1.Genome evolution: tales of scales Pat Heslop-Harrison phh4@le.ac.uk www.molcyt.com and www.molcyt.org User & pw visitorTwitter, YouTube and Slideshare: pathh1 20 December 2013

2. Proso millet (Panicum miliaceum): origins, genomic studies and prospectsPat Heslop-Harrison, Farah Badakshi and Harriet Hunt14C Millet: Tacuinum Sanitatis via Wiki See Paris & Janick Ann Bot 2009-2013 3. Scales metres, kilograms, seconds, numbers Time: 3.5 billion years from the first living cells Time: a generation in hybrids or stress response, or few years for plant breeding Size: the amount of DNA from a few kb in viruses to variation in genome size between species Size: from single base modifications to whole genome changes Numbers: from 2 to 1000s of chromosomes Area: from endemics to worldwide Numbers: from a few plants to millions of ha Scale (synonym): balancing or comparing 4. Plant genome size range > 2,300 x Genlisea aurea 1C = 63.6 MbParis japonica20 m Image wikicommons Chromosomes & data see Bennett et al. 2011 Ann Bot.1C = 149,000 Mb 5. Genome sizes: reading them out base-by-base HIV type 1 Virus Bacteria (E. coli) Yeast Genlisea Arabidopsis Man Wheat Paris2hr 40 min 53 days 138 days 2 years (20mm) 5 years 100 years 5 centuries 4 millennia (50m) 6. Repetitive DNA-Sequences form the largest part of the genomeSpecies sizeArabidopsis thaliana Sugar beet Beta vulgaris Broad bean Vicia faba Rye Secale cereale Onion Allium cepaRepetitive DNA>25% 63% 85% 92% 95%Genome145 Mbp 758 Mbp 12000 Mbp 8800 Mbp 15100 MbpThese species are all diploid 2xHuman Homo sapiens45%3000 Mbp 7. Genes! 8. Major Genomic Components Tandem Repeats Simple Sequence Repeats Dispersed Repeats Functional Repeats Retroelements GenesTypical Fraction 10% 5% 10% 15% 50% 10% 9. 32 chromosomes DAPI; TTTAGGG telomere; 45S rDNA (1 major pair + minor) 5S rDNA (1 major + minor)19/12/2013Oil Palm Kubis & HH 10. Telomere (TTTAGGG)nUniversal in eukaryotes with only a few exceptions Dynamic Number of repeats varies: tissue, age and chromosome Added by telomerase 11. 146 bp around histones 12. DNA sequence TECentromereTETandem repeat monomer Transposable element Single copy DNAKinetochore 147bp plus 5-70bp linker = 150-220bpMetaphase chromosomeSpindle microtubules pulling apart chromatidsHeslop-Harrison JS, Schwarzacher T. 2013. Nucleosomes and centromeric DNA packaging. Proc Nat Acad Sci USA. http://dx.doi.org/10.1073/pnas.1319945110. See also http://molcyt.org (Dec 2013) 13. Nucleosomes in Rye Digest intact chromatin (DNA + histone) with micrococcal nuclease for a few seconds, cutting between the nucleosomes. Then treat with protease and run on agarose gel. Vershinin & Heslop-Harrison 14. Three copies of the Arabidopsis 180 bp repeat showing (dark purple, stepped line) GC content of the sequence and (red, smooth line) sequence curvature. While GC and AT rich regions of a sequence generally correlate with curvature, the kinked region shows curvature with low GC content. 15. Arabidopsis cell line with a macro-chromosome Anti-phosphohistone H3 locates exclusively at the centromeres of the small chromosomes. In contrast, the antibody shows a weak but more uniform distribution along the full length of the macrochromosome 16. Phosphorylation of histone H3 and centromere activity, Schwarzacher 17. Major Genomic Components Tandem Repeats Simple Sequence Repeats Dispersed Repeats Functional Repeats Retroelements GenesTypical Fraction 10% 5% 10% 15% 50% 10% 18. Simple sequence repeats GGCTACGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA GAGAGATGGTCGTAATG Flanked by unique sequences (SSR/microsatellite markers) or Part of other repetitive elements Dispersed OR clustered in genome SSR markers are dispersed! 19. Simple Sequence RepeatsSugar beet: Characteristic organization of each motifSchmidt, HH et a 20. Major Genomic Components Typical Fraction Tandem Repeats 10% Simple Sequence Repeats 5% Dispersed Repeats 10% Functional Repeats 15% Transposons/Retroelements 50% Genes 10% 21. Retroelement abundance and diversity in barleyGypsy elements are present in 25% of all BAC clonesBarley gypsy: Vershinin, Druka, Kleinhofs, HH: PMB 2002; Brassica Alix & HH PMB 2005 22. Retroelement OrganizationSchmidt and Heslop-Harrison 23. Hansen & Heslop-Harrison 24. Malvern Hills: Wiki 25. gagen rtLINE Retrotransposon (non-LTR Retrotransposon)LTRgagrt int LTRGypsy (LTR Retrotransposon) LTRgagint rt LTRCopia (LTR Retrotransposon)LTRgagCommon structure of Retroelementsrt int env LTRRetrovirusgag en rt LTR env core particle compone endonuclease reverse transcriptase long terminal repeat envelope glycoprotein 26. GeneFull namePositionFunctionORFOpen reading frameLTRLong terminal repeatFlanking retrotrans posin eaeRegions of several hundred base pairs (250-4000) containing regulatory sequences for gene expression: Enhancer, promoter, transcription initiation (capping), transcription terminator and polyadenylation signal. The 3' LTR is not normally functional as a promoter, although it has exactly the same sequence arrangement as the 5' LTR. Instead, the 3' LTR acts in transcription termination and polyadenylation. As a consequence of the replication mechanism of the elements the two LTRs are identical at the time of integration.PBSPrimer binding siteAbout 18 nt at the end of the 5LTRBinding site for a specific tRNA that functions as the primer for reverse transcriptase to initiate synthesis of the minus (-) strand of viral DNAGagGroupspecific antigenUsually one of the first ORFsThe gag precursor is cleaved by the viral protease (encoded by pol) into three mature products: the matrix (MA), the capsid (CA), and the nucleocapsid (NC) together forming the capsid which surrounds the genome this complex is the virus core. Equivalent to the coat or transit protein.CPCoat proteinSequence capable of translation into a proteinEquivalent to gag 27. Cys-His or C-HCysteinehistidine repeat motifC-terminal of gagRNA or DNA binding site of the coat protein or gag (NEXT SLIDE!)PolPolyproteinPRAspartic proteasepolCleaves the full length mRNA. PR has a significant role in the processing of the polyprotein precursor into the mature form.RTReverse transcrip tasepolRNA dependant DNA polymerase translates RNA to DNARHRibonucleas e H/ RNase HpolRNase H is an enzyme that specifically degrades RNA hybridized to DNA.INTIntegrasepolEnzyme responsible for removing two bases from the end of the LTR and inserting of the linear double stranded DNA copy of the retroelement genome into the host cell DNAEnvEnvelope geneAfter pol, but not in parare trovir us if MP=e nvEnvelope genes mediate the binding of virus particles to their cellular receptors enabling virus entry, the first step in a new replication cycle. Thus the envelope genes give retroelements the ability to spread between cells and individuals - infectivity. Contain the proteins SU (surface) and TM (transmembrane).MPMovement proteinCell to cell movement, maybe equivalent to envTAVTransactivatRegulating translation of the polycistronic mRNAContains aspartic protease, reverse transcriptase and RNase H and in some cases integrase 28. BSV Expression in Banana 29. Banana Streak ParaRetrovirus (BSV) Double stranded DNA is infective Insect vector Unexpected epidemiology Appearance after cold or tissue cultureGlyn Harper & Roger Hull 30. Nuclear Copies of Banana Streak Virus in Banana 31. DNA Fibre Hybridization 32. Nuclear Copies of BSV in BananaHarper, HH et al., Virology 1999 cf DHont et al., Nature, 2012 33. DHont et al. Nature 2012 doi:10.1038/natu re11241 34. Organelle sequences from chloroplasts or mitochondriaSequences from viruses, Agrobacterium or other vectorsPlant Nuclear GenomeGenes, regulatory and noncoding single copy sequencesRepetitive DNA sequencesTransgenes introduced with molecular biology methods45S and 5S rRNA genesOther genesRepeated genesStructural components of chromosomesDispersed repeats: Transposable ElementsRetrotransposons amplifying via an RNA intermediateDNA transposons copied and moved via DNACentromeric repeatsTelomeric repeatsTandem repeatsSubtelomeric repeatsBlocks of tandem repeats at discrete chromosomal lociSimple sequence repeats or microsatellitesDNA sequence components of the plant nuclear genome Heslop-Harrison & Schmidt 2012. Encyclopedia of Life Sciences 35. Genome Genes and regulatory sequences make up a small proportion of the genome The majority of DNA sequences in all higher eukaryotic genomes are repetitive sequences (50-90%) FUNCTION? Different sequence classes evolve at different rates 36. Aegilops tauschii (D genome donor) in Iran 57 accessions collected ssp. tauschii var. meyeri (18) var. tauschii (22) var. anathera (4) var. meyeri (12)Hojjatollah Saeidi, Mohammad Reza Rahiminejad, Sadeq Vallian, HH 37. Diversity in D genome Microsatellite markers 57 accessions of wild Aegilops tauschii (2n = 2x = 14; D genome) No SSR markers were characteristic for taxa or geographical origin High diversity present Saeidi, HH et al. Genet Resources & Crop Evolution 2005 38. Aegilops tauschii in Iran dpTa1Repetitive banding pattern does correlate with taxonomic grouping Dpta1Hojjatollah Saeidi and Pat Heslop-Harrison 39. In situ repetitive DNA markers Markers characteristic for taxa Evolution of genes/DNA markers and repetitive (SSR are different) High diversity present Useful genes for wheat breeding 40. UPGMA dendrograms of the relationships based on IRAP analysis of (A) accessions of Ae. tauschii subspSaeidi, H. et al. Ann Bot 2008 101:855-861; doi:10.1093/aob/mcn042Copyright restrictions may apply. 41. Demonstration of the direction of distribution (phylogeography) even over short geographic distances Phylogeography of Ae. tauschiiSpecies originated from North of Iran and distributed in two directions. tauschii genotype passes from middle parts of Alborz Mountains and the distributed eastward and westward (direction 1) strangulata genotype are distributed along the Caspian Sea shore (direction 2) 42. susp. strangulataIRAP Cross-pollinating ancestorSSRFISH var. meyerivar. anatheraSelf-pollinating ancestorsubsp. tauschiivar. tauschii(Aegilops tauschii)An evolutionary model supported by molecular analysesSaeidi, HH et al. 2010 43. Sheep Ovis aries 2n=54Muntiacus muntjak 2n=6, 7 44. Mammalian Chromosome Evolution Mammals: 3,500 Mbp genome size remarkably conserved Diploid chromosome numbers vary from 2n=6 (Indian muntjak) to 2n=134 (black rhinoceros). From 2n=2 (an ant species), several species with 2n=4; to 2n>1000 in some ferns No correlation of chromosome number with evolutionary position loss and gain occurs 45. Bos taurus taurus vs Bos taurus indicus: 2n=60, XY But: B. taurus submetacentric Y B. indicus acrocentric Y 46. Do we see chromosome fusion now? 47. How many chromosomes? Is the number constant in a species? Cattle 2n=60 but some individuals have 2n=58 or 2n=59 because two chromosomes fuse Chromosomal evolution is happening now 48. The 1;29 fusion in cattle Found in multiple breeds Sometimes a founder effect (imported in one bull e.g. Brahman to Africa) But present even in major breeds Limited effect on fertility Probably positively selected for a difficult-toscore trait 49. Chaves, Heslop-Harrison et al. 50. rob(1;29) translocation in cattle 51. Robertsonian Fusion(+?) 52. Bovid alpha-satellites and chromosome evolution 53. Complex satellite DNA reshuffing in the polymorphic t(1;29) Robertsonian translocation and evolutionarily derivedchromosomes in cattle R. Chaves1, F. Adega1, J. S. Heslop-Harrison2,et al. 2003 54. Sheep Ovis aries 2n=54, XY three pairs biarmed chromosomes 60 autosomal arms 55. Goat Sheep Cattle Chromosome homologies and centromeric fusions Paul Popescu 56. Do we see chromosome fusion now? Molecular cytogenetic analysis and centromeric satellite organization of a novel 8;11 translocation in sheep: a possible intermediate in biarmed chromosome evolution. 2003. Chaves, Adega, Wienberg, Guedes-Pinto, Heslop-Harrison 57. Sheep 2n = 53, XY chromosome paints for 8 (yellow) and 11 (magenta; e), satellite I (yellow f), satellite II (cyan g). Chaves, HH et al. 2003 58. Satellite I and II probes in the biarmed chromosomes of the sheep with 2n = 53, XY. Chr (8;11), 2, 3, 1 are ordered from the most recent to the postulated evolutionarily oldest chromosome 59. t(8;11) showed satellite I proximal on both arms with satellite II covering the centromere, while the evolutionarily derived fusion leading to Chrs 2 and 3 showed the opposite configuration, not obviously derived by a simple fusion. Chr 1 has lost the satellite I hybridization patterns. The novel t(8;11) provides strong evidence for an intermediate step in evolution of the biarmed chromosomes in sheep. 60. 2n=52, XY including 4 bi-armed chromosomes = 58 autosomal chromosome arms +X,Y Syncerus caffer (African Buffalo or Cape Buffalo), a bovid from the family of the Bovineae 61. Tragelaphus strepsiceros or greater kudu2n=31, X1 X2 Y 26 biarmed chromosomes, three acrocentric chromosomes (inc. X1), acrocentric X and a biarmed Y 62. sheep (Ovis aries) centromeric DNA satellite I-clone pOaKB9 (green-FITC) to metaphase chromosomes (chromosomal DNA stained with DAPI, presented in red pseudocolour) of the: (a) tribe Caprini, Ovis ammon (female, 2n=54,XX), (b) tribe Reduncini, Kobus leche (male, 2n=48,XY ), (c) tribe Hippotragini, Addax nasomaculatus (female, 2n=58,XX), (d ) tribe Alcelaphini, Connochaetes taurinus (male, 2n=58,XY ), (e) tribe Alcelaphini, Damaliscus hunteri (male, 2n=44,XY), ( f ) tribe Aepycerotini, Aepyceros melampus (female, 2n=60,XX). 63. Phylogenetic relationships and the primitive X chromosome inferred from chromosomal and satellite DNA analysis in Bovidae Raquel Chaves1,*, Henrique Guedes-Pinto1 and John S. Heslop-Harrison Proc Roy Soc B 2005 64. YoungBrassica nigra (BB)Brassica carinata (BBCC)Brassica juncea (AABB)Brassica rapa (AA)Brassica oleracea (CC)Brassica napus (AACC)Old 65. Genome Specificity of a CACTA (En/Spm) Transposon B. napus (AACC, 2n=4x=38) B. oleracea (CC, 2n=2x=18) B. rapa (AA, 2n=2x=20) 66. Genome Specificity of a CACTA (En/Spm) Transposon B. napus (AACC, 2n=4x=38) hybridized with C-genome CACTA element red B. oleracea (CC, 2n=2x=18) B. rapa (AA, 2n=2x=20) Alix & HH 2008 67. Genome Specificity of a CACTA (En/Spm) TransposonB. napusAJ 245479AC 189496B. rapaAC 189446AC 189655AC 189480B ot1-1large insertion specific of Bot1-1B. oleracealarge insertion in common between Bot1-2 and Bot1-3B ot1-2B ot1-3Bo6L1-15 1010bpRearrangement specific of Bot1-3 68. Genome Specificity of a CACTA (En/Spm) Transposon Bot1 has encountered several rounds of amplification in the C (B. oleracea) genome only, playing a major role in the recent B. rapa and B. oleracea genome divergence Bot1 carries a host S-locus associated SLL3 gene copy; is the transposon associated with SLL3 proliferation?Transposons are a driver of genome and genome evolution Alix et al. The CACTA transposon Bot1 played a major role in Brassica genome divergence and gene proliferation. Plant Journal December 2008 69. Dot-plots of genomic sequence from homologous pairs of BACskbBrassica rapa (A genome) sequenceRegion of high homology between A and C sequenceRegion of low homology4kb Insertion-gap pair: present in C genome 500bp Insertion-gap pair: present in A Microsatellite Transposed (moved) sequenceAn inversion Dotter plot of Brassica oleracea var. alboglabra clone BoB028L01 x Brassica rapa subsp. pekinensis clone KBrB073F16 with transposable elements. 19/12/2013 gi 195970379 vs. gi 199580153Brassica oleracea (C genome) sequence79 70. AAGTGAATGGATGCTCGCATTAGTTACTATGAGCCGATTCTCGCTCTTGCGAAAGCTAAAGAGGAAAAGGCCTTCGCATTGCAGAAG AGCTGGCTGCCAGCGAGCAAGAGGTTTTCAATATTGGCTTGTGGAAAATTTGTTGCCACTTTTGCTTTACTAAGGAATGAAATAATAC TTGTTTTTTTTTTTCATGGTTAATATTAGAAGATATAATTTCCTTTGAAGTTAGATTACGTTTCTTTATGTCGACGAAGTGAAGAAATATT GTCTTGTTTATGGTTCCTTCTAGTCCCAACCTTTTTTCAAGAAGGTACAGTACGTGTCAGGATTTATATGGATATACACA TATCCTATTGCGCAATTGTCAATAATAGCACTTTTTGAAGTTTATGTCTCAAAATAGCACTAGAAGGAGAAAGTCACAAAAATGATATT CATTAAAGGGTAAAATATCTCTTATATCCTTGGTTTAAAATTAAATAAACAAACAAAAATAAATAAAAATAAATAAAAAAAATGAAAAAA AAGAAATTTTTTTTATAGTTTCAGATTATATGTTTTCAGATTCGATTTTTTTTTTATTTTTTTATTTTTTTCGAAATTTTTTTTTTATTTTTTTTCA AATTTTCTTTTTATAATTTAAAAATACTTTTTGAAACTGTTTTTTTAATTTTTATTTTTTATTTTAGTATTTATTTTTTATAAAATTTTAAACCCT AATTCCTAAACCCCCACCCCTTAACTCTAAACCCTAAGGTTTGGATTAATTAACCCAATGGATATAAGTGTATATTTACCTCTTTAATGA AACCTATTTTTGTGACTTTGAATCTTGAGTGCTACTTTGGGAACAAAAACTTGGTTTGGTGCTATCCTAGTCTTTTTCTCTATCCTATT TACCACCCTTCTTTGTTCAATACTTTTTACAGTTTTTGGAAAGGACATGTTTCTTCTATCATCACTTAATGGTTATATATGTATGAGAAG TTTGAAAGAGATTACACTGTTTTGGAATATTAAAAAAAAAAGATATTACAAGATCTGATTTTGTTTGTATTTTAAAATTCTACCAAATC TCTCCTCAAAATCTTGGTCAAAGTCCAAAAATCCAAATATCTCAGTTAAATTCCACCAAATATGAAATCCTAAAACTTTTCCAAAATA GTTCAATAAGCCCTTAGTGTTTGGTG542-bp BART1 TE 9-bp TSD (TATCCTATT) 6-bp TIR and 66-bp imperfect sub-TIR TSD TIRBrassica rapa with inserted 542bp sequence not present in B. oleracea 9bp TSD (red bold letters and arrow) and TIR (blue) Flanking primers used in PCR (next slide) as blue arrows on sequence 19/12/2013TIR TSD80 71. Insertion polymorphism in Brassica genomes shown by PCR with flanking primers A) Brassica rapaBrassica nigraUncertain BrassicaBrassica oleraceaBrassica juncea6X BrassicasBrassica napus Brassica carinata1500 1000 800 600 400 200HP1 1 23456 HP1 789 10 11 12 13 14 15 16 17 18 HP1 19 20 21 22 23 2425 26 27 28 29 30 HP1 31 32 33 34 35 36 37 38B) Brassica rapaBrassica nigraUncertain BrassicaBrassica oleraceaBrassica junceaBrassica napusBrassica carinata6X Brassicas1500 1000 800 600 400 200HP1 1 23456 HP1 789 10 11 12 13 14 15 16 17 18 HP1 19 20 21 22 23 2425 26 27 28 29 30 HP1 31 32 33 34 35 36 37 38Amplification with two primer sets (top and bottom) B. rapa (AA), B. juncea (AABB) and B. napus (AACC) include the longer fragment with insertion. B and C genomes have only the shorter, lower, fragment without insertion.19/12/201381 72. hAT 141F hAT 185F1hAT 8002246 TSD TIR542-bp TETIR TSD 790hAT 177R1000B. rapa (4718648200)...B. oleracea (66,350-66750) B. rapa (AA) B. juncea (AABB) B. napus (AACC)Hexaploid Brassica (carinata x rapa) B. nigra (BB)...B. oleracea (CC)... ...B. carinata (BBCC) B. oleracea (GK97361)... =A=T=C=GSchematic representation of insertion in Brassica rapa and other Brassica genomes. Green, red, blue and black boxes showing DNA motifs 19/12/201382 73. GACACTCTTCCCAATCGTTCATTCCTGACGTCATTAGGCAACCACCTCTGTTTTTCCCCACCACAAACAGTGAATACATCTCTCCTATCTCTC TCAGAATCGTCAGTGTTTGCTCTCCGTTGCTTACTCGCTTCTCTATGAATCCAACTTGCCCCGTCGTTACAAATCTGCCAAAAATAAACCAAA ACCAGTCCGGTCAATGAAAAAAATGCCAATGTTTCAGGTCTAGAAATTATCCACAACCCTAGTACTAAGATCTGAAATTTATGAGGGAGATAA ACATTTTTAGGTTAATTGTAAGAAAAAATATTTATAATTTTTGGGCCATGCAGCAAATACATAATATTTCCTTAAAATTTGGATTGTAAGAC TAATAGTGTTTGAGTATTTGATATTTGATATCTTTTAAAAAAGGAAACAAAATTGAATTTCTAAATAAGATTATATTTTTAAAATAAAACAAT AAAAATACATAAAAATAGTTACAAAAAAAAATATATATATTGTTAAACCGTTAGCAAATTAAATACTAAATCCTATACCCTAAATCCTAAACT CCAAACCCTAAATGATAAACCTTAAATCTTGGATAAACCGTAAACCATTGGAAAATTTTAAAACCTAATCATACATTAAAAACTAAAATTTAA TAACACTAAACCCTAAACCCTAATCACTAAACCCTAAACCCTTAGATAAATCATGAACCCTTGGATAAATCATAAACTCTAAATCAAAAATAT TTAAAATTAAACCCTAAAATATATAATTTATCCAAGGGCTCAGAGTTTACCCAAGGGTTTAGGGTTTAGTGATTAGGATTTAGGGTTTAGTGT TATTAAAATTTAGTTTTTAATGTATGATCTAAGGTTTAAGAGTTTCCAATGGTTTAGAGTTTATCCAAAGTTTAAGGTTTAACGTTTAGGGTT TAGGATTTAGGATTTAAGGTATAGGGTTTAGTATTTTGCTGAAGATTTAACAATATTAATTAATTTATTTTTTGTAACTATTTTTATATATTT TTATTATTTTATTTTTAAAATATAATATAATTTGGATATTCAATTTTATTTTCTTTTTTAAAAAATATCAAATATCAAATACTCAAACACTAT GGTTGGTGAACTTCTAGGTGTGAACCCAAGAATTACTCTTAATGTTTCATCCGATTGTGCTCAAAACCTTTCATGAACTGGCTAAAGCTGGAA ACATAGGATTAGTAAGAAGTAGAATCTTGTAAAGTACCTGTTATAGTATTCCTCTAAGAAAGTTCGATCAGTTTCGTCGTTTGTCTGATCGTT ACCAACAATCTCCATCAAAACATCGTTGTTTTCTTTGGTCACCGCGTCTCCGACAAGATTCTCTGTCTCCGAGCCATAAGCGACAAACTGTAT GATAGTGAGGTGAATCTGAGAGTTATTGATAAGCCACTGGCACAAGGACAGAGCCTCTCGATCATCAGGACCACCAAAGAACAATGCAGCGAC GTGTTGTACCGACTCAAACCCGTGAAGCTGGTGGAACCCGGTTATGTTTCTATCCACATAGATACCGATCG790-bp TE TAAT, 4-bp TSD AGTGT/ACTCT, 5-bp TIRs & 370-bp IRInsertion sequence present in Brassica oleracea, missing from Brassica rapa. TSD highlighted red, green and blue; boxes 19/12/2013 shows remarkable internal structure with 370-bp inverted repeat near-filling the insert 83 74. Dotplot of 790bp insertion element showing inverted repeat structure. TIR at end of box shown 19/12/201384 75. Genes! 76. EvolutionEpigeneticsDevelopmentPhenotypeCauseMultiple abnormalitiesChromosomal loss, deletion or translocation Gene mutation / base pair changes Telomere shortening (Retro)transposon insertion Retrotransposon activation SSR expansion Methylation Heterochromatinization Chromatin remodelling Histone modificationGenetic changes non-reverting Changes seen, some reverting(Male/Female) Normal Differentiation 77. From Chromosome to NucleusPat Heslop-Harrison phh4@le.ac.uk www.molcyt.com 78. Scales metres, kilograms, seconds, numbers Time: 3.5 billion years from the first living cells Time: a generation in hybrids or stress response, or few years for plant breeding Size: the amount of DNA from a few kb in viruses to variation in genome size between species Size: from single base modifications to whole genome changes Numbers: from 2 to 1000s of chromosomes Area: from endemics to worldwide Numbers: from a few plants to millions of ha Scale (synonym): balancing or comparing 79. Genome evolution: tales of scales Pat Heslop-Harrison phh4@le.ac.uk www.molcyt.com and www.molcyt.org User & pw visitorTwitter, YouTube and Slideshare: pathh1 20 December 2013 80. Scales of genome organization Base-pair / sequence Gene Repeat sequence BAC Chromosome Genetic mapping Physical mapping 81. Some DNA sequences are recognizable in all organisms and originated with the start of life. Others are unique to a single species. Some sequences are present in single copies in genomes, while others are present as millions of copies. The total amount of DNA in cells of an advanced eukaryotic species can vary over three orders of magnitude, and chromosome number can vary similarly. How can such huge variations be accommodated within the constraints of organism growth, development and reproduction? What are the evolutionary implications of these huge variations? How can we use the information to understand plant evolution, cytogenetics, genetics and epigenetics? What are the implications for future evolution, biodiversity and responses of plants during plant breeding or climate change?