gene expression pattern and hormonal regulation of small ......200 ng /mice /day, group e),...

Reprod. Nutr. Dev. 46 (2006) 641–655 641c© INRA, EDP Sciences, 2006DOI: 10.1051/rnd:2006037

Original article

Gene expression pattern and hormonal regulation ofSmall Proline-Rich Protein 2 family members in the

female mouse reproductive system during the estrouscycle and pregnancy*

Yin-fei T, Xiao-yang S, Fei-xue L, Shuang T, Yun-shang P,Yan-ling W**

State Key Laboratory of Reproductive Biology, Institute of Zoology, Chinese Academy of Sciences,Beijing 100080, China

(Received 1 February 2006; accepted 7 July 2006)

Abstract – Small proline-rich proteins (SPRR) are known to construct the cornified cell envelope(CE) in the stratified squamous epithelial cell. Their functions in the simple epithelium such asthe uterine epithelium are not clear hitherto. In the present study, the mRNA expression patternsof sprr2 family members in the mouse uterus and vagina during the estrous cycle and pregnancyas well as their regulation by steroids were investigated. Using semi-quantitative RT-PCR, it wasrevealed that the transcripts of sprr2b, 2e and 2g genes were up-regulated in the proestrous andestrous uteri, and sprr2d was up-regulated only in the estrous uterus. In the vagina, transcription ofsprr2a, 2b, 2d, 2e and 2k genes were up-regulated at the metestrous stage. Northern blot analysisdemonstrated that the overall expression of sprr2 was highly up-regulated in the estrous uterus andthe metestrous vagina. During pregnancy, the sprr2 mRNA in the uterus was sharply repressed fromday 3 postcoitus on, and began to be induced around labor time. In situ hybridization showed that thesprr2 transcripts were localized in uterine luminal and glandular epithelial cells as well as vaginalstratified epithelial cells. In ovariectomized mice, the expression of sprr2a, 2d, 2e and 2f genes inthe uterus were induced by estrogen, and the effect of estrogen on sprr2d and 2e expression couldbe partly abolished by progesterone. The data indicate that the sprr2 genes have unique regulationpatterns in different reproductive tissues under different physiological conditions, and the encodedproteins might play diverse functions in the female reproductive system.

small proline-rich protein / uterus / estrous cycle / pregnancy / stress

1. INTRODUCTION

The uterus is a dynamic organ thatshows specific morphological and func-tional change during the estrous cycle as

* This work was supported by the NSFC ProjectGrant (30370542) and the funds of the CASknowledge Innovation Program (KSCX3-IOZ-07 and KSCX-2-SW-201).** Corresponding author: [email protected]

well as the processes of embryonic im-plantation and placentation. However, themolecular mechanism underlying uterinemultifunction remains largely unclear hith-erto. Previously, we mapped the gene ex-pression profile in the mouse uterus duringthe estrous cycle by using microarray tech-nology. More than one hundred differen-tially expressed genes were found, amongwhich the most up-regulated gene at estrus

Article published by EDP Sciences and available at http://www.edpsciences.org/rnd or http://dx.doi.org/10.1051/rnd:2006037

http://www.edpsciences.org/rnd

http://dx.doi.org/10.1051/rnd:2006037

642 Y.-f. Tan et al.

vs. diestrus was the gene encoding family 2of small proline-rich proteins (SPRR2) [1].

The knowledge about the functions ofSPRR members was confined to the squa-mous epithelial cells. SPRR proteins serveas precursors to construct the cornified cellenvelope (CE) in the stratified squamousepithelium, which functions as a uniqueprotective shield against environmental in-sults such as trauma, wear-and-tear andloss of body water [2]. The CE complexalso entails other proteins including involu-crin, loricrin, cystatinA and filaggrin [3],and transglutaminase (GTase) was thoughtto be the primary enzyme that addedSPRR2 proteins to the CE complex bycrosslinking the heads and tails of SPRR2with the other structural proteins [4]. Datafrom Turksen and Troy showed that micewith defective CE caused by overexpress-ing claudin6 exhibited neonatal death dueto unquenchable infection, outflow of wa-ter and temperature instability [5]. Simi-larly, mice with the GTase1 gene knock-out died as neonates, lacking the normalinsoluble cornified envelope and havingimpaired barrier function [6]. However,the knockout of genes encoding some CEproteins such as involucrin, loricrin andenvoplakin did not abolish CE formationand only slightly affected CE function,suggesting the existence of some compen-satory mechanisms preventing a more se-vere skin phenotype [7–9].

Up to now, four families of sprr geneshave been identified in mice. These arefamilies of sprr1 (two members), sprr2(eleven members), sprr3 (one member)and sprr4 (one member) [10, 11]. Theeleven members of the sprr2 gene familyhave been named from a to k based on theirlinear arrangement on the gene locus. Thehigh homology in the coding regions ofsprr2 genes indicated that their gene locuswas expanded through a common ancestorgene by multiple intra- and inter-genic du-plications [12,13]. The different regulatoryelements on their promoters indicated that

the divergent regulation of sprr2 membersallowed the fine-tuning of the CE barrierfor the optimal protection of the organ-ism [10]. Interestingly, sprr mRNA andthe corresponding proteins were recentlyfound in the uterine epithelium and ovarywhere only simple epithelium or simpleepithelium-like cells exist. Specifically, thehuman ovary expresses sprr1, 2 and 3,whereas human and mouse uteri expresssprr2 but not sprr 1 and 3 [13, 14]. There-fore, the question of the novel role of sprr2proteins in the reproductive process hasarisen. It is thought that these uterine CEprecursors might reflect a predisposition ofthis epithelium to undergo squamoid dif-ferentiation under certain conditions [15].However, there is little further report ontheir regulation and function in the repro-ductive tissues so far.

In the present study, semi-quantitativeRT-PCR and northern blot analysis wereused to investigate the expression patternsof sprr2 in the mouse uterus, ovary andvagina during different stages of the es-trous cycle and pregnancy. The mRNAlocalization of the sprr2 gene in the uterusand vagina was demonstrated by in situ hy-bridization. Furthermore, the regulation ofsprr2 expression by steroid hormones wasstudied in the ovariectomized mice. Basedon these data, the possible protective roleof sprr2 products in the female reproduc-tive system was suggested.

2. MATERIALS AND METHODS

2.1. Animal treatment and tissuecollection

Mature virgin female CD-1 mice at theage of six weeks (about 26 g) were ob-tained from the Laboratory Animal Cen-ter, National Research Institute for FamilyPlanning (Beijing, China). The mice werehoused with the lights on for 12 h dailyand fed ad libitum. Vaginal smears were

Expression of sprr2 in female mouse reproductive tracts 643

examined daily to classify the phases ofthe estrous cycle [16]. Mice with at leasttwo consecutive 4-day cycles were cho-sen for tissue collection and mating. Theuteri, vaginas and ovaries at the proestrous,estrous, metestrous and diestrous stageswere harvested, respectively. For the mat-ing mice, the day when a virginal plugappeared was considered as the first dayof pregnancy. For the pregnant ones, theuteri and placentas (if have) were col-lected at 1300–1400 h on gestational days1, 2, 3, 4, 13, 20 and one day after de-livery, respectively. On gestational day 4when implantation just occurred, the uteriwere collected as the implantation sites andthe inter-implantation sites after venous in-jection of Evans blue dye (1% in saline)at 2200–2300 h [17]. Another forty micewere subjected to ovariectomies, and twoweeks later, the mice were randomly di-vided into four groups. They received sub-cutaneous injection of 17-βestradiol (E2,200 ng/mice/day, Group E), progesterone(P, 1 mg/mice/day, Group P), a combina-tion of E2 and P (Group EP), and vehicle(peanut oil, 0.1 mL/mice/day, Group C)for 3 days, respectively [18]. The animalswere sacrificed 24 h after the last hormoneinjection and then the uteri and vaginaswere harvested. All the tissues were flashfrozen in liquid nitrogen and then stored at–80 ◦C.

2.2. RNA isolationand semi-quantitative RT-PCR

Total RNA were isolated using TRIzolreagent (Invitrogen, CA, USA) accord-ing to the manufacturer’s instructions.RNA were subjected to digestion withDNase I, and then extracted with phe-nol:chloroform:isopropyl alcohol (25:24:1) (Sigma) and concentrated by ethanolprecipitation. One microgram of totalRNA was reverse transcribed in a 20 µLreaction mixture with oligo(d)T primers

(Promega, Madison, USA) and Super-Script II reverse transcriptase as specifiedby the manufacturer (Invitrogen, CA).One microliter aliquot from the reversetranscription was subjected to PCR am-plification with specific sets of primers(SBS Genetech, Beijing, China) listed inTable I. The cycling numbers of the PCRreactions ranged from 20 to 35 accordingto the abundance of various transcripts, toensure the amplifications were performedwithin the exponential phase (Tab. II). Allthe PCR products were then subclonedinto the pGEM-T easy vector (Promega,Madison) and verified by sequencing.

2.3. Northern blot analysis

Total RNA (25 µg) and the 3 µL RNAmarker were subjected to electrophore-sis on 1% formaldehyde agarose gels andthen vacuum transferred to Hybond+ nylonmembranes (Pharmacia, NJ). Wet mem-branes were crosslinked by an ultravioletcrosslinker for 8 s. The pGEM-T easyvectors containing the cDNA fragmentsof sprr2a, 2f or gapdh genes were usedto generate [α−32P] dCTP labeled probes(Yahui, Beijing, China) by the Prime-a-gene system (Promega, Madison). Themembranes were pre-hybridized for 4 h at65 ◦C in pre-hybridization buffer (0.2 Msodium phosphate pH7.4, 0.1 mM EDTA,7% [w/v] SDS, 1% [w/v] BSA, and 15%[v/v] formamide), and further hybridizedovernight at 65 ◦C with the sprr2 or gapdhprobe, respectively. After hybridization,the membranes were washed and then ex-posed to Fuji film (Fuji Photo Film Co.,Tokyo, Japan) at –80 ◦C for the desiredtime. The signals were quantified withthe densitometric scanner (Amersham Bio-sciences, Buckinghamshire, England) andnormalized with the density of the gapdhsignal.


Table I. Primers used in RT-PCR.

Gene symbol Primer sequences Product GeneBanksize (bp) accession No.

sprr2a Forward: 5’- AAGTAAAAGAGGCAATCCAGG 579 AJ005559(as Northern blot probe) Reverse: 5’- CATCATAGGCACATGGAGGsprr2a F: 5’- CCTTGTCGTCCTGTCATGTGC 167 AJ005559

R: 5’- CCTTCACCTGTTGGGTGGTCAsprr2b F: 5’- CTGAGACTCAAGTACGATGTCTTACTACC 323 AJ005560

R: 5’- CTGGGAAACCCTCATTTATTCTTGGGTGGAsprr2d F: 5’- ACCCGATCCTGAGAATCCAGCACT 307 AJ005562

R: 5’- TTTGTCCTGATGACTGCTGAAGACsprr2e F: 5’- ATCCTGAGAATTCAGCACTATG 275 AJ005563

R: 5’- CTTGTCCCGATGACTGCTGAATCsprr2f F: 5’- TCATTCCAGCAGAAATGC 308 AJ005564

R: 5’- CTGAACAATGGAACAAGACCsprr2g F: 5’- ATCCTGAGACTTCAGAAAGATG 273 AJ005565

R: 5’- TTGTTCTGAAGATTGCTGCCATGCsprr2h F: 5’- GGAGAACCTGAACCTAAGACTTC 436 AJ005566

R: 5’- GGGAAGATGGAGGTGTTGCTATGGsprr2i F: 5’- ATCCTGAGATCTCAGCACTATG 277 AJ005567

R: 5’- TCTTGGTCTCGATGAATGCTGAGGCATsprr2j F: 5’- ATCCTGAGATTTCAGCACTATG 322 AJ005568

R: 5’- GGGCTTATGTAAGATGGATTCTGsprr2k F: 5’- AGATCCTGAGACATCATAATG 249 AJ005569

R: 5’- GGTCTTGATGATTGCTAAAGGTase3 F: 5’- TCACGTCTGGAATGAAGG 1000 L10385

R: 5’- GGGGAAAATCTCAAATCGinvolulcrin F: 5’- CACACTGCCAGTGACTGTTCC 902 L28819

R: 5’- TCTGATCCCCTGCCATATCCgapdh F: 5’-ACGACCCCTTCATTGACC 700 M32599

R: 5’-TCAGATGCCTGCTTCACC

Table II. Cycling number used in amplifying specific cDNA in the uterus, vagina and ovary bysemi-quantitative RT-PCR.

Mice with normal estrous cycle Ovariectomized miceuterus vagina ovary uterus vagina

sprr2a 23 25 35 25 25sprr2b 25 25 35 25 28sprr2d 25 25 35 25 25sprr2e 25 25 35 25 25sprr2f 23 25 35 23 23sprr2g 28 25 35 35 25sprr2h 28 25 35 35 25sprr2i 35 35 35 35 35sprr2j 35 35 35 35 35sprr2k 35 35 35 35 35GTase3 35 35 30 35 25involucrin 30 30 35 35 25gapdh 20 20 20 20 20


2.4. In situ hybridization

Tissue sectioning, DIG-labeling and insitu hybridization were performed as pre-viously described [19]. In brief, the uterinetissues were washed twice with phosphate-buffered saline (PBS) buffer and fixedin 4% paraformaldehyde (PFA) at 4 ◦Covernight. The fixed tissues were thengradually dehydrated in ethanol and em-bedded in paraffin. The sections werecollected on Super Frost+ glass slides(Menzel-Gläser, Germany). To generateDIG-labeled RNA probes, the pGEM-Teasy vector containing the cDNA fragmentof sprr2f gene was linearized and usedas the template to synthesize DIG-labeledsense or anti-sense RNA probes using theDIG-Labeling System (Roche, IN). Theprobes were stored at –80 ◦C until use. Forin situ hybridization, paraffin sections wereroutinely deparaffinized and rehydrated.The slides were denatured subsequently at70 ◦C in 2× SSC for 15 min and digestedwith 4 µg.mL−1 of proteinase K (Invitro-gen) for another 15 min. Post-fixation wasperformed in 4% PFA at room tempera-ture for 10 min, followed by acetylationin triethanolamine buffer containing 0.5%acetic anhydride for 10 min and subse-quent equilibration in 5× SSC for 15 min.The slides were pre-hybridized for 4 h at58 ◦C in pre-hybridization buffer (50% for-mamide, 20 mM Tris-HCl, 50 mM EDTA,tRNA Coli 0.5 mg.mL−1, DTT 100 mM)and further hybridized for 18 h at 58 ◦Cin fresh hybridization buffer containing1 ng.µL−1 anti-sense DIG-RNA probes.After washing with 2× SSC and 0.1× SSCat 65 ◦C for 1 h, the slides were submit-ted to 50 µg.mL−1 RNaseA digestion at37 ◦C for 15 min. Then the slides wereblocked with 0.5% blocking reagent buffer(Bochringer Mannheim, Germany) and in-cubated with alkaline phosphatase-coupledanti-digoxigenin antibody for 2 h. Colordevelopment was performed in buffer II(100 mM Tris-HCl, 100 mM NaCl, 50 mM

MgCl2, pH 9.5) containing 4.5 µL NBTand 3.5 µL BCIP (Bochringer Mannheim).The slides were mounted in Clearmount(Zymed, San Francisco, USA) withoutcounterstaining. The negative control wasperformed with the sense RNA probe re-placing the corresponding antisense probein hybridization buffer.

2.5. Statistics

The RT-PCR, northern blot analysis andin situ hybridization were performed forat least three times with three independentpools of RNA samples, each pool was de-rived from specific tissues of at least tenmice. For RT-PCR and northern blot anal-ysis, the relative amount of target mRNAwas measured by comparing its densito-metry value with that of gapdh. The datawas expressed as mean ± SD accordingto the results from the three independentexperiments. A comparison of the relativedensities between groups was performedby One way ANOVA and P < 0.05 wasconsidered as significant.

3. RESULTS

3.1. Expression pattern of sprr2members in the uterus duringthe estrous cycle

Expression of eleven sprr2 members(2a, 2b and 2d to 2k) in cycling uteri wasanalyzed by semi-quantitative RT-PCR.Expression of sprr2c was not detectedbecause it was identified as a pseudo-gene [13]. Each PCR was performed withthe optimal cycling numbers to ensurethat the amplification was within the ex-ponential phase (Tab. II). In the uterus,the transcription of sprr2a, 2b, 2e and 2gwas up-regulated at the proestrous and es-trous stages, and 2d only at the estrousstage. However, mRNA of sprr2h, 2i, 2j


Figure 1. Semi-quantitative RT-PCR of various sprr2 members, GTase3 and involucrin in the mouseuterus (U), ovary (O) and vagina (V) at the proestrous (Pro), estrous (Est), metestrous (Met) anddiestrous (Die) stages. Amplification of the gapdh gene was set to monitor the starting quantityof the template cDNA. A negative control was set by amplifying the gapdh gene with total RNAwithout reverse transcription (gapdh-).

and 2k were hardly detectable in the uterusat any stage. The expression of involucrinslightly increased at the metestrous anddiestrous stages, while GTase3 remainedstable throughout the estrous cycle (Fig. 1).

The eleven sprr2 transcripts are simi-lar in sizes and highly homologous [13].Therefore, it is unfeasible to design dis-tinct probes for detecting each member bynorthern blot analysis. The cDNA probesused here were designed according to thecDNA sequences of sprr2a and sprr2fgenes with the length of 579 bp and

308 bp, respectively. Hybridization withthese two probes gave the same signal atabout 1.9 kb, which represented the over-all transcripts of different sprr2 members(Data generated by the sprr2f probe wasnot shown). Surprisingly, the amount ofsprr2 mRNA in the uterus was signifi-cantly higher than that in the footpad whichwas thought to be the typical tissue withCE structure. Statistical analysis showedthat the overall expression of sprr2 mRNAreached a much higher level in the proe-strous and estrous uteri, which was more


Figure 2. Northern blot analysis revealing the overall expression of sprr2 in the mouse uterus (U),ovary (O) and vagina (V) during the estrous cycle. The 579 bp PCR product from sprr2a was usedas a probe here and in FIG4 and FIG6. Pro, proestrus; Est, estrus; Met, metestrust; Die, diestrus.A. The autoradiogram of a representing northern blotting. B. The densitometric analysis of theautoradiogram. The relative amount of sprr2 was normalized by value of gapdh, and statisticalanalysis was performed by ANOVA on the data from three independent experiments. * Comparedwith Die-U, P< 0.05; # compared with Die-V, P < 0.05.

than 4-fold of that in the metestrous or die-strous uteri (Fig. 2).

In situ hybridization was performed toreveal the detailed localization of sprr2mRNA. In the uterus, sprr2 transcriptswere mainly localized in the luminal andglandular epithelial cells, and the signalwas stronger in the proestrus and estrusthan that in the metestrus and diestrus(Fig. 3A), which was inconsistent with theresult of the northern blot analysis.

3.2. Expression pattern of sprr2members in the vagina duringthe estrous cycle

In the vagina, the expression pattern ofsprr2 mRNA was quite different from that

in the uterus. By RT-PCR, the mRNA ofall sprr2 members was detectable exceptfor sprr2g, although the levels of sprr2i,2j and 2k were relatively low. The expres-sion of sprr2a, 2b, 2d, 2e, 2j and 2K wasup-regulated at the metestrus, whereas 2iwas induced at proestrus and estrus. Theexpression of involucrin was repressed atthe estrous stage, while GTase3 exhibitedstable expression during the estrous cy-cle (Fig. 1). Using northern blot analysis,it was shown that the sprr2 mRNA levelstarted to increase at estrus and reacheda plateau at metestrus, then decreased atdiestrus and proestrus. The level of sprr2mRNA in the metestrous vagina was morethan 5-fold of that in diestrus (Fig. 2).

In situ hybridization revealed that thesprr2 transcript was distributed in the


Figure 3. In situ hybridization revealing the localization of sprr2 mRNA in the mouse uterus, vaginaand ovary at the proestrous (Pro), estrous (Est), metestrous (Met) and diestrous (Die) stages. A–D.In the uterus, sprr2 transcripts were mainly localized in the luminal (LE) and glandular (GE) ep-ithelial cells. ST, stromal cells. E–H. In the vagina, sprr2 transcripts were localized in the stratifiedepithelial cells (SE). CN, keratinized layer. I. In the ovary, the granulosa cells (GC) possessed aweak positive signal for sprr2 transcripts. Sense hybridization with the sense RNA probes in theestrous uterus (J), vagina (K) and ovary (L) were set as negative controls. The scale bar represents40 µm.

stratified epithelial cells, and the signal in-tensity was higher at the estrous and mete-strous stages than at the diestrous and proe-strous stages (Fig. 3B), which was similarwith the data of Northern blot analysis.

3.3. Expression pattern of sprr2members in the ovary duringthe estrous cycle

In the ovary, RT-PCR demonstratedthat sprr2a, 2b, 2d, 2f, 2j, involucrin and

GTase3 were expressed at low levels: theexpression of sprr2a, 2d, 2j, involucrin andGTase3 appeared stable during the estrouscycle, 2b increased at estrus, and 2f de-creased at diestrus and metestrus (Fig. 1).The low expression of sprr2 genes in theovary was also proven by northern blotanalysis, in which no signal was found af-ter exposing to X-film for 1 day (Fig. 2),and a very weak signal appeared after7-day exposure to the X-film (data notshown).


Figure 4. The overall expression of sprr2 mRNA in the mouse uterus and placenta during normalpregnancy as revealed by northern blot analysis. A. Autoradiogram of a representing northern blot.B. Densitometric analysis of the autoradiograms. The relative amount of sprr2 was normalized bya value of gapdh, and statistical analysis was performed by ANOVA according to the data fromthree independent experiments. g1, g2, g3, g4, g13 and g20 represent gestational days 1, 2, 3, 4, 13and 20, respectively. Lab1, the first day after labor; i, implantation site; n, non-implantation site; p,placenta; * Compared with the amount in g20, P < 0.05.

In situ hybridization showed that onlythe granulosa cells exhibited very weaksignals for sprr2 hybridization (Fig. 3C).

3.4. The expression pattern of sprr2mRNA in the mouse uterus andplacenta during pregnancy

The expression of sprr2 mRNA in themouse uterus and placenta from gesta-tional day 1 till the first day after laborwas analyzed by northern blot analysis. Inthe uterus, a high level of sprr2 mRNAwas observed on the 1st and 2nd day ofpregnancy. The overall transcription de-creased greatly from the 3rd day on, andremained hardly detectable until the 20thday of pregnancy when the expression was

slightly induced again. On the first day af-ter labor, sprr2 expression retained to therelatively high level which was almost thesame as that on the first day of gestation(Fig. 4).

In the placenta, the sprr2 transcriptswere scarcely detectable during the wholepregnancy period (Fig. 4).

3.5. Regulation of sprr2 expression bysteroid hormones

The ovariectomized mice were used todetermine the effect of steroid hormones onsprr2 expression in the uteri and vaginas.

In the uteri, RT-PCR revealed very weakbasal expressions of sprr2b, 2f and in-volucrin genes. 17β-estradiol (E2) could


Figure 5. Semi-quantitativeRT-PCR demonstrating theregulation of sprr2, GTase3 andinvolucrin expression by steroidhormones in the uterus andvagina of the ovariectomizedmouse. The ovariectomizedmice were treated with vehicle(C), estradiol (E), progesterone(P) or the combination of estra-diol and progesterone (EP) for3 days, and RNA was extractedfrom the uterus (U) and vagina(V).

evidently induce the expression of sprr2a,2b, 2d, 2e, 2f and GTase3 genes, while pro-gesterone inhibited the basal expression ofsprr2b as well as the E2-induced expres-sion of 2b, 2d and 2e genes. Expressionof the involucrin gene was not influencedby either E2 or progesterone (Fig. 5). Bynorthern blot analysis, it was shown thatthe basal expression of overall sprr2 wasalmost undetectable. E2 alone significantlyinduced sprr2 expression, and the effectwas partially abolished by progesterone(Fig. 6).

In the vaginas of the ovariectomizedmice, only sprr2a, GTase3 and involucrin

genes exhibited basal expression. The tran-scriptions of sprr2b, 2d, 2e, 2f, 2g, 2h, 2j,2k and GTase3 genes were evidently in-duced by E2 alone or the combination withE2 and progesterone (Fig. 5) as revealed byRT-PCR. Northern blot analysis revealed alow basal expression of the overall sprr2transcript and its stimulation by E2 aloneor the combination of E2 and progesterone(Fig. 6).

4. DISCUSSION

In this paper, we investigated the ex-pression patterns as well as the hormonal


Figure 6. Northern blot analysis showing the regulation of overall sprr2 mRNA by steroid hormonesin the uterus and vagina of the ovariectomized mouse. The ovariectomized mice were treated withvehicle (C), estradiol (E), progesterone (P) or the combination of estradiol and progesterone (EP)for 3 days, and RNA was extracted from the uteri (U) and vaginas (V). RNA from the estrousuterus (Est-U) was used as a positive control. A. Autoradiogram of a representing northern blot.B. Densitometric analysis of the autoradiograms. The relative amount of sprr2 was normalized byvalue of gapdh, and statistical analysis was performed by ANOVA according to the data from threeindependent experiments. * Compared with C-U, P < 0.05; ** compared with E-U, P < 0.05;# compared with C-V, P < 0.05; ## compared with E-V, P < 0.05.

regulation of sprr2 genes in the femalemouse reproductive system.

The mechanisms involved in the regu-lation of sprr2 members are complicated.There are conserved TATA boxes in thecore promoter of the known sprr2 mem-bers, and AP1 and OCT binding sitesare present in these genes, except sprr2a.However, many other conserved bindingsites are not commonly dispersed, like Etsand kruppel binding sites [10]. The uniquecombination of these regulatory sites al-lows fine adjustment of each sprr2 geneexpression in response to the same or

different signals [14, 20]. Unlike that inthe skin, the transcriptional regulation ofsprr2 members in the reproductive organsis under the control of cycling sex hor-mones as indicated in the present study. Inthe mouse, serum estrogen concentrationreached a peak at the pro-estrous stage,started to drop at the estrous stage, de-creased to the bottom level at the mete-strous stage and increased again at thediestrous stage. Serum progesterone con-centration is low at the proestrous andestrous stages, and high at the diestrousstage [21–23]. The genes up-regulated at


the proestrous and estrous phases may bethe direct or indirect targets of estrogen,and those induced at the metestrous anddiestrous phases may be regulated by pro-gesterone. In the present study, the ex-pression of sprr2a, 2b, 2d and 2e geneswas induced in the proestrous and/or es-trous uterus, and they were proved to beup-regulated by estradiol in the ovariec-tomized mice. Although the uterus, vaginaand ovary are all the targets of steroidhormones, a given sprr2 member man-ifested different expression patterns inthese tissues. For example, sprr2d wasup-regulated in the uterus, while down-regulated in the vagina at the estrousstage, and exhibited no cyclic change inthe ovaries. The phenomenon indicatedthat some tissue-specific regulatory fac-tors might intertwine with the steroid hor-mone signaling and complicate the tran-scriptional regulation of sprr2 genes. Thetissue-specific expression patterns of sprr2genes also suggest that these moleculesmay participate in different events in var-ious tissues. As a matter of fact, thereis squamous epithelium in the vagina, inwhich CE is formed at the estrous stage(data no shown), while only a monolayerepithelium is found in the uterus through-out the estrous cycle.

Since the CE structure does not ex-ist in the cycling uterus, the existence ofsprr2 transcripts in the uterus may indi-cate their functions other than serving asprecursors for CE formation. It was re-ported that the SPRR1 protein played arole in the nucleus and was associatedwith G0 entering of the cell cycle, andSPRR2 expression was reversely related tothe proliferation state in the keratinocyte,partially due to the activation of p27, p21and p16Ink4α [24–27]. Under the effectsof cycling steroid hormones, uterine lu-minal and glandular epithelial cells havehigher mitotic rates at the diestrous andproestrous stages, and undergo apoptosisat the estrous and metestrous stages [28].

Therefore, SPRR2 proteins might partici-pate in the proliferation and apoptosis ofuterine epithelial cells during the estrouscycle. Another possible role for uterineSPRR2 proteins may be anti-stress. Evi-dence has shown that SPRR2 proteins par-ticipate in the response to various stressesin many tissues without a stratified epithe-lium. In the biliary tract, the expressionof SPRR2 members is highly induced un-der stress injury [29]. Similarly, SPRR1Aand SPRR2A are strongly induced in car-diomyocytes responding to biomechan-ical/ischemic stress, and these proteinscould protect cardiomyocytes against is-chemic injury [30]. The SPRR2A proteinwas also reported to be highly inducedin gastric mucosa upon Helicobacter py-lori infection in the human stomach [31].And SPRR genes are activated duringIL-13 mediated immune response in thelung [32]. The female mouse accepts cop-ulation only at the estrous stage, whichwill introduce pathogens to the vagina anduterus; meanwhile, the sperms may causethe changes of the physiological environ-ment in the uterus. These are kinds ofstresses for the mated females, and the up-regulated SPRR2 expression at the estrousstage may be implicated in the stress re-sponse.

The expression of sprr2 in the mouseuterus also changed along with the gesta-tional stages. In the mouse, on the 4th daypostcoitus, the uterus undergoes the trans-formation towards a favorable molecularmilieu for the implanting blastocysts. Thedown-regulated transcription of the sprr2gene from gestational day 3 on might be aprerequisite for “softening” of the uterineendometrium, which would be necessaryfor the adaptive change of the epithelium tosupport the blastocyst implantation and fe-tal growth hereafter. Likewise, the epithe-lial adhesion complex starts to dissociatefrom between 3.5 to 4.5 days of pregnancywith the cleavage of E-cadherin [33]. Inter-estingly, the sprr2 expression was highly


induced around labor. It is known thatthe uterus undergoes shedding and invo-lution during labor, and the uterine ep-ithelial cells may bear much pressure andencounter tough condition. Here, the in-tensive inducement of sprr2 genes mightimply the participation of their encod-ing proteins in the protective adjustmentagainst the labor-associated stress, possi-bly by associating with cytoskeletons andother structural proteins to solidify the cel-lular structure.

Although SPRR2 proteins may partici-pate in CE formation in the estrous vagina,the up-regulation of some sprr2 membersin the metestrous vagina may indicate theiradditional roles. In the ovaries sprr2a, 2b,2d, 2f, 2j as well as involucrin and GTase3were also expressed in granula cells at alow level. Since granulosa cells support thefollicular cavity, the SPRR2 proteins mayalso strengthen these cells against fluidpressure in the cavity. However, these pro-posals remain to be further determined.

In the present study, the expressionpatterns of sprr2 members in the uteruswith a normal steroid-driven estrous cy-cle were not always in parallel with that inthe ovariectomized mouse treated with es-trogen and/or progesterone. For instance,transcription of sprr2f was estrogen-inducible in the uteri of the ovariectomizedmice, whereas a stable level was main-tained in normal uteri throughout the es-trous cycle. This indicated that the mi-lieu in the uterus of the ovariectimizedmouse was different from that in the nor-mal one where the cellular events occurunder the combined control of fluctuatingestrogen, progesterone, LH, FSH as well assome local factors including EGF and IGF,etc. [34–36].

In summary, the expression pattern ofsprr2 genes in the female mouse reproduc-tive system during the estrous cycle andpregnancy was demonstrated. The proteinsencoded by sprr2 genes may participate inresisting the stress onto the uterine epithe-

lia cells during mating and labor. Furtherstudy will be entailed to characterize theirroles in the reproductive events. Amongthe genetic strategies, the knockout modeldoes not seem ideal in that loss-of-functionmutation of one sprr2 gene is very likely tobe compensated for by other members. Ap-plying the siRNA strategy to knockdownall sprr2 genes seems promising by us-ing 21-nucleotides of lentivirus expressinghomologues to transduce the embryo ormature uterus [37, 38].

ACKNOWLEDGEMENTS

The authors gratefully thank Prof. Lin-zhi Zhuang for her critical comments on themanuscript.

REFERENCES

[1] Tan YF, Li FX, Piao YS, Sun XY, WangYL. Global gene profiling analysis ofmouse uterus during the oestrous cycle.Reproduction 2003, 126: 171–182.

[2] Steinert PM. The complexity and redun-dancy of epithelial barrier function. J CellBiol 2000, 151: F5–F8.

[3] Steven AC, Steinert PM. Protein composi-tion of cornified cell envelopes of epidermalkeratinocytes. J Cell Sci 1994, 107: 693–700.

[4] Tarcsa E, Candi E, Kartasova T, Idler WW,Marekov LN, Steinert PM. Structural andtransglutaminase substrate properties of thesmall proline-rich 2 family of cornified cellenvelope proteins. J Biol Chem 1998, 273:23297–23303.

[5] Turksen K, Troy TC. Permeability barrierdysfunction in transgenic mice overexpress-ing claudin 6. Development 2002, 129: 1775-1784.

[6] Matsuki M, Yamashita F, Ishida-YamamotoA, Yamada K, Kinoshita C, Fushiki S,Ueda E, Morishima Y, Tabata K, Yasuno H,Hashida M, Iizuka H, Ikawa M, Okabe M,Kondoh G, Kinoshita T, Takeda J, YamanishiK. Defective stratum corneum and earlyneonatal death in mice lacking the genefor transglutaminase 1 (keratinocyte transg-lutaminase). Proc Natl Acad Sci USA 1998,95: 1044–1049.


[7] Djian P, Easley K, Green H. Targeted ab-lation of the murine involucrin gene. J CellBiol 2000, 151: 381–388.

[8] Koch PJ, de Viragh PA, Scharer E, BundmanD, Longley MA, Bickenbach J, KawachiY, Suga Y, Zhou Z, Huber M, Hohl D,Kartasova T, Jarnik M, Steven AC, RoopDR. Lessons from loricrin-deficient mice:compensatory mechanisms maintaining skinbarrier function in the absence of a majorcornified envelope protein. J Cell Biol 2000,151: 389–400.

[9] Maatta A, DiColandrea T, Groot K, WattFM. Gene targeting of envoplakin, a cy-toskeletal linker protein and precursor of theepidermal cornified envelope. Mol Cell Biol2001, 21: 7047–7053.

[10] Patel S, Kartasova T, Segre JA. Mouse Sprrlocus: a tandem array of coordinately regu-lated genes. Mamm Genome 2003, 14: 140–148.

[11] Reddy SP, Konkin T, Wu R. Structure andorganization of the genes encoding mousesmall proline-rich proteins, mSPRR1A and1B. Gene 1998, 224: 59–66.

[12] Gibbs S, Fijneman R, Wiegant J, vanKessel AG, van De Putte P, Backendorf C.Molecular characterization and evolution ofthe SPRR family of keratinocyte differen-tiation markers encoding small proline-richproteins. Genomics 1993, 16: 630–637.

[13] Song HJ, Poy G, Darwiche N, Lichti U,Kuroki T, Steinert PM, Kartasova T. MouseSprr2 genes: a clustered family of genesshowing differential expression in epithelialtissues. Genomics 1999, 55: 28–42.

[14] Cabral A, Voskamp P, Cleton-Jansen AM,South A, Nizetic D, Backendorf C. Structuralorganization and regulation of the smallproline-rich family of cornified envelope pre-cursors suggest a role in adaptive barrierfunction. J Biol Chem 2001, 276: 19231-19237.

[15] Jetten AM, De Luca LM, Nelson K,Schroeder W, Burlingame S, Fujimoto W.Regulation of cornifin alpha expression inthe vaginal and uterine epithelium by estro-gen and retinoic acid. Mol Cell Endocrinol1996, 123: 7–15.

[16] Nelson JF, Felicio LS, Randall PK, Sims C,Finch CE. A longitudinal study of estrouscyclicity in aging C57BL/6J mice: I. Cyclefrequency, length and vaginal cytology. BiolReprod 1982, 27: 327–339.

[17] Paria BC, Ma W, Tan J, Raja S, Das SK,Dey SK, Hogan BL. Cellular and molecularresponses of the uterus to embryo implanta-tion can be elicited by locally applied growthfactors. Proc Natl Acad Sci USA 2001, 98:1047–1052.

[18] Kurita T, Lee KJ, Cooke PS, Lydon JP,Cunha GR. Paracrine regulation of epithelialprogesterone receptor and lactoferrin by pro-gesterone in the mouse uterus. Biol Reprod2000, 62: 831–838.

[19] Qin L, Wang YL, Bai SX, Ji SH, Qiu W,Tang S, Piao YS. Temporal and spatial ex-pression of integrins and their extracellularmatrix ligands at the maternal-fetal interfacein the rhesus monkey during pregnancy. BiolReprod 2003, 69: 563–571.

[20] Sark MW, Fischer DF, de Meijer E, van DePutte P, Backendorf C. AP-1 and ets tran-scription factors regulate the expression ofthe human SPRR1A keratinocyte terminaldifferentiation marker. J Biol Chem 1998,273: 24683–24692.

[21] Barkley MS, Lasley BL, Thompson MA,Shackleton CH. Equol: a contributor to enig-matic immunoassay measurements of estro-gen. Steroids 1985, 46: 587–608.

[22] Bergman MD, Schachter BS, Karelus K,Combatsiaris EP, Garcia T, Nelson JF. Up-regulation of the uterine estrogen receptorand its messenger ribonucleic acid during themouse estrous cycle: the role of estradiol.Endocrinology 1992, 130: 1923–1930.

[23] Walmer DK, Wrona MA, Hughes CL,Nelson KG. Lactoferrin expression in themouse reproductive tract during the natu-ral estrous cycle: correlation with circulatingestradiol and progesterone. Endocrinology1992, 131: 1458–1466.

[24] Harvat BL, Wang A, Seth P, Jetten AM.Up-regulation of p27Kip1, p21WAF1/Cip1and p16Ink4a is associated with, but notsufficient for, induction of squamous differ-entiation. J Cell Sci 1998, 111: 1185–1196.

[25] Lohman FP, Medema JK, Gibbs S, Ponec M,van De Putte P, Backendorf C. Expression ofthe SPRR cornification genes is differentiallyaffected by carcinogenic transformation. ExpCell Res 1997, 231: 141–148.

[26] Tesfaigzi J, Carlson DM. Expression, reg-ulation, and function of the SPR family ofproteins. A review. Cell Biochem Biophys1999, 30: 243–265.


[27] Tesfaigzi Y, Wright PS, Belinsky SA.SPRR1B overexpression enhances entry ofcells into the G0 phase of the cell cycle. AmJ Physiol Lung Cell Mol Physiol 2003, 285:L889–L898.

[28] Sato T, Fukazawa Y, Kojima H, Enari M,Iguchi T, Ohta Y. Apoptotic cell death duringthe estrous cycle in the rat uterus and vagina.Anat Rec 1997, 248: 76–83.

[29] Nozaki I, Lunz JG, 3rd, Specht S, StolzDB, Taguchi K, Subbotin VM, MuraseN, Demetris AJ. Small proline-rich pro-teins 2 are noncoordinately upregulated byIL-6/STAT3 signaling after bile duct ligation.Lab Invest 2005, 85: 109–123.

[30] Pradervand S, Yasukawa H, Mulle OG,Kjekshus H, Nakamura T, St Amand TR,Yajima T, Matsumura K, Duplain H, IwatateM, Woodard S, Pedrazzini T, Ross J, FirsovD, Rossier BC, Hoshijima M, Chien KR.Small proline-rich protein 1A is a gp130pathway- and stress-inducible cardioprotec-tive protein. Embo J 2004, 23: 4517–4525.

[31] Mueller A, O’Rourke J, Grimm J, GuilleminK, Dixon MF, Lee A, Falkow S. Distinctgene expression profiles characterize thehistopathological stages of disease inHelicobacter-induced mucosa-associatedlymphoid tissue lymphoma. Proc Natl AcadSci USA 2003, 100: 1292–1297.

[32] Finkelman FD, Yang M, Perkins C, SchleiferK, Sproles A, Santeliz J, Bernstein JA,Rothenberg ME, Morris SC, Wills-Karp M.Suppressive effect of IL-4 on IL-13-inducedgenes in mouse lung. J Immunol 2005, 174:4630–4638.

[33] Potter SW, Gaza G, Morris JE. Estradiol in-duces E-cadherin degradation in mouse uter-ine epithelium during the estrous cycle andearly pregnancy. J Cell Physiol 1996, 169:1–14.

[34] Hull KL, Harvey S. Growth hormone: rolesin female reproduction. J Endocrinol 2001,168: 1–23.

[35] Leung PC, Steele GL. Intracellular signalingin the gonads. Endocr Rev 1992, 13: 476–498.

[36] Wang HS, Chard T. IGFs and IGF-bindingproteins in the regulation of human ovar-ian and endometrial function. J Endocrinol1999, 161: 1–13.

[37] Kunath T, Gish G, Lickert H, Jones N,Pawson T, Rossant J. Transgenic RNA in-terference in ES cell-derived embryos re-capitulates a genetic null phenotype. NatBiotechnol 2003, 21: 559–561.

[38] Tiscornia G, Singer O, Ikawa M, Verma IM.A general method for gene knockdown inmice by using lentiviral vectors expressingsmall interfering RNA. Proc Natl Acad SciUSA 2003, 100: 1844–1848.

To access this journal online:www.edpsciences.org/rnd

gene expression pattern and hormonal regulation of small ......200 ng /mice /day, group e),...

Documents