is full of creative and daring people. This is not true. As a matter of fact, business follows the herd instinct, gregariousness, i.e. everybody follows what others do. There is a lack of imagination in the field of business, since people are wary of risk. “If someone else does it and it works, let’s do the same.” This attitude tends to ward off the stress generated by competition. Well, strategy is not adapting to the present day situation, it is ‘thinking ahead of the herd’ and preparing for tomorrow. This requires imagination and guts. The first step is getting away from destructive competition. Instead of doing better and cheaper, let’s do something different. Let’s leave the blood-red ocean of killing competition and enter the quiet blue ocean of innovation. Starbucks, Body Shop, Compaq, Casella Wines are examples of that strategy. Find new niches. The BOS rests on 3 basic principles: �� Approach the market differently : transferring what is done to a totally different sector and applying it to the sector where it is less expected, or targeting new categories of customers, or offering complementary services. E.g. Net Jet created private jet shared ownership : flexible hours, various airports for departures/arrivals, faster checkin procedures, etc. E.g. Quick Beauty House : quicker haircuts for Japanese businessmen (no tea, no massage, quicker drying…) A real timesaver! �� Get rid of figures and performance that clog the mind, and focus on core priorities instead : developing a strategic vision through common thinking and perception of what the future of the company can be. This is a long-term vision. �� Develop strategy with a strategic framework : a series of questions to assess and control the relevance of what is offered to the customer. For instance, usefulness (go beyond their needs…or not), price (cut down must not be an obsession), anticipation of costs…

19

E.g. Cirque du Soleil : circus was declining, so innovation, no animals involved (=costs down.), prices equivalent to those of theaters to attract the same audience. To put it in a nutshell, the Blue Ocean Strategy requires imagination, long-term view and precise targeting. No competition involved. The company operates in another environment. This strategy may have to be applied to a country like France, that can’t compete by producing everything. When China snaps up all the fields of the manufacturing industry, we must specialize in fields that are out of the scope of competition, with products that are unique like champagne. It is an impossible challenge because the quantity of goods that can’t be imitated is very limited. Take watches : the timepiece industries of Europe have been almost totally wiped out by relocations. The Swiss, French and German watch industries have lost over 100,000 jobs in 20 years! To the advantage of Hong-Kong, Japan, Korea, China and India. The watch industry in France is 98% dead. The Swiss have only one way to fend off Chinese competitors : excellency and top-range technicality. Their traditional know-how and reputation are their only safety bolt. A Rolex or an Omega watch cannot be made in China without losing its Swiss made PDO (Protected Designation of Origin). Paul Krugman – the ‘Great Debunker’ According to Paul Krugman, one of the most prominent American economists, what is commonly thought is wrong. He claims (among other disturbing theories) that : ����Survival and development of nations does not depend on competition. Unlike companies, countries are not in a competitive situation. One should never confuse nation with company. Competition may be true for companies, not for states. The confusion comes from the fact that corporations increasingly infiltrate political life and have a pervasive effect among political players and the general public. Which creates a confusion: nations do not compete. Only companies do. Countries don’t do business, countries don’t sell products. Only companies do. Multinationals don’t represent nations. They represent several nations within the same entity : the corporation itself. Even when nations are bankrupt, they still exist. When companies go bankrupt they die.

20

Also, we should not forget that competition often takes place between companies of the same nation. Coca-cola has only one true competitor on the worldwide scale : Pepsi-Cola. Mecca-Cola and Virgin Cola et al are merely avatars of the long-established product. ����The idea of war and competition is artificially created by so-called experts and ill-informed people. Figures and actual observation invalidate those ideas. Players are obsessed with competition when it may only be a ghost. It is mental pollution. What the general public hears and reads about the economic war has nothing to do with what economists teach.

PART III

Feature 3 : “Darwin’s Nightmare” – Globalization from a poor country’s standpoint Feature 4 : “The Yes Men” – Globalization from a provocative standpoint

���� WHAT DO BIG INTERNATIONAL ORGANIZATIONS DO? In the global picture, the world economy seems to cause as much trouble as it generates benefits for the people. The regulation of the economic process is supposed to be in the hands of official world organizations : the World Bank, the IMF (International Monetary Fund), the OCDE (Organisation de Coopération et de Développement Economique, which consists of 200 experts in Paris delivering statistics, advice...), the European Commission, the G8 and the WTO. What is the purpose of the WTO? �� Create a global market. �� Preserve the interests of its members (all rich and emerging countries). From a critical viewpoint, it must be said that the WTO is not interested in the agriculture and the textile of poor countries. While farmers in rich countries receive subsidies to damage the environment, African and Latin American farmers get less and less assistance. For instance, the US grant their cotton planters 3 billion dollars each year. Their products flood the marketplace but they are not competitive. And in Mali, cotton-growers can’t even refund their cotton seeds and fertilizers by selling their crop. The more they produce, the

21

more they get into debt and the poorer they become. Jeffrey Sachs, one of the major American economists, thinks this is an absurdity. Also, the WTO does not include environmental and public health in its mission (this should be political). But it could, since trade has a direct link with health and the environment. In addition, the WTO has no requirements regarding children labor. The International Labour Office can’t wield any influence over the WTO. Same problem for the WHO (OMS). The WTO, IMF and others favor rich countries in their policy. The only recent exception was the cancellation of half of the poor countries’ debt (which was over $ 150 billion). The IMF imposes unadapted financial and economic policies on poor indebted countries regardless of the cultural, political and economic reality of those countries. Developing countries had to apply absurd economic policies in order to obtain loans from the IMF. Liberalization of the markets, and Western-style “solutions” have been forced on nations that were not prepared for their implementation. It has resulted in economic collapse and social chaos. In addition to practises that are similar to blackmail, the IMF has proved reluctant to admit its faults and share information openly. However, the fate of millions of people depends on organizations that disregard their basic needs in the name of liberalism defended and promoted by blind IMF bureaucrats. If we consider the world population, we realize that in the near future, the poor and emerging countries will definitely have to be taken into account. Being poor does not make them non-existent. They are here and their problems have inceased in the last 25 years in spite of a fact : the world is richer than ever.

WORLD POPULATION �2006 : 6 billion inhabitants (1b rich, 2.5 b poor, 2.5b very poor) �2022 : 7 billion �2050 : 9 billion Forecast for the next 50 years : India : + 21% China : +12% Pakistan, Bangladesh, Nigeria, USA : + 4% each Africa : will increase from 850 million today up to 1.8 billion Europe : will decrease from 730 million today down to 630 million NB: economists consider as ‘poor’ those who earn less than 1$/day.

22

NB: the female population is decreasing in poor countries. NB: fertility is declining in the world in spite of this forecast.

The world’s GDP has gone up from $11,000 billion in 1974 to almost $ 20,000 billion today. Thanks to machinery and computerization, productivity has improved on the worldwide scale to such an extent that labor is no longer a factor of wealth…for those who work. And the rich have become richer and the poor poorer. How come? The answer is dreadfully simple : because wealth is not shared. In a globalized world, where communication is efficient, discrepancies become visible to all : 20% of the people use 86% of the resources. Now, let’s keep in mind that productivity is closely related to the use of resources. The same people benefit from both. Still, the increased population can be fed if we share wealth. Otherwise, conflicts over food, water and natural resources may arise in the next 40 years : the economic scale will not set itself on equal weight with 7 billion poor people on one side and 2 billion well-off on the other side. To make up for the inequality, rich nations have long promised to dedicate part of their GNP to helping developing countries. Unfortunately, this noble resolution has gone down the drain. The initial promise of rich countries was to grant poor countries 0.7 % of their GNP. Today Europe gives a mere 0.36% and the US a generous 0.16%. In other words, rich nations have never kept their word about financial assistance to the development of poorer nations. Meanwhile, poor countries struggle to keep afloat in the global market of raw materials, their major – and sometimes only – asset with tourism and apparel manufacturing. Africa, Latin America and some Asian countries are the most vulnerable, since their economies depend on the fluctuations of raw materials. Developed nations decide on the price of staple and foodstuff (retailers are responsible for the pressure on suppliers and growers for lower and lower prices ; the law of supply and demand tops it all). Since agricultural raw materials are dealt with just like any other commodity at the stock market, their value is submitted to the laws of speculation, supply and demand, and open market. It results in always lower income for farmers in the third world. This is the evidence that a liberalized economy is blind to the needs of those who have no clout in the global game. Agricultural and textile products from

23

poor countries are not interesting enough for the WTO. They are merely regarded as low-value commodities. Their usefulness remains within the realm of profitable items for outsourced production.

AGRICULTURAL RAW MATERIALS $ COFFEE

Cents/kg COCOA Cents/kg

SUGAR Cents/kg

RICE $/ton

SOYA $/ton

1980 411.7 330.5 80.17 521.4 376 1990 118.2 126.7 27.67 270.9 246.8 2001 63.3 111.4 19.80 180.1 204.1 Source : Global Economic Prospects and the Developing Countries, Word Bank, 2003

The deregulation of trade and finance results in a dramatic gap that becomes bigger and bigger between those who have the financial power and those who starve. This has been a profitable system for decades : poor nations are indebted to the rich – with interests, of course – which places them in a dependent position. This impairs their own development, which prompts more debt and so on… It is a vicious circle. In spite of this grim picture, a number of African countries have a spectacular growth rate : Senegal : 4.6% ; Ivory Coast : 5% ; Ghana : 5.1% ; Nigeria : 5.5%; Uganda : 5.5% ; Tanzania : 6.5%... Better than France with its meagre 1.8%, even though ‘growth’ is proportional to the standard of life. But let’s not be blinded by such figures. When China, and emerging countries invest in Africa, they are driven by profit : the Maison des députés financed by the Chinese in Yamoussoukro (Ivory Coast) is no lavishness. When Tata Steel plans to invest over 700 million € (and up to 1.5 billion!) in an iron mine, when Indian, Canadian and American companies have been granted permission for gold-digging, when Loukoil from Russia plans an investment of 170 million €, and when Archer Daniels Midland and Cargill put their hands on the cocoa production and trade, this is certainly not for the mere sake of Africans. There is another factor to poverty in some countries : geographic isolation. In a globalized economy, how can populations living in remote areas of the Andes or Mongolia develop? They are away from the trade flows. And since they don’t have a lot to offer, they are just left out. Globalization does not care about places where it does not pay for lack of market. To be part of the globalization process many countries need to develop a strategy to solve their basic problems, such as reducing infant mortality, enabling soil regeneration and access to water, preventing epidemics,

24

introducing educational programs, building roads, etc. Ghana, Uganda, Ethiopia, Senegal, Kenya have worked on such schemes. Only when those countries are ready can investment begin to pour in. Also, the debt of those countries should be written off. Kenya receives $100 million every year and pays off 600 million dollars with interest! It doesn’t make any sense. According to the American economist Jeffrey Sachs, poverty in poor countries could become history in only 25 years if we made the right choice in terms of financial aid. 0.5 to 0.7 % of our GNP would be enough to achieve this miracle, instead of wasting those 0.7% in Iraq, for instance (the total budget of the US for defense is 5% of the GNP). Sachs also believes that only sustainable development can help us save the planet and feed 1 billion people at the same time. And he thinks that China and India are not a threat, but a chance to share innovation. Until we can see these happy endings, the picture is quite different this side of the world. Between 2001 and 2004, the average yearly income of the 100 best-paid French managers has gone from 900 million € up to 1.4 billion € – not including stock-options. For instance, Thierry Desmarets, the manager of Total, earned an income of 2.8 million € in 2005, J.-F. Dehecq (Sanofi-Aventis) earned 4.16 million € and Arnaud Lagardère received 7.01 million € in 2004. In the US, the average employee yearly income stagnates around $ 27,000, when CEOs’ income (as a whole) has gone up from 3 to 12 million dollars. And almost 40% of the national wealth is owned by only 1% of the households! In Europe, people wonder why the positive effects of globalization generate so much profit for a happy few – including CEOs of big corporations – and so little in terms of jobs and salaries for themselves. They don’t understand how stock can yield up to 15% in dividends when growth stagnates below 3%. Something doesn’t add up. When the Asian economic crash occurred in 1998, years of development were wiped out overnight and it threw millions of people out of work. The blame was put on the global financial system that had been left without proper regulation. Globalization benefits some people… Which explains why so many people are against it : globalization is a fantastic wealth-generating mechanism that still remains out of reach for most people on the planet.

25

One “solution” was devised by Muhammad Yunus, the Bangladeshi Nobel Prize of Economics : microcredit. A loan granted to the poorest to help them struggle through poverty. In Bangladesh, 80% of the population benefit from microcredit. In 2010, 100% are expected to have access to that system. It will then reach over 100 million people in the world. Now, Yunus has been developing a new scheme called “social business”, which consists of small businesses that are the opposite of profit-driven SMEs or multinational corporations. There are 2 kinds : those that resort to dividends, but are owned by poor people, and those that yield no loss but no profit either. The micro-credit enables poor people to borrow small sums, and/or buy cheap shares ($1.50). The payback rate is 99%! The Grameen Bank is for women mostly, and women own it. Why? Because women use money in a wiser way than men, for the sake of the family. Danone and Crédit Agricole cooperate with Muhammad Yunus : the first supplies vitamin-enriched yogurt for kids, sold door-to-door ; the second has invested 50 million € in a foundation supporting those schemes. Was colonialism a factor of wealth for western nati ons? Not as much as we think. Growth of western nations was much slower than that of colonized nations. And the idea that raw material from colonized countries made us rich is wrong, because we already produced those raw materials in our countries. The import of raw material from poor countries started late in colonial history, long after their fate was already decided by facts. 98% of ore (minerai) came from Europe/US, 80% of textile fibers came from Europe/US. Same thing with energy : it all came from coal, that we had plenty of. It all began to change after WWII with oil, and 1957 was the year when the US began importing energy. Yet, in those years colonialism was coming to an end. Until after WWII, western nations did not need the natural wealth from poor countries. Accumulation of wealth was never achieved through colonialism. The plundering of natural resources didn’t start until the 60s. Western nations exploited poor countries when the latter were independent. Which, of course, is no excuse. ���� ANTI-GLOBALIZATION BACKLASH There are 2 kinds of anti-globalization movements: �� Those who reject our model, our values and the westernization of the world (like muslim fundamentalists) �� Those who reject our economic model because it generates injustice, poverty and violence (former left-wing activists, neo-hippies, etc.) They have one common point : globalization imposes the world a model the world doesn’t want.

26

Well, they are wrong. The world does want this model because it gives them an opportunity to get a better life, if not wealth. They want a piece of the cake. But this is like a mirage : as you get closer, it vanishes into thin air. Most of the time this is an illusion, but this is what is now happening with all the nations that are now left on the wayside. They want to get on board of the passing train even though this train is rushing to a cliff. China and India are exceptions. Why? Because they already had a powerful role in geopolitics and they are unified nations. Still, more than anti-western resentment through religious excuse or class war through political resistance, the real problem with globalization is that it does not keep its promises. So far, it has failed to deliver. Exploitation is not the strongest feeling it creates. Frustration is. This reminds us of the promises of socialism which was supposed to happen : the “beautiful future” that Communism was expected to establish never occurred. We had dictatorships and economic failure instead. There is a tragic paradox here : the second and third world want to join our system, take part in it, at a time when we realize that it has destroyed the environment and created social chaos (poverty, unemployment, financial absurdity, leading to upheaval in the suburbs, etc.) In the name of what could we refuse them this model of prosperity? (Or should we say “make-believe prosperity”, since there are 3.7 million people who live below the poverty line in France?) The backlash against globalization is not only a reaction from the deprived. It is also a reaction from people and governments alike when takeovers become too hazardous to local economies. The demonstrations in Thailand against the sale of telecom Shin Corp. to Singapore or against the sale of P&O/US ports to Dubai, the resistance of the British gas supplier Centrica against the Russian Gazprom or of Suez against Enel (both European “partners”, though!), the pressure that the US government tries to put on the Chinese to balance exchanges (imports/exports and currency parity $/yuan), are the sure sign that globalization is also seen as a threat by developed nations. Against all

27

expectations, a wave of protectionism is bound to sweep through advanced economies. Globalization triggers wariness. We might delve into philosophy and human nature to understand the root of the problem when it is right before our eyes : money. Self-Interest. Greed. These notions are intimately connected with the economy. Nobody can deny that. Which brings up a new question : how can we release the economy from the claws of greed? George Soros, the famous New-York financier, chairman of Soros Fund Management and Open Society Institute, admits it : « Globalisation is the answer, but not in its current form. We must develop schemes that include poor countries and we have to start making moral considerations an integral part of our foreign policy. » Soros is a generous donator to (and supervisor of) many programs fighting poverty. His propositions are realistic :

�� Contain instability of financial markets �� Correct bias in [our] international trade and financial institutions that favours only developed countries �� Complement WTO with powerful organizations devoted to social issues and poverty �� Improve life in countries suffering from corrupt, repressive or incompetent governments

To change mankind’s behaviour, there are basically 3 ways : �� Education and moral persuasion. A long shot. And surely a long-term option, if not sheer utopia, since it works for some good-willing people and takes generations to achieve little. The “revolutions” of the 70s have had little effect, since we are back to square one in terms of social and environmental balance. �� Rules and regulations. They sometimes trigger reactions and are often not complied with. Not a 100% safe option. �� Financial incentives. They work. Whenever you offer people financial compensatory solutions their willingness to implement fair policies shows up. Again, another paradox comes out : the solution to the problems caused by money and greed is… money. For pure souls this is depressing news. For business this is perhaps a promising prospect.

28

Now, what is the option? Change our view and show them how not to repeat our mistakes? Because our system seems to be a dead-end street. And the wall we are running into is made of social resentment, professional frustration, energetic crisis & environmental disaster, financial collapse, topped with political helplessness. Is this a pessimistic view or stark reality? Keyne’s Proposal “After the Second World War, John Maynard Keynes [prominent economist] proposed a radical overhaul of money. He suggested that international trade be settled in a new ‘currency’, and that holders of that currency would incur negative interest. That means the money earned by a successful exporting nation would always be diminishing in value, so it would naturally try to spend it as quickly as possible, and so boost the exports of other nations. Under this system, wealth and development is automatically shared between nations. (…) The plan was not supported. Instead, the poor nations borrow the rich nations’ money and pay them interest while trying to develop. It is a formula for the rich to grow richer.” (New Scientist) ���� ALTERNATIVES & THE ANTI-GROWTH OPTION Financial incentives have yet to be devised. They already exist in the environmental field, though – and they contribute to the reduction of global warming, for instance. But the problem of globalization encompasses many more stakes. If globalization, through liberalism, is the way by which we are supposed to create prosperity for all people in the world, we may have to change, not the concept, but the method. And if this does not work, we may have to change the concept as well. So, what are the other options? The first alternative that comes to mind is fair trade. It is already part of the economic system. And it works. But it remains a fraction of the many solutions that could be applied to solve the problem of poverty. Fair trade is defined as a combination of justice and respect for the environment. Farmers and craftworkers are paid a decent, fair price for what they produce, under the supervision of organizations that guarantee the final customer a purchase that is not sullied by exploitation or abuse. It started with coffee, which is the most traded commodity after oil! Small growers and textile makers gather in cooperatives and directly deal with the buyers. The proceeds enable them to have a better life, get

29

healthcare and send their children to school. For this purpose, the Western consumers agree to pay a slightly higher price when they go shopping – and the stores supposedly agree to reduce their profit margin a little. Max Havelaar is an association that controls and ensures that products deserve their “Fair Trade” label (Max Havelaar is neither a real person, nor a brand). Today, one million growers and craftspeople in 50 countries, and over 80 brands in 20 developed countries, benefit that label. And there are about 10,000 outlets that offer the Max Havelaar-labeled products on the worldwide scale. However, even though 90% of fair trade goes through big retailers, it still accounts for only 0.04% of the total volume of Leclerc, for instance. In other words, fair trade has a long way to go. Awareness is not yet a common factor among the general public. As far as Western producers are concerned, perhaps if fair trade was applied to local and national farmers, the State and Europe wouldn’t have to subsidize them as much as they do; but this would require a real effort from both consumers and retailers. To be honest, fair trade is yet to be perfected. Presently, there is no guarantee that the ‘fair price’ paid to cooperatives is shared with the producers. And the Max Havelaar label does not apply to all the players of the trading chain : transporters and food processing factories may not have fair trade practices even though the product they take care of was indeed produced according to the fair trade rules. In addition, companies that are not examples of ethics – Accor, Mc Donald’s, Starbuck – benefit the Max Havelaar label for part of their products, which is good for their reputation. Needless to say that big retailers too have understood how interesting fair trade is for their image…But ‘image’ does not mean ‘real nature’. It turns out that fair trade is sometimes just a business convenience. Just take a look at the volume of the offer dedicated to fair trade products in any given outlet or store, and you understand that it is all a front! The fair trade option is part of a second, wider picture : sustainable development, which encompasses a number of possible ways. The concept of “sustainable development” emerged in 1992 at the Earth Summit in Rio. Today it is still a unifying idea. But in terms of real effects, we must admit that we have been slow : the state of the planet is worse than ever. The great hope for a better world has not yet found its culminating achievement through action. Big corporations and people alike have kept on damaging the Earth in spite of their common claim “Let’s implement respectful development schemes!”. Why? Because profit, self-interest, lack of courage and short-term vision have weakened

30

our resolution. Worst of all, many multinational companies have appropriated the concept of sustainable development and use it as a promotional gimmick while proceeding with the direct or indirect plundering and destruction of the common natural heritage. They tend to forget two of the basic principles of sustainable development : �� The economic activity must reduce its impact in terms of raw materials and energy. In other words, it must use less of both for the same purpose. And it must reduce its footprint on the environment. �� The social aspect must prevail in order to stop human exploitation and share the proceeds of business in a more equitable way. Holding up a few ads for “A Better World” and “Green Programs” is a cheap trick to buy a clear conscience. Not that big corporations don’t do anything at all – but their good deeds hardly make up for all the harmful effects of their development policies. Let us not fool ourselves : companies are meant to grow and generate profit. Except for environment-related sectors, one hardly makes a dime with good feelings and generous practices. Where competition reigns, players have no qualms. Environment and fairness come last in their priorities. But if a tad of “sustainable development” helps them convey a better image of their business and restore their reputation when necessary, they will just seize the opportunity. If we look deeper into the issue of sustainable development, we soon realize that the current concept is a fraud even though the original intention is quite noble. Does this mean we should give up supporting sustainable development? Certainly not, because this is still better than not trying at all! What indeed happened? In 1972 the Stockholm Conference initiated an interest in “Human Environment”. In 1992, in Rio, the concept had shifted to “Environment and Development”. In 2002, in Johannesburg, the notion of environment was gone, to be replaced with that of “Sustainable Development”. Between 1972 and 2002, in spite of the many unheard warnings by scientists, not only has the Earth gone through the ordeal of unstoppable economic development, for which it has paid a tremendously heavy toll, but also the fundamental proposition of the preservation of the planet has been surreptitiously swept aside to the advantage of development. Now, development means growth, which entails the continuation of exploitation without which profit is no longer possible. In other words, growth and a system based on profit are not compatible with the preservation of the

31

planet even if they managed to achieve social justice and to provide food and healthcare for all, even if they enabled us to keep the planet safe and sound. Unless profit became a possibility resulting from a “non-developing economy”. Unless business and the economy agreed to minimize profit and pay the price for real sustainable alternatives. The final question is : Can development, i.e. growth, be sustainable when development is the origin of the problem? In some cases, though, economic activity harmonizes with the protection of the environment : Salvador and Costa Rica, for instance, can trade their CO2 emissions rights, which helps them preserve the forest they need to grow coffee, since wood absorbs tons of CO2. Therefore, the ecosystem is their main capital. In the case of agriculture, sustainable development may well be a realistic possibility, because it works : growers can live better and use the natural resources in a renewable way. But what agriculture can do, industry probably can’t, even by recycling what is produces, because the process always takes more than it returns. And yet, most of the big corporations comply with the social and environmental regulations, which tends to make us believe that we can proceed with growth…Hernando de Soto, the prominent Peruvian economist, for instance, believes that some multinationals have proven useful against poverty through specific aid and development schemes. Right. After decades of harmful practice, perhaps they can act for the common good… But at no time is growth questioned. This is interesting, because experts, business people and politicians constantly ramble on about “growth”. If those people know anything about how to save the world from an economic slump, the only weapon they brandish is growth. For each productive dollar China spends 4 times more energy than the US and 5 times more than Europe. As for CO2, the total emissions may triple by 2040 even if the Chinese become as clean as the North-Americans. This is mind-boggling. Growth? At the present rate of development the key questions are : What will happen when Asia and other nations have 2 cars per family (i.e. 1 additional billion vehicles on the planet) and 3 TV sets?

32

In the long term, what will happen when the whole world market is saturated? When there is no prospect for new markets, will China and India – then fully developed – use Africa as the last relocation ground? And then what? Will Mars be the next frontier for markets? In other words, can we go on with growth on a planet that has limited resources? Can we go on with growth on a planet where the markets will eventually come to the point of saturation despite an increasing demography? The answer is : no. If growth is not the answer, then we have to rethink the economic system… The third way is a daring and extremely challenging proposition : anti-growth. In French it is called décroissance. It does not quite translate properly, since stopping growth is not the same thing as putting the economic process into reverse. The idea is to bring development to a slowdown, if not to a halt. In the eyes of the economists, the anti-growth alternative is nonsense. The economy needs growth. Productivity-Consumption is the binary movement that allows economic survival. To achieve that, the Keynesian economists used to increase the purchasing power of people through salary raises. But what was good for one given nation is no longer viable on the world scale. Open economies encourage consumers to buy cheaper, foreign-made products. Now, the cost of labor must go down in industrial countries in order to enable exportation to developing countries. But this conflicts with what globalization is supposed to achieve : wealth for all. The upshot is that some lose their jobs while others can’t yet have access to the “better-off” status. Still, the Keynesian system would still work on a worldwide scale if the purchasing power went up on the worldwide scale, thus boosting growth for all nations. Critical observers of the economy suggest that rich countries are in no hurry to see poorer nations develop to become competitors and request their share of the global cake. Which brings us back to the question of natural resources : since they are limited, why should we share them? This is exactly where economists reach the limit of the problem. Except for a few of them – Jeffrey Sachs (Head of the Earth Institute, Harvard and Columbia professor, UN advisor), Joseph Stiglitz (Nobel Prize), Noam Chomsky (not an economist, but a scholar in linguistics and a political activist) –, they do know about the issue but they are reluctant to

33

“officially” address the question and loudly proclaim that growth is plundering. But the evidence is right before our eyes : the water supplies, the fish and marine ecosystems, animal species, the forests and clean air (supposedly renewable) are dwindling at an alarming rate and, added to the global warming and to the diminishing of oil, natural gas, coal and aluminium (non-renewable), will undoubtedly place us against the wall as far as economic development is concerned. If rich countries were in the least interested in the fate of poorer ones, they would simply cancel their debt in the first place, they would then offer free medical assistance to fight AIDS in Africa, malaria, famine, infant mortality, and political assistance against repressive regimes, illiteracy, fundamentalism, ... NGOs are always on the front line, while governments do very little except giving fine-sounding, high-flown speeches and while business people do what is good for their “ethical image”. In fact, geopolitics and the economy are connected, to the detriment of the (now) ever-increasing world population. It turns out that the cake has become too small. And that growth will reach its own limit sooner or later for lack of new prospective fields. So, how can we act here and now to avoid the final crash? Since consumption is the problem, we can increase both personal and public awareness by refusing hypocrisy. For instance, why do we advocate our own social system that gives us free holidays, high wages, health coverage and welfare and, at the same time, purchase cheap goods – at the local supermarkets – that are made by children in sweatshops and by near-slaves with no coverage and revolting hourly rates? Why do we refuse noxious chemicals to be sprayed on our fields while we buy imported fruit and vegetables that are grown – cheaper – with intensive spreading of harmful products and that take fuel to ship, thus having more impact on people’s health and on the environment? Why do we protect our forests whereas acres and acres of woodlands are destroyed overseas so we can furnish our homes with “tropical wood decks”, “tropical wood floors”, “tropical wood chairs” and “tropical wood tables”?

34

To see what the economy does to the environment, there is no need to examine pages of reports. Just go to the nearest foodstore and buy a few items. Open them up and see how much marketing cares about cheating and wasting. Many products come in bulky packaging that is sometimes almost half-empty. Cookies, cosmetics, cereal, powder products (sugar, cocoa,...), animal repellent, you name it… The product is often contained in a cardboard packaging that is a lot larger than necessary. The customer is deceived by a big box where 10 to 40% more product could have been fitted in. Even though the weight tallies with the figure printed on the box, this is pure illusion – a “visual lie” – and a total waste of raw material. Either the industries should fill in their packages completely or they should reduce the amount of cardboard they use. But the dictatorship of marketing has the last word and who cares about the environment! Another pang of conscience could be sparked off if it suddenly dawned on us that business churns out stuff that we think we need, but that we actually don’t need. Rich countries are encouraged to consume while emerging and developing nations are striving to catch up with us! All in the name of growth and development. For each dollar in production, China uses 4 times the amount of energy that the US does and 5 times what Europe does. Where do you think China, India, Russia, the US and Europe get what they need to fuel their growth, therefore consumption? Consumption feeds on raw materials, and it pollutes the Earth. At the same time consumption pollutes our brains through the vast manipulation of marketing as if always buying more was the sole purpose of our lives. The result of all that is double damage. However, not consuming more than we really need can be a fantastic lever against blind growth. The French use a pun : the consommateur must turn into a consommacteur. Vast worldwide movements will be less efficient than daily ant-like awareness and action. Individuals can act in their daily life to reduce their footprint on the environment, by deciding to reduce their consumption of products and energy, and by refusing to give in to economic pressure when it entails human exploitation. This attitude requires long-term vision – reaching beyond our immediate selfishness – and global awareness. For all the players of globalization – consumers and corporate world altogether – being part of the overall economic system means being able to stand back in order to take in the world situation with a critical eye, including our own personal position.

35

CCCCCCCCOOOOOOOONNNNNNNNCCCCCCCCLLLLLLLLUUUUUUUUSSSSSSSSIIIIIIIIOOOOOOOONNNNNNNN CCCCCCCCOOOOOOOONNNNNNNNCCCCCCCCLLLLLLLLUUUUUUUUSSSSSSSSIIIIIIIIOOOOOOOONNNNNNNN What will be the price to pay for all of us, socially, economically, politically, ecologically to create a balance that will enable 9 billion human inhabitants to live well on a planet that shrinks every day? Bill Clinton said recently “We cannot have a global trading system without a global economic policy, a global healthcare policy, a global education policy, a global environmental policy and a global security policy.” Utopia, dream, unrealistic alternative? Perhaps not as much as we think. When facing what seems out of reach, I always remember the dialogue between Gandhi and a British military official at a negotiation table: “Independence? You’re not suggesting the British Empire should leave India, do you, Mr. Gandhi?” “Oh, yes, I do.” , replied Gandhi. How could the British ever imagine that they could possibly relinquish their major possession abroad? Unthinkable. And yet, this skinny, stooped and half-naked man, was standing up to a long-established colonial empire and, without touching a rifle himself, managed to achieve the impossible : kicking the foreign masters out. This is a lesson to remember, because being enslaved to the master Business is not irreversible : as customers, we should decide what and how we want to consume, thus having our say in the productive process and in the way we use natural resources and how the dividends of growth should be shared out. Instead of being driven by economic coercion, consumers can exert their own influence through well-considered purchasing and thoughtful choices in their daily life. We should often ask ourselves these questions : “When I buy this item, do I hurt someone?”, “When I participate in the local and global economic process, does my action have a negative impact along the line?” This is how globalization and sustainable policies can eventually be turned toward their prime objectives : providing for all without further damage to our planet. I would like to finish this study with a little story. It says a lot more than lengthy reports about what people can decide they want to do with their life in this economic world... That is food for thought.

36

The American Businessman and the Mexican Fisherman An American businessman was at the pier of a small Mexican village when a small boat with a fisherman docked. Inside the small boat were several big fish. The American complimented the Mexican on the quality of his fish and asked how long it took to catch them. The Mexican replied “ only a little while.” The American then asked why didn’t he (the fisherman) stay out longer and catch more fish ? The Mexican said he had enough to fulfill his family’s immediate needs. The American then asked “But what do you do with the rest of your time ? ”. The Mexican fisherman said “ I sleep late, fish a little, play with my children, take siesta with my wife, stroll into the village each evening, where I have wine and play guitar with my amigos. I have a full and busy life, Señor.” The American scoffed and said “I’m a Harvard MBA and I could help you. You should spend more time fishing and, with the proceeds, buy a bigger boat. With the proceeds from the bigger boat you could buy several boats, eventually you would have a fleet of fishing boats. Instead of selling your catch to a middleman, you would sell directly to the processor, eventually opening your own cannery. You would control the product, processing and distribution. You would need to leave this small village and move to Mexico City, then L.A. and eventually to New York City where you would run your expanding company.” The Mexican fisherman asked “ But, Señor, how long would this all take ? ” “ 15 to 20 years. ” the American replied. “ And what then, Señor ? ” The American businessman laughed and said “ Well, when the time is right, you would announce an IPO (International Public Offer) and sell your company stocks (shares) to the public and become very rich. You would make millions.” “ Millions, Señor ? Then what ? ” “ Then, you would retire, move to a small coastal fishing village where you would sleep late, fish a little, play with your children, take siesta with your wife, stroll into the village in the evenings, where you could have wine and play guitar with your amigos…”