Gene MutationsGene Mutations

Changes to the Changes to the nucleotide nucleotide sequence of the sequence of the genetic material of genetic material of an organism. an organism.

Dr. TimmelDr. Timmel

MutationsMutations

Mutations arise when the sequence Mutations arise when the sequence of nucleotides within an organisms of nucleotides within an organisms nucleic acids is changed.nucleic acids is changed.

The impact of these mutations on The impact of these mutations on the organism can range from life the organism can range from life threatening to completely threatening to completely inconsequential.inconsequential.

Mutations are random, though some Mutations are random, though some risky behaviors can put an individual risky behaviors can put an individual at a greater danger of a mutation.at a greater danger of a mutation.

The good, the bad and The good, the bad and the ugly.the ugly.

Mutations are an important Mutations are an important ingredient to the theory of ingredient to the theory of evolution by natural evolution by natural selection, as they increase selection, as they increase the amount of genetic the amount of genetic diversity in a population.diversity in a population.

Usually (>99%) mutations Usually (>99%) mutations are deleterious (bad) to an are deleterious (bad) to an organism.organism.

However, on occasion, a However, on occasion, a mutation gives an individual a mutation gives an individual a selective advantage, and will selective advantage, and will increase in frequency within increase in frequency within a population.a population.

Mutations will never, ever Mutations will never, ever give you superpowers.give you superpowers.

What causes mutations?What causes mutations?

Agents that can Agents that can cause mutations are cause mutations are called MUTAGENS.called MUTAGENS.

Some examples are:Some examples are:1.1. Chemicals (Such as Chemicals (Such as

the ones in cigarette the ones in cigarette smoke)smoke)

2.2. Ultra-violet or Ultra-violet or ionizing radiationionizing radiation

3.3. VirusesViruses

Types of genetic Types of genetic mutations.mutations.

There are two main categories of mutation.There are two main categories of mutation. Point mutations and frame shift mutations.Point mutations and frame shift mutations.

In a point mutation, a single nitrogen base is In a point mutation, a single nitrogen base is substituted with another. substituted with another.

e.g. Normal gene =ATACCGe.g. Normal gene =ATACCGGGCATTACATTA

Mutated gene =ATACCGMutated gene =ATACCGTTCATTACATTA

In this example, a guanine base has been In this example, a guanine base has been substituted with a thymine. substituted with a thymine.

Outcomes of point Outcomes of point mutationsmutations

There are three possible outcomes of There are three possible outcomes of a point mutation.a point mutation.

1.1. Silent mutationSilent mutation: The mutated codon : The mutated codon codes for the same amino acid. The codes for the same amino acid. The protein will be unchanged.protein will be unchanged.

2.2. Small change mutationSmall change mutation: A single amino : A single amino acid in a protein will be different. The acid in a protein will be different. The protein will function, but not as well as protein will function, but not as well as an unmutated one. Sickle-cell anemia is an unmutated one. Sickle-cell anemia is the result of this type of point mutation.the result of this type of point mutation.

Point mutations (cont.)Point mutations (cont.)

3. 3. The stop command mutationThe stop command mutation: : The mutation causes a codon that The mutation causes a codon that would have coded for an amino acid would have coded for an amino acid to instead code for the stop to instead code for the stop command. This will lead to command. This will lead to incomplete protein fragments that incomplete protein fragments that will not function.will not function.

Types of genetic Types of genetic mutation (cont.)mutation (cont.)

2. Frame shift mutations: A nitrogen 2. Frame shift mutations: A nitrogen base is either added (insertion) or base is either added (insertion) or removed (deleted) from a gene.removed (deleted) from a gene.

Normal gene: ATACGGCTATTCNormal gene: ATACGGCTATTC

Insertion: ATACGInsertion: ATACGAAGCTATTCGCTATTC

Deletion: ATACGCTATTC (a Deletion: ATACGCTATTC (a guanine guanine

was deleted)was deleted)

Results of a frame shift Results of a frame shift mutationmutation

Except in the case of the stop command Except in the case of the stop command point mutation, frame shift mutations are point mutation, frame shift mutations are much worse than point mutations.much worse than point mutations.

In a gene that has been afflicted with a In a gene that has been afflicted with a frame shift mutation, it is unaffected frame shift mutation, it is unaffected prior to the location of the mutation, but prior to the location of the mutation, but then completely garbled afterwards.then completely garbled afterwards.

Lets look at an analogy to help illustrate Lets look at an analogy to help illustrate this.this.

Frame shift analogyFrame shift analogy

Consider the following sentence:Consider the following sentence: The fat cat sat and ate rat. This The fat cat sat and ate rat. This

represents the normal gene. Each 3-represents the normal gene. Each 3-letter word represents a codon in the letter word represents a codon in the gene.gene.

Now let us consider what happens in an Now let us consider what happens in an insertion mutation. Lets insert a “a” insertion mutation. Lets insert a “a” between the t in “cat” and the s in “sat”.between the t in “cat” and the s in “sat”.

The gene would now look like thisThe gene would now look like this

The fat cat The fat cat aasa tan dat era tsa tan dat era t

As you can see, the portion of the As you can see, the portion of the gene before the insertion is gene before the insertion is unchanged, but from the location of unchanged, but from the location of the insertion onwards, the gene is the insertion onwards, the gene is now nonsense.now nonsense.

This gene will not translate into a This gene will not translate into a useable protein.useable protein.