gaggle analysis tools

8/8/2019 Gaggle Analysis Tools

http://slidepdf.com/reader/full/gaggle-analysis-tools 1/25

SUPPLEMENTARY TEXT.

Systems analysis with the Gaggle

mRNA level changes were analyzed simultaneously with gene/protein functional

associations [operons (Moreno-Hagelsieb and Collado-Vides 2002), phylogenetic profile

(Pellegrini et al. 1999), chromosomal proximity (Overbeek et al. 1999)], physical

interactions [protein-DNA interactions (Facciotti etal, submitted)], putative functions in

the SBEAMS database (http://halo.systemsbiology.net) (Bonneau et al. 2004) along with

supporting evidence such as matches in protein databank [PDB (Sussman et al. 1998)],

protein families [Pfam (Bateman et al. 2000), COG database (Tatusov et al. 2000)] and

metabolic pathways [KEGG (Kanehisa 2002)]. Further, data were extracted into sub-

matrices using custom filters, normalized and statistically analyzed using the R statistical

package (http://www.r-project.org) and TIGR microarray expression viewer [TMeV

(Saeed et al. 2003)]. Given the size and heterogeneity of data and software, we used the

Gaggle framework (http://gaggle.systemsbiology.net) (Shannon et al, accepted in BMC

Bioinformatics) to facilitate analyses and queries. The Gaggle is an open source Java

software framework for seamless desktop integration of diverse databases and software

applications.

Specifically, all genes were visualized in Cytoscape (Shannon et al. 2003) as

networks of nodes (genes) and edges (functional associations). The genes were

organized into various function categories and node color was mapped to mRNA level

changes (red for increased and green for decreased mRNA) (Johnson etal, submitted,

Shannon etal, submitted); and node size was mapped to statistical significance (λ) (Baliga

et al. 2004; Shannon et al. 2003). With this visualization scheme significant changes

(genes appearing as large red or green nodes) in various function categories become

immediately evident. This also enabled assignment of putative function to genes of

previously unknown function by retrieving matching records in SBEAMS, Pfam, PDB,

COG, and KEGG. Function assignments were further confirmed with orthogonal sources

of information such as expression correlation and functional associations to genes of

known function (Bonneau et al. 2004) (ST2).



Physiological reconstruction

Deletion of individual subunits of multi-component ABC transporters does not

effect any change in metal sensitivity

Multi-subunit ATP-binding cassette (ABC) transporters mediate active transport of

sugars, ions, peptides, and oligonucleotides (Schneider and Hunke 1998). At least 50

genes of this function category were differentially regulated in one or more metal (ST2).

To evaluate whether these transporters play a role in metal resistance, we selected

subunits of four ABC transport systems for further analysis on basis of both their putative

functions and their differential regulation. While three of these genes, phoX , appA, and

ycdH , encode subunits of transport systems for PO42-

, peptides, and Mn(II), respectively,

the other two, fepC and VNG2562H , are both putative subunits of the same Fe(II)

transport system. Each gene deletion strain was then assayed for altered growth

characteristics in varying concentrations of selected metals. Absence of defective growth

phenotypes of these strains initially suggested that ABC transporters may not contribute

towards metal resistance (ST3). However, given that numerous ABC transport systems

were differentially regulated in each metal, we cannot rule out that loss of function of

individual subunits in one might be complemented by subunits of other related transport

systems.

Responses of metalloenzymes, a ferritin and putative siderophore biosynthesis genes

Metalloenzymes. Several metabolic pathways that require metal co-factors were affected

during metal stress; for example genes of cobalamin biosynthesis, a pathway that requires

Co(II),were differentially regulated in at least four metals Mn(II), Fe(II), Co(II) and

Zn(II). The most notable change was Co(II)-specific down regulation of four of seven

genes encoding a segment of the pathway that requires this metal ion. Included among

these genes is CobN, a putative Co-chelatase which inserts Co into the corrin ring. A

second example was Mn(II)- and Fe(II)-specific up regulation of a putative molybdenum

cofactor sulfurase (VNG1735C ) implicated in delivering sulphur to diverse metal-sulphur

clusters.



Ferritin. Structural analysis of the halobacterial ferritin DpsA has demonstrated

that it stores iron in its nontoxic Fe3+

form through a process of matrix-controlled

biomineralization (Reindel et al. 2002; Zeth et al. 2004). In conjunction with these

reports, increase in dpsA transcript during Fe(II) stress points to a regulatory mechanism

that ensures increased abundance of DpsA to minimize Fe(II) toxicity as has been

reported for other prokaryotes (Munro and Linder 1978; Nair and Finkel 2004; Theil

1987; Wiedenheft et al. 2005).

Siderophore biosynthesis. Bacteria synthesize low molecular weight compounds

termed siderophores for scavenging Fe (Winkelmann 2002). Four of six genes ( gabT ,

bdb, iucA, iucB, hxyA and iucC ) in an operon in Halobacterium NRC-1 putatively encode

siderophore biosynthesis: two (IucA and IucC ) match a protein family (PF04183) for

synthesis of the siderophore aerobactin (de Lorenzo and Neilands 1986); and the other

two (Bdb and GabT) putatively act on L-2,4-diaminobutyrate –a precursor of pyovredine

siderophore biosynthesis (Vandenende et al. 2004). Although, none of these genes were

differentially regulated in presence of Fe(II), addition of Mn(II) resulted in their up

regulation (this is also discussed further later). However, we did not detect any growth

defects in the ∆iucA strain, with and without Mn(II), upon adding excess Fe(II) or

chelating “free” Fe(II) with the Fe(II)-specific chelator 2, 2’-dipyridyl (DIP) (ST3). This

suggests that perhaps Fe(II)

uptake studies might be better suited to characterize the roleof siderophore biosynthesis in Halobacterium NRC-1 Fe(II) response.

Transcription regulators selected for further analysis solely on basis of differential

regulation and putative functions

We also selected transcription regulators for further analysis merely on the basis of their

putative functions and differential regulation Specifically, we selected three putative

transcription regulators: CspD1, VNG0703H and VNG5176C. CspD1 was selected

because its putative function implicated it in stress response (Schindelin et al. 1994) and

it was down regulated in Mn(II) and Fe(II) and up regulated in Cu(II) and Zn(II) (ST2).

VNG0703H, on the other hand, was selected on basis of its up regulation in Fe(II) and

Zn(II) as well as its proximity in the genome to yvgX , which was implicated in mediating

resistance to Cu(II). Finally, VNG5176C was selected because it was up regulated in



presence of Zn(II) and it was one of four differentially regulated transcription regulators

of the ArsR family, which is characterized by the alpha3N metal binding site implicated

in binding and mediating responses to Zn(II) (Turner et al. 1996). Therefore, the

VNG5176C mutant was predicted to fair poorly under Zn(II) stress. However, the

∆cspD1, ∆VNG0703H and ∆VNG5176C strains did not have any observable growth

defects (ST3) ruling out their roles in directly controlling mechanisms that confer

resistance to these metals.

SirR may bind up to four different metals with diverse outcomes

The putative Mn(II) uptake genes zurA, zurM and ycdH were up regulated by Co(II) and

Ni(II) but down regulated by Mn(II) and Fe(II) (Fig 6A). This suggested that SirR, the

putative MntR family transcriptional repressor of this uptake system, can functionally

bind Mn(II) and Fe(II) to repress these genes. In contrast binding of Co(II) and Ni(II)

seems to interfere with normal SirR function. Another possible explanation is that

addition of excess Co(II) and Ni(II) changes the balance of the cellular metal ion pool,

including relative Mn(II)-availability.

Supplementary References

Baliga, N.S., S.J. Bjork, R. Bonneau, M. Pan, C. Iloanusi, M.C.H. Kottemann, L. Hood,

and J. DiRuggiero. 2004. Systems Level Insights Into the Stress Response to UVRadiation in the Halophilic Archaeon Halobacterium NRC-1. Genome Res. 14:

1025-1035.Bateman, A., E. Birney, R. Durbin, S.R. Eddy, K.L. Howe, and E.L. Sonnhammer. 2000.

The Pfam protein families database. Nucleic Acids Res 28: 263-266.

Bonneau, R., N.S. Baliga, E.W. Deutsch, P. Shannon, and L. Hood. 2004.Comprehensive de novo structure prediction in a systems-biology context for the

archaea Halobacterium sp. NRC-1. Genome Biol 5: R52.

de Lorenzo, V. and J.B. Neilands. 1986. Characterization of iucA and iucC genes of theaerobactin system of plasmid ColV-K30 in Escherichia coli. J Bacteriol 167: 350-

355.

Kanehisa, M. 2002. The KEGG database. Novartis Found Symp 247: 91-101; discussion

101-103, 119-128, 244-152.Moreno-Hagelsieb, G. and J. Collado-Vides. 2002. A powerful non-homology method

for the prediction of operons in prokaryotes. Bioinformatics 18 Suppl 1: S329-

336.



Munro, H.N. and M.C. Linder. 1978. Ferritin: structure, biosynthesis, and role in iron

metabolism. Physiol Rev 58: 317-396. Nair, S. and S.E. Finkel. 2004. Dps protects cells against multiple stresses during

stationary phase. J Bacteriol 186: 4192-4198.

Overbeek, R., M. Fonstein, M. D'Souza, G.D. Pusch, and N. Maltsev. 1999. The use of

gene clusters to infer functional coupling. Proc Natl Acad Sci U S A 96: 2896-2901.

Pellegrini, M., E.M. Marcotte, M.J. Thompson, D. Eisenberg, and T.O. Yeates. 1999.

Assigning protein functions by comparative genome analysis: protein phylogenetic profiles. Proc Natl Acad Sci U S A 96: 4285-4288.

Reindel, S., S. Anemuller, A. Sawaryn, and B.F. Matzanke. 2002. The DpsA-homologue

of the archaeon Halobacterium salinarum is a ferritin. Biochim Biophys Acta 1598: 140-146.

Saeed, A.I., V. Sharov, J. White, J. Li, W. Liang, N. Bhagabati, J. Braisted, M. Klapa, T.

Currier, M. Thiagarajan, A. Sturn, M. Snuffin, A. Rezantsev, D. Popov, A.Ryltsov, E. Kostukovich, I. Borisovsky, Z. Liu, A. Vinsavich, V. Trush, and J.

Quackenbush. 2003. TM4: a free, open-source system for microarray datamanagement and analysis. Biotechniques 34: 374-378.

Schindelin, H., W. Jiang, M. Inouye, and U. Heinemann. 1994. Crystal structure of CspA,the major cold shock protein of Escherichia coli. Proc Natl Acad Sci U S A 91:

5119-5123.

Schneider, E. and S. Hunke. 1998. ATP-binding-cassette (ABC) transport systems:functional and structural aspects of the ATP-hydrolyzing subunits/domains.

FEMS Microbiol Rev 22: 1-20.

Shannon, P., A. Markiel, O. Ozier, N.S. Baliga, J.T. Wang, D. Ramage, N. Amin, B.Schwikowski, and T. Ideker. 2003. Cytoscape: a software environment for

integrated models of biomolecular interaction networks. Genome Res 13: 2498-2504.

Sussman, J.L., D. Lin, J. Jiang, N.O. Manning, J. Prilusky, O. Ritter, and E.E. Abola.

1998. Protein Data Bank (PDB): database of three-dimensional structuralinformation of biological macromolecules. Acta Crystallogr D Biol Crystallogr

54: 1078-1084.

Tatusov, R.L., M.Y. Galperin, D.A. Natale, and E.V. Koonin. 2000. The COG database:

a tool for genome-scale analysis of protein functions and evolution. Nucleic Acids

Res 28: 33-36.

Theil, E.C. 1987. Ferritin: structure, gene regulation, and cellular function in animals,

plants, and microorganisms. Annu Rev Biochem 56: 289-315.Turner, J.S., P.D. Glands, A.C. Samson, and N.J. Robinson. 1996. Zn2+-sensing by the

cyanobacterial metallothionein repressor SmtB: different motifs mediate metal-

induced protein-DNA dissociation. Nucleic Acids Res 24: 3714-3721.Vandenende, C.S., M. Vlasschaert, and S.Y. Seah. 2004. Functional characterization of

an aminotransferase required for pyoverdine siderophore biosynthesis in

Pseudomonas aeruginosa PAO1. J Bacteriol 186: 5596-5602.

Wiedenheft, B., J. Mosolf, D. Willits, M. Yeager, K.A. Dryden, M. Young, and T.Douglas. 2005. An archaeal antioxidant: characterization of a Dps-like protein

from Sulfolobus solfataricus. Proc Natl Acad Sci U S A 102: 10551-10556.



Winkelmann, G. 2002. Microbial siderophore-mediated transport. Biochem Soc Trans 30:

691-696.Zeth, K., S. Offermann, L.O. Essen, and D. Oesterhelt. 2004. Iron-oxo clusters

biomineralizing on protein surfaces: structural analysis of Halobacterium

salinarum DpsA in its low- and high-iron states. Proc Natl Acad Sci U S A 101:

13780-13785.

SUPPLEMENTARY FIGURE LEGENDS

Supplementary Figure 1. Viability of Halobacterium NRC-1 cells after prolonged

exposure to six transition metals. A mid-log phase culture of Halobacterium NRC-1 was

exposed to a growth-inhibitory concentration of each metal over 27 hours at 37oC.

Culture aliquots were serially diluted (effectively reducing metal ion concentration by

over 10,000-fold) and 5 ul of 10-4, 10-5 and 10-6 dilutions were plated on to CM agar

plates. Cell survival was evaluated in seven days by counting colonies The five panels

show no significant change in cell viability under constant metal stress up until 27 hours

suggesting the metals caused growth inhibition and not killing.

Supplementary Figure 2. mRNA level changes for the P1 ATPase (YvgX) and its

putative transcription regulator VNG1179C in ~240 different experimental conditions

including gene expression changes described in this study.

Supplementary Figure 3. Growth phenotypes of Halobacterium NRC-1 ∆ura3 and

Halobacterium NRC-1 ∆ura3 ∆ zntA in increasing concentrations of CoSO4 (A), NiSO4

(B), CuSO4 (C), and ZnSO4 (D).

Supplementary Figure 4. Investigation of mechanistic basis of SirR function. A.

Inferelator prediction of influence of putative regulators of a bicluster containing Mn(II)

uptake genes. Red arrows indicate “activate” and green arrows indicate “repress”

influences and the numbers by the influences indicate their relative contribution in

predicting mRNA levels of genes in that bicluster. The blue lines indicate that the

transcription regulators combine through “AND”/”OR” gates to exert influence on the



genes. The black lines indicate that those regulators were included as part of the

bicluster. B. Properties of the bicluster containing Mn(II) uptake genes. The genes in

this bicluster have correlated mRNA level change in ~150 (to the left of the red vertical

line) out of ~256 conditions that were analyzed. SirR was not a part of this bicluster but is

included for purpose of illustration. Three motifs were detected de novo by cMonkey

and may be responsible for mediating some of the predicted regulatory influences. The

locations of the three motifs in the upstream regions of the various genes is indicated with

red, green and blue boxes for motifs 1, 2 and 3 respectively. C. Differences in

normalized (mean=0, variance=1) mRNA level changes in Halobacterium NRC-1 ∆ura3

and Halobacterium NRC-1 ∆ura3 ∆ sirR were determined using the SAM algorithm by

Tusher et al 2001. Among the two groups are those that appear to be under negative

control of SirR (Group I) and those that are under positive control of SirR (Group II).

The inset plot shows mRNA profiles for three genes ( zurA, zurM and ycdH ) of a putative

Mn-uptake ABC transport system in the wt, ∆ura3 and ∆ura3 ∆ sirR in presence of Mn

and Fe.

Supplementary Figure 5. Investigation of mechanistic basis of VNG1179C function.

A. Differences in normalized (mean=0, variance=1) mRNA level changes in

Halobacterium NRC-1 ∆ura3 and Halobacterium NRC-1 ∆ura3 ∆VNG1179C were

determined using the SAM algorithm by Tusher et al 2001. B. Significant differences

among the two sets were hierarchically clustered to reveal two distinct groups. C.

Among the two groups are those that appear to be under negative control of VNG1179C

(Group I) and those that are under positive control of VNG1179C (Group II). The inset

plot shows mRNA profile for YvgX a Cu-efflux P1 ATPase in ∆ura3 and ∆ura3

∆VNG1179C backgrounds in presence of Cu.

Supplementary Figure 6. mRNA level changes for the putative Mn-uptake ABC

transporter system operon zurA, zurM and ycdH and its putative transcription regulator

SirR in ~250 different experimental conditions including gene expression changes

described in this study.



Supplementary Figure 7. Correspondence analysis (contd. from Fig. 5 in main text).

CoA plots with Axes 1 and 3 (A) , and Axes 2 and 3 (2), demonstrate relationships

among responses to different metals. Panel C shows mRNA level changes for 23 genes

at a higher concentration of Co(II) appear to be similar to mRNA level changes at

0.05mM Zn(II). Each dot in this graph represents a particular experiment, for example

Co (0.5) refers to mRNA level changes in 0.5mM Co(II). Eigen values are plottted for

each of the first two dimensions, indicated as Axes 1 and 2, which represent inertia

values of 26.34 and 19.45, respectively.

Supplementary Figure 8. Similarity dendogram of transcript level changes for

transcription regulators. log10 ratios of the 48 transcription regulators were

normalized (variance=0, mean=1) and hierarchically biclustered (genes and conditions;

Euclidean distance, Average Linkage). Regulators containing any of the four different

metal-binding protein family (Pfam) signatures are indicated along with GTFs, genes that

were succesfully deleted, and genes that we were unable to delete.



35h

32h 35h

0

0.2

0.4

0.6

0.8

1

1.2

1.4

14h 17h 20h 23h 26h 29h 32h 35h

∆yvgX ∆yvgX (0.6mM Cu)∆ura3∆ura3 (0.6mM Cu)

O . D .

( 6 0 0 n m )

Time (hours)

0

0.2

0.4

0.6

0.8

1

1.2

1.4

14h 17h 20h 23h 26h 29h 32h

∆VNG1179C

∆ura3∆ura3 (0.6mM Cu)

∆VNG1179C (0.6mM Cu)

O . D .

( 6 0 0 n m )

Time (hours)

0

0.2

0.4

0.6

0.8

1

1.2

14h 17h 20h 23h 26h 29h 32h 35h

∆zntA∆

zntA (0.005mM Zn)∆ura3∆ura3 (0.005mM Zn)

O . D .

( 6 0 0 n m )

Time (hours)

0

0.2

0.4

0.6

0.8

1

1.2

∆sirR ∆sirR (0.4mM Mn)∆ura3∆ura3 (0.4mM Mn)

14h 17h 20h 23h 26h 29h

O . D .

( 6 0 0 n m )

Time (hours)

Growth rate assay

i ii

iii iv

Supplementary Figure 3. Growth phenotypes of Halobacterium NRC-1 ∆ura3 and Halobacterium NRC-1 ∆ura3 ∆ zntA

in increasing concentrations of CoSO4 (A), NiSO4 (B), CuSO4 (C), and ZnSO4 (D).

Dilution

CM

CM + 9.8mM FeSO4

CM +2 mM MnSO4

CM + 1.25 mM CuSO4

CM + 0.5mM CoSO4

CM + 0.05mM ZnSO4

CM + 2.5mM NiSO4

30 minutes

10-4 10-5 10-6 10-4 10-5 10-6

90 minutes

10-4 10-5 10-6

3 hours

10-4 10-5 10-6

6 hours

10-4 10-5 10-6

27 hours

Supplementary Figure 1. Viability of Halobacterium NRC-1 cells after prolonged exposure to six transition metals. A mid-log phase culture of Halobac

terium NRC-1 was exposed to a growth-inhibitory concentration of each metal over 27 hours at 37oC. Culture aliquots were serially diluted (effectively

reducing metal ion concentration by over 10,000-fold) and 5 ul of 10-4, 10-5 and 10-6 dilutions were plated on to CM agar plates. Cell survival was evalu

ated in seven days by counting colonies The five panels show no significant change in cell viability under constant metal stress up until 27 hours suggesting

the metals caused growth inhibition and not killing.

-0.4

-0.3

-0.2

-0.1

0

0.1

0.2

0.3

0.4

0.5

1 1 1 21 31 41 51 61 71 81 91 101 111 1 21 131 141 1 51 161 1 71 181 191 2 01 211 221 2 31 241

VNG0700G (yvgX )

VNG1179C

Cu

Zn Zn

Experiments

m R N A

l e v e s ( l o g 1 0 r a t i o s )

Supplementary Figure 2. mRNA level changes for the P1-type ATPase (YvgX) and its putative transcription regulator VNG1179C in ~240

different experimental conditions including gene expression changes described in this study.



VNG0037H VNG0037H

VNG0293H VNG0293H putative transcription regulator, Rosetta prediction

VNG0452G pstB2 Phosphate transport ATP-binding

VNG0453G pstA2 Phosphate ABC transporter permease

VNG0457G phoX Phosphate ABC transporter periplasmic PO4-binding

V NG0962G flaB3 Flagell in B 3 precursor

VNG0974G cheY CHEY and CHEB genes (Chemotaxis protein)

VNG0997G acs2 A cetyl-CoA synthetase

VNG1047H VNG1047H

VNG1121G aspC2 Aspartate aminotransferase

VNG1295H VNG1295H

V NG1332G sod2 S uperoxide dismutase [Mn] 2

VNG1380H VNG1380H

VNG1529G mmdA Methylmalonyl-CoA decarboxylase, subunit alpha

VNG1794C VNG1794C Staphylococcal nuclease homolog

VNG1801G h sp 1 S ma ll h ea t s ho ck p ro te in

VNG1806H VNG1806H

VNG1912G trpD2 P hosphoribosyl transferase

VNG1973H VNG1973H

VNG2109H VNG2109HVNG2246H VNG2246H

V NG2410G gbp3 GTP -binding protein homolog

VNG2431C VNG2431C

VNG2433H VNG2433H

V NG2436G argH A rgininosuccinate lyase

VNG2437G argG A rgininosuccinate synthetase

VNG2473G radA1 DNA repair and recombination protein radA

VNG2482G pstB1 Phosphate ABC transporter ATP-binding

VNG2484G pstC1 Phosphate transporter permease

VNG2486G yqgG Phosphate ABC transporter binding

VNG2508C VNG2508C

V NG2624G ribC Riboflavin synthase alpha subunit

VNG6162H VNG6162H

VNG6241G gvpA2 Gas vesicle structural protein 2 (GVP) (C-VAC)

VNG6262G zurM A BC transporter, permease protein

VNG6264G zurA ABC transporter, ATP-binding protein

VNG6265G y cd H A dh es io n p ro te in

V NG 14 06 G r hl p ut at iv e D NA h el ic as e

V NG5028G gvpE1 GvpE protein, cluster A

V NG5029G gvpD1 GvpD protein, cluster A

VNG5032G gvpC1 GvpC protein, cluster A

VNG5033G gvpN1 GvpN protein, cluster A

VNG5183G arsC

I Genes directly or indirectly repressed by SirR

VNG1653H VNG1653H transposase

VNG2118G pyrE2 Orotate phosphoribosyltransferase

VNG2634H VNG2634H

VNG6181H VNG6181H

VNG6182H VNG6182H IS200-like transposase

VNG6255C VNG6255C

V NG 62 56 G l ip B L ip oa te p ro te in l ig as e

VNG6305C VNG6305C radical SAM superfamily protein

VNG5044H VNG5044H transposase

VNG2059H VNG2059H

VNG0101G cspD1 Cold shock protein (putative regulator)

VNG0146H VNG0146H

VNG0285C VNG0285C transposase

VNG0394C VNG0394C

VNG0426G rpoM DNA-directed RNA-polymerase subunit M

V NG0491G dnaK Chaperone protein dnaK (Hsp70)

VNG0659H VNG0659H

VNG0702H VNG0702H heavy metal transport protein

VNG0765H VNG0765H

VNG0863H VNG0863H

VNG1007H VNG1007H

VNG1132G rps13p 30S ribosomal protein S13P/S18E (HS13)

VNG1289H VNG1289H

V NG1320G cbp Calcium-binding protein homology

VNG1433G rps17e 30S ribosomal protein S17e

VNG1541G sucC Succinyl-CoA synthetase beta chain

VNG1542G sucD Succinyl-CoA synthetase alpha chain

VNG1591H VNG1591H

V NG 16 24 G m dh M al at e d eh yd ro ge na se

VNG1692G rpl2p 50S ribosomal protein L2PVNG1695G rpl22p 50S ribosomal protein L22P (HHAL22)

VNG1698G rpl29p 50S ribosomal protein L29P (HHAL29)

VNG1699C VNG1699C putative RNAse P encoded in ribosomal operon

VNG1727G c mk Cyti dyl ate k in ase

VNG1830G p yr G C TP s yn th as e/ GA Ta se

VNG2273H VNG2273H

VNG2467G rpl31e 50S ribosomal protein L31e


VNG2643H VNG2643H

V NG2657G rps7p 30S ribosomal protein S 7P

V NG 26 61 G n us A N us A p ro te in h om ol og

VNG6332H VNG6332H

VNG0287H VNG0287H

VNG2664G rpoA DNA-directed RNA polymerase subunit A

VNG5008H VNG5008H

V NG5019G gvpM1 GvpM protein, cluster A

VNG5071C VNG5071C sugar (and other) transporter

II Genes directly or indirectly activated by SirR

A B

I

II

SAM analysis on 352 genes with significant (λ >15.0) change in at least two microarray experiments.

change shared with ∆sirR

change inverse to ∆sirR

Protease/nuclease/chaperone

Dehydrogenase/oxidoreductase/redoxins

Putative transcription regulators

-2.5

-2

-1.5

-1

-0.5

0

0.5

1

1.5

2

Fe

wt

Mn

wt

Mn

∆ura3∆sirR

Mn

∆ura3

0 0

m R N A ( l o g 1 0 r a t i o )

zurM ycdH zurA

AND

VNG1405C

Mn(II), PO42-

and Co(II)

transport

VNG2476C

KaiC

SirR

Prp1

0.15

0.12

-0.14

PhoU

0.12

C

Supplementary Figure 4. Investigation of mechanistic basis of SirR function. A. Inferelator prediction of influence of putative regulators of a bicluster

containing Mn(II) uptake genes. Red arrows indicate “activate” and green arrows indicate “repress” influences and the numbers by the influences indicate their

relative contribution in predicting mRNA levels of genes in that bicluster. The blue lines indicate that the transcription regulators combine through “AND”/”OR”

gates to exert influence on the genes. The black lines indicate that those regulators were included as part of the bicluster. B. Properties of the bicluster containing

Mn(II) uptake genes. The genes in this bicluster have correlated mRNA level change in ~150 (to the left of the red vertical line) out of ~256 conditions that were

analyzed. SirR was not a part of this bicluster but is included for purpose of illustration. Three motifs were detected de novo by cMonkey and may be responsible

for mediating some of the predicted regulatory influences. The locations of the three motifs in the upstream regions of the various genes is indicated with red,

green and blue boxes for motifs 1, 2 and 3 respectively. C. Differences in normalized (mean=0, variance=1) mRNA level changes in Halobacterium NRC-1 ∆ura3

and Halobacterium NRC-1 ∆ura3 ∆ sirR were determined using the SAM algorithm by Tusher et al 2001. Among the two groups are those that appear to be under

negative control of SirR (Group I) and those that are under positive control of SirR (Group II). The inset plot shows mRNA profiles for three genes ( zurA, zurM

and ycdH ) of a putative Mn-uptake ABC transport system in the wt, ∆ura3 and ∆ura3 ∆ sirR in presence of Mn and Fe.



Supplementary Figure 5. Investigation of mechanistic basis of VNG1179C function. A. Differences in normalized (mean=0, variance=1) mRNA

changes in Halobacterium NRC-1 ∆ura3 and Halobacterium NRC-1 ∆ura3 ∆VNG1179C were determined using the SAM algorithm by Tusher et al 2

B. Significant differences among the two sets were hierarchically clustered to reveal two distinct groups. C. Among the two groups are those that ap

to be under negative control of VNG1179C (Group I) and those that are under positive control of VNG1179C (Group II). The inset plot shows mR

profile for YvgX a Cu-efflux P1-type ATPase in ∆ura3 and ∆ura3 ∆VNG1179C backgrounds in presence of Cu.



Supplementary Figure 6. mRNA level changes for the putative Mn-uptake ABC transporter system operon zurA, zurM and ycdH and its putative tran-

scription regulator SirR in ~250 different experimental conditions including gene expression changes described in this study.

-0.8

-0.6

-0.4

-0.2

0

0.2

0.4

1 11 21 31 41 51 61 71 81 91 101 111 121 131 141 151 161 171 181 191 201 211 221 231 241 251

VNG0536G (sirR )

VNG6262G (zurM )

VNG6264G (zurA)

VNG6265G (ycdH )

Experiments

m R N A l e v e l s

l o g 1 0 r a t i o

-0.304 -0.243 -0.182 -0.122 -0.061 0.061 0.122 0.182 0.243 0.3

Axes 2 and 3

Fe (2.0)

Fe (4.0)

Fe (6.0)

Fe (7.0)

Cu (0.7)

Cu (1.0) Cu (0.85)

Co (0.2)

Ni (0.75)Ni (0.5)

Ni (1.5)

Co (0.3)

Co (0.5)

Zn (0.005)

Zn (0.01)

Zn (0.02)

Mn (0.8)

Mn (1.0)Mn (1.5)

0.221

0.177

0.133

0.089

0.044

-0.044

-0.089

-0.133

-0.177

-0.221

-0.304 -0.243 -0.182 -0.122 -0.061 0.061 0.122 0.182 0.243 0.304

0.221

0.177

0.133

0.089

0.044

-0.044

-0.089

-0.133

-0.177

-0.221

Co (0.5)

Co (0.3)

Zn (0.005)

Zn (0.01)

Zn (0.02)

Co (0.2)Cu (0.85)

Cu (1.0)Fe (7.0)

Fe (6.0)

Fe (4.0)

Fe (2.0)

Mn (0.8)

Mn (1.0)Mn (1.5)

Ni (1.5)

Ni (0.5) Ni (0.75)

Cu (0.7)

Axes 1 and 3

Ribosomal proteinsGasVesicle biogenesisRadA1Ferredoxin/quinoneoxidoreductaseSod2

A B

C

ZntA,YvgX,CpXArsenic resistance genesFbr (putative fibrillarin)plastocyaninAldehyde reductase (Zn-binding)Zn-binding proteaseslom protease,proteasome

Siderophore biosynthesisIron transport

Supplementary Figure 7. Correspondence analysis (contd. from Fig. 5 in main text). CoA

plots with Axes 1 and 3 (A) , and Axes 2 and 3 (2), demonstrate relationships among re

sponses to different metals. Panel C shows mRNA level changes for 23 genes at a highe

concentration of Co2+ appear to be similar to mRNA level changes at 0.05mM Zn 2+. Eac

dot in this graph represents a particular experiment, for example Co (0.5) refers to mRNA

level changes in 0.5mM Co2+. Eigen values are plottted for each of the first three dimen

sions, indicated as Axes 1, 2 and 3, which represent inertia values of 26.34, 19.45 and 16.41

respectively.



Metal mM up down

Mn 0.8 76 186

1 111 124

1.5 182 167

Fe 2 43 54

4 75 31

6 61 267 11 17

Co 0.2 17 15

0.3 56 13

0.5 59 15

Ni 0.5 38 30

0.75 40 36

1.5 21 30

Cu 0.7 57 23

0.85 11 7

1 34 4

Zn 0.005 40 17

0.01 134 40

0.02 106 53

Supplementary Table 1. Numbers of genes that changed (�

> 15) in at least one concentration of each of the six metals

The values for Fe do not include changes in the time series experiment



Supplementary Table 2. I. Genes of known function (including genes in operon)

A. Transporters

Gene ORF Mn Fe_st Fe_ts Co Ni Cu Zn Putative Function

VNG0002G yvrO Amino acid ABC transporter, ATP-binding protein

VNG0123G trp1 ABC transport protein

VNG0124C VNG0124C creatinine hydrolase, Creatinine amidohydrolase (EC:3.5.2.10), or

creatininase, catalyses the hydrolysis of creatinine to creatine.

VNG0149G zntA Broad specificity P1-ATPase for Co, Ni, Cu and Zn

VNG0316C VNG0316C FhuD is an ATP-binding cassette-type (ABC-type) binding protein

involved in the uptake of hydroxamate-type siderophores

VNG0365G arsA1 Arsenical pump-driving ATPase

VNG0452G pstB2 Phosphate transport ATP-binding


VNG0455G pstC2 Phosphate ABC transporter permease

VNG0457G phoX Phosphate ABC transporter periplasmic phosphate-binding

VNG0465G nosF2 Copper transport ATP-binding protein

VNG0524G yurY ABC transporter, ATP-binding proteinVNG0525C VNG0525C Predicted component of ABC transporter system (COG0719)

VNG0527C VNG0527C Predicted component of ABC transporter system (COG0719)

VNG0700G yvgX Cu-transporting P1-ATPase


VNG0727C VNG0727C Multi Antimicrobial Extrusion (drug/sodium antiporter)

VNG0897G rbsC1 Ribose ABC transporter permease

VNG0898G rbsC2 Ribose ABC transporter permease

VNG0901G rbsA Ribose ABC transporter ATP-binding

VNG0903C VNG0903C Basic membrane protein

VNG0921G potA1 Spermidine/putrescine ABC transporter ATP-binding

VNG0923G sfuB Iron transporter-like protein

VNG0924G ibp Iron-binding protein

VNG0938G gufA GufA protein, putative divalent cation transporter (PFAM, COG

matches).

VNG1367G srp19 Signal recognition particle 19 kDa protein (SRP19)

VNG1369G hemV1 Iron (III) ABC transporter ATP-binding

VNG1370G hemU Iron (III) ABC transporter permease

VNG1371G hemV2 Iron (III) ABC transporter ATP-binding

VNG1631G cbiO2 Cobalt transport ATP-binding protein

VNG1632G cbiQ Cobalt transport protein

VNG2358G appA Oligopeptide binding protein

VNG2359G appB Oligopeptide ABC permease

VNG2361G appC Oligopeptide transport permease protein

VNG2363G oppD1 Oligopeptide ABC transporter ATP-binding

VNG2365G appF Oligopeptide ABC transporter ATP-binding

VNG2482G pstB1 Phosphate ABC transporter ATP-binding


VNG2484G pstC1 Phosphate transporter permease

VNG2486G yqgG Phosphate ABC transporter binding

VNG2527G dppD Dipeptide ABC transporter ATP-binding

VNG2529G dppB2 Dipeptide ABC transporter permease

VNG2531G dppC1 Dipeptide ABC transporter permease

VNG2532H VNG2532H

VNG2558G fepC Ferric enterobactin transport protein

VNG2560G yfmD2 Ferrichrome ABC transporter permease protein

VNG2562H VNG2562H periplasmic binding protein, probably involved in iron transport


VNG2582H VNG2582H

VNG5071C VNG5071C sugar (and other) transporter

VNG5180G arsA2 Anion transporting ATPase

VNG5181G arsD

VNG5183G arsC Arsenate reductase

VNG6262G zurM ABC transporter, permease protein

VNG6264G zurA ABC transporter, ATP-binding protein

VNG6265G ycdH Adhesion protein

VNG6277G ugpB Glycerol-3-phosphate-binding protein precursor

VNG6279G ugpA Sn-glycerol-3-phosphate transport system permease

VNG6281G ugpC Sn-glycerol-3-phosphate transport system ATP-binding

B. Oxidative stress


VNG0154G merA Mercury(II) reductase

VNG0281G soxB . Sarcosine oxidase

VNG0439C VNG0439C Pyridine nucleotide-disulfide oxidoreductase

VNG0467G yafB Aldehyde reductase

VNG0474G porA Pyruvate ferredoxin oxidoreductase, subunit alpha

VNG0523G inb Oxidoreductase homolog

VNG0563G ndhG2 NADH dehydrogenase/oxidoreductase

VNG0628G gdhA1 Glutamate dehydrogenase

VNG0635G nolB NADH dehydrogenase/oxidoreductase-like protein



VNG0640G nolD NADH dehydrogenase/oxidoreductase-like protein

VNG0641C VNG0641C NADH-ubiquinone/plastoquinone oxidoreductase chain 6

VNG0642C VNG0642C NADH-ubiquinone oxidoreductase

VNG0643G nolC NADH dehydrogenase/oxidoreductase-like protein

VNG0646G nuoL F420H2:quinone oxidoreductase chain L

VNG0647G nuoM F420H2:quinone oxidoreductase chain M

VNG0677H VNG0677H

VNG0678G acaB1 3-ketoacyl-CoA thiolase

VNG0679G acd4 Acyl-CoA dehydrogenase

VNG0771G aldY2 Aldehyde dehydrogenase (Retinol)

VNG0815G yfmJ Quinone oxidoreductase

VNG0891G yjlD NADH dehydrogenase

VNG0930G yvbT Alkanal monooxygenase homolog

VNG0931G acaB2 3-ketoacyl-CoA thiolase

VNG0933G yqjM NADH-dependent flavin oxidoreductase

VNG0935G noxC NADH oxidase

VNG0937G gap Glyceraldehyde-3-phosphate dehydrogenase

VNG0998G yajO2 Probable oxidoreductase

VNG1011C VNG1011C Uncharacterized conserved protein

VNG1012H VNG1012H glutaredoxin

VNG1018G adh3 Alcohol dehydrogenase

VNG1070G gpdA1 FAD-dependent oxidoreductase

VNG1128G korA Putative 2-ketoglutarate ferredoxin oxidoreductase (Alpha)

VNG1190G sod1 Superoxide dismutase [Mn] 1




VNG1259G trxB2 Thioredoxin reductase

VNG1306G sdhA Succinate dehydrogenase subunit A

VNG1308G sdhB Succinate dehydrogenase subunit B

VNG1309G sdhD Membrane anchor

VNG1310G sdhC Succinate dehydrogenase hydrophobic membrane anchor protein

VNG1332G sod2 Superoxide dismutase [Mn] 2

VNG1644G nrdB2 Ribonucleoside reductase large chain

VNG1774G hemA Glutamyl-tRNA reductase

VNG1775C VNG1775C Nad-Dependent Dehydrogenase and Ferrochelatase Involved In

Siroheme Synthesis.


VNG2023G gsp General stress protein 69

VNG2106G sdh Succinate dehydrogenase subunit

VNG2115H VNG2115H glutaredoxin

VNG2171G adh1 Alcohol dehydrogenaseVNG2218G pdhB Pyruvate dehydrogenase beta subunit

VNG2219G dsa Dihydrolipoamide S-acetyltransferase

VNG2220G lpdA Dihydrolipoamide dehydrogenase

VNG2299H VNG2299H

VNG2301G txrB3 Thioredoxin reductase

VNG2420G metA Probable homoserine O-acetyltransferase

VNG2513G aldY1 Aldehyde dehydrogenase (Retinol)

VNG2555C VNG2555C putative ferredoxin

VNG2600G trxA2 Thioredoxin


VNG6270G gldA Sn-glycerol-1-phosphate dehydrogenase

VNG6294G perA Peroxidase/catalase

C. Cobalamin biosynthesis


VNG1550G cbiT Putative precorrin 8-w decarboxylase (AdoMet

methyltransferase).\nInvolved in synthesis of Cobalamin

precursors

VNG1551G cbiL Precorrin-2 C20 methyltransferase\nsynthesis of Cobalamin

precursors

VNG1553G cbiF Precorrin 4-methyltransferase\nCobalamin biosynthesis; CbiF

involved in synthesis of precursors

VNG1554G cbiG Cobalamin biosynthesis

VNG1558H VNG1558H

VNG1559H VNG1559H

VNG1561C cbiX, putative Putative cobaltochelatase with ferredoxin domain\npossible

function in cobalamin biosynthesis

VNG1562H VNG1562H

VNG1564H VNG1564H

VNG1566G cobN Putative chelatase involved in cobalt insertion into corrin ring

VNG1574G cobA Cobalamin adenosyltransferase

D. Fe uptake and storage systems(i ncluding Siderophore biosynthesis)


VNG2443G dpsA Starvation induced DNA binding protein

VNG6210G gabT Gamma-aminobutyrate aminotransferase

VNG6211G bdb L-2,4-diaminobutyrate decarboxylase

VNG6212G iucA Iron transport protein A

VNG6213G iucB Iron transport protein B

VNG6214G hxyA Monooxygenase

VNG6216G iucC Iron transport protein C

E. Molybdenum cofactor biosynthesis protein


VNG0081G moaE Molybdenum cofactor biosynthesis protein

VNG0085G moaA3 Molybdenum cofactor biosynthesis protein

VNG0086G moeA2 Molybdenum cofactor biosynthesis protein

VNG0207H VNG0207H Molybdenum cofactor biosynthesis protein

VNG1273G moaC Molybdenum cofactor biosynthesis proteinVNG1735C VNG1735C putative molybdenum cofactor sulfurase, The MOSC domain is

predicted to be a sulphur-carrier domain that delivers sulphur, from

its conserved cysteine, for the formation of diverse sulphur-metal

clusters.

F. Transcription

i. RNA polymerase


VNG0426G rpoM DNA-directed RNA-polymerase subunit M

VNG1136G rpb3 DNA-directed RNA polymerase subunit D

VNG1140G rpoN DNA-directed RNA polymerase subunit N

VNG1141G rpoK DNA-directed RNA polymerase subunit K

VNG1169C VNG1169C RNA polymerase Rpb4

VNG2051G rpoE'' DNA-directed RNA polymerase subunit E''

VNG2053G rpoE' DNA-directed RNA polymerase subunit E'

ii. General transcription factors


VNG0254G tfbG Transcription Factor B homolog G

VNG0315G tfbF Transcription Factor B homolog F

VNG0734G tfbB Transcription Factor B homolog B

VNG2184G tfbA Transcription Factor B homologA

VNG2243G tbpE TATA-Binding Protein E

iii. Transcription regulators


VNG0019H VNG0019H putative repressor

VNG0039H VNG0039H putative transcription regulator (ArsR family). Predicted through

de novo structure prediction using Rosetta

VNG0040C VNG0040C transcription repressor

VNG0101G cspD1 Cold shock protein (putative regulator)

VNG0142C VNG0142C putative transcription regulator (MarR family)

VNG0176H VNG0176H putative histone acetyl transferase

VNG0194H VNG0194H putative transcription regulator of the CopG family

VNG0258H VNG0258H putative transcription regulator (PadR family)




VNG0293H VNG0293H putative transcription regulator, Rosetta predicted structure

matched CATH class 1.10.10.10

VNG0320H VNG0320H Transcription reglator (ArsR family)

VNG0451G phoU Transcriptional regulator

VNG0458G prp1 Putative Phosphate regulatory protein homolog

VNG0511H VNG0511H putative transcription regulator, function predicted by Rosetta

VNG0536G sirR Transcription repressor (MntR family)

VNG0651G imd1 Hypothetical protein VNG0651G

VNG0703H VNG0703H putative transcription regulator, Function assigned on the basis of

Rosetta-predicted structure match to CATH class 1.10.10.10

VNG0751C VNG0751C putative transcription regulator (PadR family)

VNG0826C dmsR putative transcription regulator involved in anaerobic growth on

DMSO and/or TMAO.

VNG0890G imd2 putative transcriptional regulator with C-terminal CBS domain,

COG2524

VNG1029C VNG1029C putative transcription regulator VNG1123G trh7 putative Lrp-like transcriptional regulator

VNG1179C VNG1179C TRASH domain containing regulator

VNG1215G pai1 acetyl transferase (histone)

VNG1377G asnC Putative transcription regulator

VNG1404G trh1 Putative transcription regulator

VNG1490H VNG1490H Putative transcription regulator (ArsR family)

VNG1776G nirH Putative transcription regulator, structural match to lrp-like

transcriptional regulator (e = 1x10E-28), COG1552.

VNG1836G cspD2 Cold shock protein

VNG2020C VNG2020C predicted transcriptional regulator (marR/padR family)

VNG2126C VNG2126C putative transcription regulator

VNG2277H VNG2277H putative histone acetyltransferase, COG0454:histone

acetyltransferase HPA2 (PET=9)\nPFAM0583:GNAT

acetyltransferase family

VNG2441G rad3b Helicase

VNG2476C VNG2476C putative rad3-related helicase, somewhat weak PDB hit to Bacillus

uvrB\nCOG1199 (rad3-like helicases), PET=11

VNG2614H VNG2614H putative transcription regulator

VNG2661G nusA NusA protein homolog

VNG5028G gvpE1 GvpE protein, cluster A

VNG5068G boa3 bacterio-opsin activator-like protein

VNG5075C VNG5075C PadR family transcription regulator

VNG5144H VNG5144H Transcriptional regulator PadR-like family

VNG5176C VNG5176C Transcriptional regulator (ArsR family)

VNG5182G arsR predicted transcriptional regulators (ArsR family)

VNG6193H VNG6193H putative transcription regulator of the (CopG)

VNG6441H VNG6441H putative DNA-binding protein, (Robetta server prediction)

metal-binding regulators are shown in red font

E. Protein Synthesis and Degradation

i. Proteases


VNG0166G psmA2 Proteasome alpha subunit

VNG0303G lon Putative protease La homolog type

VNG0321G ids putative membrane-associated protease

VNG0329G caaX Zinc metalloproteinase homolog

VNG0409C VNG0409C Prolyl Oligopeptidase

VNG0446G gcd Glucose dehydrogenase

VNG0510G prrIV2 Proteasome-activating nucleotidase 2

VNG0557H VNG0557H putative protease

VNG0723G pepQ1 Probable peptidase

VNG0875C VNG0875C M50 family peptidase (metalloprotease)

VNG0880G psmA1 Proteasome, subunit alpha

VNG1233G pepQ2 X-pro aminopeptidase homolog

VNG2302G yuxL Acylaminoacyl-peptidase

VNG2323H VNG2323H putative zinc-binding CAAX amino terminal protease

VNG2324H VNG2324H

VNG2416G sec11 Signal sequence peptidase

VNG2449G pepB2 Aminopeptidase homologVNG2465C VNG2465C Prefoldin alpha subunit (GimC alpha subunit)

VNG2546G pepB3 Aminopeptidase homolog

VNG2616G cxp Probable carboxypeptidase

VNG6201G hsp5 Heat shock protease protein

VNG6361G npa Neutral proteinase

ii. Translation factors


VNG0401G epf2 mRNA 3'-end processing factor homolog

VNG0549G eif2a translation initiation factor 2 alpha subunit (eIF-2-alpha)

VNG1262G eif2b translation initiation factor 2 beta subunit ( eIF-2-beta)

VNG1756G eif1a2 translation initiation factor 1A-2 (aIF-1A-2)

VNG1853G eif2ba Translation initiation factor eIF-2B subunit alpha

VNG2056G eif2g translation initiation factor 2 gamma subunit (eIF-2-gamma)

VNG2247G hisG ATP phosphoribosyltransferase

VNG2584C VNG2584C Translation initiation factor SUI1

VNG2654G eef2 Translation elongation factor eEF-2

iii. Ribosomal proteins



VNG0548C VNG0548C Nucleolar RNA-binding protein


VNG0551G rpl44e 50S ribosomal protein L44E

VNG0787G rps3e 30S ribosomal protein S3Ae

VNG0790G rps15p 30S ribosomal protein S15P

VNG1103G rpl12p 50S ribosomal protein L12P ('A' type) (HL20)

VNG1104G rpl10p Acidic ribosomal protein P0 homolog (L10E)

VNG1105G rpl1p 50S ribosomal protein L1P (HL8)

VNG1108G rpl11p 50S ribosomal protein L11P

VNG1132G rps13p 30S ribosomal protein S13P/S18E (HS13)






VNG1137G rpl18e 50S ribosomal protein L18e (HeL18)




VNG1157G rphs6 50S ribosomal protein L7Ae

VNG1159G rpl24e 50S ribosomal protein L24E (LSU ribosomal protein L24E)

VNG1168C VNG1168C predicted RNA binding protein




VNG1688C VNG1688C Predicted SAM-dependent nucleic acid methylase





VNG1693G rps19p 30S ribosomal protein S19P (HHAS19)VNG1695G rpl22p 50S ribosomal protein L22P (HHAL22)

VNG1697G rps3p 30S ribosomal protein S3P (HS4) (HHAS3)


VNG1699C VNG1699C putative RNAse P residing within ribosomal operon

VNG1700G rps17p 30S ribosomal protein S17 (HHAS17)




VNG1705G rpl5p 50S ribosomal protein L5P (HSal5)





VNG1713G rpl19e Ribosomal protein L19

VNG1714G rpl18p 50S ribosomal protein L18P (HSal18)




VNG2047G rps27ae 30S ribosomal protein S27E







VNG2658G rps12p 30S ribosomal protein S12P (HmaS12)

F. Replication, Repair and recombination


VNG0133G rpa Replication A related protein

VNG1255C VNG1255C replication protein A ortholog

VNG1406G rhl putative DNA helicase

VNG1408G ush 5'-nucleotidase/2',3'-cyclic phosphodiesterase and related

esterases;\nUDP-sugar hydrolase

VNG2160C VNG2160C replication protein A ortholog

VNG2173G rad24a DNA repair protein

VNG2213G brr2 Pre-mRNA splicing helicase

VNG2333C VNG2333C recJ-like phosphoesterase (endonuclease)

VNG2441G rad3b Helicase

VNG2473G radA1 DNA repair and recombination protein radA

VNG2476C VNG2476C putative rad3-related helicase, somewhat weak PDB hit to Bacillus

uvrB\nCOG1199 (rad3-like helicases), PET=11

VNG2620G uvrD Repair helicase

G. Transposase


VNG0042G ntp putative transposase

VNG0213H VNG0213H putative transposase

VNG0285C VNG0285C putative transposaseVNG0286C VNG0286C probable transposase




VNG6148H VNG6148H predicted transposase

VNG6182H VNG6182H IS200-like transposase

H. Energy metabolism


VNG0150H VNG0150H cytochrome C biogenesis protein

VNG0151C VNG0151C profilin-like contractile protein

VNG0582C VNG0582C putative cytochrome bc1\n

VNG0583G cyb Cytochrome b6

VNG0665G coxB1 Cytochrome c oxidase subunit II

VNG1257H VNG1257H putative cytochrome oxidase

VNG2138G atpB V-type ATP synthase beta chain

VNG2139G atpA V-type ATP synthase alpha chain

VNG2140G atpF V-type ATP synthase subunit F

VNG2141G atpC V-type ATP synthase subunit C

VNG2142G atpE V-type ATP synthase subunit E

VNG2143G atpK H+-transporting ATP synthase subunit K

VNG2144G atpI V-type ATP synthase subunit I

VNG2150G etfB Electron transfer flavoprotein subunit beta

VNG2151G etfA Electron transfer flavoprotein subunit alpha

VNG2193G coxA1 Cytochrome c oxidase subunit I

VNG2195G coxB2 Cytochrome c oxidase subunit II

VNG5055G cydA cytochrome d oxidase chain I

VNG5057G cydB cytochrome d oxidase chain II

I. Cell division/Flagellin/Chemotaxis


VNG0192G ftsZ2 Cell division protein ftsZ homolog

VNG0265G ftsZ4 Cell division protein

VNG0949G gspE3 Type II secretion system protein

VNG0950G fapH Flagella-related protein H

VNG0953C VNG0953C archaeal flagellin-associated protein




VNG0954C VNG0954C Flagellar Accessory protein D or E

VNG0960G flaB1 Flagellin B1 precursor



VNG0966G cheR Chemotaxis protein

VNG0967G cheD Chemotaxis protein

VNG0971G cheA Chemotaxis protein

VNG0973G cheB Protein-glutamate methylesterase

VNG0974G cheY CHEY and CHEB genes (Chemotaxis protein)

VNG0976G cheW1 Chemotaxis protein

VNG1008G flaA1a Flagellin A1 precursor

VNG1009G flaA2 Flagellin A2 precursor


VNG2181G mcm MCM / cell division control protein 21

VNG2271G orc6 Orc / cell division control protein 6

VNG6150G orc1 Orc / cell division control protein 6VNG6187G orc3 Orc / cell division control protein 6


J. Miscellaenous Metalloproteins


VNG0249G fbr Copper binding proteins/plastocyanin/azurin

VNG0684G fbp Fructose-bisphosphatase

VNG0795G hcpC Halocyanin precursor-like

VNG1197G bcp Bacterioferritin comigrating protein

VNG2196G hcpB Halocyanin precursor-like



G e n e

O R F

M n

F e_ s t

F e_

t s

C o

N i

C u

Z n

P f a m

f u n c t i o

n / p f a m

C O G

f u n c t i o n / C O G

M a t c h i n p d b

V N G 0 9 4 3 C

C O G 0 6 4 0

A r s R

- P r e d i c t e d t r a n s c r i p t i o n a l r e g u l a t o r s

V N G 0 9 6 4 C

P F 0 4 2 8 3

U n k n o w

n f u n c t i o n f a m i l y

C O G 2 4 6 9

U n c h

a r a c t e r i z e d A C R

V N G 0 9 9 1

V N G 0 9 9 5

V N G 1 0 2 0 C

P F 0 1 0 6 6

C D P - a l c o h o l p h o s p h a t i d y l t r a n s f e r a s e

C O G 0 5 5 8

P h o s p h a t i d y l g l y c e r o p h o s p h a t e s y n t h a s e

V N G 1 0 2 1 C

P F 0 5 1 6 5

G T P c y

c l o h y d r o l a s e I I I

C O G 2 4 2 9

U n c h


V N G 1 0 2 1 C

P F 0 5 1 6 5

G T P c y

c l o h y d r o l a s e I I I

C O G 2 4 2 9

V N G 1 0 2 3 C

P F 0 0 1 0 7

Z i n c - b i n

d i n g d e h y d r o g e n a s e

C O G 1 0 6 3

T h r e o

n i n e d e h y d r o g e n a s e a n d r e l a t e d Z n - d e p e n d e n t d e h y d r o g e n a s e s

V N G 1 0 2 4 C

C O G 0 7 2 0

6 - p y r u v o y l - t e t r a h y d r o p t e r i n s y n t h a s e - m a y b e i n c o e n z y m e m e t a b o l i s m

V N G 1 0 2 4 C

C O G 0 7 2 0

6 - p y r u v o y l - t e t r a h y d r o p t e r i n s y n t h a s e

V N G 1 0 2 5

V N G 1 0 2 6

V N G 1 0 4 7

V N G 1 0 5 2

V N G 1 0 8 5

V N G 1 0 8 6 C

P F 0 1 8 9 3

C O G 1 7 4 5

U n c h

a r a c t e r i z e d A r C R ; p r o b a b l y m e t a l - b i n d i n g

V N G 1 0 8 8 C

C O G 3 3 8 8

U n c h

a r a c t e r i z e d A r C R

V N G 1 0 9 3 C

P F 0 1 9 0 3

C b i X -

C h e l a t a s e S u p e r f a m i l y - m i g h t b e i n v o l v e d i n

m e t a l c h e l a t i o n

C O G 2 1 3 8

V N G 1 1 1 5

P F 0 1 9 8 0

C O G 1 7 2 0

U n c h


V N G 1 1 6 8 C

P F 0 4 9 1 9

C O G 1 4 9 1

P r e d i c t e d R N A - b i n d i n g p r o t e i n

V N G 1 1 9 3 C

C O G 0 6 4 2

S i g n a

l t r a n s d u c t i o n h i s t i d i n e k i n a s e

V N G 1 2 4 4 C

P F 0 1 8 1 7

C h o r i s m

a t e m u t a s e t y p e I I - i n t h e p a t h w a y o f t y r o s i n e

a n d p h e

n y l a l a n i n e b i o s y n t h e s i s .

C O G 1 6 0 5

C h o r i s m a t e m u t a s e

V N G 1 2 6 3 C

P F 0 1 8 9 3

C O G 1 7 4 5

s o m e

i n t e r a c t i o n w i t h v n g 1 0 8 6 C - U n c h a r a c t e r i z e d A r C R ; p r o b a b l y m e t a

l -

b i n d i n g

V N G 1 2 9 5

V N G 1 3 1 4

V N G 1 3 1 5

V N G 1 3 1 8

V N G 1 3 2 3 C

P F 0 0 8 0 1

P K D d o

m a i n

V N G 1 3 2 4 C

P F 0 4 1 3 8

G t r A - l i k

e p r o t e i n

C O G 2 2 4 6

U n c h

a r a c t e r i z e d m e m b r a n e p r o t e i n

V N G 1 3 3 9 C

P F 0 0 5 0 1

A M P - b i n d i n g e n z y m e

C O G 0 3 1 8

A c y l - C o A s y n t h e t a s e s ( A M P - f o r m i n g ) / A M P - a c i d l i g a s e s I I - m a y b e i n

M E N A Q U I N O N E B I O S Y N T H E S I S

V N G 1 3 4 3 C

P F 0 1 9 7 3

C O G 1 6 3 4

U n c h

a r a c t e r i z e d R o s s m a n n f o l d e n z y m e

V N G 1 3 6 5 C

P F 0 4 2 5 8

S i g n a l p

e p t i d e p e p t i d a s e

C O G 3 3 8 9

V N G 1 3 6 6

C O G 3 2 7 7

R N A - b i n d i n g p r o t e i n i n v o l v e d i n r R N A p r o c e s s i n g

V N G 1 3 7 2 C

P F 0 5 2 9 9

M 6 1 g l y

c y l a m i n o p e p t i d a s e

V N G 1 3 7 6

V N G 1 3 8 0

V N G 1 3 8 1

V N G 1 4 1 3

V N G 1 4 3 8

C O G 0 6 4 0

A r s R

- P r e d i c t e d t r a n s c r i p t i o n a l r e g u l a t o r s

V N G 1 4 7 1 C

C O G 1 7 1 1

U n c h

a r a c t e r i z e d A r C R

V N G 1 4 7 3

V N G 1 5 3 4

V N G 1 5 5 8

C O G 1 1 4 1

F e r r e

d o x i n 1

V N G 1 5 5 9

V N G 1 5 5 9

V N G 1 5 6 2

V N G 1 5 6 4 H

m a t c h t o 1 e r j ( p d b ) - t r a n s c r i p t i o n

i n h i b i t o r

V N G 1 5 6 4 H

m a t c h t o 1 e r j ( p d b ) - t r a n s c r i p t i o n

i n h i b i t o r

V N G 1 6 1 3

V N G 1 6 4 2

V N G 1 6 6 3 C

P F 0 0 5 7 1

C B S d o

m a i n

C O G 0 5 1 7

C B S

d o m a i n s - p l a y a r e g u l a t o r y r o l e m a k i n g p r o t e i n s s e n s i t i v e t o a d e n o

s y l

c a r r y i n g l i g a n d s

m a t c h t o 1 z f j ( p d b ) I n o s i n e

M o n o p h o s p h a t e D e h y d r o g e n a s e

V N G 1 6 6 4

V N G 1 6 7 9

V N G 1 6 8 8 C

C O G 2 1 0 6

U n c h


V N G 1 7 2 0

V N G 1 7 3 7

V N G 1 7 3 7

V N G 1 7 4 0 C

V N G 1 7 4 0 C

V N G 1 7 4 4

P F 0 2 5 3 5

Z I P Z i n c t r a n s p o r t e r

C O G 0 4 2 8

P r e d i c t e d d i v a l e n t h e a v y - m e t a l c a t i o n s t r a n s p o r t e r

V N G 1 7 4 6 C

C O G 3 3 6 1

U n c h


V N G 1 8 0 0

V N G 1 8 0 6

V N G 1 8 2 0



G e n e

O R F

M n

F e_ s t

F e_

t s

C o

N i

C u

Z n

P f a m

f u n c t i o n

/ p f a m

C O G

f u n c t i o n / C O G

M a t c h i n p d b

V N G 1 8 2 0 H

V N G 1 8 6 1 C

P F 0 4 0 5 5 /

P F 0 0 9 1 9 /

P F 0 1 9 3 8

R a d i c a l S

A M s u p e r f a m i l y / n o k n o w n f u n c t i o n / T R A M

d o m a i n

C O G 0 6 2 1

2 - m e t h

y l t h i o a d e n i n e s y n t h e t a s e

V N G 1 8 6 5 H

V N G 1 8 8 0 C

P F 0 1 9 7 9

m e t a l d e p e n d e n t h y d r o l a s e s u p e r f a m i l y

C O G 1 5 7 4

P r e d i c t e d m e t a l - d e p e n d e n t h y d r o l a s e w i t h t h e T I M - b a r r e l f o l d

m a t c h t o 1 I e 7 ( p d b ) - U r e a

A m i d o h y d r o l a s e ; r e q u i r e s C a i o n s

f o r f u n c t i o n

V N G 1 8 9 8 C

P F 0 0 5 8 2

U n i v e r s a

l s t r e s s p r o t e i n f a m i l y

C O G 0 5 8 9

U n i v e r

s a l s t r e s s p r o t e i n U s p A a n d r e l a t e d n u c l e o t i d e - b i n d i n g p r o t e i n s

m a t c h t o 1 m j h ( p d b ) - A T P - b i n d i n g

d o m a i n - b i n d s M n i o n s

V N G 1 9 2 5 H

V N G 1 9 4 0 H

V N G 1 9 7 3 H

V N G 2 0 0 6 C

P F 0 1 1 7 1

P P - l o o p s u p e r f a m i l y

C O G 2 1 1 7

P r e d i c t e d s u b u n i t o f t R N A ( 5 - m e t h y l a m i n o m e t h y l - 2 - t h i o u r i d y l a t e )

m e t h y l t r a n s f e r a s e , c o n t a i n s t h e P P - l o o p A T P a s e d o m a i n - m a y b e i n

T r a n s l a t i o n , r i b o s o m a l s t r u c t u r e a n d b i o g e n e s i s

V N G 2 0 2 7 H

V N G 2 0 3 9 H

V N G 2 0 5 4 H

P F 0 1 8 5 0

P I N d o m

a i n

C O G 1 4 1 2

U n c h a

r a c t e r i z e d p r o t e i n s o f P i l T N - t e r m . / V a p c s u p e r f a m i l y

V N G 2 0 5 9 H

V N G 2 0 8 1 H

V N G 2 0 9 7 C

C O G 2 3 1 1

U n c h a

r a c t e r i z e d m e m b r a n e p r o t e i n

V N G 2 1 9 1 H

V N G 2 2 5 9 C

P F 0 4 4 7 7

C O G 1 8 9 2

U n c h a

r a c t e r i z e d A r C R

V N G 2 2 6 0 H

V N G 2 2 7 3 H

V N G 2 2 9 8 A

P F 0 1 2 0 5

V N G 2 2 9 9 H

V N G 2 2 9 9 H

V N G 2 3 4 2 H

V N G 2 4 1 5 H

V N G 2 4 3 1 C

V N G 2 4 7 7 H

V N G 2 5 3 2 H

V N G 2 5 3 9 H

V N G 2 5 4 3 C

P F 0 1 8 7 1

A M M E C R 1 - m a y h a v e a b a s i c c e l l u l a r f u n c t i o n i n e i t h e r

t h e t r a n s

c r i p t i o n , r e p l i c a t i o n , r e p a i r o r t r a n s l a t i o n

m a c h i n e r y

C O G 2 0 7 8

U n c h a

r a c t e r i z e d A C R

V N G 2 5 5 6 H

V N G 2 5 8 2 H

P F 0 0 5 8 1

R h o d a n e

s e - l i k e d o m a i n - i n v o l v e d i n c y a n i d e

d e t o x i f i c a t i o n

C O G 0 6 0 7

R h o d a

n e s e - r e l a t e d s u l f u r t r a n s f e r a s e s

V N G 2 6 1 9 H

V N G 2 6 4 2 H

V N G 2 6 4 4 C

C O G 2 4 5 0

U n c h a

r a c t e r i z e d A C R

V N G 2 6 5 2 H

C O G 0 6 7 5

P r e d i c t e d t r a n s p o s a s e s

V N G 5 0 0 8 H

V N G 5 0 3 8 H

V N G 5 0 6 9 C

P F 0 0 7 5 3 /

P F 0 0 5 8 1

M e t a l l o - b

e t a - l a c t a m a s e s u p e r f a m i l y - r e q u i r e s

z i n c i o n s

a s c o f a c t o r / R h o d a n e s e - l i k e d o m a i n - i n v o l v e d i n

c y a n i d e d e t o x i f i c a t i o n

m a t c h t o 1 q h 3 ( p d b ) - H u m a n

G l y o x a l a s e I I - b i n d s Z n , M n , C l

i o n s i n s t r u c t u r e

V N G 5 0 8 3 H

V N G 5 1 3 7 H

V N G 5 1 7 3 H

a r s A 2

V N G 5 1 8 0 G

P F 0 2 3 7 4 -

a r s a 2 ( s b e

a m s )

A n i o n - t r a

n s p o r t i n g A T P a s e

m a t c h t o 1 f 4 8 A ( p d b ) - A r s e n i t e -

T r a n s l o c a t i n g A T P a s e

a r s D

V N G 5 1 8 1 G

a r s C

V N G 5 1 8 3 G

P F 0 1 4 5 1 -

a r s C

L o w m o l e c u l a r w e i g h t p h o s p h o t y r o s i n e p r o t e i n

p h o s p h a t a s e

m a t c h t o 1 j l 3 ( p d b ) - A r s e n a t e

R e d u c t a s e - b i n d s S O 4 2 - i o n s

V N G 5 2 0 0 H

m a t c h t o 1 f n n ( p d b ) - C e l l d i v i s i o n

c o n t r o l p r o t e i n 6

V N G 6 0 5 2 H

V N G 6 1 3 3 H

V N G 6 1 5 9 H

V N G 6 1 8 1 H

C O G 0 6 7 5


V N G 6 2 0 6 H

V N G 6 2 2 1 H

C O G 0 6 7 5


V N G 6 2 9 6 C

P F 0 0 5 6 1

a l p h a / b e t a h y d r o l a s e f o l d

C O G 0 5 9 6

P r e d i c t e d h y d r o l a s e s o r a c y l t r a n s f e r a s e s ( a l p h a / b e t a h y d r o l a s e s u p e r f a m i l y )

m a t c h t o 1 c q w ( p d b ) - H a l o a l k a n e

D e h a l o g e n a s e - b i n d s i o d i n e i o n s

i n s t r u c t u r e



Supplementary Table 5: Strains used in this study

Strain_name Gene

Plasmid used for

gene replacement Reference

Halobacterium NRC-1 (wild type strain) Ng. et al (2000)

Halobacterium NRC-1 � ura3 ura3 (parent strain gene deletions) Peck et al (2000)

Halobacterium NRC-1 � ura3 � cspD1 cspD1 pNBcspD1d this study

Halobacterium NRC-1 � ura3 � zntA zntA pNBzntAd this study

Halobacterium NRC-1 � ura3 �VNG0402H VNG0402H pNB0402Hd this studyHalobacterium NRC-1 � ura3 � phoX phoX pNBphoXd this study

Halobacterium NRC-1 � ura3 � sirR sirR pNBsirRd this study

Halobacterium NRC-1 � ura3 � yvgX yvgX pNByvgXd this study

Halobacterium NRC-1 � ura3 �VNG0703H VNG0703H pNB0703Hd this study


Halobacterium NRC-1 � ura3 �VNG1179C VNG1179C pNB1179Cd this study

Halobacterium NRC-1 � ura3 � appA appA pNBappAd this study

Halobacterium NRC-1 � ura3 � fepC fepC pNBfepCd this study



Halobacterium NRC-1 � ura3 �VNG5176C VNG5176C pNB5176Cd this study


Halobacterium NRC-1 � ura3 � iucA iucA pNBiucAd this study

Halobacterium NRC-1 � ura3 � ycdH ycdH pNBycdHd this study

ORF Knockout_ Mn Fe_st Fe_ts Co Ni Cu Zn Function

VNG0149G zntA NC NC - D D D D Zinc-transporting ATPase

VNG0457G phoX na NC - na NC na NC Phosphate ABC transporter periplasmic phosphate-binding

VNG0700G yvgX NC NC - NC NC D NC Molybdenum-binding protein

VNG2358G appA NC NC - NC NC NC NC Oligopeptide binding protein

VNG2558G fepC NC na - na na na na Ferric enterobactin transport protein

VNG2562H VNG2562H NC na - na na na na periplasmic binding protein, probably involved in iron transport

VNG6212G iucA NC na - na na na NC Iron transport protein A

VNG6265G ycdH NC NC - NC na na na Adhesion protein

VNG0101G cspD1 NC NC - na na na na Cold shock protein (putative regulator)

VNG0536G sirR D NC - NC NC NC NC Transcription repressor

VNG0703H VNG0703H na NC - na na NC na putative transcription regulator

VNG1179C VNG1179C NC NC - NC NC D NC putative Lrp-like transcription regulator (AsnC family)VNG5176C VNG5176C na na - na na na NC transcriptional regulator, arsR family

VNG1012H VNG1012H na NC - na na na NC glutaredoxin

VNG2652H VNG2652H NC NC - na na na NC putative transposase

VNG6182H VNG6182H NC NC - na na na na IS200-like transposase

VNG0402H VNG0402H na NC - na NC na na

Key

Phenotype mRNA abundance Fe_st: Fe steady state

NC No Change up Fe_ts: Fe time series

D Defective growth down

na not assayed no significant change

Supplementary Table 3. Phenotypes under selected metal stress for in frame single gene deletion strains

tfbA tfbB tfbC tfbD tfbE tfbF tfbG tbpB

VNG0019H Y Y Y YVNG0039H Y

VNG0040C Y

cspD1 Y Y Y

VNG0142C Y

VNG0176H Y Y

VNG0194H Y Y Y

VNG0258H Y Y

VNG0293H

VNG0320H Y Y

VNG0511H

VNG0703H Y

VNG1029C Y

trh7 Y

VNG1490H Y

cspD2

VNG2163H

rad3b Y Y

VNG2641H

VNG5009H VNG5144H

arsR Y

VNG6193H Y Y

VNG6441H Y Y

metal-binding regulators are indicated in red font

Y indicates mRNA level of transcription factor changed under the same conditions in which the

corresponding TFB mRNA also changed

Supplementary Table 4. Transcription factor binding sites in upstream regions of putative metal

response regulators

indicates binding site for TFB in the promoter of that gene



ORF Gene oligo_name oligo_sequence (5'-3')

VNG0101G cspD1 VNG0101G_a CCAGCGCGACGAAGTCCGGGA

VNG0101G_b ACTGTGACGCCTCGCACTCAT

VNG0101G_c AGTGCGAGGCGTCACAGTTAATCGGGATTCCGTATAGAC

VNG0101G_d TCCCGAATGATCTGGTGGGGG

VNG0101G_e CAGGCGGTTCAACGTGGACGA

VNG0101G_f GCGCTCGACGTTGATCTTGC

VNG0101G_g AATGGCGACAGGCGAAGTTG

VNG0101G_h GCCTGCTCGATGTCGAACTC

VNG0149G zntA VNG0149G_a CTGCGACCGGTGTATCCGTGA

VNG0149G_b CGGGTGATCGCGTGAAGACAT

VNG0149G_c TCTTCACGCGATCACCCGTAGCCGCCGGCCCAGCGCTAC

VNG0149G_d GGAGCCGTCGCCGGCGTGGTG

VNG0149G_e GAACGTCGAGATGGACTCCAG

VNG0149G_f ACATGAGTGCGCTCCCGTTG

VNG0149G_g ACGCCCAGTCGAATCAGACC

VNG0149G_h ATGGCCGACACGACTGACAC

VNG0402H VNG0402H VNG0402H_a ACTGGGAGAGATACGGCGCGA

VNG0402H_b ACCACGTTTCGTGTCGCCCAT

VNG0402H_c GGCGACACGAAACGTGGTTGACCGTCCCCGAAACGGTCG

VNG0402H_d CTTCCGGAGCTTGGACGCCAG

VNG0402H_e AACTTGTCGTGGTCGGGCTTG

VNG0402H_f TCGCGCTCCTGTTTGAGGAAG

VNG0402H_g AAAGAAGCGCGAACAACTCCG

VNG0402H_h GAGTTCGCCGTCCGGGAACTC

VNG0457G phoX VNG0457G_a GATCGATGGACTCGGCTTCCA

VNG0457G_b TTCGGCGTCGTCTGCTGGCAT

VNG0457G_c CCAGCAGACGACGCCGAATAGCGCGTCGCCCCACCCAGC

VNG0457G_d GCGGGCGTGATGTAGATGACG

VNG0457G_e CAGAGGCGGTCGACGTCGTCG

VNG0457G_f GGATGAACGACGAGAAGATG

VNG0457G_g CTGACCGTCATCGTCAACAC

VNG0457G_h ATGATGGTCCGGTCCTGTTC

VNG0536G sirR VNG0536G_a GCTGCCGCCGGGCGACCAGTA

VNG0536G_b AACACCGTCGTTTAGATGCAT

VNG0536G_c CATCTAAACGACGGTGTTTGAGCGCGTTCACGGAAGTCC

VNG0536G_d CAGCATTTCCCCCAGCCAGAT

VNG0536G_e GGTGGCGGCGTACGCTGCCGC

VNG0536G_f GAACGACACCGGATACTAAC

VNG0536G_g ACGCCCTCGAACACCACATC

VNG0536G_h CTCGGTGACCGTGAGTTCAG

VNG0700G yvgX VNG0700G_a GAACGCGCTGTCCCCGCCGCG

VNG0700G_b CCGCGCTGTTCTGGTCGTCAT

VNG0700G_c ACGACCAGAACAGCGCGGTAGCCGGGGTGTGGCGGCGCG

VNG0700G_d GCTTTTGGGTCAGTCCGCCGT

VNG0700G_e GGCTCTGGATCTGGCTGGTGA

VNG0700G_f ACCGAACTCGGTCAGTCACTC

VNG0700G_g GCGACCGCCTGAAAGTCAAAC

VNG0700G_h GACGAAGTACGCGCTGATGC

Supplementary Table 6. Oligonucleotides used for constructing and evaluating

gene knockout strains




VNG0703H VNG0703H VNG0703H_a CGCGATGGCGGTGTCGAGTGT

VNG0703H_b GGTTTCGTCAGTTGAACTCAT

VNG0703H_c AGTTCAACTGACGAAACCTAGCGCCTACACGACCGACGC

VNG0703H_d GCGCGTCCGGGAGGGGGTGGC

VNG0703H_e CGACGACCCCGCGGACGTGAT

VNG0703H_f CGTCGTCGGCGAACTACATC

VNG0703H_g CGAGTGCGAAGCTTGTACTG

VNG0703H_h AGGGCTTCAACGGGCTTGTC

VNG1012H VNG1012H VNG1012H_a CTCGTTGGAGCCACCGGGGCA

VNG1012H_b CGGTACGGTCGACACGCGCAT

VNG1012H_c CGCGTGTCGACCGTACCGTAGCGCGACTGGTCGGATTCC

VNG1012H_d ATCGTGGAAGTCATCAACGAC

VNG1012H_e GTGGACCGTGACACCGTCGCC

VNG1012H_f CAACACGGACAACCTCAAAG

VNG1012H_g ACTGCCCGTACTCCCAGAAG

VNG1012H_h GGGTTTCGAGGTGGGTGATG

VNG1179C VNG1179C VNG1179C_a CCTTCGAGACCTTCGGCGCGA

VNG1179C_b ACAGGCCAACAGCACAGCCAT

VNG1179C_c GCTGTGCTGTTGGCCTGTTGATGCAGCGCCACCGCTTCG

VNG1179C_d GCGTGGACGCCATCGTGCAGGVNG1179C_e CGCAGCCACCAGGATCATCGC

VNG1179c_f GGACGCAGTGCTGTATTTGG

VNG1179c_g TCTCCGACCGGATCACGAAG

VNG1179c_h CTCGAAATCGACGGTGTCTG

VNG2358G appA VNG2358G_a ATACCACGGAGATGATCGAGA

VNG2358G_b ATGGTTGTCTCTATTTGCCAT

VNG2358G_c GCAAATAGAGACAACCATTAAGCCACCAGTTCAGAGGGA

VNG2358G_d GATGATGAGCACGAGCGCGAA

VNG2358G_e GTGTCGGATCGCGTGGCGGTC

VNG2358G_f TCCGGAAGACGTGGTGTATC

VNG2358G_g TCGGGAAGGTCGGCATCAAG

VNG2358G_h TATCCGGCGCATAGCCGTAG

VNG2558G fepC VNG2558G_a ACAACCTCGGGGTCGTGATGT

VNG2558G_b GTTCGCGGGTTGTCGTGTCAT

VNG2558G_c ACACGACAACCCGCGAACTGAGGGCGGCGGATGCGGACG

VNG2558G_d CTCGGCGATGCCCACAACCAC

VNG2558G_e GAGCTCGCCAGCCCCTACATC

VNG2558G_f CCGACTCACAACGGTTATAC

VNG2558G_g TGGACCCACACCACCAACTC

VNG2558G_h TGCCGTCCTCGTCGTGTAAC

VNG2562H VNG2562H VNG2562H_a GCGGTGGGGGCGGCGGACTCG

VNG2562H_b GATCTGCCGTCTTCGCGCCAT

VNG2562H_c GCGCGAAGACGGCAGATCTAGGCAGCGATGACAGCCAAC

VNG2562H_d TTCTTCCACGCGATCGCGTAC

VNG2562H_e TCTCACCGAGCGCAGCCTGAT

VNG2562H_f CCGAACCGCACTTTCTCAAC

VNG2562H_g CGATTCGTACACGGTGACAG

VNG2562H_h CGGCGTAGAAGTTCTCCTTG

VNG2652H VNG2652H VNG2652H_a CCGAGAGCATCACGCACTTCT

VNG2652H_b ATAATCGTTCCATACTGTCAT

VNG2652H_c ACAGTATGGAACGATTATTGAGGGAACTACAAAAGCCTC




VNG2652H_d GCGTCCTCCAACGCCCCCACC

VNG2652H_e GCTGCGTCCGGCGAGGTGCAG

VNG2652H_f TCAACGTGAACTCCACTACC

VNG2652H_g CGTGTTCGTGCTGTGGTGAG

VNG2652H_h GATGAGGTTGGGCGGCTTAC

VNG5176C VNG5176C VNG5176C_a TCGGAAATCGAGTCGGTCACG

VNG5176C_b AGCGGTTGCGTCCTGAACCAT

VNG5176C_c GTTCAGGACGCAACCGCTTAATGACAACGAGACGATGGT

VNG5176C_d TCGAGATGACGACGTTGACGG

VNG5176C_e CAGGCGTTGGTCGACGCACGC

VNG5176C_f ACTCGGTGCTCTCGTCCTTC

VNG5176C_g TCAGCCATGGGCAACGACAC

VNG5176c_h TCGTCTCGGTCGGTTCGTAG

VNG6182H VNG6182H VNG6182H_a GGAAGAAACGTTCGATCAGGT

VNG6182H_b CGCGTGCCGTGTGGTCTTCAT

VNG6182H_c AAGACCACACGGCACGCGTGACCGAACTCACGAAGACGC

VNG6182H_d GCGTTCCTCTACGTCGCGGGT

VNG6182H_e GATTCGTGAACGCGACGCTGT

VNG6182H_F CCCGAAGGACTCCACGATAC

VNG6182H_G CGAAATAGCCGCCGACAAAGVNG6182H_H TCGACTGTCTCGCTCGAAAC

VNG6212G iucA VNG6212G_a AATCCGGCGGGCGACGCCGTC

VNG6212G_b CACCGCACCGACACCGGTCAT

VNG6212G_c ACCGGTGTCGGTGCGGTGTGACAGCGCCACTGCCCCGAA

VNG6212G_d GAACCCGGCGCGTTCGAAGGC

VNG6212G_e GAGTATCGATCCCCTGTCGGC

VNG6212G_f CGTGAACCGACTCCGTCATC

VNG6212G_g GGTTCTACCGGGACAACCAG

VNG6212G_h TCCGCCAACGACTCCAGTTC

VNG6265G ycdH VNG6265G_a GGGTCGATGTCACTCTAGACA

VNG6265G_b CGTGTGTGTCTGCTCGTCCAT

VNG6265G_c GACGAGCAGACACACACGTGACACCACACCACGACAACA

VNG6265G_d CAGTTCGGCCTCACCGGCGAG

VNG6265G_e AAATCCTTCTCGATCACGTTT

VNG6265G_f GATCACGTCCGTCATCAGTC

VNG6265G_g CCGTCCGCAATCTCATTCCC

VNG6265G_h CAACGAGTTCGACGCCATCC

Primers a+b and c+d were used to amplify flanking 500bp segments of the target gene. Using the

overlap in b and c primers the two 500bp segments were fused in a third PCR reaction using a+d

primers. Chromosomal primers e (upstream) and f (downstream) are external to the 500bp flanking

segments of the targetr gene. Primers g and h are internal to the intact gene and not present in the

deletion copy. Second crossover recombinant colonies were screened for gene deletion using primers

a+d or e+d. Colonies positive for a+d/e+d screening were further analyzed by a+d: this confirms

knockout; e+d and a+f: these confirm correct chromosomal location of the knockout; and g+h: this

confirms absence of intact copy. We also included a ura3 gene specific primer set to rule out presenceof plasmid in the cell.

gaggle analysis tools

Documents