genetic variation is meaningful only in the context of a population
DESCRIPTION
ccagtcagag A tgtgcacatggcttagttttcataca G agcctgggctgggggtggggtg ccagtcagag A tgtgcacatggcttagttttcatacacagcctgggctgggggtggggtg ccagtcagagttgtgcacatggcttagttttcatacacagcctgggctgggggtggggtg ccagtcagag A tgtgcacatggcttagttttcatacacagcctgggctgggggtggggtg - PowerPoint PPT PresentationTRANSCRIPT
genetic variation is meaningfulonly in the context of a population
the minor allele frequency f says how often a particular allele (variant) occurs at a particular site in a given population; by definition it is < 0.5
ccagtcagagAtgtgcacatggcttagttttcatacaGagcctgggctgggggtggggtgccagtcagagAtgtgcacatggcttagttttcatacacagcctgggctgggggtggggtgccagtcagagttgtgcacatggcttagttttcatacacagcctgggctgggggtggggtgccagtcagagAtgtgcacatggcttagttttcatacacagcctgggctgggggtggggtgccagtcagagAtgtgcacatggcttagttttcatacacagcctgggctgggggtggggtgccagtcagagttgtgcacatggcttagttttcatacacagcctgggctCggggtggggtgccagtcagagttgtgcacatggcttagttttcatacacagcctgggctgggggtggggtgccagtcagagttgtgcacatgTcttagttttcatacacagcctgggctgggggtggggtgccagtcagagttgtgcacatggcttagttttcatacaGagcctgggctgggggtggggtgccagtcagagttgtgcacatggcttagttttcatacacagcctgggctgggggtggggtg
f = 4/10 f = 1/10 f = 2/10 f = 1/10
indi
vidu
als
1-10
the polymorphisms most analyzed are:
single nucleotide polymorphisms (SNPs) replace one bp with another but do not change lengths
1 SNP per 1000 bp between any two individuals; almost every bp is variable when we consider the world population
SNPs are essentially always bi-allelic; not because tri-allelics are impossible, just highly unlikely
other polymorphism categories include:
small insertions-deletions (indels) below reads length
large structural variations consisting of insertions and deletions and inversions above reads length
SNPs approximate 1/f distribution
this is the observed frequency distribution from the complete sequencing a large population; however many SNP discovery projects sequence a small population
and then consider the absence or presence of those previously discovered SNPs in a large population; this is known to underestimate the number of rare
variants
0 0.1 0.2 0.3 0.4 0.50
250
500
750
1000
f (minor allele)
# of
SNP
s
# of SNPs found = 1541
NonSyn Synon 5'-UTR 3'-UTR Frame Splice 5'-Flank3'-FlankIntron
population specific SNPs arefound at lower f than shared ones
minor allele frequencies classified by occurrence within individuals of either African or European descent (population specific) or presence in both (shared)
as shown by Halushka MK, …, Chakravarti A. 1999. Nat Genet 22: 239-347
GENOTYPE
first we identify variant sites by sequencing a small number of individuals; then we test (i.e. genotype) only those variant sites to determine which alleles are present
RE-SEQUENCE [inconsistently used terminology]
generate low coverage (2x) sequence from one individual and compare that data against the reference genome
DE NOVO
generate high coverage (50x) sequence from one individual and perform de novo assembly of that genome without making use of the existing reference genome
growth in public databases for “common” human polymorphisms
27 October 2005 one million SNPs genotyped in 269 individuals from
four diverse populations
28 October 2010 15 million SNPs, one million short insertion-deletion,
20000 structural variants genotyped in up to 697
individuals from 7 diverse populations worldwide
18 October 2007 3.1 million SNPs genotyped in 270 individuals from
four diverse populations
structural variations detected by fosmid end-sequence pairs (ESPs)
the fosmid cloning system generates an exceptionally narrow distribution of clone insert sizes, 40 ± 2.8 kb; each of these fosmid clones is sequenced from both ends, creating an end-sequence pair with two 500 bp sequence reads separated by a known distance in the test genome from which the fosmid clone was made; insertions-deletions-inversions are detected by computationally aligning end-sequence pairs to the reference genome
10 kb deletion relative to reference
50 kb on REF
REF genome
test genome
40 kb on test
deleted 10 kb
arrows indicate direction of
sequence read
structural variations follow a1/f distribution just like SNPs
15% (261 of 1,695) of discovered sites represent the more common configuration than the reference human genome
JM Kidd, et al. 2008. Mapping and sequencing of structural variation from eight human genomes. Nature 453: 56-64
human pan-genome: non-redundant collection of sequences found across the entire world’s human population
de novo assembly of individual genome reveals ~5 Mb of novel sequence not present in reference genome; complete human pan-genome contains 19~40 Mb of novel sequence not present in reference genome
R Li, et al. 2010. Building the sequence map of the human pan-genome. Nat Biotechnol 28: 57-63.
Lewontin’s (in)famous paper on non-existence of “race” in genetics
Lewontin RC. 1972. "The apportionment of human diversity“, in Evolutionary Biology 6: 391-398
most of the variations (85%) found in human populations is found within local geographic groups and any differences attributable to race groups is just a small fraction of human genetic variability (15%); race is an invalid taxonomic construct because the probability of a racial misclassification is approximately 30% based on a single genetic locus
Edwards AW. 2003. Human genetic diversity: Lewontin's fallacy. Bioessays 25: 798-801
even if the probability of misclassifying an individual’s race based on a single locus is as high as 30%, the misclassification probability based on 10 loci can drop to a few percent
Structure clustering of genotype data
Rosenberg NA, …, Feldman MW. 2002. Science 298: 2381-2385
This analysis is based on 377 microsatellites in 1056 individuals from 52 populations. Variations within populations account for 93 to 95% of the data. Nevertheless we can identify clusters that are consistent with known populations. K is chosen in advance. For any given K, each individual is represented by a thin vertical line, which is partitioned into K colored segments indicating the individual’s estimated membership in the preordained K clusters.
Africa AsiaEurope
science does notdictate public policy
science can and should inform policy but that is never the only consideration, and in the meantime there are better (or at least more fun) things to do
with the decreasing cost of sequencing, the age of personal genomics is fast approaching; we need not limit ourselves to sequencing live individuals
human genome sequencefrom an extinct Palaeo-Eskimo
evidence of migration from Siberia into the New World some 5,500 years ago independent of migrations giving rise to modern Native Americans and Inuits
M Rasmussen, et al. Feb 2010. Nature 463: 757-762.
Kennewick Man is but the tip of the iceberg for the New World Entrada controversy. Who occupied the American continents first and where did they come from? These questions are intricately connected with the rights of indigenous Native Americans. Sequencing of a pre-Clovis genome over 11,500 years old would rattle the field.
personal genomes for $199
Anne Wojcicki and Sergey Brin