genetically determined p2x7 receptor pore formation ... · genetically determined p2x7 receptor...

19
Supplementary Information for: Genetically determined P2X7 receptor pore formation regulates variability in chronic pain sensitivity Robert E. Sorge, Tuan Trang, Ruslan Dorfman, Shad B. Smith, Simon Beggs, Jennifer Ritchie, Jean-Sebastien Austin, Dmitri V. Zaykin, Heather Vander Meulen, Michael Costigan, Teri A. Herbert, Merav Yarkoni-Abitbul, David Tichauer, Jessica Livneh, Edith Gershon, Ming Zheng, Keith Tan, Sally L. John, Gary D. Slade, Joanne Jordan, Clifford J. Woolf, Gary Peltz, William Maixner, Luda Diatchenko, Ze’ev Seltzer, Michael W. Salter and Jeffrey S. Mogil Nature Medicine doi:10.1038/nm.2710

Upload: others

Post on 06-Mar-2020

2 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Genetically determined P2X7 receptor pore formation ... · Genetically determined P2X7 receptor pore formation regulates variability in chronic pain sensitivity Robert E. Sorge, Tuan

Supplementary Information for:

Genetically determined P2X7 receptor pore formation

regulates variability in chronic pain sensitivity

Robert E. Sorge, Tuan Trang, Ruslan Dorfman, Shad B. Smith, Simon Beggs,

Jennifer Ritchie, Jean-Sebastien Austin, Dmitri V. Zaykin, Heather Vander Meulen,

Michael Costigan, Teri A. Herbert, Merav Yarkoni-Abitbul, David Tichauer,

Jessica Livneh, Edith Gershon, Ming Zheng, Keith Tan,

Sally L. John, Gary D. Slade, Joanne Jordan, Clifford J. Woolf,

Gary Peltz, William Maixner, Luda Diatchenko, Ze’ev Seltzer,

Michael W. Salter and Jeffrey S. Mogil

Nature Medicine doi:10.1038/nm.2710

Page 2: Genetically determined P2X7 receptor pore formation ... · Genetically determined P2X7 receptor pore formation regulates variability in chronic pain sensitivity Robert E. Sorge, Tuan

Supplementary Fig. 1. Mean (±S.E.M.) stimulus intensity (Threshold; g) at which mice withdrew from a monofilament pressed against the plantar hind paw, at baseline (BL) and 1, 4, 7, 14, 21 and 28 days after nerve injury (SNI) in 18 inbred mouse strains. For clarity, only ipsilateral data are shown.

Nature Medicine doi:10.1038/nm.2710

Page 3: Genetically determined P2X7 receptor pore formation ... · Genetically determined P2X7 receptor pore formation regulates variability in chronic pain sensitivity Robert E. Sorge, Tuan

Supplementary Table 1. Top 10 genome-wide associations with SNI-induced mechanical allodynia. Gene p value Protein Gene Expressiona Relevanceb cSNP?c P2rx7 0.00056 purinergic receptor P2X, ligand-gated ion channel, 7 immune cells, microglia, 2 + osteoclasts, uterus Arntl 0.0013 aryl hydrocarbon receptor nuclear translocator-like intestines, cerebellum 0 – Pttg1 0.0019 pituitary tumor-transforming gene 1 B-cells, testes 0 –d Kcnk2 0.0021 potassium channel, subfamily K, member 2 (TREK-1) pituitary, nervous system 2 – Clcn4-2 0.0023 chloride channel 4-2 nervous system 1 –d Gabrg2 0.0025 gamma-aminobutyric acid (GABA) A receptor, subunit γ2 nervous system 1 – Slco3a1 0.0025 solute carrier organic anion transporter family, member 3a1 widespread 1 – Scn8a 0.0028 sodium channel, voltage-gated, type VIII, α (Nav1.6) nervous system 2 – Clpb 0.0028 ClpB caseinolytic peptidase B (E. coli) testes 0 – Ctgf 0.0032 connective tissue growth factor widespread 1 –e aLoci displaying highest relative expression, according to BioGPS gene expression database (http://biogps.gnf.org). bExisting evidence for involvement in pain, based on a literature search of December 20, 2011: 0 - no evidence, 1 – potential involvement, 2 – demonstrated involvement. cNon-synonymous coding SNP (cSNP) causing one or more amino acid changes in strains of different haplotype groups. dAltered amino acid only in DBA/2 strain. eAltered amino acid only in C57BL/6 strain.

Nature Medicine doi:10.1038/nm.2710

Page 4: Genetically determined P2X7 receptor pore formation ... · Genetically determined P2X7 receptor pore formation regulates variability in chronic pain sensitivity Robert E. Sorge, Tuan

Supplementary Fig. 2. Chromosomal position (in bp) and haplotypes of SNPs in the chromosome 5 haplotype block within the mouse P2rx7gene showing high correlation to neuropathic mechanical allodynia (see main text). Of the 24 SNPs, 19 are intronic and four produce synonymous changes; only P451L (highlighted in yellow) produces a non-synonymous (i.e., amino acid) change.

Nature Medicine doi:10.1038/nm.2710

Page 5: Genetically determined P2X7 receptor pore formation ... · Genetically determined P2X7 receptor pore formation regulates variability in chronic pain sensitivity Robert E. Sorge, Tuan

Supplementary Fig. 3. Mechanical allodynia after SNI in a set of 15 inbred mouse strains (n = 8–16 mice/strain; all male) common to those in Fig. 1a (“McGill”) but tested in a different laboratory at Massachusetts General Hospital (Dr. Clifford Woolf; “MGH”). Symbols in a represent mean ± S.E.M. threshold (g) to withdraw from von Frey fibers applied to the hind paw (only ipsilateral data shown) before (at -7 and -4 days) and 5 and 7 days after SNI. Bars in b represent the mean ± S.E.M. average percent change (i.e., decrease) in threshold of the two post-operative measures from the two baseline measures. The scatterplot in c shows the statistically significant correlation of strain means (percent allodynia versus average percent change, respectively) in the McGill and MGH cohorts.

Nature Medicine doi:10.1038/nm.2710

Page 6: Genetically determined P2X7 receptor pore formation ... · Genetically determined P2X7 receptor pore formation regulates variability in chronic pain sensitivity Robert E. Sorge, Tuan

Supplementary Fig. 4. Reversal of SNI (a) and CFA (b) mechanical allodynia by a TAT-P451 but not a TAT-451L peptide in A/J but not B10.D2 mice. Symbols represent mean ± S.E.M. threshold (g) to withdraw from increasing pressure applied to the ipsilateral hind paw (electronic von Frey test). Mice were tested at baseline (BL), at the presumed peak of allodynia (Day 7 after SNI; 24 h after CFA), and 15 and 60 min post-peptide injection. Data presented are from a subset of mice of both strains such that initial allodynia levels (on Day 7 after SNI surgery, and 24 h after CFA injection) are equivalent, but the same results were obtained when all subjects are considered. *P<0.05, **P<0.01 compared to pre-injection baseline on Day 7 (SNI) or 24 h (CFA) by Student’s t-test.

Nature Medicine doi:10.1038/nm.2710

Page 7: Genetically determined P2X7 receptor pore formation ... · Genetically determined P2X7 receptor pore formation regulates variability in chronic pain sensitivity Robert E. Sorge, Tuan

Supplementary Table 2. Results of the statistical association between pain intensity and genotypes of 3 of the 30 studied SNPs (top) in the PMP cohort (middle) and OA cohort (bottom).

SNP ID rs208294 rs208296 rs7958311 SNP position (bp) 121600253 121600953 121605355 Amino acid change p.His155Tyr c.533+630C>T p.Arg270His Genotypes G/G A/G A/A C/C T/C T/T G/G A/G A/A

Protein types HH HY YY Intronic RR RH HH

PMP Cohort

N 93 191 70 146 171 37 171 160 23 Mean Rating (±SEM) (0–20 NRS)

2.7

(0.47)

3.6

(0.36)

4.9

(0.69)

4.4

(0.19)

3.2

(0.37)

2.2

(0.25)

4.3

(0.21)

3.0

(0.08)

2.4

(0.13)

Beta 1.17 -1.21 -1.19

P value 0.003 0.003 0.006

OA Cohort

N 378 672 279 620 572 136 743 505 81 Freq. of Cases (%) 57.7 55.5 54.5 55.3 55.2 61.0 58.3 52.3 56.8

OR (adjusted) (95% CI) 0.94 (0.79-1.10) 1.05 (0.88-1.25) 0.79 (0.65-0.95)

P value 0.43 0.60 0.015

Nature Medicine doi:10.1038/nm.2710

Page 8: Genetically determined P2X7 receptor pore formation ... · Genetically determined P2X7 receptor pore formation regulates variability in chronic pain sensitivity Robert E. Sorge, Tuan

Supplementary Fig. 5. Human 270H (rs7958311)-containing P2X7Rs are hypofunctional compared with R270-containing P2X7Rs. 1321N1 cells were transfected with human R270 or 270H containing P2X7Rs, or with transfection reagent only (mock transfection) for 24 h. Cells were then loaded with the dye YO-PRO and following 5 min stable baseline readings, treated with saline or BzATP (300 mM). Pore formation was assessed by YO-PRO dye uptake. (a) Time course of YO-PRO dye uptake upon BzATP stimulation. (b) Rate of YO-PRO dye uptake following 7.5-min treatment with saline or BzATP. BBG (5 mM) was pretreated 5 min prior to application of saline or BzATP. Each experimental group represents n=10. ***P<0.001.

Nature Medicine doi:10.1038/nm.2710

Page 9: Genetically determined P2X7 receptor pore formation ... · Genetically determined P2X7 receptor pore formation regulates variability in chronic pain sensitivity Robert E. Sorge, Tuan

Supplementary Table 3. Association between haplotypes of the SNPs rs208294 (p.H155Y), rs208296 (c.533+630C>T), and rs7958311 (p.R270H) and PMP (top) and OA (bottom) pain. Significantly associated haplotypes are shown in bold.

aFreq.: haplotype frequency in cohort. bSTAT: coefficient t-statistic. cOR: odds ratio.

PMP Cohort Alleles Beta Freq.a STATb P ATA 155Y; T; 270H 1.58 0.01 1.76 0.186

GTA 155H; T; 270H -0.71 0.20 8.92 0.003 ACA 155Y; C; 270H -0.48 0.05 0.86 0.354 GCA 155H; C; 270H 0.08 0.02 0.01 0.922 GTG 155H; T; 270R -0.41 0.12 1.57 0.211 ACG 155Y; C; 270R 0.70 0.41 10.9 0.001 GCG 155H; C; 270R 0.06 0.18 0.06 0.803

OA Cohort Alleles ORc Freq. STAT P

GTA 155H; T; 270H 0.91 0.19 0.65 0.422 ACA 155Y; C; 270H 0.49 0.04 7.69 0.005 GCA 155H; C; 270H 0.43 0.02 5.34 0.021 ATG 155Y; T; 270R 0.91 0.01 0.04 0.831 GTG 155H; T; 270R 1.30 0.11 3.53 0.060 ACG 155Y; C; 270R 1.02 0.40 0.06 0.807 GCG 155H; C; 270R 1.10 0.22 0.88 0.348

Nature Medicine doi:10.1038/nm.2710

Page 10: Genetically determined P2X7 receptor pore formation ... · Genetically determined P2X7 receptor pore formation regulates variability in chronic pain sensitivity Robert E. Sorge, Tuan

Supplementary Fig. 6. Prevention (a,c) and reversal (b,d) of nerve injury- (SNI; a,b) and chronic inflammation- (CFA; c,d) induced mechanical allodynia by the P2X7R antagonist, BBG (4 or 120 mg/kg, i.v.). Timing of nerve injury and injections is indicated by the vertical dotted lines. Symbols represent mean ± S.E.M. threshold (g) to withdraw from increasing pressure applied to the ipsilateral hind paw (electronic von Frey test). In every case, a drug-by-repeated measures ANOVA revealed a significant interaction at values of p<0.01). *p<0.05, **p<0.01, ***p<0.001 compared to vehicle at same time point by Student’s t-test. Lower BBG doses were investigated (data not shown), but found to be ineffective at reversal of already developed SNI and CFA allodynia.

Nature Medicine doi:10.1038/nm.2710

Page 11: Genetically determined P2X7 receptor pore formation ... · Genetically determined P2X7 receptor pore formation regulates variability in chronic pain sensitivity Robert E. Sorge, Tuan

Supplementary Methods

Subjects. Inbred mice of 18 strains (129S1, A, A/He, AKR, B10.D2-H2/oSn, BALB/c,

BALB/cBy, BUB/Bn, C3H/He, C57BL/6, DBA/2, FVB/N, LG, LP, MRL/Mp, NZB/BIn,

NZW/LaC, and SM; all “J” substrains; n=5–6 mice/strain) were obtained from The Jackson

Laboratory (Bar Harbor, ME). A second strain survey, performed independently but using

similar protocols at Massachusetts General Hospital (MGH), included 15 of the strains listed

above (n=8–26 mice/strain). Mice bred in-house were weaned at 18–21 days and housed with

their same-sex littermates; purchased mice were housed same-sex and habituated to the vivarium

for at least one week before testing. Mice were housed in standard shoebox cages, 2–4 per cage,

maintained in a temperature-controlled (20±1° C) environment (14:10 h light cycle; with lights

on at 07:00 h), and fed (Harlan Teklad 2920X) and watered ad lib. All procedures were

approved by local animal care and use committees and were consistent with national guidelines.

von Frey testing. Mice were placed individually in transparent Plexiglas cubicles (5 cm wide ×

8.5 cm long × 6 cm high; each cubicle was separated from the other by an opaque divider) placed

upon a perforated metal floor (with 5 mm diameter holes placed 7 mm apart), and habituated for

at least 2 h before behavioral testing began. Nylon monofilaments (Stoelting Touch Test

Sensory Evaluator Kit #2 to #9, corresponding to 0.015–1.3 g bending force; calibrated weekly

using a microbalance) were firmly applied to the plantar surface of the hindpaw (alternating the

side of the body being tested) until they bowed for 5 s. In subsequent experiments, an automated

von Frey test was used (UgoBasile Dynamic Plantar Aesthesiometer). In this assay, pressure is

gradually increased by the device until the mouse withdraws its hind paw; the maximal pressure

Nature Medicine doi:10.1038/nm.2710

Page 12: Genetically determined P2X7 receptor pore formation ... · Genetically determined P2X7 receptor pore formation regulates variability in chronic pain sensitivity Robert E. Sorge, Tuan

at that point is displayed. We have found this method to feature less variability than the up-down

technique. Relative strain sensitivities are preserved using both methods (unpublished data).

Haplotype mapping. In HapMapper, SNPs are organized into haplotype blocks; only a limited

number of haplotypes—typically 2, 3 or 4—are present within a haplotype block. The

haplotype-based computational analysis identifies haplotype blocks in which the haplotypic

strain grouping within the block correlates with the distribution of phenotypic data among the

inbred strains analyzed. To do this, a P value for a test that assesses the likelihood that genetic

variation within each block could underlie the observed distribution of phenotypes among the

inbred strains is calculated. The haplotype blocks are then ranked based upon the calculated P

value. A genetic effect score is also calculated from the ANOVA, as: (SSB – (k-1)*MSE) /

(SStotal + MSE), where SSB is the between-group sum-of-squares of the ANOVA model,

SStotal is the total sum-of-squares, k is the number of groups and MSE is within-group

sum-of-squares divided by (n–k), where n is the total number of objects in the model.

Primary macrophage cultures. Peritoneal macrophages were isolated from adult male A/J or

B10.D2 mice. Mice were sacrificed using ether and the peritoneal cavity lavaged with

RPMI-1640 media (Invitrogen). The recovered media from 3–4 mice was pooled, washed twice

with RMPI-1640 media, and centrifuged at 1200 rpm for 10 min at 4 ºC. The cells were then

re-suspended in RPMI-1640 media supplemented with 10% fetal bovine serum (Invitrogen) and

1% penicillin-streptomycin (Invitrogen) and seeded onto poly-D-lysine coated cover-slips and

allowed to adhere for 24 h at 37 °C with 5% CO2 and 95% O2 prior to imaging experiments.

Nature Medicine doi:10.1038/nm.2710

Page 13: Genetically determined P2X7 receptor pore formation ... · Genetically determined P2X7 receptor pore formation regulates variability in chronic pain sensitivity Robert E. Sorge, Tuan

Human P2X7R subcloning, mutagenesis and expression. Human P2X7R cDNA was obtained

from GeneCopoeia (EX-Z8319-M11) expressed in the pReceiver-M11 vector. Mutagenesis was

performed using PCR (Affymetrix Change-IT Multiple Mutation Site Directed Mutagenesis Kit)

using the primer CACTGCCATCCCAAATACAGTTTCCGTCGCCTTG to convert 809G>A

(R270 to 270H in the protein). All constructs were verified by sequencing. P2X7R R270 or

270H constructs were transfected separately into 1321N1 cells using protocols described

previously (C.J. Gallagher & M.W. Salter, J. Neurosci. 23:6728-6739, 2003). Cells were plated

onto 96-well plates and YO-PRO dye uptake measured as described below.

Calcein dye loss assay for P2X7R-mediated pore formation. Peritoneal macrophages were

incubated at room temperature for 30 min with calcein-AM (2.5 µM; Invitrogen) in extracellular

recording solution (ECS). Following incubation, cells were thoroughly rinsed with ECS without

calcein-AM and mounted on an inverted microscope (Diaphot-TMD, Nikon) and viewed using a

40x epifluorescence Fluor objective lens. Measurement of calcein fluorescence was performed

by means of single-photon counting from individual macrophages using a photomultiplier

detector and the number of photons measured for 3 s every 60 s. Calcein was excited by 490 nm

light generated from a compact xenon arc lamp (75 W). Emitted light was sent to the side

camera port of the microscope, where it entered a dual optical pass adapter (Nikon). Emitted

light (520 nm) was directed through a DM510 bandpass emission filter, after which the light

passed through a manually adjustable aperture and was detected by a photomultiplier tube in

single-photon counting mode (Photon Technologies). The output of the photomultiplier was

sampled at a rate of 5 Hz by an IBM-compatible computer with hardware and software from

Photon Technologies.

Nature Medicine doi:10.1038/nm.2710

Page 14: Genetically determined P2X7 receptor pore formation ... · Genetically determined P2X7 receptor pore formation regulates variability in chronic pain sensitivity Robert E. Sorge, Tuan

YO-PRO dye uptake assay for P2X7R-mediated pore formation. Peritoneal macrophages were

plated onto a 96-well plate and allowed to adhere for 24 h at 37°C with 5% CO2 and 95% O2

prior to imaging experiments. To initiate P2X7R pore formation, cells were stimulated with

BzATP (300 µM). In the macrophage experiments, BzATP was applied with no YO-PRO dye

(2.5 µM; Invitrogen) present in the ECS. After 10 min of BzATP stimulation, YO-PRO was

then co-applied with TAT-P451 (25 µM), TAT-451L (25 µM), or saline, directly into the ECS.

Measurement of YO-PRO fluorescence was performed every 5 min for a total of 30 min using a

fluorescence plate reader (Molecular Devices). In the experiments using human P2X7Rs

expressed in 1321N1 cells, BzATP was applied after 5 min pre-incubation with YO-PRO and

fluorescence measurements were made every 30 s. YO-PRO was excited at 491 nm and emitted

fluorescence was detected at 509 nm.

Western blot measurement of P2X7R protein expression. Whole brain tissue from A/J or B10.D2

mice was rapidly isolated and and homogenized in RIPA buffer (50 mM Tris-HCl, pH 8.0;

150 mM NaCl, 1 mM EDTA, 1% NP-40, 0.5% deoxycholic acid, 0.1% SDS, 1 mM Na3VO4,

1 U/ml aprotinin, 20 µg/ml leupetin, and 20 µg/ml pepstatin A) and centrifuged at 14,000 rpm for

30 min at 4 °C. The protein concentration was determined using a detergent-compatible protein

assay with a bovine serum albumin as standard. Whole brain homogenates were separated on a

precast sodium dodecyl sulfate polyacrylamide gradient gel (4–12% Tris-HCl; Bio-Rad) and

transferred onto nitrocellulose membrane. The membrane was probed with rabbit anti-P2X7R

(1:1000 Alomone) and mouse anti-actin (1:5,000 Sigma) antibodies. Membranes were washed

Nature Medicine doi:10.1038/nm.2710

Page 15: Genetically determined P2X7 receptor pore formation ... · Genetically determined P2X7 receptor pore formation regulates variability in chronic pain sensitivity Robert E. Sorge, Tuan

and incubated for 1 h at room temperature in rabbit and mouse specific secondary antibody

before quantification with the Odyssey Licor system (USA).

Fluorescent measurement of intracellular [Ca2+]. Peritoneal macrophages were prepared as

described above. Prior to recording, cells were incubated at room temperature for 30 min with

the fluorescent Ca2+-indicator dye Fura-2 AM (2.5 µM; Molecular Probes) in ECS. Following

fluorophore loading, cells were thoroughly rinsed with ECS lacking Fura-2 AM, and mounted on

an inverted microscope (Diaphot-TMD, Nikon). As previously described in detail (M.W. Salter

& J.L. Hicks, J. Neurosci. 4:2961-2971, 1995), excitation light was generated from a 75 W

xenon arc lamp and passed in an alternating fashion through 340 or 380 nm bandpass filters

(Omega Optical). Emitted light was directed through a 510 nm bandpass filter and the light

collected by a photomultiplier tube detector. Data were acquired by computer at a rate of ∼2.5/s

and were stored on a hard disk. The fluorescence ratio of emitted light with 340 nm excitation to

that emitted with 380 nm excitation was calculated after baseline subtraction. The change in

fluorescence ratio over the initial fluorescence ratio (ΔF/F) was calculated offline. Hardware and

software for Ca2+ measurement were from Photon Technologies.

In vitro pharmacology. Drugs for in vitro experiments were prepared as stock solutions in saline

and stored as single-use aliquots at 4 °C or -20 °C as required. The control groups without drug

received the vehicle. For calcein dye efflux experiments and fluorescent measurement of

intracellular Ca2+ experiments, drugs were applied by bath in the ECS at room temperature

containing: NaCl 140 mM; KCl 5.4 mM; CaCl2 1.3 mM; HEPES 10 mM; and glucose 33 mM,

Nature Medicine doi:10.1038/nm.2710

Page 16: Genetically determined P2X7 receptor pore formation ... · Genetically determined P2X7 receptor pore formation regulates variability in chronic pain sensitivity Robert E. Sorge, Tuan

pH 7.35, osmolarity315–320 mOsm. Cells were stimulated with 2′(3′)-O-(4-

Benzoylbenzoyl)adenosine 5′-triphosphate triethylammonium (BzATP) (300 µM; Sigma).

Cells were pretreated with TAT-P451 (5 µM) or TAT-451L (5 µM) 30 min prior to BzATP

stimulation. In other experiments, TAT-P451 (25 µM) or TAT-451L (25 µM) was co-applied

with YO-PRO dye 10 min following BzATP stimulation. TAT fusion peptides were obtained

from Advanced Protein Technology Centre Peptide Synthesis Facility (Toronto, ON).

In vivo pharmacology. Experiments using BBG were conducted in outbred, CD-1 mice.

Following baseline testing as described, mice were subjected to SNI surgeries or CFA injection

(see above). Immediately following the confirmation of allodynia development at post-operative

day 7 or 24 h post-injection, respectively, mice were injected intravenously (i.v.) with vehicle

(0.9% saline; 5 ml/kg) or BBG (4, 40 or 120 mg/kg) (n=4–8 mice/dose). We found that blocking

P2X7Rs with BBG both prevented and reversed the development of mechanical allodynia in

CD-1 mice, albeit at different doses.

Because only P451 strains are able to form the pore, if pore formation is responsible for the

greater allodynia in P451 strains, one would predict that only TAT-P451 given to A/J mice

would reverse allodynia. Immediately following the confirmation of SNI- or CFA-related

allodynia development at post-operative day 7 or 24 h post-injection, respectively, A/J and

B10.D2 mice were injected i.v. with saline (1 ml/g body weight), TAT-P451 (30 nmol) or

TAT-451L (30 nmol) (n=6–13 mice/strain/peptide). Data are expressed as a percentage of the

maximum possible anti-allodynia from the peptide at its peak effect, calculated as a ratio of the

pre- vs. post-peptide injection difference compared to the baseline vs. pre-injection

(postoperative day 7 for SNI; 24 h post-CFA).

Nature Medicine doi:10.1038/nm.2710

Page 17: Genetically determined P2X7 receptor pore formation ... · Genetically determined P2X7 receptor pore formation regulates variability in chronic pain sensitivity Robert E. Sorge, Tuan

Human pain cohorts. The two cohorts —including 354 Israeli women having previously

undergone breast surgery to remove a malignant tumor and axillary lymph node dissection, and

743 osteoarthritis patients (plus 586 controls)—were genotyped. The studies were approved by

the ethics review board of the Israeli Ministry of Health and University of North Carolina,

respectively. In order to compare these cohorts directly, we made an a priori decision to analyze

only the most obviously comparable pain intensity measure in each cohort: intensity of a typical

pain episode in the post-mastectomy pain cohort and WOMAC pain subscale in the osteoarthritis

cohort (see below).

PMP Cohort. Subjects were recruited from two large oncology institutes at the Hadassah

Medical Center, Jerusalem, and the Sheba Medical Center, Ramat Gan, who had undergone

breast surgery to remove a malignant tumor and axillary lymph node dissection at least a year

prior to the study, and who were at least 6 months after the last radio-, chemo-, and hormonal

adjuvant therapy. The pain intensity outcome was rated on a numerical rating scale (NRS) that

ranges from 0 (‘no pain’) to 20 (‘maximal pain imaginable’) (mean NRS = 3.7; SD = 5.3). Using

these ratings we found that about half of the women have chronic PMP syndrome that

manifested as patient-specific episodes of pressing, piercing, crushing, pinching and electrical

shock-like pain in the missing breast and surgical scars, that may spread to the chest, arm and

shoulder.

OA Cohort. This cohort was made up of subjects of both sexes (66% female for cases, 55%

female for controls) extracted from the Johnston County Osteoarthritis Project, an ongoing

population-based prospective study of OA of the knee and hip in a rural North Carolina county.

Civilian, non-institutionalized African-American and Caucasian individuals 45 years of age and

Nature Medicine doi:10.1038/nm.2710

Page 18: Genetically determined P2X7 receptor pore formation ... · Genetically determined P2X7 receptor pore formation regulates variability in chronic pain sensitivity Robert E. Sorge, Tuan

older were recruited by probability sampling of 6 townships in Johnston County, NC, between

May 1991 and December 1997. All participants had two interviewer-administered home

interviews, a limited clinical and functional examination, and X-rays of the knees; women over

the age of 50 years and all men also underwent hip radiography. Only mean scores from the five

pain-specific items (on a 5-point Likert scale) are reported (mean = 8.2; SD = 3.7).

Genotyping. For the PMP cohort, the genotype data was cleaned by removing samples with

>80% failed genotypes resulting in the call rate over 98%; none of the markers showed a

significant deviation from Hardy-Weinberg equilibrium. Multiple regression analysis was used

to identify significant covariates affecting pain levels using the GLM procedure in PLINK v1.07,

adjusting for covariates (i.e., age at surgery, and time since the operation, which robustly

affected pain traits in this cohort).

For the OA cohort, samples were filtered based on call rate <98%, inconsistency between

self-report and genotypic sex, race, and cryptic relatedness. SNP markers were removed for call

rate <98%, discordance across repeated samples>0, minor allele frequency <0.005%, and test of

Hardy-Weinberg equilibrium p<10-4. The final overall call rate for the study was 99.96%.

Association between SNP genotype and symptomatic OA (WOMAC pain subscale values >3)

was assessed by logistic regression in PLINK v1.07, using a model that included sex, age, BMI,

collection site, and genotyping batch as covariates.

Statistical analyses. A criterion α level of 0.05 was adopted in all cases. Behavioral data were

first analyzed by repeated measures ANOVA. In some cases, raw data were integrated over time

by calculating the area over the threshold x time curve using the trapezoidal method; from these

Nature Medicine doi:10.1038/nm.2710

Page 19: Genetically determined P2X7 receptor pore formation ... · Genetically determined P2X7 receptor pore formation regulates variability in chronic pain sensitivity Robert E. Sorge, Tuan

areas, percentage of maximum possible allodynia was calculated. Data from three mice in the

strain survey were omitted from further analysis because they were identified as statistical

outliers (Studentized residual > 3). For in vitro experiments, statistical significance between

treatment groups was determined by ANOVA followed by a Student Newman-Keuls post hoc

test. Haploview 4.2 (Broad Institute, Cambridge MA) was used for linkage disequilibrium

analysis, using phased HapMap (Phase III) data. Proportion of variance explained by genetic

variants was calculated using the liability threshold model for the binary OA phenotype.

Nature Medicine doi:10.1038/nm.2710