geminivirus replication origins have a modular · pdf filegeminivirus replication origins have...

The Plant Cell, Vol. 6, 405-416, March 1994 O 1994 American Society of Plant Physiologists

Geminivirus Replication Origins Have a Modular Organization

Elizabeth P. B. Fontes,ai‘ Heather J. Gladfelter,a Reenah L. Schaffer,bi2 lan T. D. Petty,b and Linda Hanley-Bowdoin a Department of Biochemistry, P.O. Box 7622, North Carolina State University, Raleigh, North Carolina 27695-7622

Department of Microbiology, North Carolina State University, Raleigh, North Carolina 27695-7615

Tomato golden mosaic virus (TGMV) and bean golden mosaic virus (BGMV) are closely related geminiviruses with bipartite genomes. The A and B DNA components of each virus have cis-acting sequences necessary for replication, and their A components encode trans-acting factors required for this process. We showed that virus-specific interactions between the cis- and trans-acting functions are required for TGMV and BGMV replication in tobacco protoplasts. We also demonstrated that, similar to the essential TGMV AL1 replication protein, BGMV AL1 binds specifically to its origin in vitro and that neither TGMV nor BGMV AL1 proteins bind to the heterologous origin. The in vitro AL1 binding specificities of the B components were exchanged by site-directed mutagenesis, but the resulting mutants were not replicated by either A component. These results showed that the high-affinity AL1 binding site is necessary but not sufficient for virus-specific origin activity in vivo. Geminivirus genomes also contain a stem-loop sequence that is required for origin function. A BGMV B mutant with the TGMV stem-loop sequence was replicated by BGMV A, indicating that BGMV AL1 does not discriminate between the two sequences. A BGMV B double mutant, with the TGMV AL1 binding site and stem- loop sequences, was not replicated by either A component, indicating that an additional element in the TGMV origin is required for productive interaction with TGMV AL1. These results suggested that geminivirus replication origins are composed of at least three functional modules: (1) a putative stem-loop structure that is required for replication but does not contribute to virus-specific recognition of the origin, (2) a specific high-affinity binding site for the AL1 protein, and (3) at least one additional element that contributes to specific origin recognition by viral trans-acting factors.

INTRODUCTION

The geminiviruses are a large and diverse family of plant- infecting viruses that share a unique particle structure of fused incomplete icosahedra and have genomes comprised of circular, single-stranded DNA (reviewed by Stanley, 1991; Lazarowitz, 1992). Their genomes replicate via double-stranded DNA intermediates that are transcribed in the nuclei of infected plant cells. Geminiviruses encode only a few proteins necessary for their replication and transcription and depend largely on host factors to mediate these processes. Consequently, geminiviruses are excellent model systems for investigating both DNA replication and transcription in plant cells.

The geminivirus family can be divided into four subgroups defined by their biological properties (Harrison, 1985) and molecular genetics. One of the largest subgroups comprises the whitefly-transmitted geminiviruses that infect dicotyledonous plants and have bipartite genomes (Haber et al., 1981). Their

genomes are composed of two -2.6-kb DNA components, designated A and 6, that are dissimilar in sequence except for a highly conserved common region of approximately 200 nucleotides. The common region is located in a 5’ intergenic region on both DNA components and includes replication (Revington et al., 1989; Lazarowitz et al., 1992) and transcription (Townsend et al., 1985; Hanley-Bowdoin et al., 1988; Sunter et al., 1989) signals. The common region also contains a GC- rich inverted repeat that could form a cruciform or stem-loop structure. (In this study, “stem-loop” refers to the sequence and potential secondary structure, whose existence has not yet been demonstrated.) An invariant AT-rich sequence, 5‘-TAA- TATTAC, in the loop is found in all geminivirus genomes. Mu- tations that either disrupt the invariant sequence or partially delete the GC-rich stem sequence prevent replication in vivo (Revington et al., 1989; Lazarowitz et al., 1992).

The A component of bipartite genome geminiviruses en- codes all of the viral proteins required for replication and encapsidation (Rogers et ai,, 1986; Townsend et 1986;

tions necessary for the spread of infection in plants (Brough et al., 1988; Etessami et al., 1988). Two genes, AL7 and AL3,

Current address: Department of Biochemistry, BIOAGRO-CTQ, Universidade Federal de Vicosa, 36570.000 Vicosa MG, Brazil.

University, Raleigh, NC 27695-8008. 2 Current address: Department of Forestry, NOrth Carolina State Sunter et 1987), whereas the component contributes func-

To whorn correspondence should be addressed.

406 The Plant Cell

on the A component encode viral proteins involved in replication. The only viral protein essential for replication is AL1 (Elmer et al., 1988; Hayes and Buck, 1989; Hanley-Bowdoin et al., 1990), but AL3 is necessary for efficient accumulation of viral DNA in plants (Elmer et al., 1988) and in protoplasts (Sunter et al., 1990). There is strong amino acid sequence and functional conservation among the AL1 and AL3 proteins encoded by geminiviruses with bipartite genomes (Howarth and Vandemark, 1989; Etessami et al., 1991; Lazarowitz et al., 1992). This conservation also extends to the AL1 homologs encoded by geminiviruses with a single genome component (Mullineaux et al., 1985; Accotto et al., 1989; Lazarowitz et al., 1989; Schalk et al., 1989; Stanley et al., 1992).

Three independent lines of evidence show that geminiviruses reproduce their circular, single-stranded DNA genomes by a rolling circle replication mechanism analogous to some prokaryotic viruses and plasmids. First, the nucleotide sequences of beet curly top virus genomes generated from recombinant heterodimers are consistent with rolling circle replication that initiatesherminates (+) strand DNA synthesis within the stem-loop sequence (Stenger et al., 1991). This pos- siblity is further supported by studies of African cassava mosaic virus (ACMV) and wheat dwarf virus (Etessami et al., 1989; Heyraud et al., 1993). Second, the intracellular DNAforms that accumulate during ACMV infection correspond to rolling circle replication intermediates (Saunders et al., 1991). Third, geminivirus AL1 proteins contain three amino acid sequence motifs that are related to consensus motifs found in the replication initiator proteins of two bacterial plasmid families (Koonin and Ilyina, 1992) and in the gene A protein of bacteriophage (pX174 (Ilyina and Koonin, 1992). These prokaryotic proteins introduce a sequence-specific nick in the (+) strand to initi- atekerminate rolling circle replication. The AL1 protein may serve the same function in geminivirus replication. AL3 does not show homology to any proteins involved in rolling circle replication, and the mechanism whereby AL3 acts as a geminivirus replication accessory factor is unknown.

In spite of the strong functional conservation between the trans-acting replication factors encoded by bipartite genome geminiviruses, these proteins can show specificity for replication of their cognate genomes. The A and B genome components are usually only infectious on plants when both are derived from the same geminivirus. Studies carried out with squash leaf curl virus (SqLCV) and tomato golden mosaic virus (TGMV) revealed that incompatibility between the B component replication origin and frans-acting replication factors encoded by the A component can be responsible for the failure of heterologous DNA components to produce a viable infection (Lazarowitz et al., 1992). These studies also showed that an approximately 90-nucleotide fragment, which includes the stem-loop sequence and 60 nucleotides from the AL7-proximal (left) side of the SqLCV common region, contains the replication origin and the determinant(s) required for specific recognition of the origin by AL1 in vivo. An analogous fragment of the TGMV common region contains the minimal replication origin for this virus (H.J. Gladfelter and

L. Hanley-Bowdoin, manuscript in preparation). Thus, SqLCV and TGMV display exclusive origin recognition, but the region(s) of the replication origins that mediates specific recognition and the mechanisms by which specificity is achieved have not been elucidated. Other studies that established that TGMV AL1 binds specifically to a directly repeated sequence on the left side of the TGMVcommon region in vitro (Fontes et al., 1992, 1994) suggest a possible mechanism for virus-specific, replication origin recognition.

In this study, we showed that TGMV and another closely related geminivirus, bean golden mosaic virus (BGMV), also exhibit strict specificity in the interactions between the cis- and trans-acting factors required for their replication in vivo. Using this system, we examined the role that AL1 plays in specific recognition of the origin, both in vitro and in vivo. The results of this investigation suggested that geminivirus replication origins consist of at least three functional modules.

RES U LTS

TGMV and BGMV DNA B Components Are Replicated Selectively by Their Homologous A Components in Tobacco Cells

To establish an experimental system for investigating the determinants of geminivirus replication specificity, it was first necessary to identify two closely related viruses that show selective replication of their homologous origins. Comparison of the nucleotide sequences of TGMV and BGMV revealed that these viruses are closely related (Howarth et al., 1985). However, it was not known whether TGMV and BGMV display selectivity in the interaction between the cis- and trans-acting factors required for their replication. It was also not known if BGMV can replicate in the tobacco cell lines used in TGMV transfection systems (Sunter et al., 1990; Brough et al., 1992; H.J. Gladfelter and L. Hanley-Bowdoin, manuscript in preparation).

To address these questions, partial tandem copies of TGMV A and B or BGMVA and B were introduced by electroporation into protoplasts derived from tobacco suspension cells and assayed for their capacity to replicate autonomously (A components) or in combination with the homologous component (6 components), as shown in Figure 1. Recombinant DNAs containing partial tandem repeats of geminivirus genomes support the release and replication of unit-length, circular viral DNA in plant cells. Total DNA was isolated after a 48-hr cul- ture period and analyzed by DNA gel blot hybridization by sequentially probing with virus-specific radiolabeled DNAs un- der conditions that prevented cross-hybridization between TGMV and BGMV DNA sequences. Cross-hybridization between the A and B components of the same virus was prevented by excluding common region sequences from the probes. Prior to DNA gel blot analysis, replicon DNA was linearized, and the samples were treated with Dpnl, which

Geminivirus Replication Origins 407

TGMVA + - + + - - - -TGMVB - + + - - - - +BGMVA - - - - + - + +BGMVB - - - + - + + -

TGMVA

Ids-

ss-

TGMVB

ds-

ss-

BGMVA

ds-

ss-

BGMVB

ds-

ss-

1 2 3 4 5 6 7 8

Figure 1. Virus-Specific Interactions between the c/s- and frans-ActingFunctions Required for TGMV and BGMV Replication.

Plasmids containing partial tandem copies of TGMV A, TGMV B, BGMVA, and BGMV B were electroporated into tobacco protoplasts in thecombinations indicated at the top. Transfection of a given DNA is

only digests dam-methylated, input plasmid DNA. Newlysynthesized, double-stranded DNA was identified by its resis-tance to Dpnl digestion and by length (2.6 versus 6 kb for inputDNA). The identity of newly synthesized, single-stranded DNAwas confirmed by its sensitivity to mung bean nuclease diges-tion (data not shown). Double- and single-stranded forms ofreplicated viral DNA were readily detected for TGMV A (Fig-ure 1, lanes 1, 3, and 4) and BGMV A (lanes 5, 7, and 8) eitherin the presence or the absence of the homologous B compo-nent. In contrast, TGMV B only replicated in the presence ofTGMV A (Figure 1, cf. lanes 2 and 3), while BGMV B only repli-cated in the presence of BGMV A (cf. lanes 6 and 7). Theseresults established that BGMV is able to replicate efficientlyin tobacco cells and that, similar to TGMV A (Rogers et al.,1986; Hayes and Buck, 1989), BGMV A provides all of the vi-ral frans-acting factors required for replication.

The capacity of TGMV and BGMV A components to repli-cate the heterologous B components was examined incotransfection experiments shown in Figure 1. No replicationof BGMV B was detected in the presence of TGMV A (lane4) or of TGMV B in the presence of BGMV A (lane 8). Replica-tion of the heterologous A components in the same samples(Figure 1, lanes 4 and 8) and of the B components in the pres-ence of their homologous A component (lanes 3 and 7)indicated that the protoplasts were competent for viral replica-tion. Thus, the TGMV- and BGMV-encoded replication factorsdisplayed a high degree of specificity for their respective ori-gins, making these two closely related viruses an ideal systemfor investigating the molecular basis of replication specificityin common host cells.

TGMV and BGMV AL1 Proteins Bind Specifically toTheir Cognate Origins of Replication in Vitro

We demonstrated previously that TGMV AL1 specifically bindsto a DNA sequence on the left side of the TGMV common re-gion (Fontes et al., 1992) and more recently that this high-affinitybinding site is essential for TGMV replication in tobacco cells(Fontes et al., 1994). The TGMV and BGMV AL1 proteins arefunctionally equivalent, suggesting that BGMV AL1 may spe-cifically bind to sequences in the BGMV common region. Thishypothesis was tested using an in vitro immunoprecipitationDNA binding assay devised for TGMV AL1 (Fontesetal., 1992).

indicated by a (+), whereas the absence of a given DNA is indicatedby a (-). The transfected DNAs (20 ng of each) were pTG1.3A (lane1), pTG1.4B(lane2), pTG1.3A + pTG1.46 (lane 3), pTG1.3A + pGA1.2B(lane 4), pGA1.2A (lane 5), pGA1.2B (lane 6), pGA1.2A + pGA1.2B(lane 7), and pGA1.2A + pTG1.4B (lane 8). Total DNA was isolated 2days post-transfection, digested with Dpnl and Xhol (lane 1), Dpnl andBglll (lanes 2, 5 to 8), or Dpnl, Xhol, and Bglll (lanes 3 and 4). Thedigested DNA was resolved on an agarose gel and analyzed by DNAhybridization using 32P-labeled probes specific for the viral DNAs in-dicated on the left. Double-stranded (ds) and single-stranded (ss) formsof the viral DNAs are marked.

408 The Plant Cell

1 2 3

AL1 - -43

-30

BCompetitor DMAs

TGMV B - -BGMV B - -TGMV B-B1 - -BGMV B-T1 - -

AL1 protein

TGMV

BGMV

1 2 3 4 5 6 7

Figure 2. In Vitro DMA Binding by TGMV and BGMV AL1 Proteins.

(A) AL1 proteins were immunoprecipitated using a monoclonal anti-body raised against TGMV AL1 and rabbit anti-mouse IgG beads. Theimmunoprecipitated proteins were analyzed by SDS-PAGE followedby immunoblotting using a rabbit polyclonal antibody raised againstTGMV ALL Immunoprecipitates from total soluble protein extracts ofrecombinant baculovirus-infected Sf9 cells expressing TGMV AL1 (25ng, lane 1), healthy beans (0.5 mg, lane 2), or BGMV-infected beans(0.5 mg, lane 3) are shown. Molecular mass markers are given at rightin kilodaltons.(B) Immunoprecipitation assays were used to examine the binding ofTGMV or BGMV AL1 proteins to their respective common regions, asindicated on the left, in the presence of 50-fold molar excesses of thecompetitor DMAs indicated by (+) at the top. A (-) indicates the ab-sence of a competitor DMA. TGMV AL1 from recombinantbaculovirus-infected insect cells or BGMV AL1 from infected beanswas included in the binding reactions in lanes 2 to 6. The TGMV Bcommon region probe was a 3' end-labeled, 370-bp Ndel-Clal frag-ment from pTG0.4B (TGMV, lane 1). The BGMV B probe was a 3'end-labeled, 489-bp BamHI-Hindlll fragment from pGA0.2B (BGMV,lane 1). The probe DMAs were not immunoprecipitated prior to elec-trophoresis in lane 1 (TGMV and BGMV). In lane 2, the binding reactionscontained AL1 protein and its homologous probe DNA in the absenceof competitor DNA. The competitor DMAs in lanes 3 to 6 were a 370-bp Ndel-Clal fragment from pTG0.4B (lane 3), a 489-bp BamHI-Hindlllfragment from pGA0.2B (lane 4), a 368-bp Ndel-Clal fragment of pTGB-B1 (lane 5), or a 491-bp BamHI-Hindlll fragment from pGAB-T1 (lane6). Control extracts were incubated with probe DNA and electrophoresed

Prior to the binding studies, it was necessary to confirm thata monoclonal antibody raised against TGMV AL1 was able tocross-react efficiently with BGMV ALL Protein extracts fromleaves of healthy and BGMV-infected bean plants wereimmunoprecipitated using a TGMV AL1-specific monoclonalantibody. The precipitated proteins were resolved by SDS-PAGE and detected by immunoblotting using a polyclonal an-tiserum raised against TGMV AL1, as shown in Figure 2A. Boththe monoclonal and polyclonal antibodies cross-reacted witha protein from BGMV-infected plants (Figure 2A, lane 3). Threelines of evidence indicated that this protein is BGMV AL1. First,the protein is approximately 40 kD, which is the size predictedby the BGMV AL1 open reading frame. Second, the BGMVprotein comigrated with the TGMV AL1 protein produced inrecombinant baculovirus-infected insect cells (Figure 2A, lane1). Third, no cross-reacting material was detected in proteinextracts from healthy beans (lane 2), indicating that the pro-tein is specific to BGMV-infected plants.

The TGMV AL1 monoclonal antibody was then used to im-munoprecipitate TGMV AL1 from recombinant baculovirus-infected insect cell extracts and BGMV AL1 from infected beanextracts. The immunocomplexes were incubated with 3' radio-labeled fragments containing either the TGMV B or the BGMVB common region (Figure 2B, lane 1), and the bound DNA waseluted and resolved on denaturing gels. TGMV AL1 bound tothe TGMV common region probe (TGMV; Figure 2B, lane 2),and binding was prevented by competition with a 50-fold mo-lar excess of the unlabeled homologous probe (TGMV; lane3). Similarly, BGMV AL1 bound to the BGMV common regionprobe (BGMV; Figure 2B, lane 2), and binding was preventedby competition with a 50-fold molar excess of the unlabeledhomologous probe (BGMV; lane 4). In contrast, neither TGMVAL1 binding to the TGMV common region (TGMV; lane 4) norBGMV AL1 binding to the BGMV common region (BGMV; lane3) was prevented by competition with a 50-fold molar excessof the heterologous common region DNA. Control extracts lack-ing the AL1 proteins from recombinant baculovirus-infectedinsect cells expressing p-galactosidase (TGMV; Figure 2B, lane7) or from healthy beans (BGMV; lane 7) did not bind to thecommon region probes. These results demonstrated that thetwo AL1 proteins bind specifically to their respective commonregions and are unable to interact with the heterologous com-mon region in vitro. The conditions used to wash theimmunocomplexes after DNA binding were stringent (Fonteset al., 1992), indicating that both AL1 proteins bind to their rec-ognition sequences with high affinity.

To define the BGMV AL1 recognition sequence, site-directedmutagenesis was used to exchange the known TGMV AL1 bind-ing site with the BGMV AL1 binding site predicted by nucleotidesequence alignment and vice versa, as shown in Figure 3A.In the mutant TGMV B-B1, the TGMV B common region was

in lanes 7. The TGMV control extract was from recombinant baculovirus-infected insect cells expressing p-galactosidase, and the BGMV con-trol extract was from healthy bean leaves.


A - - TGMV B-B1 T A T C . M ~ a c ~ C T C T . T A T A T A T T A G A A G T T C C T A A G G G G ................... CACGTGGCGGCCATCC~~MTATTACCGGATGGCCGCGCGAT

TGMV B T A T G . M T T ~ T M ~ C T C T . T A T A T A T T A G A A G T T C C T A A G G G G ................... CACGTGGCGGCtATCCmrrMTATTACCGGATGGCCGCGC~T

BCMV B TATCCAA~~ACAATATATACTAGTA.CCCTCAATCTCGTCAATTATCAGA~CACACACGTGGCGGCCATCCGATATMTATTACCGGATGGCCGCGCGCC

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . ......................................... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .........................................

BCMV B - T 1 T A T G C A A T T ~ t a o ~ A C A A T A T A T A C T A G T A . C C C T C A A T C T C G T ~ T T A T ~ ~ T T C A C A C A C ~ G G C G G C C A T C C G A T A T M T A T T A C C G ~ T G G C C G C G C G C C

BCMV B-T14 TATGCM'TT~too~ACAATATATACTAGTA.CCCTCAATCTCGTGAATTATATCAGATTCACACACGTGGCGGCCATCCGtTtTAATATTACCGGATGGCCGCGCGCC BCMV B-T4 T A T G C M - C A C M T A T A T A C T A G T A . CCCTCAATCTCGTGAATTATCAGATTCACACACGTGGCGGC~TCCGtTt~MTATTACCGGATGGCCGCGCGCC

B I I -

TGMV ACAAAAGTTA. . T A T G . A A T T m . T M a C T C T T A T A T A T T - 23 BGMV T C A A A C T C T C G C T A T G C A A W . . A C T B A C A A T A T A T A C T - 40

AbMV TCAAACTTGCTC.ATGTA~T.ATTGGACGTCTllATATACT - 3 1

BOMV T C A A A A C T A T C T C A T T C T m . m T A C l l A T A T A C r - 30

BGMV-BZ TCAAAACTCr.CTATG.AATCGGIGT.AAT~C.CAATAAATAGT - 3 1

WMV TCAAAACTCT. . T A T G . A A w n C l T A T A T A G T - 28

SqLCV TCAACmCTCATATT.. G C T C T A T A T A T A C C - 41

ToMoV T C A A A C l l C . C T C A T T C A A l l ~ T T A ~ C T T A T A T A T A - 4 1

Figure 3. Comparison of the TGMV and BGMV AL1 Binding Sites with Other New World Geminivirus DNA Sequences

(A) The DNA sequences from TGMV 6, BGMV B, or their mutant derivatives are shown. The ALI binding site, putative stem-loop, and intervening sequence of TGMV B are compared to the equivalent region of BGMV 6. The colons mark nucleotides that are conserved between the TGMV B (nucleotide positions 64 to 157) and BGMV B (nucleotide positions 77 to 188) sequences. The repeated elements of the TGMV ALI binding site and the equivalent sequences for BGMV are underlined. The inverted repeats that form the putative stem-loop structure are marked by bars above the sequences. Mutations that alter the TGMV AL1 binding site to match BGMV (Bl) or the predicted BGMV ALI binding site to match TGMV (TI) are shown by lowercase letters or by a dash for deleted bases. Mutations that alter the BGMV loop sequence to the TGMV loop sequence (T4) are also shown in lowercase letters. In BGMV BT14, the mutations of the BGMV ALI binding site and loop sequence to TGMV sequences are combined. Gaps introduced to maximize the sequence alignments are marked by dots. (B) Sequences from the TGMV and BGMV B common regions were compared to sequences on the left of the common regions of other bipartite geminiviruses from the New World. The sequences were aligned using the predicted TATA box sequences (long bar) for transcription to the left. Directly repeated elements are underlined, and conserved GG motifs are marked by short bars. The numbers on the right are the distance in nucleotides to the stem-loop sequence for each virus. The viruses and their GenBank accession numbers are TGMV (K02030), BGMV (M91605), abutilon mosaic virus (AbMV; X15984), bean dwarf mosaic virus (BDMV; M88180), BGMV-Brazil (-BZ; M88687), potato yellow mosaic virus (PYMV; D00941), SqLCV (M63158), and tomato mottle virus (ToMoV; M90494).

modified at five positions to change the TGMV AL1 binding site to the predicted BGMVALl binding site. In mutant BGMV BT1, the BGMV B common region was also altered at five positions to change the predicted BGMVALl binding site to that for TGMV ALI. Restriction fragments containing these mutated common regions were used in 50-fold molar excess as com- petitors for AL1 binding to wild-type common region probes in vitro (Figure 28). The TGMV B-B1 mutant did not compete for TGMV AL1 binding to the wild-type TGMV common region (TGMV; Figure 28, lane 5), while BGMV BT1 DNA was an efficient competitor for TGMV AL1 binding (TGMV; lane 6). Conversely, the BGMV BT1 mutant was unable to compete for BGMV AL1 binding to the wild-type BGMV common region (BGMV; Figure 2B, lane 6), while TGMV B-B1 DNA was an efficient competitor for BGMV AL1 binding (BGMV; lane 5). Thus, the introduced mutations altered the in vitro binding specificities of the common region fragments such that TGMV B-B1 is bound by BGMV AL1 and BGMV BT1 is bound by TGMV AL1. These data demonstrated that the recognition sequence

required for high-affinity binding of BGMV AL1 to the BGMV common region contains the repeated motif 5'-TGGAGAC- TGGAG, which is analogous to the TGMV AL1 binding site 5I-GGTAGTAAGGTAG (Fontes et al., 1994). It is possible that the BGMV AL1 recognition sequence includes additional 5' sequences, because the BGMV and TGMV B common regions are identical at seven of eight positions immediately upstream of the repeated motif (Figure 3A).

The HighAffinity AL1 Binding Site 1s Necessary but Not Sufficient for Specific Geminivirus Origin Recognition

The in vitro DNA binding experiments established that the TGMV and BGMV AL1 proteins recognize related, but distinct, high-affinity binding sites. The failure of either AL1 protein to support the replication of a heterologous B component may be due to the inability of AL1 to bind to the heterologous

410 The Plant Cell

common region, resulting in the replication specificity observedin vivo. To test this hypothesis, we took advantage of the switchin AL1 binding specificity exhibited by the TGMV B-B1 andBGMV B-T1 mutants. Plasmids containing partial tandem cop-ies of the mutant B components were cotransfected with eachof the wild-type A components into tobacco protoplasts andassayed for replication by DNA hybridization, as shown in Fig-ure 4. Consistent with their altered AL1 binding specificitiesin vitro, TGMV B-B1 failed to replicate in the presence TGMVA (Figure 4, lane 3; TGMV B probe), and no replication ofBGMV B-T1 was detected in the presence of BGMV A (lane8; BGMV B probe). However, TGMV B-B1 also failed to repli-cate in the presence of BGMV A (lane 7; TGMV B probe), eventhough BGMV AL1 binds to TGMV B-B1 in vitro. Similarly,BGMV B-T1 did not replicate in the presence of TGMV A (Fig-ure 4, lane 4; BGMV B probe), even though TGMV AL1 bindsto BGMV B-T1 in vitro. Both A components retained the ca-pacity to replicate their homologous, wild-type B components(Figure 4, lane 1, TGMV B probe; lane 6, BGMV B probe). Inaddition, accumulation of TGMV A (lanes 1 to 4) or BGMV A(lanes 5 to 8) was detected in all samples, indicating that theprotoplasts were competent for geminivirus replication.

These results showed that mutation of the high-affinity AL1binding site prevented replication by the homologous AL1 pro-tein, confirming the importance of this site. However, transferof the in vitro AL1 binding specificity was not sufficient to cre-ate a functional replication origin for the nonhomologous AL1protein. These results established that specific binding of AL1to its high-affinity site in the common region is necessary forthe replication of two different geminiviruses and, thus, con-tributes to the specificity of geminivirus origin recognition.Nevertheless, because transfer of the high-affinity AL1 bind-ing site alone does not result in productive interaction betweenAL1 and the mutant origin, additional determinants of speci-ficity must be required for geminivirus origin function.

Nonconserved Nucleotides in the Putative Stem-LoopDo Not Mediate the Specific Interaction betweenfrans-Acting Replication Factors and the Origin

Lazarowitz et al. (1992) suggested that nonconserved nucleo-tides in the loop sequence of the stem-loop might beresponsible for the specificity of interaction between AL1 andits cognate replication origin. The stem sequences of TGMVand BGMV are identical, whereas their loop sequences differat only two nucleotide positions (Figure 3A). To directly assessthe role of these variant nucleotides in replication, site-directedmutagenesis was used to alter the loop sequence of wild-typeBGMV B to that found in TGMV B, resulting in a mutant desig-nated BGMV B-T4. The loop mutations were also introducedinto the BGMV B-T1 mutant, which contains the high-affinitybinding site for TGMV AL1, to generate a double mutant desig-nated BGMV B-T14. Plasmids containing partial tandem copiesof these mutant B components were cotransfected into tobaccocells with each of the wild-type A components and assayed

TGMV ATGMVBTGMV B-B1BGMV ABGMVBBGMV B-T1

TGMV A

TGMVB

fflHM^^I»

BGMV A

BGMVB

1 2 3 4 5 6 7 8

Figure 4. Replication Analysis of the AL1 Binding Site Mutants.

Plasmids containing partial tandem copies of TGMV A, TGMV B, TGMVB-B1 (binding site mutant), BGMV A, BGMV B, and BGMV B-T1 (bind-ing site mutant) were electroporated into tobacco protoplasts asindicated at the top. Transfection of a given DNA is indicated by a (+),while the absence of a given DNA is indicated by a (-). In lanes 1to 4, the transfected DMAs (20 ng of each) were pTG1.3A plus eitherpTG1.4B (lane 1), pGA1.2B (lane 2), pTG1.3B-B1 (lane 3), or pGA1.2B-T1 (lane 4). In lanes 5 to 8, the transfected DMAs were pGA1.2A pluspTG1.4B (lane 5), pGA1.2B (lane 6), pTG1.4B-B1 (lane 7), or pGA1.2B-T1 (lane 8). Total DNA was isolated 2 days post-transfection and digestedwith Dpnl, Xhol, and Bglll (lanes 1 to 4) or Dpnl and Bglll (lanes 5to 8). The digested DNA was resolved on an agarose gel and ana-lyzed by DNA hybridization using 32P-labeled probes specific for theviral DNAs indicated on the left. Double-stranded forms of replicatedviral DNA are shown.

for replication by DNA gel blot analysis, as shown in Figure5. The loop mutant BGMV B-T4 was replicated by BGMV A (Fig-ure 5, lane 7; BGMV B probe), but not by TGMV A (lane 3;BGMV B probe), as was wild-type BGMV B (lanes 2 and 6;BGMV B probe). In contrast, no replication of the double mu-tant BGMV B-T14 was detected in the presence of either TGMVA (Figure 5, lane 4) or BGMV A (lane 8). DNA gel blot analysisof TGMV A (Figure 5, lanes 1 to 4; TGMV A probe), BGMVA (lanes 5 to 8; BGMV A probe), and TGMV B (lanes 1 and4; TGMV B probe) verified that the protoplasts were compe-tent for geminivirus replication. These results demonstrated


that the loop sequence does not contribute significantly to theability of BGMV AL1 to specifically recognize the BGMV ori-gin of replication. In addition, because the double mutantBGMV B-T14 does not replicate in the presence of TGMV AL1,the combination of the cognate high-affinity AL1 binding siteand the wild-type TGMV loop sequence was not sufficient toconfer TGMV replication specificity on the BGMV origin.

DISCUSSION

Although the geminiviruses TGMV and BGMV are closelyrelated, we showed that they exhibit strict specificity in the in-teractions between the c/s- and frans-acting factors necessary

TGMV A + + + + - - - -TGMVB + . . - + - - -BGMVA . . . . + + + +BGMV B . + . - - + - -BGMVB-T4 - - + - - - + -BGMVB-T14 - - - + - - - +

TGMV A

TGMVB

BGMV A

BGMVB

1 2 3 4 5 6 7 8

Figure 5. Replication Analysis of the BGMV Loop Sequence Mutants.Plasmids containing partial tandem copies of TGMV A, TGMV B, BGMVA, BGMV B, BGMV B-T4 (loop mutant), and BGMV B-T14 (binding siteand loop mutant) were electroporated into tobacco protoplasts as in-dicated at the top. Transfection of a given DMA is indicated by a (+),while the absence of a given DMA is indicated by a (-). In lanes 1to 4, the transfected DMAs (20 ng of each) were pTG1.3A plus pTG1.4B(lane 1), pGA1.2B (lane 2), pGA1.2B-T4 (lane 3), or pGA1.2B-T14 (lane4). In lanes 5 to 8, the transfected DMAs were pGA1.2A plus pTG1.4B(lane 5), pGA1.2B (lane 6), pGA1.2B-T4 (lane 7), or pGA1.2B-T14 (lane8). Total DNA was isolated 2 days post-transfection and digested withDpnl, Xhol, and Bglll (lanes 1 to 4) or Dpnl and Bglll (lanes 5 to 8).The digested DNA was resolved on an agarose gel and analyzed byDNA hybridization using 32P-labeled probes specific for the viral DNAsindicated on the left. Double-stranded forms of replicated viral DNAare shown.

for their replication in vivo. One mechanism that might medi-ate this specificity is sequence-specific binding of AL1 to itsorigin. This type of interaction governs origin recognition ofthe rolling circle replicons in the pT181 plasmid family (Wanget al., 1993) and probably the filamentous bacteriophages M13and IKe (Peelers et al., 1986). We demonstrated previously thatTGMV AL1 binds with high affinity to a site in the TGMV com-mon region (Fontes et al., 1992) and recently located thisbinding site on a directly repeated motif near the left edge ofthe minimal origin of replication (Fontes et al., 1994). In thisstudy, we showed that BGMV AL1 also binds specifically toits common region in vitro. Furthermore, BGMV AL1 did notbind to the TGMV common region, and TGMV AL1 did notrecognize the BGMV common region.

Alignment of the common region sequences from variousbipartite genome geminiviruses revealed that they frequentlycontain a directly repeated motif with conserved GG dinucleo-tides in an analogous position to the TGMV AL1 high-affinitybinding site (see Figure 3B). We used this alignment to iden-tify the likely binding site for BGMV AL1 in the BGMV commonregion and constructed two B component mutants in whichthe binding site sequences were exchanged between BGMVand TGMV. The BGMV B-T1 mutant contains the TGMV AL1high-affinity binding site in a wild-type BGMV common regionbackground, and the TGMV B-B1 mutant contains the predictedBGMV AL1 high-affinity binding site in a wild-type TGMV com-mon region background. We found that the in vitro AL1 bindingspecificities of the mutant common regions were reversed rel-ative to their wild-type parents, i.e., BGMV B-T1 boundspecifically to TGMV AL1, and TGMV B-B1 bound specificallyto BGMV ALL These results confirmed that the TGMV se-quence 5'-GGTAGTAAGGTAG and the analogous BGMVsequence 5'-TGGAGACTGGAG determine the binding spe-cificity for the cognate AL1 protein.

The success of our nucleotide sequence alignment inpredicting the AL1 recognition motif for BGMV AL1 suggestedthat the related, directly repeated sequences observed in othergeminivirus genomes also constitute high-affinity binding sitesfor their respective AL1 proteins (Figure 3B). The sequenceheterogeneity of the predicted binding sites in differentgeminiviruses makes it likely that AL1 proteins recognize theirorigins in a highly specific manner. This suggestion is consis-tent with recent findings that the TGMV and abutilon mosaicvirus A components are also unable to support replication ofthe heterologous B component (Frischmuth et al., 1993). Simi-lar results were also obtained with TGMV and the Old Worldgeminivirus ACMV (Frischmuth et al., 1993).

We have shown previously by site-directed mutagenesis thatthe high-affinity AL1 binding site forms an essential elementof the TGMV replication origin (Fontes et al., 1994). This ob-servation raised the possibility that the AL1 recognition motifis the sole determinant of origin recognition specificity. To testthis hypothesis, B component mutants, which have their in vitroAL1 binding specificities exchanged (TGMV B-B1 and BGMVB-T1), were analyzed for their ability to undergo DNA replica-tion in tobacco protoplasts. Neither of the mutant B components

412 The Plant Cell

was replicated in the presence of either TGMV A or BGMV A. This lack of replication cannot be attributed to a nonspecific loss of replication competence by the mutant B components, because both mutants can replicate in the presence of chi- meric AL1 proteins (E.P.B. Fontes, H.J. Gladfelter, I.T.D. Petty, and L. Hanley-Bowdoin, manuscript in preparation). Thus, as previously shown for TGMV, the BGMV high-affinity AL1 binding site is an essential element of its replication origin (BGMV BT1 is not replicated by BGMV A). However, because neither of the mutant origins was replicated by the ALI protein to which it bound efficiently in vitro, additional elements of the replication origin must be involved in specific interaction(s) with viral trans-acting factors in vivo.

Lazarowitz et al. (1992) suggested that nonconsetved nucleotides in the loop of the stem-loop sequence in the common region may be responsible for discrimination of the TGMV and SqLCV origins by their respective AL1 proteins. The loop sequences of the TGMV and BGMV B components are also distinct (Figure 3A) and therefore might have a role in origin recognition specificity in vivo. To test this hypothesis, we used site-directed mutagenesis to substitute the TGMV loop sequence into a wild-type BGMV common region background. The resulting mutant, BGMV BT4, was able to replicate in the presence of BGMV A, but not in the presence of TGMV A. Thus, variation in the putative loop sequence did not contribute to the ability of BGMV AL1 to discriminate between the BGMV and TGMV replication origins. The TGMV loop sequence was also substituted into the mutant BGMV BT1, which already contains the TGMV AL1 high-affinity binding site in the BGMV common region. The resulting double mutant, BGMV 6714, had the same phenotype as its BGMV BT1 parent; i.e., it was unable to replicate in the presence of either the BGMV or TGMV A component. Because the high-affinity AL1 binding site and stem-loop essentially delimit the TGMV minimal origin of replication (H.J. Gladfelter and L. Hanley-Bowdoin, manuscript in preparation), it is likely that additional determinants required for replication of the origin by TGMV-encoded, trans-acting factors are located between these two elements.

The replication assays with BGMV, TGMV, and their mutant derivatives were all performed in tobacco cells so that the specificity of origin recognition could not be mediated by host factors. However, because the source of viral frans-acting factors in these experiments was always a wild-type A component, a possible contribution of the accessory replication protein AL3 to origin recognition specificity cannot formally be excluded. Because the mutants with reversed in vitro ALI binding specificities cannot be replicated by either of the A components in vivo, we can infer that if AL3 has any role in specific origin recognition, it is unable to act in the absence of the appropri- ate AL1 binding site. Although AL3 is not essential for TGMV replication, viral DNA accumulation is reduced m50-fold in its absence (Sunter et al., 1990). Consequently, if a specific interaction between AL3 and the origin is disrupted in the mutants, viral DNA accumulation might fall below detectable levels. Two other factors could exacerbate this problem. First, TGMV AL1 negatively regulates its own synthesis (Sunter et

al., 1993), and DNA replication may be limited by the supply of AL1. Second, the replication origin of the A component that supplies the trans-acting factors is wild type in character, and it is in direct competition for AL1 with the mutant B component origin being assayed. To address these potential limitations of the replication assay, we are currently pursuing experiments in which the viral frans-acting factors are supplied from non- replicating expression cassettes.

The results presented here extend our understanding of the structure and function of geminivirus replication origins and represent an important step toward using these viruses to char- acterize the nuclear DNA replication processes of higher plants. By combining our results with those of previous studies, we can now propose that the replication origins of TGMV, BGMV, and related geminiviruses are modular in structure. Modular organization is also associated with the (+) strand origins of bacterial plasmids (de Ia Campa et al., 1990) and parvoviruses (Snyder et al., 1993; Tam and Astell, 1993) and with the chromosomal origins of yeast (Marahrens and Stillman, 1992). The geminivirus minimal origin contains at least three functional elements, and, by analogy with other viral and plasmid systems, there may also be as yet unidentified replication enhancer elements that lie outside the minimal origin (DePamphilis, 1988; Gennaro, 1993). The three elements of the geminivirus minimal origin, shown schematically in Figure 6, are (1) a high-

invariant sequence a ATA A T - r i i p n

spacer

1 0 0 0 0

AL1 second specificity ,nickingr binding determinant

virus-specific recognition

Figure 6. Modular Organization of a Geminivirus Origin of Replication.

A schematic drawing of the functional domains of a geminivirus origin of replication is shown. The relative locations of the ALI binding site (hatched box) and the stem-loop motif in the origin are indicated. The invariant sequence and the AT-rich spacer motif in the loop are marked. The limits of the DNA sequence that contains the probable nick site for initiation of rolling circle replication mapped by Etessami et al. (1989), Stenger et al. (1991), and Heyraud et al. (1993) are shown (A). Other sites in the origin that may be involved in additional interactions with viral replication proteins are illustrated by the open boxes. Sites that may function in a sequence-specific manner are marked by the large open rectangle, whereas specific interactions that may be mediated by differential spacing are indicated by the small open boxes.


affinity binding site for the AL1 protein that is located on the left side of the origin, (2) the putative stem-loop structure that delimits the right side of the origin and contains the invariant sequence 5'-TAATATTAC, and (3) an intervening sequence that contains at least one element that must interact specifically with viral frans-acting factors for replication to occur in vivo.

The high-affinity AL1 binding sites are essential for function of both the TGMV and BGMV replication origins, probably because they promote the recruitment of AL1 to the origin. Sequence-specific interaction between AL1 and the origin also contributes to the ability of geminivirus trans-acting factors to discriminate between the origins of closely related viruses. The integrity of the putative stem-loop is essential for replication, but the variant AT residues preceding the invariant 5'-TAA- TATTAC sequence in the loop apparently do not contribute to the specificity of origin recognition. This arrangement is reminiscent of the AT-rich spacer adjacent to the nick site in the (+) strand origin of bacteriophage (pX174 in which nucleotide substitutions can be tolerated without compromising replication (Heidekamp et al., 1981). The existence of an additional element that contributes to origin recognition was inferred from the inability of the TGMV A component to replicate a BGMV mutant that carries both the high-affinity AL1 binding site and the stem-loop sequence of TGMV. The sequences of the two origins differ in the region between these elements, and the BGMV origin contains 19 additional nucleotides compared to that of TGMV (Figure 3A). Consequently, the additional interactions with viral proteins required for origin function may be mediated by sequence specificity, differential spacing, or some combination of both, as has been observed for the (+) strand origins of the pT181 plasmid family (Wang et al., 1993). Experiments designed to distinguish between these possibil- ities for the geminivirus origins are currently in progress.

METHODS

Plasmid Constructs and Site-Dlrected Mutagenesis

The position numbers used to describe the following clones refer to the nucleotide coordinates of the tomato golden mosaic virus (TGMV) sequence determined by Hamilton et al. (1984), as corrected by MacDowell et al. (1986), von Arnim and Stanley (1992), and Schaffer (1992). The corrected size of full-length TGMV DNA B is 2525 bp. The coordinates for bean golden mosaic virus (BGMV) refer to the sequence of the Guatemalan isolate (BGMV-GA) determined by J.C. Faria, R.L. Gilbertson, F.J. Morales, !? Ahlquist, and D.P. Maxwell (personal com- munication, University of Wisconsin, Madison; GenBank accession number M91605). In these numbering schemes, the common regions of both viruses are delimited by positions 1 to 210.

The construction of recombinant plasmids containing partial tandem repeats of the A or B components of TGMV and BGMV has been described previously by Schaffer (1992). Briefly, plasmids pBH401 (Bisaro et al., 1982) and pBH604 (Hamilton et al., 1983), which contain single copies of TGMV A or B DNA, respectively, were used to subclone fragments that included the TGMV A or B common region

into pZfl9U (Mead et al., 1986). The plasmid pTG0.3A contains the 736- bp EcoRI-Xhol fragment from pBH401, while pTGOAB contains the 939- bp Bglll-Clal fragment from pBH604. Partial tandem copies of TGMV A and B were generated by insertion of the 2588-bp EcoRl fragment from pBH401 into EcoRI-digested pTG0.3A and of the 2525-bp Clal fragment from pBH604 into Clal-digested pTG0.4B. The resulting plasmids pTGl.3A and pTG1.48 contained 1.3 copies of TGMV DNA A or 1.4 copies of TGMV DNA 8, respectively, and had duplicated common regions.

The plasmids pGAAl and pGAB1, which contain a single copy of the A or B genome components of BGMV-GA, respectively, have been described previously by Gilbertson et al. (1991). The 634-bp Bglll-Hindlll fragment from pGAA1 was subcloned into pZfl9U to give pGAO.PA, which contains the BGMV A common region and flanking sequences. Similarly, the 489-bp BamHI-Hindlll fragment from pGABl was subcloned into pZfl9U to give pGAO.PB, which contains the BGMV B common region and flanking sequences. A partial tandem copy of BGMV A was constructed by releasing the 2647-bp EcoRl fragment from pGAA1, circularizing it in vitro, followed by linearization with Spel, and inserting it into the Spel site of pGAO.2A. A partial tandem copy of BGMV B was generated by inserting the 2596-bp BamHl fragment of pGABl into BamHI-digested pGAO.2B. The resulting plasmids pGAl.2A and pGA1.28 contained 1.2 copies of BGMV DNA A or 1.2 copies of BGMV DNA B, respectively, and had duplicated common regions.

Mutations were introduced into the common regions of plasmids containing a single copy of TGMV B (pTGB1) or BGMV B (pGAB1) using dU-containing, single-stranded DNA templates (Kunkel, 1985), as described previously (Petty et al., 1989). The plasmid pTGBl was made by inserting the 2525-bp Clal fragment from pBH604 into the Clal site of pBluescript II KS+ (Stratagene). The TGMV B common region was modified at TGMV B positions 74, 77 to 79, and 82 using the primer WGTTATATGAATTGGAGACTGGAGCTCTTATATATTAG-3' to create pTGB-B1 (TGMV B-B1, Figure 3A). The BGMV B common region was modified at positions 87, 90 to 92, and 94 using the primer 5'- CGCTATGCAATTGGrAGlAAGCZACXACAATATATAC-3' to create pGAB- T1 (BGMV BT1, Figure 3A), and at positions 161 and 163 using the primer 5'-CACGTGGCGGCCATCCCZTTTAATATTACCGG-3' to create pGABT4 (BGMV BT4, Figure 3A). The T4 mutation was subsequently introduced into pGABT1 to generate the double mutant pGABT14. All mutations were verified by DNA sequencing. A subclone of pTGB-B1, which contains the common region, was created by digestion with BamHI. The resulting plasmid, pTGO.3B-B1, contained the 848-bp BamHI-Clal fragment of TGMV B-81. A partial tandem copy of TGMV B-B1 was generated by inserting the 2523-bp Clal fragment of pTGB- B1 into Clal-digested pTGO.3B-Bl. Partial tandem copies of BGMV BT1, BGMV BT4, and BGMV BT14 were constructed from pGABT1, pGABT4, and pGABT14, respectively, as described above for wild- type BGMV DNA B. The resulting plasmids, pTG1.38-81, pGA1.2BT1, pGA1.2BT4, and pGA1.2BT14, contained duplicated, mutant common regions.

lsolation and lmmunoprecipitation of AL1 Protein

Bean plants (Pbaseolus vulgaris cv Top Crop) were infected with BGMV- GA bysap transmission. Systemically infected leaf tissue or the equivalent from uninoculated control plants was harvested 12 days postinfection and used to prepare whole-cell protein extracts, as described previously by Hanley-Bowdoin et al. (1990). Whole-cell protein extracts were also prepared from healthy beans and from recombinant

414 The Plant Cell

baculovirus-infected Spodopfem frugiperda Sf9 cells expressing TGMV AL1 or b-galactosidase (Fontes et al., 1992).

AL1 protein was immunoprecipitated from 5 mg of plant cell extract or 25 pg of insect cell extract using 20 pg of an AL1-specific monoclo- na1 antibody (Fontes et al., 1992) and 20 pg of rabbit anti-mouse IgG coupled to Sepharose beads (Harlow and Lane, 1988). The immunocomplexes were fractionated by SDS-PAGE and analyzed by immunoblotting using a rabbit polyclonal antibody raised against ALI (Hanley-Bowdoin et al., 1990) and the enhanced chemiluminescence protein detection system (Amersham). Alternatively, the immunoprecipitated AL1 protein was resuspended in binding buffer for DNA binding assays.

DNA Binding Assays

DNA binding assays were performed as described by Fontes et al. (1992). The immunocomplexes were incubated with 1 nM of radiolabeled probe DNA (-60,000 cpm) in the absence or presence of 50 nM competitor DNA. Bound DNA was extracted from the DNA/ALl immunocomplexes using phenol-CHC13-isoamyl alcohol and visualized on denaturing, 6% polyacrylamide gels. Probe and competitor DNAs were prepared by restriction enzyme digestion followed by fraction- ation on agarose gels and purification by glass adhesion (Vogelstein and Gillespie, 1979). A 370-bp Ndel-Clal fragment from pTG0.46, which includes the wild-type TGMV B common region and flanking sequences, and a489-bp BamHI-Hindlll fragment from pGA0.2B, which includes the wild-type BGMV B common region and flanking sequences, were radiolabeled using a-=P-dATP and the Klenow fragment of DNA poly- merase I from Escherichia co/i(Sambrook et al., 1989); these fragments were used as probes in DNA binding experiments. Competitor DNAs were isolated by Ndel-Clal digestion of pTG0.46 (wild-type TGMV B) and pTGB-B1 (mutant TGMV 8-61) and by BamHI-Hindlll digestion of pGAO.26 (wild-type BGMV B) and pGABT1 (mutant BGMV BT1).

Replication Assays

Protoplasts were prepared from the Nicotiana tabacum suspension cell line NT-1 and cultured in NT-1 medium supplemented with 0.2 mg/mL 2,4-dichlorophenoxyacetic acid (An, 1985). The protoplasts were isolated by digestion with 1% cellulase, 0.1% pectolyase Y30.4 M mannitol, 20 mM 2-(N-morpholino)ethanesulfonic acid, pH 5.5; washed twice with 0.4 M mannitol, pH 5.5; and resuspended in 0.8% NaCI, 0.020/0 KCI, 0.02% KH2P04, 0.11Vo Na2HP04, 0.4 M mannitol, pH 6.5. Repli- cation assays were performed by electroporation (250 V, 500 pF) of 20 pg of each replicon DNA and 30 pg of sheared salmon sperm DNA into 5.0 x 106 protoplasts. Protoplasts were diluted into 8 mL of NT-1 medium supplemented with 0.2 mg/mL 2,4-dichlorophenoxyacetic acid and 0.4 M mannitol. Total DNA was isolated from the protoplasts 48 hr after transfection (Junghans and Metzlaff, 1990), digested with Xhol- Dpnl (TGMV A) or Bglll-Dpnl (TGMV B, BGMV A, and BGMV B), resolved on 1% agarose gels, and vacuum transferred and UV cross- linked to nylon membranes (MagnaGraph; MSI, Westboro. MA). The blots were analyzed by DNA gel blot hybridization according the protocol of Thomashow et al. (1980), except that 0.2% sodium pyrophosphate was included in all solutions. Virus- and component-specific probes were randomly labeled using U-~'P-~ATP and the Klenow fragment (Sambrook et al., 1989). The probes were a 1.8-kb Xhol-EcoRI fragment from TGMV A, a 2.1-kb Pstl fragment from TGMV B, a 1.4-kb Scal-Bglll fragment from BGMVA, and a 1.6-kb Hindlll fragment from BGMV B.

ACKNOWLEDGMENTS

We thank Doug Maxwell and his colleagues (University of Wisconsin, Madison) for generously providing the plasmids pGAAl and pGAB1 and complete nucleotide sequence data for BGMV-GA prior to publi- cation. We also thank Verne Luckow (Monsanto Company, St. Louis, MO) for production of TGMV ALI in recombinant baculovirus-infected insect cells and Keith Everett for oligonucleotide synthesis. We thank Ron Sederoff (Forestry, North Carolina State University) for critical reading of the manuscript. BGMV-infected beans were maintained in the South Eastern Plant Environment Laboratory (Phytotron) at North Caro- lina State University. We are indebted to Daniel Bowdoin for the photography. This work was supported in part by National Science Foundation Grant No. DMB-9104150 to L.H.43. and in part by Public Health Service Grant No. GM-48067 to I.T.D.P. E.P.B.F. was supported by a Conselho Nacional de Desenvolvimento Cientifico e Technoldgico postdoctoral fellowship from the Brazilian Government.

Received October 19, 1993; accepted January 11, 1994.

REFERENCES

Accotto, G.P., Donson, J., and Mullineaux, P.M. (1989). Mapping of Digitaria streak virus transcripts reveals different RNA species from the same transcription unit. EMBO J. 8, 1033-1039.

An, G. (1985). High efficiency transformation of cultured tobacco cells. Plant Physiol. 79, 568-570.

Bisaro, D.M., Hamilton, W.D.O., Coutts, R.H.A., and Buck, K.W. (1982). Molecular cloning and characterization of the two DNA components of tomato golden mosaic virus. Nucl. Acids Res. 10,

Brough,C.L.,Hayes, R.J., Morgan,A.J.,Coutts, R.H.A.,andBuck, K.W. (1988). Effects of mutagenesis in vitro on the ability of cloned tomato golden mosaic virus DNA to infect Nicotiana benthamiana plants. J. Gen. Virol. 69, 503-514.

Brough, C.L., Sunter, G., Gardiner, W.E., and Bisaro, D.M. (1992). Kinetics of tomato golden mosaic virus DNA replication and coat protein promoter activity in Nicotiana tabacum protoplasts. Virology

de Ia Campa, A.G., de1 Solar, G.H., and Espinosa, M. (1990). Initia- tion of replication of plasmid pLS1: The initiator protein RepB acts on two distant DNA regions. J. MOI. Biol. 213, 247-262.

DePamphilis, M.L. (1988). Transcriptional elements as components of eukaryotic origins of DNA replication. Cell 52, 635-638.

Elmer, J.S., Brand, L., Sunter, G., Gardiner, W.E.,'Bisaro, D.M., and Rogers, S.G. (1988). Genetic analysis of the tomato golden mosaic virus. 11. The product of the AL1 coding sequence is required for replication. Nucl. Acids Res. 16, 7043-7060.

Etessami, P., Callis, R., Ellwood, S., and Stanley, J. (1988). Delimi- tation of essential genes of cassava latent virus DNA 2. Nucl. Acids Res. 16, 4811-4829.

Etessami, P., Watts, J., and Stanley, J. (1989). Size reversion of Afri- can cassava mosaic virus coat protein gene deletion mutants during infection of Nicotiana benthamiana. J. Gen. Virol. 70, 277-289.

4913-4922.

187, 1-9.


Etessami, P., Saunders, K., Watts, J., and Stanley, J. (1991). Muta- tional analysis of complementary-sense genes of African cassava mosaic virus DNA A. J. Gen. Virol. 72, 1005-1012.

Fontes, E.P.B., Luckow, V.A., and Hanley-Bowdoin, L. (1992). A geminivirus replication protein is a sequence-specific DNA binding protein. Plant Cell 4, 597-608.

Fontes, E.P.B., Eagle, P.A., Sipe, P., Luckow, V.A., and Hanley- Bowdoin, L. (1994). lnteraction between a geminivirus replication protein and origin DNA is essential for viral replication. J. Biol. Chem. 269, in press.

Frischmuth, T., Roberts, S., von Arnlm, A., and Stanley, J. (1993). Specificity of bipartite geminivirus movement proteins. Virology 196,

Gennaro, M.L. (1993). Genetic evidence for replication enhancement from a distance. Proc. Natl. Acad. Sci. USA 90, 5529-5533.

Gilbertson, R.L., Faria, J.C., Hanson, S.F., Morales, F.J., Ahlquist, P., Maxwell, D.P., and Russell, D.R. (1991). Cloning of the complete DNA genomes of four bean-infecting geminiviruses and determining their infectivity by electric discharge particle accelera- tion. Phytopathology 81, 980-985.

Haber, S., Ikegami, M., Bajet, N.B., and Goodman, R.M. (1981). Evi- dente for a divided genome in bean golden mosaic virus, a geminivirus. Nature 289, 324-326.

Hamilton, W.D.O., Bisaro, D.M., Coutts, R.H.A., and Buck, K.W. (1983). Demonstration of the bipartite nature of the genome of a single-stranded DNA plant virus by infection with the cloned DNA components. Nucl. Acids Res. li, 7387-7396.

Hamilton, W.D.O., Stein, V.E., Coutts, R.H.A., and Buck, K.W. (1984). Complete nucleotide sequence of the infectious cloned DNA components of tomato golden mosaic virus: Potential coding regions and regulatory sequences. EMBO J. 3, 2197-2205.

Hanley-Bowdoin, L., Elmer, J.S., and Rogers, S.G. (1988). Transient expression of heterologous RNAs using tomato golden mosaic virus. Nucl. Acids Res. 16, 10511-10528.

Hanley-Bowdoin, L., Elmer, J.S., and Rogers, S.G. (1990). Expres- sion of functional replication protein from tomato golden mosaic virus in transgenic tobacco plants. Proc. Natl. Acad. Sci. USA 87,

Harlow, E., and Lane, D. (1988). Antibodies, a Laboratory Manual. (Cold Spring Harbor, NY Cold Spring Harbor Laboratory Press).

Harrison, B.D. (1985). Advances in geminivirus research. Annu. Rev. Phytopathol. 23, 55-82.

Hayes, R.J., and Buck, K.W. (1989). Replication of tomatogolden mosaic virus DNA B in transgenic plants expressing open reading frames (ORFs) of DNA A: Requirement for ORF AL2 for production of single-stranded DNA. Nucl. Acids Res. 17, 10213-10222.

Heidekamp, F., Baas, P.D., van Boom, J.H., Veeneman, G.H., Zipursky, S.L., and Jansz, H.S. (1981). Construction and characterization of recombinant plasmid DNAs containing sequences of the origin of bacteriophage X174 DNA replication. Nucl. Acids Res. 9, 3335-3354.

Heyraud, F., Maitzeit, V., Kammann, M., Schaefer, S., Schell, J., and Gronenborn, B. (1993) ldentification of the initiation sequence for viral-strand DNA synthesis of wheat dwarf virus. EMBO J. 12,

Howarth, A.J., and Vandemark, G. (1989). Phylogeny ofgeminiviruses. J. Gen. Virol. 70, 2717-2727.

Howarth, A.J., Caton, J., Bossert, M., and Goodman, R.M. (1985). Nucleotide sequence of bean golden mosaic virus and a model for

666-673.

1446-1450.

4445-4452.

gene regulation in geminiviruses. Proc. Natl. Acad. Sci. USA 82,

Ilyina, T.V., and Koonin, E.V. (1992). Conserved sequence motifs in the initiator proteins for rolling circle DNA replication encoded by diverse replicons from eubacteria, eucaryotes and archasbacteria. Nucl. Acids Res. 20, 3279-3285.

Junghans, H., and Metzlaff, M. (1990). A simple and rapid method for the preparation of total plant DNA. BioTechniques 8, 176.

Koonin, E.V., and Ilyina, T.V. (1992). Geminivirus replication proteins are related to prokaryotic plasmid rolling circle DNA replication initiator proteins. J. Gen. Virol. 73, 2763-2766.

Kunkel, T.A. (1985). Rapid and efficientsite-specific mutagenesis without phenotypic selection. Proc. Natl. Acad. Sci. USA 82,482-492.

Lazarowitz, S. (1992). Geminiviruses: Genome structure and gene function. Crit. Rev. Plant Sci. 11, 327-349.

Lazarowitz, S.G., Pinder, A.J., Damsteegt, V.D., and Rogers, S.G. (1989). Maize streak virus genes essential for systemic spread and symptom development. EMBO J. 8, 1023-1032.

Lazarowitz, S.G., Wu, L.C., Rogers, S.G., and Elmer, J.S. (1992). Sequence-specific interaction with the viral ALI protein identifies a geminivirus DNA replication origin. Plant Cell 4, 799-809.

MacDowell,S.W., Coutts, R.H.A., and Buck, K.W. (1986). Molecular characterization of subgenomic single-stranded and double-stranded DNAforms isolated from plants infected with tomato golden mosaic virus. Nucl. Acids Res. 14, 7967-7984.

Marahrens, Y., and Stillman, B. (1992). A yeast chromosomal origin of DNA replication defined by multiple functional elements. Science

Mead, D.A., Szczesna-Skorupa, E., and Kemper, B. (1986). Single- stranded DNA 'blue' T7 promoter plasmids: A versatile tandem promoter system for cloning and protein engineering. Protein Eng. l , 67-74.

Mullineaux, P.M., Donson, J., Stanley, J., Boulton, M.I., Morris- Krisinich, B.A.M., Markham, P.G., and Davies, J.W. (1985). Com- puter analysis identifies sequence homologies between potential gene products of maize streak virus and those of cassava latent virus and tomato golden mosaic virus. Plant MOI. Biol. 5, 125-131.

Peeters, B.P.H., Schoenmakers, J.G.G., and Konings, R.N.H. (1986). The gene II proteins of the filamentous phages IKe and Ff (M13, fd, and fl) are not functionally interchangeable during viral strand replication. Nucl. Acids Res. 14, 5067-5079.

Petty, I.T.D., Hunter, B.G., Wei, N., and Jackson, A.O. (1989). Infec- tious barley stripe mosaic virus RNA transcribed in vitro from full-length genomic cDNA clones. Virology I7l, 342-349.

Revington, G.N., Sunter, G., and Bisam, D.M. (1989). DNAsequences essential for replication of the B genome component of tomato golden mosaic virus. Plant Cell 1, 985-992.

Rogers, S.G., Bisaro, D.M., Horsch, R.B., Fraley, R.T., Hoffman, N.L., Brand, L., Elmer, J.S., and Lloyd, A.M. (1986). Tomatogolden mosaic virus A component DNA replicates autonomously in transgenic plants. Cell 45, 593-600.

Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989). Molecular Clon- ing: A Laboratory Manual. (Cold Spring Harbor, NY Cold Spring Harbor Laboratory Press).

Saunders, K., Lucy, A., and Stanley, J. (1991). DNA forms of the geminivirus African cassava mosaic virus consistent with a rolling circle mechanism of replication. Nucl. Acids Res. 19, 2325-2330.

Schaffer, R.L. (1992). Host range determination of geminiviruses. M.S. Thesis (Raleigh: North Carolina State University).

3572-3576.

255, 817-823.

416 The Plant Cell

Schalk, H.J., Matzeit, V., Schiller, B., Schell, J., and Gronenborn, B. (1989). Wheat dwarf virus, a geminivirus of graminaceous plants, needs splicing for replication. EMBO J. 8, 359-364.

Snyder, R.O., Im, DA., Ni, T., Xiao, X., Samulski, R.J., and Muzyczka, N. (1993). Features of the adeno-associated virus origin involved in substrate recognition by the viral Rep protein. J. Virol.

Stanley, J. (1991) The molecular determinam of geminivirus patho- genesis. Seminars Virol. 2, 139-149.

Stanley, J., Latham, J.R., Pinner, M.S., Bedford, I., and Markham, P.G. (1992). Mutational analysis of the monopartite geminivirus beet curly top virus. Virology 191, 396-405.

Stenger, D.C., Revington, G.N., Stevenson, M.C., and Bisaro, D.M. (1991). Replicational release of geminivirus genomes from tandemly repeated copies: Evidence for rolling-circle replication of a plant viral DNA. Proc. Natl. Acad. Sci. USA 88, 8029-8033.

Sunter, G., Gardiner, W.E., Rushing, A.E., Rogers, S.G., and Bisaro, D.M. (1987). lndependent encapsidation of tomato golden mosaic virus A component DNA in transgenic plants. Plant MOI. Biol. 8,

Sunter, G., Gardiner, W.E., and Bisaro, D.M. (1989). ldentification of tomato golden mosaic virus-specific RNAs in infected plants. Virol-

Sunter, G., Hartitz, M.D., Hormuzdi, S.G., Brough, C.L., and Bisaro, D.M. (1990). Genetic analysis of tomato golden mosaic virus: ORF AL2 is required for coat protein accumulation while ORFAL3 is necessary for efficient DNA replication. Virology 179, 69-77.

67, 6096-6104.

477-404.

Ogy 170, 243-250.

Sunter, G., Hartitz, M.D., and Bisaro, D.M. (1993). Tomato golden mosaic virus leftward gene expression: Autoregulation of geminivirus replication protein. Virology 195, 275-280.

Tam, P., and Astell, C.R. (1993). Replication of minute virus of mice minigenomes: Nove1 replication elements required for MVM DNA replication. Virology 193, 812-824.

Thomashow, M.F., Nutter, R., Montoya, A.L., Gordon, M.P., and Nester, E.W. (1980). lntegration and organization of Ti plasmid sequences in crown gall tumors. Cell 19, 729-739.

Townsend, R., Stanley, J., Curson, S.J., and Short; M.N. (1985). Major polyadenylated transcripts of cassava latent virus and loca- tion of the gene encoding coat protein. EMBO J. 4, 33-37.

Townsend, R., Watts, J., and Stanley, J. (1986). Synthesis of viral DNA forms in Nicotiana plumbaginifolia protoplasts inoculated with cassava latent virus (CLV): Evidence for the independent replication of one component of the CLV genome. Nucl. Acids Res. 14,

Vogelstein, B., and Gillespie, D. (1979). Preparative and analytical purification of DNA from agarose. Proc. Natl. Acad. Sci. USA 76,

von Arnim, A., and Stanley, J. (1992). Determinants of tomato golden mosaic virus symptom development located on DNA 6. Virology 186,

Wang, P.Z., Projan, S.J., Henriquez, V., and Novick, R.P. (1993). Ori- gir! recognition specificity in pTl8l plasmids is determined by a functionally asymmetric palindromic DNA element. EMBO J. 12,

1253-1265.

615-619.

286-293.

45-52.

DOI 10.1105/tpc.6.3.405 1994;6;405-416Plant Cell

E P Fontes, H J Gladfelter, R L Schaffer, I T Petty and L Hanley-BowdoinGeminivirus replication origins have a modular organization.

This information is current as of May 11, 2018

Permissions 298X

https://www.copyright.com/ccc/openurl.do?sid=pd_hw1532298X&issn=1532298X&WT.mc_id=pd_hw1532

eTOCs http://www.plantcell.org/cgi/alerts/ctmain

Sign up for eTOCs at:

CiteTrack Alerts http://www.plantcell.org/cgi/alerts/ctmain

Sign up for CiteTrack Alerts at:

Subscription Information http://www.aspb.org/publications/subscriptions.cfm

is available at:Plant Physiology and The Plant CellSubscription Information for

ADVANCING THE SCIENCE OF PLANT BIOLOGY © American Society of Plant Biologists

https://www.copyright.com/ccc/openurl.do?sid=pd_hw1532298X&issn=1532298X&WT.mc_id=pd_hw1532298X

https://www.copyright.com/ccc/openurl.do?sid=pd_hw1532298X&issn=1532298X&WT.mc_id=pd_hw1532298X

http://www.plantcell.org/cgi/alerts/ctmain

http://www.plantcell.org/cgi/alerts/ctmain

http://www.aspb.org/publications/subscriptions.cfm

geminivirus replication origins have a modular · pdf filegeminivirus replication origins have...

Documents