gene knockout

21
Gene knockout Lecturer Du Shengyang January 24 2013

Upload: zola

Post on 24-Feb-2016

54 views

Category:

Documents


0 download

DESCRIPTION

Gene knockout. Lecturer : Du Shengyang January 24 2013. Minimum genome Based on a kind of ideal hypothesis It a ssume that cells contain a minimal gene set Under the condition of the gene set to maintain normal life functions reduced genome - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: Gene knockout

Gene knockout

Lecturer: Du ShengyangJanuary 24 2013

Page 2: Gene knockout

Minimum genomeBased on a kind of ideal hypothesisIt assume that cells contain a minimal gene setUnder the condition of the gene set to maintain normal life functions

reduced genomeGradually eliminate nonessential gene sequence

Page 3: Gene knockout

The significance of gene knockout

Gene knockout can reduce the redundancy of biological system

Identify specific essential genes

Improve metabolic efficiency

Controllability and predictability higher

Page 4: Gene knockout

nonessential genes and sequences recombinogenic or mobile DNA and cryptic virulence genes gene cluster related to different secondary metabolites synthesis IS sequence Redundancy sequence

Page 5: Gene knockout

The common method

1、 homologous recombination

2、 Insertion mutation

3、 RNAi

Page 6: Gene knockout

Red recombination 1.red and Sce I cutting 2.Two step to Red recombination

Page 7: Gene knockout

Cre-LoxP System LoxP : ATAACTTCGTATAGCATACATTATACGAAGTTAT ATAACTTCGTATA TATTGAAGCATAT

Cre

Target geneLoxP

Page 8: Gene knockout

a novel Bacillus subtilis strain,MBG874,depleted of 874 kb (20%) of the genomic sequence

productivity of extracellular cellulase and protease from transformed plasmids harboring the corresponding genes is remarkably en-hanced

Page 9: Gene knockout
Page 10: Gene knockout
Page 11: Gene knockout
Page 12: Gene knockout

a new genetic strategy based on the Cre-loxP recombination system to generate large chromosomal rearrangements in Lac-tococcus lactis.

The Cre-loxP recombination system described can potentially be used for other gram-positive bacteria without further modi-fication.

Page 13: Gene knockout

Chromosomal inversions in Lactocoaal

Page 14: Gene knockout
Page 15: Gene knockout
Page 16: Gene knockout

All inversions have an effect on the cell fitness compared to thatassociated with the corresponding isogenic parental structure,with a decrease in growth rate ranging from 8 to 18% dependingon the extent of the chromosome disorganization it can potentially be used for generating rearrangements in any region of the bacterial chromosome.

Page 17: Gene knockout

It will be a powerful tool for purposes such as control of the copy number of integrated exogenous DNA in gene expression investigations or shuffling of the bacterial chromosome (by deletions or inversions) for applied and fundamental genome studies.

Page 18: Gene knockout

MG1655 red(KmR) rpsL hsdR::ApR

These criteria are described in PEC database nonessential genes is 29.7% (1.38 Mb).

The construction of deletion units by theCRS cassette method Using P1 phage integrates "deletion unit" in the MG1655 rpsL

MG1655 Deleting the largest K-islands of E.coli an 0.38Mb(8.1%) reduced genome size

comparing the genomes of MG1655and EDL933plasmid pSG76-CS.by PCR carrying a selectable marker [CmR] two I-SceI siteshelper plasmid pBADαβγ integrated the linear fragment into their chromosomeplasmid pSTKST delete insert segments

MG1655 IS sequence, transposase, defect

phage and integration enzyme all movable component size 0.71

Mb (15.27%)

Compare genome information of MG1655 with other five e. coli strains and knock out the gene fragments only exist in the MG1655 、 use red reorganization system of the phage λ to knock out the target segment

Page 19: Gene knockout

W3110ΔrecBCD::Plac-bet

exo kan

Confirm nonessential area and translocation genes, IS sequence by comparative genome

comparing the genomes of W3110and Buchnera sp.compare PEC and ERGO database determine the knock out areause red reorganization system of

the phage λ

B.subtilis GB469

Gain 11 nonessential gene cluster by prediction and experimental verification

Using the upp-cassette and 5-FU screening method,it choose the area that a single gene knockout does not affect cell growthgene knock out gradually

Page 20: Gene knockout

Our subject

Confirm the target that can be deleted

In other hand, we can not affect the bacteria growth and nisin synthetic

Using some Gene knockout techniques deletes IS sequence and gene cluster related to secondary metabolites synthesis.(upp or Cre-loxP )

Experimental verification and analysis

Page 21: Gene knockout