glial cell-line derived neurotrophic factor-dependent fusimotor neuron survival during development

Glial cell-line derived neurotrophic factor-dependent fusimotor

neuron survival during development

Jennifer Whiteheada,d, Cynthia Keller-Pecke, Jan Kuceraf,g, Warren G. Tourtellottea,b,c,d,*

aDepartment of Pathology (Neuropathology), Northwestern University, Chicago, IL 60611, USAbDepartment of Neurology, Northwestern University, Chicago, IL 60611, USA

cThe Institute for Neuroscience, Northwestern University, Chicago, IL 60611, USAdVeterans Administration Lakeside Division in Chicago, Chicago, IL 60611, USA

eDepartment of Anatomy and Neurobiology, Washington University, 660 S Euclid Ave., St Louis, MO 63110, USAfDepartment of Neurology, Boston University School of Medicine, Boston, MA, USA

gThe Veterans Administration Medical Center in Boston, Boston MA, USA

Received 30 July 2004; received in revised form 13 September 2004; accepted 14 September 2004

Available online 6 October 2004

Abstract

Glial cell-line derived neurotrophic factor (GDNF) is a potent survival factor for motor neurons. Previous studies have shown that some

motor neurons depend upon GDNF during development but this GDNF-dependent motor neuron subpopulation has not been characterized.

We examined GDNF expression patterns in muscle and the impact of altered GDNF expression on the development of subtypes of motor

neurons. In GDNF hemizygous mice, motor neuron innervation to muscle spindle stretch receptors (fusimotor neuron innervation) was

decreased, whereas in transgenic mice that overexpress GDNF in muscle, fusimotor innervation to muscle spindles was increased. Facial

motor neurons, which do not contain fusimotor neurons, were not changed in number when GDNF was over expressed by facial muscles

during their development. Taken together, these data indicate that fusimotor neurons depend upon GDNF for survival during development.

Since the fraction of cervical and lumbar motor neurons lost in GDNF-deficient mice at birth closely approximates the size of the fusimotor

neuron pool, these data suggest that motor neuron loss in GDNF-deficient mice may be primarily of fusimotor neuron origin.

q 2004 Elsevier Ireland Ltd. All rights reserved.

Keywords: Glial cell-line derived neurotrophic factor; Motor neuron; Muscle spindle; Fusimotor

1. Introduction

Glial cell-line derived neurotrophic factor (GDNF) is a

potent motor neuron survival factor for developing and

mature motor neurons (Henderson et al., 1994; Li et al.,

1995; Yan et al., 1995; Zurn et al., 1994). It is best known for

its ability to rescue motor neurons from death after injury

(Henderson et al., 1994; Matheson et al., 1997; Oppenheim

et al., 1995; Ramer et al., 2000; Vejsada et al., 1998) and in

animal models of primary motor neuron degeneration (e.g.

amyotrophic lateral sclerosis; ALS) (Kaspar et al., 2003;

0925-4773/$ - see front matter q 2004 Elsevier Ireland Ltd. All rights reserved.

doi:10.1016/j.mod.2004.09.003

* Corresponding author. Address: Departments of Pathology (Neuro-

pathology), Neurology, The Institute for Neuroscience, Northwestern

University, 303 E. Chicago Ave., Chicago, IL 60611, USA. Tel.: C1 312

503 2415; fax: C1 312 503 2459.

E-mail address: [email protected] (W.G. Tourtellotte).

Mohajeri et al., 1999). Comparatively little is known about

its role during motor neuron development but it appears to

function as a target derived neurotrophic factor for motor

neurons in vivo because it is expressed in developing and

adult target muscles (Trupp et al., 1996; Wright and Snider,

1996), it is retrogradely transported in motor axons (Tomac

et al., 1995; Yan et al., 1995) and a fraction of spinal motor

neurons appear to co-express the preferred GDNF signaling

receptor complex, GFRa1/c-ret (Leitner et al., 1999;

Oppenheim et al., 2000). GDNF is among a large group of

motor neuron trophic factors that include other GDNF

family members (Neurturin and Persephin) (Kotzbauer

et al., 1996; Milbrandt et al., 1998), brain-derived neuro-

trophic factor (BDNF) (Oppenheim et al., 1992; Sendtner

et al., 1992a; Yan et al., 1992), neurotrophin-4 (NT4)

(Koliatsos et al., 1994), insulin-like growth factor-1 (IGF-1)

(Lewis et al., 1993; Neff et al., 1993), ciliary neurotrophic

Mechanisms of Development 122 (2005) 27–41

www.elsevier.com/locate/modo

http://www.elsevier.com/locate/modo

J. Whitehead et al. / Mechanisms of Development 122 (2005) 27–4128

factor (CNTF) (Sendtner et al., 1992b), leukemia inhibitory

factor (LIF) (Cheema et al., 1994), cardiotrophin-1 (Pennica

et al., 1996) and hepatocyte growth factor/scatter factor

(HGF/SF) (Yamamoto et al., 1997). GDNF is one of

the most potent motor neuron survival factors identified

to date but like all other known motor neuron survival

factors, only a fraction of motor neurons depend upon it

during development or are rescued by it after injury. In

GDNF-deficient and GFRa1-deficient mice approximately

22–35% of spinal motor neurons are lost by birth,

demonstrating the existence of GDNF-dependent and

GDNF-independent motor neuron populations (Cacalano

et al., 1998; Moore et al., 1996; Oppenheim et al., 2000;

Sanchez et al., 1996).

The GDNF-dependent motor neurons in the spinal cord

have remained poorly characterized. Studies focused on

identifying the spinal motor neurons lost in GFRa1-

deficient or GDNF-deficient mice have shown that they

are distributed in a complex manner throughout the rostral-

caudal extent of the spinal cord, in the medial and lateral

motor columns, and that most of them express the preferred

GFRa1/c-ret GDNF signaling receptor complex (Garces

et al., 2000; Homma et al., 2003; Oppenheim et al., 2000).

There is no single trophic factor identified that all motor

neurons depend upon, but it is clear that motor neurons

derive survival and differentiation signals from muscle

during development since mutant mice lacking all skeletal

muscles due to impaired myogenesis also lack somatic

motor neurons (Grieshammer et al., 1998; Kablar and

Rudnicki, 1999). Accordingly, GDNF-dependent motor

neurons probably derive GDNF from a specific population

of target muscle fibers once innervation is initiated. Indeed,

this appears to be the case for a particular population of

brachial motor neurons that innervate the latisssimus dorsi

(LD) and cutaneous maximus muscles (CM) in mice

(Haase et al., 2002; Helmbacher et al., 2003). These

muscles selectively express GDNF during their innervation

where it regulates the expression of the Ets related

transcription factor Pea3 in the CM and LD motor neuron

pools in the spinal cord. Interestingly, GDNF plays a

critical role in establishing the motor neuron pools that

innervate CM and LD at embryonic day 12.5 (E12.5) but it

is not required for motor neuron survival at this develop-

mental stage since spinal motor neuron numbers are not

altered at E12.5 in GDNF-deficient mice (Haase et al.,

2002; Oppenheim et al., 2000). At later stages of

development however, GDNF clearly has an additional

role related to motor neuron survival that is more

widespread than its highly selective role in regulating

Pea3 expression in brachial motor neurons that innervate

CM and LD muscles.

We hypothesized that GDNF-dependent spinal motor

neurons could be further characterized by examining

whether they represent functionally similar motor neurons

that derive GDNF from a related population of target

muscle fibers. Here we demonstrate that GDNF is

expressed in a sub-population of muscle fibers known as

intrafusal muscle fibers within muscle spindle stretch

receptors and that fusimotor neurons innervating intrafusal

muscle fibers depend upon trophic signals from spindles

for survival during development. Moreover, fusimotor

innervation is selectively reduced in GDNF haploinsuffi-

cient (GDNFC/lacz) mice and it is increased in mice

expressing GDNF in all muscle fibers (MyoGDNF). These

results demonstrate a role for GDNF in the survival of

fusimotor neurons, an important class of motor neurons

involved in proprioception. Thus, we propose that spinal

motor neuron loss in GDNF-deficient mice is, at least in

part, attributed to loss of fusimotor neurons.

2. Results

2.1. GDNF expression is localized to intrafusal muscle

fibers in skeletal muscle spindle stretch receptors

To understand the role of GDNF as a motor neuron

survival factor for a subset of spinal motor neurons, we

examined the expression of GDNF in developing muscles

using heterozygous mice (GDNFC/lacz) that express a loss-

of-function n-terminal GDNF/b-galactosidase (lacz) fusion

protein (Moore et al., 1996). In E12.5 embryos, GDNF/

lacz expression was identified in proximal forelimb and

hindlimb buds, and in mesenchymal cells positioned along

the ventral rostral-caudal extent of the spinal cord as

previously described (Haase et al., 2002; Wright and

Snider, 1996). GDNF expression in muscle was examined

at later developmental timepoints since widespread

motor neuron death occurs between E14.5 and E15.5 in

GDNF-deficient mice (Oppenheim et al., 2000). GDNF/

lacz positive skeletal muscle fibers were first identified in

E15.5 embryos (data not shown) and by E18.5, the

individual GDNF/lacz expressing muscle fibers were

clearly identifiable as single intrafusal muscle fibers within

muscle spindle stretch receptors. The first intrafusal fiber to

form after the onset of spindle morphogenesis is the

nuclear bag2 fiber, which can be identified by its selective

expression of slow-developmental myosin heavy chain

(Kucera and Walro, 1995). In nascent spindles, GDNF/lacz

was expressed in intrafusal fibers that formed after the

bag2 fiber, in either a nuclear bag1 or a nuclear chain

intrafusal fiber (Fig. 1A,B). At E18.5, the GDNF/lacz

reaction product clearly delineated the entire length of

single intrafusal fibers (Fig. 1C, arrows). In adult spindles,

GDNF/lacz was identified in all intrafusal muscle fibers

within each spindle throughout the longitudinal extent of

the fibers (Fig. 1D,E). Whereas all intrafusal muscle fibers

expressed high levels of GDNF, a small number of

extrafusal muscle fibers were noted to express low levels

of GDNF in late embryonic, perinatal and adult GDNF/

lacz heterozygous mice.

Fig. 1. GDNF/lacz expression in muscle spindle intrafusal fibers during development in mice. (A) Shortly after the onset of spindle morphogenesis in mouse

skeletal muscle, GDNFlacz is expressed in single intrafusal muscle spindle fibers (E18.5, lacz histochemistry; arrow pointing to single transversely sectioned

blue fiber). (B) An adjacent tissue section shows slow-developmental myosin heavy chain expression by the first intrafusal muscle fiber to form during spindle

morphogenesis, the nuclear bag2 fiber (S46 immunohistochemistry; arrow pointing to single transversely sectioned red fiber). At this developmental stage,

GDNF/lacz and slow-developmental myosin heavy chain expression are not colocalized to the same intrafusal fibers, indicating that GDNF/lacz is initially

expressed in an intrafusal fiber that forms after the nuclear bag2 fiber (either nuclear bag1 or nuclear chain fiber). Thus, GDNF/lacz expression is initiated in

intrafusal fibers well after the onset of spindle morphogenesis. (C) GDNF/lacz expression in intrafusal muscle fibers in intercostal muscles from E18.5

GDNF/lacz heterozygous mice. Single GDNF/lacz expressing intrafusal fibers are running in anti-parallel directions (blue fibers), reflecting the anti-parallel

orientation of the two intercostal muscle layers that interconnect the ribs (r). (D and E) In spindles from adult skeletal muscle, GDNF/lacz expression is

identified in all intrafusal fibers. The same spindle is transversely sectioned through (D) the equatorial and (E) the polar region demonstrating GDNF/lacz

reaction product throughout the longitudinal extent of the fibers. (Magnification barsZ1 mm.)

J. Whitehead et al. / Mechanisms of Development 122 (2005) 27–41 29

2.2. Fusimotor neuron innervation depends upon intact

spindles during development

Somatic motor neurons require signals from skeletal

muscles for survival during development but the relation-

ship between particular trophic factors and the motor

neurons that depend upon them remains very poorly defined

(Grieshammer et al., 1998; Kablar and Rudnicki, 1999). To

test the hypothesis that the innervation of spindles by

fusimotor neurons depends upon spindle-derived trophic

signals, we examined mice deficient in the transcription

factor Egr3. Egr3 and GDNF are expressed by spindles

during their morphogenesis (Fig. 2A–D) and adult

Egr3-deficient mice lack muscle spindles (Tourtellotte

and Milbrandt, 1998). Cervical and lumbar ventral spinal

roots were examined in wild type and Egr3-deficient mice

to identify large diameter skeletomotor and small

diameter fusimotor axons (Kawamura et al., 1977;

McHanwell and Biscoe, 1981). In Egr3-deficient mice,

O95% of the small diameter fusimotor axons (g) were

Fig. 2. Muscle spindles produce trophic signals that are essential for fusimotor innervation. (A) In newborn skeletal muscle (PN0.5), expression of the zinc-finger

transcription factor Egr3 colocalizes (brown labeling) with (B) GDNF/lacz expression (blue labeling) in a similar subset of intrafusal muscle fibers. (C) In adult

spindles, Egr3 is expressed (brown labeling) in all intrafusal muscle fibers similar to (D) the expression pattern of GDNF/lacz (blue labeling). (E) Extrafusal

muscle fibers are innervated by large diameter motor neurons that give rise to large diameter myelinated (a, skeletomotor) axons, whereas intrafusal fibers are

innervated by small diameter motor neurons that give rise to small diameter (g, fusimotor) axons. In wild type mice (top), a bimodal axon diameter-frequency

distribution distinguishes fusimotor from skeletomotor axons, accounting for approximately 35% and 65%, respectively, of the motor axons innervating skeletal

muscle from this ventral spinal root. In adult Egr3-deficient mice (bottom), greater than 95% of the fusimotor axons are missing while there is no significant

change in the number of skeletomotor axons. Fusimotor axon loss as a consequence of absent muscle targets (spindles) in Egr3-deficient mice indicates that

spindles produce trophic signals that are required to support fusimotor neuron innervation during development. (Magnification barZ5 mm (A–D) and 10 mm (E).)


absent while no significant difference in the number of

large diameter skeletomotor axons (a) was identified

(Fig. 2E). That fusimotor neuron innervation to abnormal

Egr3-deficient spindles is present at birth (Tourtellotte

et al., 2001) and that fusimotor axons degenerate after

spindles disassemble in the periphery, indicates that

fusimotor neurons require intact spindles for their survival

during development.


2.3. GDNF/lacz haploinsufficient mice have abnormal

fusimotor but not skeletomotor innervation

We observed that fusimotor innervation depends upon

intact muscle spindles and that GDNF expression is highly

restricted to intrafusal muscle fibers within spindles. To

determine whether fusimotor neurons specifically depend

upon GDNF produced by spindles, we examined fusimotor

and skeletomotor axons in ventral spinal nerve roots from

adult GDNF/lacz heterozygous mice. Since there are

presently no molecular markers available that distinguish

fusimotor from skeletomotor neurons in the spinal cord,

Fig. 3. Fusimotor neurons depend upon muscle-derived GDNF for target innervatio

contain skeletomotor (large diameter) and fusimotor (small diameter) axons. In GD

decreased in the ventral spinal roots (L4 shown here). (B) The axon diameter–frequ

roots defines the fusimotor axon (%3.5 mm in diameter) and skeletomotor axon

diameters. (C) L4 ventral roots from GDNF/lacz heterozygous mice contained 11

roots. The axon loss was entirely attributed to a 46% loss of fusimotor axons (P!0

skeletomotor axons between wild type and GDNF/lacz heterozygous adult L4 ve

and the differential diameter-frequency relationship

between skeletomotor and fusimotor axons is poorly

established at birth, we examined ventral roots from adult

GDNF/lacz heterozygous and wild type mice (Fig. 3A). It

was necessary to examine heterozygous mice since GDNF/

lacz homozygous mice suffer from renal agenesis and die

shortly after birth (Moore et al., 1996; Pichel et al., 1996;

Sanchez et al., 1996). To define whether fusimotor or

skeletomotor neurons were preferentially affected, we

analyzed the diameter and frequency of myelinated axons

in cervical (C4) and lumbar (L4) ventral roots from adult

wild type and GDNF/lacz heterozygous mice. The axon

n. (A) Ventral spinal roots (L4 shown here) from adult wild type mice (left)

NF/lacz heterozygous mice (right), the number of fusimotor axons appears

ency analysis from adult wild type and GDNF/lacz heterozygous L4 ventral

(O3.5 mm in diameter) populations from the bimodal distribution of axon

% fewer total myelinated axons (P!0.05, Student’s t-test) than wild type

.01, Student’s t-test), as there was no significant difference in the number of

ntral roots. (Magnification barsZ10 mm.)

Fig. 4. Axon diameter–frequency analysis demonstrates a selective loss of

fusimotor axons in muscle nerves from GDNF/lacz heterozygous mice. (A)

Adult medial gastrocnemius muscle nerves had 9.1% fewer axons (P!0.05, Student’s t-test) in GDNF/lacz heterozygous mice relative to wild

type mice. The axon loss was attributed to a 29% loss of small diameter

axons (P!0.05, Student’s t-test), the majority of which were fusimotor

axons. (B) Similarly, soleus muscle nerves from GDNF/lacz heterozygous

mice had 11% fewer axons (P!0.05, Student’s t-test) with all of the axon

loss attributed to a 31% loss of small diameter fusimotor axons (P!0.01,

Student’s t-test). (C) A small branch of the soleus nerve (the ‘propriocep-

proprioceptive’ branch) innervates Golgi tendon organs and spindles but

contains no skeletomotor axons. There was a 43% loss of axons (P!0.05,

Student’s t-test) in the proprioceptive branch of the soleus muscle nerve,

which was entirely attributed to a 63% loss of small diameter axons (P!0.0001, Student’s t-test), the vast majority of which are fusimotor axons.


diameter measurements showed a characteristic bimodal

distribution that identified fusimotor axons (‘small’ diam-

eter myelinated axons %3.5 mm in diameter) and skeleto-

motor axons (‘large’ diameter myelinated axons O3.5 mm

in diameter) (Fig. 3B) (Kawamura et al., 1977; Ringstedt et

al., 1998; Tourtellotte et al., 2001; Tourtellotte and

Milbrandt, 1998). In L4 ventral roots, 34% of the motor

axons originated from fusimotor neurons and of those, 46%

were lost in GDNF/lacz heterozygous mice (P!0.01;

Student’s t-test; Fig. 3C). Analysis of cervical (C4) ventral

nerve roots showed similar results (not shown). Surpris-

ingly, the motor axon loss in GDNF/lacz heterozygous mice

was entirely attributed to a loss of fusimotor axons since

there was no significant change in the number of

skeletomotor axons (Fig. 3C).

Individual hindlimb muscle nerves supplied by other

lumbar and sacral spinal roots were also examined to

confirm the results obtained from the analysis of lumbar

(L4) and cervical (C4) ventral roots. In the medial

gastrocnemius muscle nerve (supplied by L4, L5 and the

first sacral (S1) nerve roots) there was a 9.1% decrease in the

number of axons entering the muscle in GDNF/lacz

heterozygous mice (P!0.05; Student’s t-test). Moreover,

diameter-frequency analysis of axons in the medial gastro-

cnemius muscle nerve showed a selective loss of small

myelinated axons (29%, P!0.05; Student’s t-test) and no

loss of large diameter myelinated axons in GDNF/lacz

heterozygous mice (Fig. 4A). Similarly, in the soleus

muscle nerve (also supplied by L4, L5 and S1 spinal

roots) there was an 11% decrease (P!0.05; Student’s t-test)

in the total number of myelinated axons in GDNF/lacz

heterozygous mice and a selective loss of small (31%,

P!0.01; Student’s t-test) but not large diameter myelinated

axons (Fig. 4B). Unlike the analysis performed on lumbar

and cervical ventral spinal roots that contain primarily

motor axons, examination of the muscle nerves was

confounded by the fact that they contained a mixture of

sensory and motor axons. Some small diameter myelinated

sensory axons were included in the morphometry analysis of

the muscle nerves, which may have contributed to

decreasing the magnitude of small diameter axon loss

relative to the loss identified in ventral spinal roots from

GDNF/lacz heterozygous mice. This interpretation was

validated by analyzing a purely proprioceptive branch of the

soleus muscle nerve, which innervates only Golgi tendon

organs and muscle spindles. This nerve branch contains a

mixture of myelinated axons that consist of large diameter

sensory axons (Group Ia, II and Ib) and small diameter

axons (primarily fusimotor efferents) that innervate 2–4

muscle spindles and three Golgi tendon organs, but no

extrafusal muscle fibers in the soleus muscle (see Section 4)

(Tourtellotte et al., 2001; Vult von Steyern et al., 1999).

Morphometric analysis of the proprioceptive branch of the

soleus muscle nerve from adult GDNF/lacz heterozygous

mice showed a 43% loss of the total number of myelinated

axons (P!0.05; Student’s t-test), a 63% loss of small


diameter axons (P!0.0001; Student’s t-test) and no change

in the number of large diameter axons (Fig. 4C). These data

confirm the observations that GDNF is essential for

fusimotor neuron innervation of intrafusal muscle fibers

during development in mice.

2.4. Increased fusimotor innervation in transgenic mice

that over-express GDNF in muscle

Increased GDNF expression in skeletal muscle of

transgenic mice (MyoGDNF) or chronic perinatal GDNF

administration leads to increased numbers of spinal and

cranial somatic motor neurons (Oppenheim et al., 2000; Sun

et al., 2003). The results demonstrating that fusimotor

neurons require GDNF produced by target intrafusal fibers

raises the possibility that at least some of the somatic motor

neuron increase observed in GDNF treated or MyoGDNF

transgenic mice could be attributed to an increase in the

number of fusimotor neurons that was never considered in

any of the previously published reports. MyoGDNF mice

were examined at PN28, a time point when the transient

perinatal neuromuscular junction polyinnervation had

decreased to control levels (Nguyen et al., 1998). The

innervation pattern in muscle spindles from hindlimb

muscles was examined using confocal microscopy to

characterize axons innervating spindles from whole mount

muscle preparations. Muscle spindles from MyoGDNF

mice were hyperinnervated by small diameter axons

entering the equatorial zone of spindles when compared to

wild type littermate mice. The small diameter axons were

identified as fusimotor axons (g) since they terminated on a-

bungarotoxin labeled motor endplates near the polar region

of the intrafusal muscle fibers (Fig. 5A,B). Hindlimb and

paraspinal muscles were embedded in resin and serially

sectioned to quantify the fusimotor innervation to individual

spindles (see Section 4). In MyoGDNF mice, medial

gastrocnemius muscle spindles were innervated by 63%

more fusimotor axons (P!0.0001, Student’s t-test), soleus

muscle spindles were innervated by 68% more fusimotor

axons (P!0.0001, Student’s t-test) and paraspinal muscle

spindles were innervated by 118% more fusimotor axons

(P!0.005, Student’s t-test) compared to wild type mice

(Fig. 5C). No change in the sensory innervation to spindles

was identified. Fusimotor hyperinnervation of spindles was

further confirmed by examining the proprioceptive branch

of the soleus nerve in MyoGDNF and wild type mice.

Consistent with the results obtained from the individual

spindle analyses, there was an increase in the total number

of axons (38% increase; P!0.01, Student’s t-test) and small

diameter myelinated (primarily fusimotor) axons (50%

increase; P!0.05, Student’s t-test) but no difference in

the large diameter (sensory proprioceptive) axons within the

nerve branch (Fig. 5D). The increase in fusimotor

innervation to spindles was primarily due to an increase in

fusimotor innervation from separate axons rather than

intramuscular preterminal axon branching since there was

an increase in the number of small diameter (fusimotor)

axons in the proprioceptive branch of the soleus nerve

(Fig. 5D) as well as the medial gastrocnemius and tibialis

anterior muscle nerves (not shown). These results demon-

strate that GDNF overexpression in muscle during devel-

opment leads to a sustained increase in fusimotor

innervation of spindles.

Newborn MyoGDNF mice are reported to have approxi-

mately 45% more lumbar and brachial spinal motor neurons

than wild type mice (Oppenheim et al., 2000). Since there

are no selective molecular markers for fusimotor neurons, it

was not possible to directly examine the relative proportion

of fusimotor and skeletomotor neurons present in the spinal

cord of neonatal MyoGDNF mice. To examine whether

fusimotor neurons were selectively increased by muscle

specific GDNF expression, we examined cervical and

lumbar ventral spinal roots from PN28 MyoGDNF and

wild type mice. Since the observations were similar, we

focused our analysis on the L4 ventral roots. Compared to

wild type ventral roots (Fig. 6A, left), the cross-sections

from lumbar (L4) ventral roots of MyoGDNF mice (Fig. 6A,

right) showed a large increase in the number of small-

diameter myelinated axons. A characteristic bimodal axon

diameter distribution was noted in the ventral roots

(Fig. 6B). However, there were 105% more total myelinated

axons in MyoGDNF L4 ventral roots than wild type L4

ventral roots (P!0.001, Student’s t-test). The small

diameter myelinated axons were increased by 324% relative

to wild type (P!0.0005, Student’s t test) whereas the

large diameter myelinated axons were decreased by 37%

(P!0.05, Student’s t-test). The axon counts were an

accurate reflection of the number of motor neurons in this

spinal cord segment since there was no detectable axon

branching within the ventral roots when proximal and distal

sections of the roots were compared. The marked increase in

the number of small diameter myelinated axons parallels the

increased fusimotor innervation that was directly observed

in muscle spindles from MyoGDNF mice. However, it was

not possible to exclude the possibility that a portion of the

small diameter axons could have originated from atrophic

skeletomotor neurons or that some small diameter axons

ended blindly in muscle.

2.5. Facial motor neurons which lack fusimotor neurons

are not increased in MyoGDNF mice

The facial motor nerve innervates facial muscles and

lacks fusimotor axons since facial muscles are devoid

of spindles. In GDNF-deficient mice, previous reports

indicated that there is no loss of facial motor neurons

(Mikaels et al., 2000; Moore et al., 1996; Sanchez et al.,

1996), which may reflect the fact that there are no fusimotor

neurons present. To examine whether facial motor neurons

respond to GDNF during development, we examined facial

motor neurons and axons in wild type and MyoGDNF mice.

We found no difference in the number of facial motor

Fig. 5. Muscle specific over expression of GDNF in transgenic mice (Myo-GDNF) leads to fusimotor hyperinnervation of muscle spindles. (A) Motor and

sensory innervation to individual muscle spindles was observed in intact PN28 skeletal muscles using confocal microscopy. In wild type muscles, small

diameter fusimotor axons (g; neurofilament immunohistochemistry, green) entered the spindle capsule near the equatorial region and terminated on a-

bungarotoxin labeled motor endplates (red). The intrafusal muscle fibers were identified by their specific myonuclear expression of Egr3 (Egr3; Egr3

immunohistochemistry; blue). Note the large diameter group Ia sensory axon (Ia; neurofilament immunohistochemistry, green) forming an anulospiral ending

around an intrafusal fiber. (B) Spindles from Myo-GDNF mice showed obvious hyperinnervation by small caliber myelinated axons (g; neurofilament

immunohistochemistry, green) that terminated on a-bungarotoxin motor endplates (red), the latter feature defining them as fusimotor axons. (C) Serial sections

from resin embedded muscle tissues were used to count the number of fusimotor axons that innervated individual spindles by tracing the axons terminating on

the polar region of intrafusal fibers to their entry into the spindle capsule. Spindles from Myo-GDNF medial gastrocnemius muscle were innervated by 63%

more fusimotor axons (P!0.0001, Student’s t-test), spindles from soleus muscle were innervated by 68% more fusimotor axons (P!0.0001, Student’s t-test)

and spindles from lumbar paraspinal muscles were innervated by 118% more fusimotor axons (P!0.005, Student’s t-test) relative to spindles from the same

muscles in age matched wild type mice. (D) The proprioceptive branch of the soleus muscle nerve from Myo-GDNF mice had 38% more axons (P!0.01,

Student’s t-test) than wild type mice. The increase in the number of axons was entirely attributed to a 50% increase (P!0.05, Student’s t-test) in the number of

small diameter fusimotor axons. (Magnification barsZ100 mm.)


neurons between PN28 wild type and MyoGDNF mice

(Student’s t-test; PZ0.73, Fig. 7A). To confirm these results,

we counted the number of axons in facial motor nerves.

Consistent with the facial motor neuron counts, no

differences were observed in the number of facial motor

axons between PN28 wild type and MyoGDNF mice

(Student’s t-test; PZ0.67, Fig. 7A). Moreover, axon

diameter-frequency analysis showed no significant differ-

ences in the axon diameter distributions within the facial

nerve (Fig. 7B and morphometry data not shown). Thus, in

sharp contrast to spinal motor innervation (Fig. 6A), facial

motor innervation (Fig. 7B) is unaffected in the context of

increased GDNF expression in muscle during development.

While muscle GDNF transgene expression and protein

content have been confirmed in upper hindlimb muscles

from PN3 MyoGDNF mice (Nguyen et al., 1998), GDNF

transgene expression has not been confirmed in facial

muscles from these mice. Apart from the fact that facial

motor neurons are devoid of fusimotor neurons, an

alternative explanation for a lack of facial motor neuron

Fig. 6. Altered distribution of axon types and numbers in lumbar ventral roots from Myo-GDNF mice. (A) In lumbar ventral roots from PN28 wild type mice

(left), a normal number of large diameter myelinated skeletomotor and small diameter myelinated fusimotor axons were noted. In L4 ventral roots from PN28

Myo-GDNF mice (right), there was a large increase in small diameter myelinated axons and a decrease in large diameter myelinated axons. (B) The axon

diameter-frequency analysis defined the two different axon populations that in wild type mice correspond to fusimotor and skeletomotor axons. (C) In Myo-

GDNF mice, there was a 105% increase (P!0.001, Student’s t-test) in the total number of myelinated axons. The small diameter myelinated axons,

indistinguishable from fusimotor axons in wild type mice, were increased by 324% (P!0.0005, Student’s t-test) while large diameter axons were decreased by

37% (P!0.05, Student’s t-test). The small diameter axon increase is consistent with a selective increase in survival and/or proliferation of fusimotor neurons in

the spinal cord. The selective decrease in large diameter myelinated axons is consistent with an increase in the motor unit size within skeletal muscles in

Myo-GDNF mice that has been previously reported. (Magnification barsZ10 mm.)


response to increased muscle produced GDNF could be that

the MyoGDNF transgene is not expressed in facial muscles.

We examined GDNF expression using semi-quantitative

RT-PCR analysis and found that GDNF was expressed at

comparable levels in facial (posterior digastric) and hindlimb

(gastrocnemius) muscles in PN28 and adult MyoGDNF

mice, and that the expression was markedly elevated relative

to muscle from wild type mice (Fig. 7C). Thus, despite the

fact that facial motor neurons are exposed to elevated levels

of GDNF in MyoGDNF mice, they dramatically differ in

their response to GDNF relative to spinal motor neurons. The

results are consistent with the hypothesis that fusimotor

neurons which are present in the spinal cord, but not in the

facial motor nucleus, are preferentially rescued from

programmed cell death by GDNF during development.

3. Discussion

Previous attempts to characterize GDNF-dependent

motor neurons have met with little success, largely because

molecular markers that distinguish functional groups of

neurons are limited in number (Garces et al., 2000; Homma

et al., 2003; Oppenheim et al., 2000). GDNF-dependent

Fig. 7. Unlike axons in spinal ventral roots, facial motor axons were not affected by over expression of GDNF in muscle in Myo-GDNF mice. Facial muscles do

not contain muscle spindles and hence facial motor neurons are devoid of fusimotor neurons. (A) Neither the number of facial motor neurons (left) nor the

number of facial motor axons (right) was altered in adult Myo-GDNF mice relative to wild type littermate mice. (B) Unlike the axon changes that occurred in

lumbar ventral roots, there were no obvious differences between wild type and Myo-GDNF facial motor axons. (C) Semi-quantitative PCR analysis

demonstrated equivalent levels of GDNF expression in facial (posterior digastric; lanes 3 and 5) and hindlimb (gastrocnemius; lanes 4 and 6) muscles in PN28

and adult Myo-GDNF mice. GDNF was expressed at far lower levels in both posterior digastric (lane 1) and gastrocnemius (lane 2) muscles from wild type

muscles. The cycle number was reduced to maintain linear amplification of highly expressed GDNF in transgenic muscle samples (lanes 3–6) thereby reducing

the sensitivity of the assay to a level that was unable to detect the low abundance endogenous GDNF expression in muscle from PN28 wild type mice (lanes 1

and 2). PCR reactions performed with no template added (water only) showed no amplification of GDNF or GAPDH (lane C). (Magnification barsZ5 mm.)


motor neurons appear to express GFRa1, c-ret and isl-1

which is consistent with the fact that they express the

components of the preferred GDNF signaling receptor

complex (GFRa1 and c-ret) and have a motor neuron

phenotype (isl-1) (Oppenheim et al., 2000). It was not

possible to directly characterize GDNF-dependent motor

neurons further so we explored whether they were

functionally related by examining GDNF expression in

muscle. We found GDNF expression localized to intrafusal

muscle fibers shortly after the induction of spindle

morphogenesis at E15.5–E16.5 and low levels of GDNF

expression in relatively few extrafusal muscle fibers.

Fusimotor neurons were dependent upon intact spindles

since Egr3-deficient mice with defective spindle morpho-

genesis lacked fusimotor innervation. Taken together, these

results indicate that fusimotor neurons depend upon trophic

signals produced by spindles and that GDNF is a candidate

trophic factor required for their survival during develop-

ment. Since it was not possible to study fusimotor neurons

directly in GDNF-deficient mice without fusimotor neuron

specific markers, we used axon morphometry to distinguish

small diameter fusimotor axons from large diameter

skeletomotor axons in ventral spinal roots and motor nerves.

Fusimotor innervation to muscle spindles was decreased by

46% in GDNF haploinsufficient mice which closely agreed

with the predicted 50% that would be lost if fusimotor

neurons were dependent upon GDNF produced in limiting

amount by target muscle fibers. Moreover, the morpho-

metric analysis demonstrated that fusimotor axons rep-

resented 34% of the L4 motor axons which was similar to

the 22–30% lumbar motor neuron loss previously reported

in newborn GDNF-deficient mice (Oppenheim et al., 2000;

Sanchez et al., 1996). From these data, the calculated

average net loss of motor axons would be 16% (100%!0.34!0.46) in GDNF/lacz heterozygous mice, which

compared within 5% to the measured total axon loss of

11% (P!0.05; Student’s t-test, Fig. 3C). Accordingly, these

results would predict that 32% (16%!2) of the motor

axons, attributed entirely to fusimotor axons, would be lost

if it were possible to study GDNF/lacz-deficient mice using

these methods. These results also closely corresponded to

the amount of motor neuron loss previously reported in

GDNF-deficient mice. That fusimotor neurons appear to

depend upon target derived GDNF from intrafusal muscle

fibers is similar to neurotrophin dependent sensory inner-

vation of intrafusal muscle fibers. Intrafusal muscle fibers


receive both sensory (group Ia and II afferent) and motor

(fusimotor efferent) innervation and they express both

Neurotrophin-3 (NT3) and GDNF. Mice lacking either NT3

or TrkC, the preferred tyrosine kinase signaling receptor for

NT3, also lack group Ia sensory neurons (Ernfors et al.,

1994; Klein et al., 1994; Kucera et al., 1995) and fusimotor

neurons. However, in NT-3 deficient mice, fusimotor

neuron loss is dependent upon intact Ia-afferents and

spindles rather than trophic activity from NT-3 (Ringstedt

et al., 1998). Thus GDNF and NT3 appear to have analogous

but distinct roles in establishing and/or maintaining motor

and sensory innervation to intrafusal muscle fibers.

It was surprising that there was no skeletomotor axon

loss in GDNF haploinsufficient mice since it has been

widely assumed that skeletomotor neurons are lost in

GDNF-deficient mice. This concept has been largely

promulgated by evidence that GDNF has potent survival

activity for injured skeletomotor neurons and in dissociated

motor neuron cultures (Henderson et al., 1994; Matheson

et al., 1997). However, GDNF application to injured motor

neurons, to motor neurons cultured in vitro, or by systemic

administration or abnormal tissue expression all reflect

abnormal cellular contexts that may not recapitulate the role

of GDNF during normal development. In this study, we

sought to identify the motor neuron population that depends

upon GDNF for survival in an anatomically relevant

developmental context. Skeletomotor neurons do not appear

to require GDNF for survival during development, but since

our conclusions are based upon results obtained from

haploinsufficient mice, we cannot rule out the possibility

that other motor neuron survival factors produced by muscle

may have masked the affects of decreased GDNF available

to skeletomotor neurons. By contrast, the results clearly

demonstrate that fusimotor neurons depend upon GDNF

since unequivocal fusimotor axon loss was associated with

GDNF haploinsufficiency. Moreover, this interpretation was

further supported by GDNF expression which is primarily

restricted to intrafusal muscle fibers, the developmental

timing of motor neuron loss in GDNF-deficient mice that is

well correlated with the timing of GDNF expression in

intrafusal muscle fibers and the fact that the magnitude of

L4 motor neuron loss in GDNF-deficient mice is similar to

the size of the L4 fusimotor neuron pool. While our detailed

studies were mainly focused on the analysis of L4 motor

neurons, similar results were obtained when we analyzed

axon loss in muscle nerves arising from other lumbar and

sacral roots and when we examined cervical (C4) ventral

roots.

To examine whether GDNF could influence the distri-

bution of skeletomotor and fusimotor neurons, we examined

transgenic mice that express GDNF in all muscle fibers

(MyoGDNF) and found a marked increase in small

myelinated axons and a decrease in large myelinated

axons. The large myelinated (skeletomotor) axon loss in

MyoGDNF mice (e.g. 37% loss in L4 ventral root

corresponding to 63% of the axons remaining to innervate

the same number of extrafusal muscle fibersZ1.6-fold

increase in the average motor unit size) closely compared to

previously published results indicating that skeletomotor

unit size is increased by approximately 1.5-fold in both

MyoGDNF mice and mice treated postnatally with GDNF

(Keller-Peck et al., 2001; Nguyen et al., 1998). However,

the large increase in the number of motor neurons that

appears to correspond to an increase in small diameter axons

is not easily explained (Oppenheim et al., 2000). It is

possible that the increased number of small myelinated

axons corresponded to atrophic skeletomotor axons but in

agreement with what has been previously reported in

MyoGDNF mice, polyinnervation of extrafusal muscle

fibers by separate axons was not observed and thus seems

unlikely to account for a large skeletomotor neuron/axon

increase (Keller-Peck et al., 2001; Nguyen et al., 1998). The

axon increase must have corresponded 1:1 with the increase

in the number of motor neurons since axons numbers in

proximal and distal segments of ventral roots and muscle

nerves showed no evidence of axon branching. Thus, it is

tempting to speculate that GDNF expression in muscle leads

to a selective increase in fusimotor neurons. Indeed,

hyperinnervation of intrafusal muscle fibers was confirmed

in individually examined spindles from several different

muscles indicating that at least some of the small myelinated

axons terminated on intrafusal fibers. It was not possible to

resolve all of the individual axons within the intramuscular

nerve bundles with our imaging technique, but some axons

may have ended blindly and not terminated on any muscle

fibers. Thus, the increased number of small diameter

myelinated axons must have originated from newly formed

neurons or neurons rescued from programmed cell death in

MyoGDNF mice. Despite the fact that the small diameter

myelinated axons were morphologically indistinguishable

from fusimotor axons, until specific molecular markers that

distinguish fusimotor from skeletomotor neurons become

available, it will not be possible to directly study these

motor neuron populations within the spinal cord.

Fusimotor neurons may be similar to skeletomotor

neurons in their response to GDNF and the fact that they

appear to differentially respond to GDNF during develop-

ment may be largely dictated by the fact that fusimotor

neurons derive GDNF from intrafusal muscle fiber targets

that express high levels of GDNF, whereas skeletomotor

neurons that innervate extrafusal muscle fibers do not.

GDNF-dependent motor neurons express GFRa1 and c-ret

whereas many GDNF-independent motor neurons express

additional receptors such as GFRa2 that may allow them to

respond to other trophic factors and not depend strictly upon

GDNF (Mikaels et al., 2000; Oppenheim et al., 2000). A

subset of spinal and cranial neurons are GDNF-dependent

with the exception of facial motor neurons that do not

appear to depend upon GDNF during development (Mikaels

et al., 2000; Moore et al., 1996; Sanchez et al., 1996). One

potential explanation for why facial motor neurons do not

depend upon GDNF during development is that they do not


contain any fusimotor neurons since facial muscles are

devoid of muscle spindles. Accordingly, unlike ventral

spinal roots and muscle nerves, we found no change in the

number of facial motor neurons or axons in MyoGDNF

mice, despite high levels of GDNF expression in facial

muscles. We speculate that this differential responsiveness

to muscle derived GDNF, which is dramatically different for

spinal motor neurons, is due to the fact that there are no

fusimotor neurons in the facial nucleus that require GDNF

during development.

There are many motor neuron trophic factors that have

been described but a single trophic factor that all motor

neurons depend upon has never been identified. Since many

trophic factors have motor neuron survival activity, there

may be a high degree of redundancy such that the function of

one trophic factor could compensate for loss of another.

Current data would seem to support some aspects of this

model since many motor neurons express receptors for more

than a single trophic factor (Garces et al., 2000; Homma et al.,

2003; Oppenheim et al., 2000). In part, this may explain why

administration of a single trophic factor to motor neurons in

vitro or after injury may rescue comparably more neurons

than are lost in vivo in the trophic factor deficient mice. For

example, c-ret, GFRa1 (the preferred GDNF co-receptor)

and GFRa2 (the preferred Neurturin co-receptor) are

expressed in most facial motor neurons (Mikaels et al.,

2000). Facial motor neurons do not require GDNF in vivo

suggesting that Neurturin or another neurotrophin may

compensate for loss of GDNF. Thus, while facial motor

neurons are rescued from programmed cell death by GDNF

administered after injury or when GDNF is supplied to

dissociated neurons in vitro (Henderson et al., 1994;

Matheson et al., 1997; Oppenheim et al., 1995; Yan et al.,

1995), the motor neurons do not depend upon GDNF because

other survival signaling mechanisms may be utilized.

Accordingly, it is possible that fusimotor neurons express

c-ret and GFRa1, but not other receptors for potential trophic

factors expressed by intrafusal fibers, making them strictly

dependent upon GDNF for survival during development.

While trophic factor redundancy may be one mechanism for

ensuring motor neuron survival, motor neurons that require

single trophic factors, or a discreet combination of trophic

factors, may have a specific relationship to the muscle targets

that are innervated and the functions that the neurons

subserve. Thus, the myriad motor neuron trophic factors

that have been described may reflect a unique relationship

between particular motor neurons and specific muscle fiber

types or functionally related muscle groups that are not

currently appreciated. For example, there is precedence for

this organizational scheme in different classes of sensory

neurons that mediate proprioception and nociception.

Proprioceptive and nociceptive neurons in the dorsal root

ganglion require NT3 and nerve growth factor (NGF),

respectively, from their targets for survival, which closely

relates to the sensory neuron subtype and function. Likewise,

fusimotor neurons may derive GDNF from intrafusal muscle

fibers that participate in maintaining or establishing their

interaction with intrafusal muscle fibers. As more consider-

ation is given to exploring the use of GDNF and other

potential motor neuron trophic factors for treating motor

neuron diseases, it will be essential to thoroughly character-

ize the motor neuron populations upon which these factors

act. Our data indicate that GDNF, which has a transient

trophic influence on skeletomotor neurons and sustained

trophic affects on fusimotor neurons, may not be the best

choice for treatment of motor neuronopathies, such as ALS,

that primarily affect skeletomotor neurons (Kawamura et al.,

1981; Tsukagoshi et al., 1979).

4. Methods

Animals. Egr3-deficient mice were generated as pre-

viously described(Tourtellotte and Milbrandt, 1998) and

genotyped by PCR using the following primers: Egr3sense:

GTCAACCCACCCCCTATTACCCCA, Egr3antisense: ATG

TGAGTGGTGAGGTGGTCGCT and Neoantisense: ATA-

TTGGCTGCAGGGTCGCTCGG. GDNF/lacz-deficient

mice were generated as previously described (Moore et al.,

1996) and genotyped by PCR with the following primers:

GDNFsense: CAGCGCTTCCTCGAAGAGAGAGGAA-

TCGGC, GDNFantisense: CATGCCTGGCCTACCTTGTCA

and Laczantisense: GATGGGCGCA TCGTAACCGTG-

CATCT. Myo-GDNF transgenic mice were generated as

previously described (Nguyen et al., 1998) and genotyped by

PCR with the following primers: hGHsense: GCCTA-

TATCCCAAAGGAACAGAAG and hGHantisense:

CCTTCCTCTAGGTCCTTTAGGAGG. For all PCR geno-

typing, the reaction conditions were: 95 8C!3 0; (95 8C!30 00; 60 8C!30 00; 72 8C!1 0)!35 cycles; 72 8C!10 0. The

use of all of the animals was approved by the Animal Care

and Use Committee of Northwestern University.

Histology. Hindlimbs or dissected muscles from newborn

(PN0.5), adolescent (PN28) or adult (PNO60) mice were

obtained after intracardiac aldehyde perfusion (4% parafor-

maldehyde, 0.1 M phosphate buffer (PB), pHZ7.4). Periph-

eral nerves and ventral spinal roots were dissected from PN28

and adult mice after intracardiac perfusion with gluteralde-

hyde/paraformaldehyde fixative (2.5% gluteraldehyde, 2%

paraformaldehyde, 0.1 M cacodylate buffer, pHZ7.2).

Muscles and hindlimbs were cryoprotected in 30% sucro-

se/PB, embedded in OCT and sectioned at 15-mm thickness

on a cryostat. Peripheral nerves and ventral spinal roots were

fixed overnight in gluteraldehyde/paraformaldehyde fixa-

tive, washed in cacodylate buffer, osmicated, dehydrated and

embedded in Epon 812 (EMS). 1-mm thick resin embedded

tissue sections were stained with Toluidine Blue.

Immunohistochemistry. Immunohistochemistry was per-

formed on either frozen tissue sections from hindlimbs and

muscles or on whole unsectioned muscles (whole mount

preparation). Tissue sections were incubated with 3%

normal serum/0.1% Triton X-100 in PBS (blocking buffer)


for 1 h at room temperature. The sections were incubated in

primary antibody diluted in blocking buffer overnight at

4 8C. The sections were washed in PBS/0.1% Triton X-100

and incubated with either an appropriate fluorescent

secondary antibodies (Cy3, Cy5, Jackson Immunoresearch

or Alexa-488, Molecular Probes) or a horseradish peroxi-

dase (HRP) conjugated secondary antibody for 1 h at room

temperature. When HRP-conjugated secondary antibodies

were used, the immunocomplexes were visualized using

DAB histochemistry. The whole mount immunohistochem-

istry was essentially the same except that the sections were

washed for a longer time between antibody incubations

(3–4 h) and the detergent in the blocking and antibody

diluents was increased (0.4% Triton X-100). The following

reagents were used: rabbit anti-Egr3 antibody (SC-191,

Santa Cruz Biotechnology, 1:1000), mouse anti-neurofila-

ment antibody (SMI-312, Sternberger Monoclonals,

1:1000), mouse anti-slow developmental myosin heavy

chain (S46, Developmental Studies Hybroma Bank,

University of Iowa, 1:1000) and Cy3- conjugated a-bungar-

bungarotoxin (Molecular Probes, 1:200). Fluorescent

images were captured with a Nikon E600 microscope

equipped with a Spot digital camera (Research Diagnostics).

Spindles within whole mount muscle preparations were

visualized with a Zeiss LS510 confocal microscope using a

100! oil immersion lens. Individual microscopic fields

were assembled into large field montages using Photoshop

(Adobe) to generate high-resolution images of spindles and

their innervating axons.

b-Galactosidase (lacz) histochemistry. Lacz histochem-

istry on 10-mm aldehyde-fixed frozen muscle sections and

newborn intact mice was performed as previously described

(Hogan, 1994).

Axon morphometry. Axon morphometry of ventral spinal

roots and peripheral nerves was performed as previously

described (Tourtellotte and Milbrandt, 1998). Diameter–

frequency measurements of individual axons and total axon

numbers were determined for ventral roots and peripheral

nerves. To examine whether axons branched within the

roots or nerves the number of axons and axon diameter-

frequency from proximal and distal portions of many nerves

or ventral roots were compared.

Analysis of the proprioceptive branch of the soleus

muscle nerve. The proprioceptive branch of the soleus nerve

was analyzed as described previously (Tourtellotte et al.,

2001). In the mouse, the soleus muscle nerve divides into a

large and a small branch approximately 200–500 mm

proximal to its entry into the muscle (Vult von Steyern et

al., 1999). The small proprioceptive branch supplies sensory

(Ia, Ib, II) and fusimotor axons to 2–4 spindles and three

Golgi tendon organs (GTO) located in the proximal part of

the muscle. There are no skeletomotor axons in this nerve

branch. The composition of this purely proprioceptive

branch of the soleus muscle nerve was determined by

retrograde tracing using serial transverse sections of resin

embedded muscle to identify the constituent axons from

their spindle or GTO terminations. Large caliber axons

terminating in the equatorial region of spindles were group

Ia afferents and axons terminating in the juxtaequatorial

regions were group II afferents. Axons innervating GTOs

were identified as Ib afferents. Axons other than Ia, Ib and II

(‘large diameter’ axons) represented a mixed group

comprising fusimotor efferents and group III non-proprio-

ceptive afferents (‘small diameter’ axons). The total number

of small diameter axons (primarily fusimotor efferents) in

the nerve branch was determined and compared between

wild type, Myo-GDNF and GDNF/lacz heterozygous mice.

Analysis of fusimotor innervation of spindles. Serial

sections were examined from transversely cut resin

embedded muscles. Fusimotor efferents were identified as

small diameter myelinated axons within spindles that

terminated on intrafusal muscle fibers in the polar region

of spindles. Individual fusimotor axons were traced back in

the serial sections to their entry point at the equatorial region

of the spindle and counted in individual spindles from wild

type and Myo-GDNF mice. A total of 3–10 spindles were

serially reconstructed for each genotype and for several

different muscles.

Quantification of facial motor neurons and facial motor

axons. Mice were perfused through the heart with 4%

paraformaldehyde/0.1 M phosphate buffer (pHZ7.4). The

brainstems from PN28 wild type (NZ4, transgene negative)

and Myo-GDNF (NZ4, transgene positive) mice were

dissected, processed in paraffin and 8-mm serial sections

were cut in the transverse plane. The tissue sections were

stained with Cresyl Violet and motor neurons within the

discreet facial motor nucleus were counted. Starting with

the first section containing facial motor neurons, every third

section was counted throughout the rostral-caudal extent of

the nucleus. To avoid counting neurons more than once,

they were scored only if they contained nuclear profiles with

an intact nucleolus. For facial motor nerve axon counts and

morphometry, PN28 wild type (NZ4) and Myo-GDNF

(NZ4) mice were perfused with 2.5% gluteraldehyde, 2%

paraformaldehyde, 0.1 M cacodylate buffer (pHZ7.2) and

the facial nerve was dissected as it existed the skull. This

portion of the facial nerve represented the majority of axons

projecting from the facial motor nucleus but did not

represent axons that innervated posterior auricular muscu-

lature and the stapedius muscle. Accordingly, the number of

motor axons counted in this portion of the facial nerve was

always less than the number of motor neurons counted in the

brainstem.

Semi-quantitative RT-PCR. The posterior digastric

muscle (a representative facial muscle) and gastrocnemius

muscle (a representative upper hindlimb muscle) from adult

and PN28 wild type and Myo-GDNF mice were dissected

and snap frozen in liquid nitrogen. The tissues were lysed in

Trizol (Invitrogen) and total RNA was extracted. For each

muscle and time point examined, total RNA was pooled

from three animals. Reverse transcription using Superscript

II reverse transcriptase (Invitrogen) was performed


according to the manufacturer’s protocol. The cDNA was

subjected to PCR using gene specific primers for GDNF

(GDNFsense: AGCGCTTCCTCGAAGAGAGAGGAA-

TCGGC, GDNFantisense: CATGCCTGGCCTACCTTGTCA

and glyceraldehydes-3-phosphate dehydrogenase (GAPDH;

GAPDHsense: GCTTTCCAGAGGGGCCATCCACAG,

GAPDHantisense: GCTTTCCAGAGGGGCCATCCACAG).

The PCR reaction was cycled in the linear range and the

products probed by Southern blotting with cDNA probes for

GDNF and GAPDH.

Statistical analysis. For all quantitative analyses, at least

three animals for each genotype and tissue were analyzed.

For many nerves analyzed by morphometry, tissue sections

from proximal and distal regions of the nerve were

compared to determine whether there was significant axon

branching within the nerve. Statistical significance was

determined using Student’s t-test with significance set at

P!0.05.

Acknowledgements

This work was supported by grants to W.G.T. from the

VA Medical Research Service (Merit Review) and NIH

(NS40748). J.K. received funding from the Veterans

Administration and the National Science Foundation. We

thank Dr. T. Jessell, Columbia University, NY for providing

the PEA3 antibody, Dr. A. Parsadanian, Washington

University, St. Louis, for providing the GDNF cDNA,

Dr. H. Phillips, Genentec, San Francisco, CA for providing

the GDNF/lacz knockout mice and Dr. W. Snider, UNC,

Chapel Hill, NC for providing the Myo-GDNF transgenic

mice.

References

Cacalano, G., Farinas, I., Wang, L.C., Hagler, K., Forgie, A., Moore, M.,

et al., 1998. GFRalpha1 is an essential receptor component for GDNF in

the developing nervous system and kidney. Neuron 21, 53–62.

Cheema, S.S., Richards, L.J., Murphy, M., Bartlett, P.F., 1994. Leukaemia

inhibitory factor rescues motoneurones from axotomy-induced cell

death. Neuroreport 5, 989–992.

Ernfors, P., Lee, K.F., Kucera, J., Jaenisch, R., 1994. Lack of neurotrophin-

3 leads to deficiencies in the peripheral nervous system and loss of limb

proprioceptive afferents. Cell 77, 503–512.

Garces, A., Haase, G., Airaksinen, M.S., Livet, J., Filippi, P.,

deLapeyriere, O., 2000. GFRalpha 1 is required for development of

distinct subpopulations of motoneuron. J. Neurosci. 20, 4992–5000.

Grieshammer, U., Lewandoski, M., Prevette, D., Oppenheim, R.W.,

Martin, G.R., 1998. Muscle-specific cell ablation conditional upon

Cre-mediated DNA recombination in transgenic mice leads to

massive spinal and cranial motoneuron loss. Dev. Biol. 197,

234–247.

Haase, G., Dessaud, E., Garces, A., de Bovis, B., Birling, M., Filippi, P.,

et al., 2002. GDNF acts through PEA3 to regulate cell body positioning

and muscle innervation of specific motor neuron pools. Neuron 35,

893–905.

Helmbacher, F., Dessaud, E., Arber, S., deLapeyriere, O., Henderson, C.E.,

Klein, R., Maina, F., 2003. Met signaling is required for recruitment of

motor neurons to PEA3-positive motor pools. Neuron 39, 767–777.

Henderson, C.E., Phillips, H.S., Pollock, R.A., Davies, A.M., Lemeulle, C.,

Armanini, M., et al., 1994. GDNF: a potent survival factor for

motoneurons present in peripheral nerve and muscle. Science 266,

1062–1064.

Hogan, B., 1994. Manipulating the Mouse Embryo: A Laboratory Manual.

Cold Spring Harbor Laboratory Press, Plainview, NY pp. xvii, 497.

Homma, S., Yaginuma, H., Vinsant, S., Seino, M., Kawata, M., Gould, T.,

et al., 2003. Differential expression of the GDNF family receptors RET

and GFRalpha1. 2, and 4 in subsets of motoneurons: a relationship

between motoneuron birthdate and receptor expression. J. Comp.

Neurol. 456, 245–259.

Kablar, B., Rudnicki, M.A., 1999. Development in the absence of skeletal

muscle results in the sequential ablation of motor neurons from the

spinal cord to the brain. Dev. Biol. 208, 93–109.

Kaspar, B.K., Llado, J., Sherkat, N., Rothstein, J.D., Gage, F.H., 2003.

Retrograde viral delivery of IGF-1 prolongs survival in a mouse ALS

model. Science 301, 839–842.

Kawamura, Y., Okazaki, H., O’Brien, P.C., Dych, P.J., 1977. Lumbar

motoneurons of man: I. Number and diameter histogram of alpha and

gamma axons of ventral root. J. Neuropathol. Exp. Neurol. 36, 853–860.

Kawamura, Y., Dyck, P.J., Shimono, M., Okazaki, H., Tateishi, J., Doi, H.,

1981. Morphometric comparison of the vulnerability of peripheral

motor and sensory neurons in amyotrophic lateral sclerosis.

J. Neuropathol. Exp. Neurol. 40, 667–675.

Keller-Peck, C.R., Feng, G., Sanes, J.R., Yan, Q., Lichtman, J.W.,

Snider, W.D., 2001. Glial cell line-derived neurotrophic factor

administration in postnatal life results in motor unit enlargement and

continuous synaptic remodeling at the neuromuscular junction.

J. Neurosci. 21, 6136–6146.

Klein, R., Silos-Santiago, I., Smeyne, R.J., Lira, S.A., Brambilla, R.,

Bryant, S., et al., 1994. Disruption of the neurotrophin-3 receptor gene

trkC eliminates la muscle afferents and results in abnormal movements.

Nature 368, 249–251.

Koliatsos, V.E., Cayouette, M.H., Berkemeier, L.R., Clatterbuck, R.E.,

Price, D.L., Rosenthal, A., 1994. Neurotrophin 4/5 is a trophic factor

for mammalian facial motor neurons. Proc. Natl Acad. Sci. USA 91,

3304–3308.

Kotzbauer, P.T., Lampe, P.A., Heuckeroth, R.O., Golden, J.P.,

Creedon, D.J., Johnson Jr., E.M., Milbrandt, J., 1996. Neurturin,

a relative of glial-cell-line-derived neurotrophic factor. Nature 384,

467–470.

Kucera, J., Walro, J.M., 1995. Origin of intrafusal fibers from a subset of

primary myotubes in the rat. Anat. Embryol. (Berlin) 192, 149–158.

Kucera, J., Fan, G., Jaenisch, R., Linnarsson, S., Ernfors, P., 1995.

Dependence of developing group Ia afferents on neurotrophin-3.

J. Comp. Neurol. 363, 307–320.

Leitner, M.L., Molliver, D.C., Osborne, P.A., Vejsada, R., Golden, J.P.,

Lampe, P.A., et al., 1999. Analysis of the retrograde transport of glial

cell line-derived neurotrophic factor (GDNF), neurturin, and persephin

suggests that in vivo signaling for the GDNF family is GFRalpha

coreceptor-specific. J. Neurosci. 19, 9322–9331.

Lewis, M.E., Neff, N.T., Contreras, P.C., Stong, D.B., Oppenheim, R.W.,

Grebow, P.E., Vaught, J.L., 1993. Insulin-like growth factor-I: potential

for treatment of motor neuronal disorders. Exp. Neurol. 124, 73–88.

Li, L., Wu, W., Lin, L.F., Lei, M., Oppenheim, R.W., Houenou, L.J., 1995.

Rescue of adult mouse motoneurons from injury-induced cell death by

glial cell line-derived neurotrophic factor. Proc. Natl Acad. Sci. USA

92, 9771–9775.

Matheson, C.R., Wang, J., Collins, F.D., Yan, Q., 1997. Long-term survival

effects of GDNF on neonatal rat facial motoneurons after axotomy.

Neuroreport 8, 1739–1742.

McHanwell, S., Biscoe, T.J., 1981. The sizes of motoneurons supplying

hindlimb muscles in the mouse. Proc. R. Soc. Lond. B Biol. Sci. 213,

201–216.


Mikaels, A., Livet, J., Westphal, H., De Lapeyriere, O., Ernfors, P., 2000. A

dynamic regulation of GDNF-family receptors correlates with a specific

trophic dependency of cranial motor neuron subpopulations during

development. Eur. J. Neurosci. 12, 446–456.

Milbrandt, J., de Sauvage, F.J., Fahrner, T.J., Baloh, R.H., Leitner, M.L.,

Tansey, M.G., et al., 1998. Persephin, a novel neurotrophic factor

related to GDNF and neurturin. Neuron 20, 245–253.

Mohajeri, M.H., Figlewicz, D.A., Bohn, M.C., 1999. Intramuscular grafts

of myoblasts genetically modified to secrete glial cell line-derived

neurotrophic factor prevent motoneuron loss and disease progression in

a mouse model of familial amyotrophic lateral sclerosis. Hum. Gene

Ther. 10, 1853–1866.

Moore, M.W., Klein, R.D., Farinas, I., Sauer, H., Armanini, M.,

Phillips, H., et al., 1996. Renal and neuronal abnormalities in mice

lacking GDNF. Nature 382, 76–79.

Neff, N.T., Prevette, D., Houenou, L.J., Lewis, M.E., Glicksman, M.A.,

Yin, Q.W., Oppenheim, R.W., 1993. Insulin-like growth factors:

putative muscle-derived trophic agents that promote motoneuron

survival. J. Neurobiol. 24, 1578–1588.

Nguyen, Q.T., Parsadanian, A.S., Snider, W.D., Lichtman, J.W., 1998.

Hyperinnervation of neuromuscular junctions caused by GDNF over-

expression in muscle. Science 279, 1725–1729.

Oppenheim, R.W., Yin, Q.W., Prevette, D., Yan, Q., 1992. Brain-derived

neurotrophic factor rescues developing avian motoneurons from cell

death. Nature 360, 755–757.

Oppenheim, R.W., Houenou, L.J., Johnson, J.E., Lin, L.F., Li, L., Lo, A.C.,

et al., 1995. Developing motor neurons rescued from programmed and

axotomy-induced cell death by GDNF. Nature 373, 344–346.

Oppenheim, R.W., Houenou, L.J., Parsadanian, A.S., Prevette, D.,

Snider, W.D., Shen, L., 2000. Glial cell line-derived neurotrophic

factor and developing mammalian motoneurons: regulation of pro-

grammed cell death among motoneuron subtypes. J. Neurosci. 20,

5001–5011.

Pennica, D., Arce, V., Swanson, T.A., Vejsada, R., Pollock, R.A.,

Armanini, M., Dudley, K., et al., 1996. Cardiotrophin-1, a cytokine

present in embryonic muscle, supports long-term survival of spinal

motoneurons. Neuron 17, 63–74.

Pichel, J.G., Shen, L., Sheng, H.Z., Granholm, A.C., Drago, J.,

Grinberg, A., et al., 1996. Defects in enteric innervation and kidney

development in mice lacking GDNF. Nature 382, 73–76.

Ramer, M.S., Priestley, J.V., McMahon, S.B., 2000. Functional regener-

ation of sensory axons into the adult spinal cord. Nature 403, 312–316.

Ringstedt, T., Copray, S., Walro, J., Kucera, J., 1998. Development

of fusimotor innervation correlates with group Ia afferents but

is independent of neurotrophin-3. Brain Res. Dev. Brain Res. 111,

295–300 bin/cas/tree/store/bresd/cas_sub/browse/browse.cgi?yearZ1998&volumeZ111&issueZ2&aidZ60721.

Sanchez, M.P., Silos-Santiago, I., Frisen, J., He, B., Lira, S.A.,

Barbacid, M., 1996. Renal agenesis and the absence of enteric neurons

in mice lacking GDNF. Nature 382, 70–73.

Sendtner, M., Holtmann, B., Kolbeck, R., Thoenen, H., Barde, Y.A., 1992a.

Brain-derived neurotrophic factor prevents the death of motoneurons in

newborn rats after nerve section. Nature 360, 757–759.

Sendtner, M., Schmalbruch, H., Stockli, K.A., Carroll, P.,

Kreutzberg, G.W., Thoenen, H., 1992b. Ciliary neurotrophic factor

prevents degeneration of motor neurons in mouse mutant progressive

motor neuronopathy. Nature 358, 502–504.

Sun, W., Gould, T.W., Vinsant, S., Prevette, D., Oppenheim, R.W., 2003.

Neuromuscular development after the prevention of naturally occurring

neuronal death by Bax deletion. J. Neurosci. 23, 7298–7310.

Tomac, A., Widenfalk, J., Lin, L.F., Kohno, T., Ebendal, T., Hoffer, B.J.,

Olson, L., 1995. Retrograde axonal transport of glial cell line-derived

neurotrophic factor in the adult nigrostriatal system suggests a trophic

role in the adult. Proc. Natl Acad. Sci. USA 92, 8274–8278.

Tourtellotte, W.G., Milbrandt, J., 1998. Sensory ataxia and muscle spindle

agenesis in mice lacking the transcription factor Egr3. Nat. Genet. 20,

87–91.

Tourtellotte, W.G., Keller-Peck, C., Milbrandt, J., Kucera, J., 2001. The

transcription factor Egr3 modulates sensory axon-myotube interactions

during muscle spindle morphogenesis. Dev. Biol. 232, 388–399.

Trupp, M., Arenas, E., Fainzilber, M., Nilsson, A.S., Sieber, B.A.,

Grigoriou, M., et al., 1996. Functional receptor for GDNF encoded

by the c-ret proto-oncogene. Nature 381, 785–789.

Tsukagoshi, H., Yanagisawa, N., Oguchi, K., Nagashima, K.,

Murakami, T., 1979. Morphometric quantification of the cervical

limb motor cells in controls and in amyotrophic lateral sclerosis.

J. Neurol. Sci. 41, 287–297.

Vejsada, R., Tseng, J.L., Lindsay, R.M., Acheson, A., Aebischer, P.,

Kato, A.C., 1998. Synergistic but transient rescue effects of BDNF

and GDNF on axotomized neonatal motoneurons. Neuroscience 84,

129–139.

Vult von Steyern, F., Martinov, F., Rabben, V., Nja, I., de Lapeyriere, O.,

Lomo, T., 1999. The homeodomain transcription factors Islet 1 and

HB9 are expressed in adult alpha and gamma motoneurons identified by

selective retrograde tracing. Eur. J. Neurosci. 11, 2093–2102.

Wright, D.E., Snider, W.D., 1996. Focal expression of glial cell line-

derived neurotrophic factor in developing mouse limb bud. Cell Tissue

Res. 286, 209–217.

Yamamoto, Y., Livet, J., Pollock, R.A., Garces, A., Arce, V.,

deLapeyriere, O., Henderson, C.E., 1997. Hepatocyte growth factor

(HGF/SF) is a muscle-derived survival factor for a subpopulation of

embryonic motoneurons. Development 124, 2903–2913.

Yan, Q., Elliott, J., Snider, W.D., 1992. Brain-derived neurotrophic factor

rescues spinal motor neurons from axotomy-induced cell death. Nature

360, 753–755.

Yan, Q., Matheson, C., Lopez, O.T., 1995. In vivo neurotrophic effects

of GDNF on neonatal and adult facial motor neurons. Nature 373,

341–344.

Zurn, A.D., Baetge, E.E., Hammang, J.P., Tan, S.A., Aebischer, P., 1994.

Glial cell line-derived neurotrophic factor (GDNF), a new neurotrophic

factor for motoneurones. Neuroreport 6, 113–118.

http://bin/cas/tree/store/bresd/cas_sub/browse/browse.cgi?year=1998&volume=111&issue=2&aid=60721

http://bin/cas/tree/store/bresd/cas_sub/browse/browse.cgi?year=1998&volume=111&issue=2&aid=60721

glial cell-line derived neurotrophic factor-dependent fusimotor neuron survival during development

Documents