from the ground and all around - illinois aitc booklets/sai... · from the ground and all around...

Illinois Agriculture in the Classroom

From the Ground and

All Around

A Complementary Lesson Booklet for IAITC’s

Summer Agriculture Institute

2 Illinois Agriculture in the Classroom


Table of Contents

Web Presence ............................................................................................................................. 4

Website Information ................................................................................................................... 5

Tagriculture ................................................................................................................................. 6

Earth Day/Energy ....................................................................................................................... 7

Earth Day Bracelet

Soil ............................................................................................................................................... 8

Say It With Soil

Soil Slurry

Soybeans/Corn/Wheat/Cotton ................................................................................................... 14

Beanie Baby

Corn Dissection

Anna’s Corn

Wheat Milling

Cotton Ginning

Livestock ................................................................................................................................................ 21

What COW Is This?

Milk: The Local Connection

Milk And So Much More

The Work Horse

Nutrition .................................................................................................................................................. 29

What I Eat

Mighty Microbes

Biotechnology ........................................................................................................................................ 35

DNA Bracelet

Cell Booklet

Urban ...................................................................................................................................................... 40

Urban vs. Rural

Pumpkin & Apple ................................................................................................................................... 42

3-D Pumpkin

Apple Chain

Online Resources/Recommended Reading ......................................................................................... 44


www.agintheclassroom.org

/agintheclassroom @ilagclass

Web Presence


Teacher Resources—In this section you will find lesson plans, printable AITC materials and lesson

booklets, and make-n-take activities that are ready for use in your classroom. You will also find grants

and other resources available to you.

Contact Your County Agricultural Literacy Coordinator—Here you will find our County Coordina-

tors listed in alphabetical order by county. These coordinators will help you get your hands on all of

our free resources, including Ag Mags and kits, and they may even be able to set up time to come into

your classroom to do activities with your students.

Teacher Workshop—We are constantly providing development opportunities for educators, many of

which offer CPDUs. Check back here often to see when we will be visiting your area and how you can

see more of our materials.

IL Farm Life—In this section, you will find photos, website links and other resources about general

Illinois agriculture.

County Support—This section is for county coordinators and staff only.

Social Media Buttons—Become a fan of our Facebook Page or follow us on Twitter by clicking on

this button or by searching for Illinois Agriculture in the Classroom. This is a great place to collaborate

and interact with other teachers with wonderful ideas to share. We also work to provide new videos,

lessons, articles and websites that will help you with lessons in your classroom.

U.S. Department of Agriculture AITC—Click here to go to the National AITC website. This is a great

place to go and see lessons from Ag in the Classroom programs around the country. Tons of great

stuff to explore.

Links—Find links to other agricultural organizations.

Support AITC—Clicking here will take you to the IAA Foundation website. The IAA Foundation raises

funds for the Illinois AITC program in order to provide educators with free or low cost information and

materials.

Contact Us—Here you will find contact information for Illinois AITC. However, your first contact

should always be your County Ag Literacy Coordinator, who is your link for free materials, kits and in-

formation.

About AITC—Learn about the history of both the National and Illinois Ag in the Classroom Programs.

Search—Search for lessons, activities and materials that will be useful in your classroom.

Tagriculture—Discussion board designed to share “best practices” of how agriculture can support

bigger causes. This can include classroom lessons, activities, etc. Open discussion with the ability to

communicate with others, ask questions, or share comments.

Website Information


A Teach Agriculture Initiative

Submission

The Community


Objective: After completing this lesson, students will discover the circles of our Earth and will be better

prepared for Earth Day!

Common Core: Language Arts: CCSS.ELA-Literacy.RI.4.3; RI.4.4; RI.4.5; RF.4.3a

Next Generation Science Standards:

Interdependent Relationships in Ecosystems: 3-LS2-1; 3-LS4-3; 3-LS4-4

Life Cycles & Traits: 3-LS1-1; 3-LS3-1; 3-LS3-2

Weather & Climate: 3-LESS2-1; 3-ESS3-1

Structure, Function & Information Processing: 4-LS1-1

Earth’s Systems: 5-ESS3-1

Background Information:

People move in circles. The earth provides us with everything we need to survive. We must take great care

of our valuable resources!

Water is a circle. Water rains down on land. Water collects in oceans, rivers, lakes, and streams. It

evaporates back up into the sky and collects in clouds. The clouds become heavy, and rain falls down to

land again.

Plants and soil are circles. Plants grow from soil. Plants provide food for animals. Animals provide food for

other animals. Animals die and decompose. New soil is made. New plants grow.

Earth is a circle. Earth is spinning through space, rotating on its axis, revolving around the sun. The Earth

and sun give us the circle of the seasons and the circle of night and day.

Air is a circle. Animals breathe in oxygen and exhale carbon dioxide. Plants take in carbon dioxide, use it to

make food, and give off oxygen. Animals breathe it in again.

The sun is a circle. The sun provides warmth for light for all of the Earth’s circles. Without the sun, plants

and animals would not survive. The sun binds us together.

Materials Needed:

1 pipe cleaner per student 1 small clear pony bead (people)

1 small blue pony bead (water) 1 small green pony bead (plants)

1 small brown pony bead (soil) 1 small orange pony bead (day)

1 small black pony bead (night) 1 small white pony bead (air)

1 small yellow pony bead (sun) 1 small red pony bead (animals)

Directions:

1. String the colored beads on to the pipe cleaner to represent the circles of the Earth. String opposite end of

the pipe cleaner back through the clear “People” bead. Now your clear “People” bead is an adjuster for the

bracelet.

Earth Day Bracelet


Say It With Soil

Objective: Instruction in this lesson should result in students achieving how to demonstrate

through writing and how soil interconnects with all living things.



Interdependent Relationships in Ecosystems: 3-LS4-4

Life Cycles & Traits: 3-LS3-2


Materials Needed:

ELA Lesson 2– Soil Quotes Handout– Say It With Soil (from Soil mAGic Kit)

Directions:

1. Using the provided quotes on the ELA Lesson 2– Soil Quotes Handout– Say It With Soil,

cut quotes into strips and distribute to students.

2. Students will read the soil quote and write a paragraph about the quote. Some/all of the

following questions should be addressed:

What does the quote mean to me?

What did this quote mean to the author?

Under what circumstances did the author write this quote?

Has this quote withstood the passage of time? Why?

Is this quote appropriate in today’s world? Why?

3. Students can share their writing with the entire class.

Adapted from Soil mAGic Kit


Say It With Soil

Soil Quotes Handout

Soil, like faith, is the substance of things hoped for, the evidence of things not seen. It is the

starting point for all living things that inhabit the earth. -Firman E. Bear; 1986

I know of no pursuit in which more real and important services can be rendered to any country

than by improving its agriculture. -George Washington; July 20, 1794

The soil is the source of life, creativity, culture and real independence. -David Ben Gurion,

Hazon VeDerek; 1950’s

There are two spiritual dangers in not owning a farm. One is the danger of supposing that

breakfast comes from the grocery, and the other that heat comes from the furnace. -Aldo

Leopold; 1949

A nation that destroys its soil, destroys itself. -Franklin D. Roosevelt; 1937

A conservationist is one who is humbly aware that with each stroke he is writing his signature on

the face of the land. -Aldo Leopold; 1949

When tillage begins, other arts follow. The farmers therefore are the founders of human

civilization. -Daniel Webster; 1840

If in the human economy, a squash in the field is worth more than a bushel of soil, that does not

mean that food is more valuable than soil; it means simply that we do not know how to value the

soil. In its complexity and its potential longevity, the soil exceeds our comprehension; we do not

know how to place a just market value on it, and we will never learn how. Its value is inestimable;

we must value it, beyond whatever price we put on it, by respecting it. -Wendell Berry; 1995

We know more about the movement of celestial bodies than about the soil underfoot. - Leonardo

DaVinci; 1500’s

Essentially, all life depends upon the soil...There can be no life without soil and no soil without life:

they have evolved together. -Charles E. Kellogg; 1938

..the Latin name for man, homo, derived from humus, the stuff of life in the soil. -Dr. Daniel Hillel;

late 1900’s

I saw all the people hustling early in the morning to go into the factories and the stores and the

office buildings, to do their job, to get their check. But ultimately it’s not office buildings or jobs that

give us our checks. It’s the soil. The soil is what gives us the real income that supports us all. -Ed

Begley; late 1900’s


Plowed ground smells of earthworms and empires. -Justin Isherwood; 1990

Soil erosion is as old as agriculture. It began when the first heavy rain struck the first furrow turned

by a crude implement of tillage in the hands of prehistoric man. It has been going on ever since,

wherever man’s culture of the earth has bared the soil to rain and wind. -Hugh H. Bennett and

W.C. Lowdermilk; 1930’s

We abuse land because we regard it as a commodity belonging to us. When we see land as a

community to which we belong, we may begin to use it with love and respect. -Aldo Leopold; 1949

I bequeath myself to the dirt, to grow from the grass I love; If you want me again, look for me under

your boot soles. -Walt Whitman; 1855

We are part of the earth and it is part of us...What befalls the earth befalls all the sons of the earth.

-Chief Seattle; 1854

Each soil has had its own history. Like a river, a mountain, a forest, or any natural thing, its present

condition is due to the influences of many things and events of the past. -Charles Kellogg; 1956

Nature has endowed the earth with glorious wonders and vast resources that man may use for his

own ends. Regardless of our tastes or our way of living, there are none that present more

variations to tax our imagination than the soil, and certainly none so important to our ancestors, to

ourselves, and to our children. -Charles Kellogg; 1956

Man and man’s earth are unexhausted and undiscovered. Wake and listen! Verily, the earth shall

yet be a source of recovery. Remain faithful to the earth, with the power of your virtue. Let your gift

-giving love and your knowledge serve the meaning of the earth. -Friedrich Nietzche; 1870’s –

1880’s

A cloak of loose, soft material, held to the earth’s hard surface by gravity, is all that lies between

life and lifelessness. -Wallace H. Fuller; 1975

I cannot conceive of the time when knowledge of soils will be complete. Our expectation is that our

successors will build on what has been done, as we are building on the work of our predecessors.

-R.S. Smith; 1928

Soils are developed; they are not merely an accumulation of debris resulting from decay of rock

and organic materials...In other words, a soil is an entity – an object in nature which has

characteristics that distinguish it from all other objects in nature. -C.E. Millar & L.M. Turk; 1943

We spend our lives hurrying away from the real, as though it were deadly to us. “It must be

somewhere up there on the horizon,” we think. And all the time it is in the soil, right beneath our

feet. -William Bryant Logan; 1996

The wealth of Illinois is in her soil and her strength lies in its intelligent development.

-Draper; 1899


Soil Slurry

Objective: After completing this lesson students will recognize that soil is made up of

different sized particles that will define its texture, be able to explain why different soil

particles form layers, and be able to use appropriate increments to measure soil layer

thickness.


Mathematics: CCSS.Math.Content.4.MD.A.2; 4.MD.B.4


Structure & Properties of Matter: 5-PS1-1; 5-PS1-2; 5-PS1-3; 5-PS1-4

Materials Needed:

2 quart jars with lids

Masking tape, to label jars

Dishwashing liquid

Plastic rulers

Science Lesson 2 Student Worksheet - Soil Slurry Data Table

Dry soil sample from garden, flowerbed or field

Soil sample from roadside, gravel pit or housing development, completely dry

* Samples for Soil Slurry are taken from the topsoil. Topsoil is the upper, outermost layer of soil, usually the top 2 to 8 inches. It has the highest concentration of organic matter and microorganisms and is where most of the Earth's biological soil activity occurs.

Vocabulary Terms:

Clay– smallest of three soil particles; when wet, feels sticky or greasy; when dry, hard and

brick-like.

Organic matter– partially decomposed plant and animal matter.

Sand– very tiny rock fragments; largest and heaviest of soil particles; feels gritty.

Silt– medium-sized soil particles; feels like flour.

Soil– the outer portion of the earth’s surface. Soil is the foundation of every living thing.


Directions:

1. Make sure that all dried soil clumps are crushed and that any rocks, roots and litter are

removed from the samples.

2. Label the two jars using the masking tape.

3. Fill the first jar ¼ full of soil sample A.

4. Fill the second jar ¼ full of soil sample B.

5. Add water to the jars until they are about ½ full.

6. Add 1 teaspoon of dishwashing liquid to each jar.

7. Making sure the lids are on securely, shake them hard for about 3 minutes. Continue

shaking until the particles have separated from each other.

8. Set the jars on a table. Observe them closely for 5 minutes. (The sand should settle to

the bottom in approximately 1 minute.)

9. Measure any layers and record the data.

10. Observe the jars after 30 minutes. (The silt will settle out in 30 – 60 minutes.)


12. Observe the jars after 24 hours. (The clay will take about 1 day to settle.)


14. Observe the jars after 48 hours. (The final sample should have a layer of sand on

bottom, followed by silt, with the clay at the top. Any floating material should be

considered organic matter.)

15. Measure any layers, students will record data on the Science Lesson 2 Student

Worksheet - Soil Slurry Data Table.


Science – Lesson #2 Name______________________________

Soil Slurry Data Table

Student Worksheet

Sample A Sample B

# of layers

(5 minutes)

Layer Measurements

(5 minutes)

# of layers

(30 minutes)

Layer Measurements

(30 minutes)

# of layers

(24 hours)

Layer Measurements

(24 hours)

# of layers

(48 hours)

Layer Measurements

(48 hours)


Beanie Baby

Objective: Upon completion of this activity, students will have a better

understanding of the plant germination process.


Mathematics: CCSS.Math.Content.4.MD.A.2


Structure & Properties of Matter: 5-PS1-4

Materials Needed:

Jewelry size re-sealable bag (found in craft stores)

Crystal Soil

Hole Punch

Water

Measuring Spoons

Soybeans

Yarn

Directions:

1. Punch a hole in the top of your bag.

2. Place a scant 1/4 teaspoon of Crystal Soil into the bag.

3. Add one tablespoon of water.

4. Gently push in two soybeans.

5. Seal your bag firmly.

6. Insert the yarn to make a necklace.

7. Wear your Beanie Baby around your neck and under your shirt to keep it in a warm, dark

place.

8. Check your Beanie Baby several times a day for germination and record the growth.

Lesson Extender:

Soybeans have many different uses in today’s society. Explain how the use of soybeans has

evolved since George Washington Carver studied them. Be sure to include your own

experiences along with information from the reading.


Objective: Students will understand the importance of corn as a crop in the United States.

They will also understand each part of the corn kernel.

Common Core Standards: Language Arts: CCSS.ELA-Literacy.L.4.4; L.4.4a; RI.4.3;

RI.4.5; RI.4.7


Interdependent Relationships in Ecosystems: 3-LS4-3; 3-LS4-4

Structure, Function and Information Processing: 4-LS1-1

Background Information/Questions:

What are the different kinds of corn? Sweet corn, popcorn, field corn/dent corn

What do we get from corn? Bubble gum, potato chips, popcorn, soda, ketchup, mustard,

etc.

What is ethanol? A high-performance fuel made from corn.

What is a kernel? A kernel is another name for a seed; it is usually within a husk or shell.

Parts of a Corn Kernel:

Pericarp - waterproof outer covering that protects the food energy

Endosperm - largest part of the kernel where energy is stored; provides starch

Germ - contains the genetic information for the corn plant; used for corn oil

Tip Cap - attaches the kernel to the cob (ear); where water and nutrients enter the kernel

from the cob

Corn Dissection


Materials Needed:

Soaked Kernels

Plastic Knives

Magnifying glasses

Directions:

1. Soak corn kernels 48 hours before dissection.

2. Pass out a few corn kernels to each student.

3. Students investigate the corn kernels with magnifying glasses.

4. Each student will dissect a corn kernel using a plastic knife.

5. Find and identify the four seed parts.

6. Draw a giant kernel on the blackboard and identify pericarp, endosperm, germ, and tip

cap.

Lesson Extenders:

1. Try dissecting soybeans! Soak soybeans 24 hours before dissection.

2. Monocot embryos have a single cotyledon while dicot embryos have two cotyledons. The

cotyledons are seed leaves produced by the seed’s embryo. Cotyledons absorb nutrients

packaged in the seed until the seedling is able to produce its first true leaves and begin

photosynthesis.

Activity:

Using potting soil, sprout some corn and bean seeds in two separate containers.

Observe the similarities and differences as the plants grow.

Do you notice the single blade of the corn seeds? This signifies that corn is a monocot.

Do you see the two leaves of the beans? This means that beans are dicots.


Anna’s Corn

Objective: After completion of this lesson students will learn more about shelling corn by

hand and about how corn is shelled today by combines. They will have the opportunity to

take their corn home and start their own garden!



Life Cycles & Traits: 3-LS1-1; 3-LS3-2


Materials Needed:

Pouches– www.giftsintl-us.com - packs of 25 for $3.00

Squirrel Corn– Wal-Mart—Approximately 20 ears for $5.47

Directions:

1. Begin by reading the book Anna’s Corn by Barbara Santucci.

2. Have students hold an ear of squirrel corn in their hands. Talk about the different types of

corn using the Corn Ag Mag.

3. Students should shell (pull off) a few kernels of corn to place in their pouch. Remind

students that before machinery took over the job, corn was shelled by hand.

4. Encourage students to take their corn home and plant it and watch it grow.

http://www.giftsintl-us.com


Wheat Milling

Objective: This lesson will introduce students to wheat as a plant and how that plant becomes food(s).





Materials Needed: Wheat Stalks Salt or Pepper Grinder

Directions: 1. Show students wheat stalks. 2. Go over the parts of the wheat stalk with the students to familiarize them with the parts so

they can understand the directions for dissection.

Stalk—the entire plant. Head—the part of the wheat plant that contains the kernels. Beard—the bristle-like parts of the wheat plant that cover and protect the kernels. Kernel—the seed from which the wheat plant is grown or that people harvest from the wheat

plant to grind into flour. Stem/Straw—the part of the wheat plant that supports the head and is known as straw after

harvest. 3. Dissect the wheat using the following steps: Hand out stalks of wheat to the students. Break the head off the stem. Make a straw out of the stem by breaking it to avoid the nodes. Lay the wheat head flat on a hard surface and pat with your hand to shake out the kernels. Have the students count their kernels. 4. Put the kernels of wheat into a salt or pepper grinder and have the students mill their wheat

into flour. What simple machines are being used? 5. Talk about different ways to grind wheat. The Native Americans did it using rocks, etc.

Have students design their own method of grinding wheat and then test their machines. 6. Talk about the uses of wheat flour to make pastas, breads, desserts, etc.

Lesson Extender! 1. Have students find the gluten in wheat by chewing the kernels. Before there was chewing

gum in the store, farmers made their own with grains of wheat! This and other activities can be found in the back of the book Bread Comes to Life.

Adapted from Wheat mAGic Kit


Cotton Ginning

Objective: By examining cotton, students will grasp and be able to relate how cotton influenced the

slave trade, slave culture, economic policies, the Civil War and the Industrial Revolution.

Common Core Standards: Language Arts: CCSS.ELA- Literacy.RI.4.3; RI.4.4; RI.4.5; RF.4.3a

Mathematics: Math.Content.3.0A.A.1




Materials Needed:

Order Cotton Bolls from www.cottonman.com

Background:

If you ask someone “What was the cause of the Civil War?” chances are they will answer “slavery.” True, but why did the South want or need slaves? Cotton. Cotton picking was a job for healthy adult slaves. Generally, these slaves would hand pick cotton in the fields all day. Ginning cotton means to remove the lint or fiber from the seed. It is important to remember that the more lint one removed from the seed, the more profit from each boll. Your students may have anywhere from 12-42 plus seeds per boll, as did the slaves. A slave could gin one pound of cotton a day. Eli Whitney is generally credited with the invention of the cotton gin (1793). He basically wanted to “rake” the fiber from the seeds. His machine, operated by a hand-crank, revo-lutionized the production of cotton. With the invention of the cotton gin, one slave could gin 50 pounds of cotton a day. Did this mean plantation owners needed fewer slaves? No, this machine meant cotton was a more profitable crop. Now plantation owners needed more slaves to produce more cotton. Today, the United States produces 43 million tons of cotton annually. The largest cotton producing states are Texas, Mississippi, and Georgia. Cotton is even an important crop in the West. Arizona and California are well-known for their Pima cotton, which is a finer, more expensive cotton fiber. Most of those fuzzy seeds are fed to dairy cattle or processed into cottonseed oil, which can be found in nearly every kind of snack food including chocolate candy bars. Adapted from Growing a Nation found at www.agclassroom.org

http://www.cottonman.com

http://www.agclassroom.org


Directions:

Share with the students the background information about cotton and slavery. Give each

student or group of students one cotton boll (see materials list) for ginning. Have your students

examine the woody stem and the boll holding the cotton fibers. Ask them to predict how many

seeds they think are in their boll.

Questions:

1. Who invented the cotton gin, and in what year?

2. How many pounds of cotton could a slave gin in one day by hand? How many could a slave

gin in one day after the invention of the cotton gin?

3. Ask students if they can understand why it was so painful to pick this plant by hand. Would

gloves have been available? Would it have been possible to gin cotton by hand with gloves?

What may slaves have used to protect their hands from getting cut?

4. Ask students to compare their prediction with the actual number of seeds. Were there more

or less than they thought? How did they like the work? Why would people have had so few

changes of clothes during this period?

5. Discuss the invention of the cotton gin. Ask your students how many years passed after the

invention of the cotton gin until the beginning of the Civil War. Did the tension between the

northern and southern states escalate after this important invention?

For questions 6 –8, assume it takes 350 bolls of cotton to make one pair of jeans.

6. How many bolls of cotton would it take to make 5 pairs of

jeans?

7. How many bolls of cotton would it take to make 7 pairs of

jeans?

8. Jacob collected 7,350 bolls of cotton, how many pairs of jeans

can this make?


What COW is this?

Objective: Students will learn similarities and differences between dairy cattle and beef cattle.



Life Cycles & Traits: 3-LS1-1; 3-LS3-1; 3-LS3-2; 3-LS4-2

Structure, Function, and Information Processing: 4-LS1-1; 4-LS1-2

Background Information:

All female cattle breeds produce milk and meat, but some cattle are better milk producers, while some

are better meat producers. Beef cows provide us with meat and other by-products such as crayons,

plastic, insulin and pet foods. Dairy cows produce milk products. Since dairy cows produce milk, they

usually have very large udders. For this reason, dairy cows are a different shape than beef cows. The

basic shape of a dairy cow is a trapezoid. The basic shape of a beef cow is a rectangle. Dairy cows

must be milked 2 to 3 times a day and because of this they are very scheduled animals. Most dairy

cows will make their way to the barn from the pasture without the assistance of the farmer, because of

this routine they become accustomed to. Beef cattle on the other hand do not have as rigid a

schedule, so they can be seen out in the pasture for longer periods of time and they will be moved

from one pasture to another pasture more often. Some beef cattle will even be miles away from the

main farm when they are put out to pasture.

Directions:

1. Hand out Beef and Dairy Ag Mags. Have students read through the Ag Mags. While reading,

encourage students to highlight any information or interesting facts they discover.

2. Share the background information with students.

3. Provide students with the Venn diagram template to chart the similarities and differences between

beef and dairy cattle. Students can use the information from the Ag Mags or search for their own

information using books and the Internet.

4. Create a Venn diagram on a chalkboard or large piece of paper. Record student responses as they

share what they found.

Extension Activities:

Have students extend their Venn diagrams by comparing/contrasting another Illinois farm animal.

Collect products made from beef and dairy cattle. Have students sort the products into two groups

to reveal beef and dairy products.

Ask students to design their own beef and dairy cows, starting with appropriate shapes: rectangle

for beef and trapezoid for dairy. Encourage students to use information within Ag Mags to add

other features to their cows.

Adapted from Oklahoma Agriculture in the Classroom


Dairy Cattle

Beef Cattle

What COW is this? Venn Diagram


Objective: Every milk product contains a code on the packaging that details which dairy the product came from. Find the code, enter it into the code location at the site www.whereismymilkfrom.com and you’ll find out what dairy your milk came from!


Next Generation Science Standards: Earth Systems: 5-ESS3-1

Directions: 1. Find the code on your own container or find a sample code from the map on the next

page. Investigate the following from your code: • From what dairy did your milk come? • How many miles did your milk travel? • Are their other dairies closer to you than the one from which your milk came? • Investigate different brands of milk purchased in the same store or in the same town. • What did you notice about the different brands of milk and the locations of dairies? • Why do you think some stores carry milk from multiple locations? • As you conduct your own research, notice that your milk can come from a variety of

places in the state and outside the state. What parts of the state are typically represented with milk from dairies located outside the state?

• If possible examine the code on UHT Pasteurized Milk. Why is it produced in other states?

www.whereismymilkfrom.com


http://www.whereismymilkfrom.com


Objective: After completing this activity, students will understand how

sensitive fats and proteins are to new substances and how this

sensitivity helps control the molecules in milk so different products can

be made from milk.

Common Core:

Language Arts: CCSS.ELA-Literacy.RI.4.3; RI.4.4; RI.4.5; RF.4.3a

Mathematics: CCSS.Math.Content.4.MD.A.2; 4.MD.B.4


Structure & Properties of Matter: 5-PS1-1; 5-PS1-2; 5-PS1-3; 5-PS1-4

Introduction:

Milk is mostly water but it also contains vitamins, minerals, proteins and tiny droplets of fat

suspended in solution. Fats and proteins are sensitive to changes in the surrounding

solution (the milk).

When you add soap, the weak chemical bonds that hold the proteins in the solution are

altered. It becomes a free-for-all! The molecules of protein and fat bend, roll, twist and

contort in all directions. The food coloring molecules are bumped and shoved everywhere,

providing an easy way to observe all the invisible activity.

At the same time, soap molecules combine to form a micelle, or cluster of soap

molecules. These micelles distribute the fat in the milk. This rapidly mixing fat and soap

causes swirling and churning where a micelle meets a fat droplet.

Milk is mostly water and it has surface tension like water. The drops of food coloring

floating on the surface tend to stay put. Liquid soap wrecks the surface tension by

breaking the cohesive bonds between water molecules and allowing the colors to zing

throughout the milk. What a party!

Milk and So Much More


Materials Needed:

Milk (whole or 2%)

Dinner plate

Cotton swabs

Food coloring (red, yellow, green, blue)

Dish-washing soap (Dawn brand works well)

Directions:

1. Pour enough milk in the dinner plate to completely cover the bottom. Allow the milk to

settle. There should be no ripples in the milk before starting this activity.

2. Add one drop of each of the four colors of food coloring - red, yellow, blue, and

green - to the milk. Keep the drops close together in the center of the plate of milk.

3. Find a clean cotton swab for the next part of the experiment. Predict what will happen

when you touch the tip of the cotton swab to the center of the milk. It's important not to

stir the mix. Just touch it with the tip of the cotton swab.

4. Now, place a drop of liquid dish soap on the other end of the cotton swab. Place the

soapy end of the cotton swab back in the middle of the milk and hold it there for 10 to

15 seconds.

5. Add another drop of soap to the tip of the cotton swab and try it again. Experiment with

placing the cotton swab at different places in the milk.

Review:

1. Describe how the milk reacted when you first added the food coloring drops (step

number 2).

2. What did you predict would happen when you touched the cotton swab to the center of

the milk, why (step number 3)? Explain what actually happened.

3. Explain what happened when the soapy cotton swab was held on the surface of the

milk.

4. What happened when you placed the soapy cotton swab in different locations of the

plate? Would this work with the plain cotton swab, why or why not?

5. What makes the food coloring in the milk move?

6. Explain why this activity would or would not work with regular tap water.

Exercise adapted from Kitchen Chemistry:

http://www.stevespanglerscience.com

http://www.stevespanglerscience.com


The Work Horse

Objective: After completing this activity, students should be able to identify types of simple

machines and be able to provide an example for each machine used.

Common Core: Language Arts: CCSS.ELA-Literacy.RF.3.4; W.4.3; W.4.7


Forces & Interactions: 3-PS2-1

Energy: 4-PS3-1; 4-PS3-3; 4-ESS3-1

Introduction: Simple machines are tools that we have devised to make everyday tasks easier.

Simple machines are tools that generally have few to no moving parts and can be found all

around us. In early history, humans used the combination of simple machines and horses to

perform amazing tasks that have helped reduce work. Explain the seven types of simple

machines and how they work. These machines can be tied back to horses and agriculture, some

examples are: covered wagons = wheel and axle, an axe for cutting wood = wedge, hoisting water

in a bucket from an old well = pulley, dumping contents from a wheelbarrow = lever, sloping roads

(the horse pulling the cart up the hill) = inclined plane. After students understand how each

simple machine works, complete this school or classroom scavenger hunt.

Lesson Extender!

1. Have students develop their own machine that performs an activity that they don’t like doing.

For example, a student may develop a machine that takes out the household trash. The new

designs should include no less than three simple machines that they just learned about. Allow

the option for students to actually create machines or have them complete sketches of their

inventions just like Leonardo might have! Have students share their inventions with the class

and their motivation for wanting this particular machine.

2. Place regular household items that are simple machines in a brown lunch sack. Have

students describe what the item is used for and what type of machine it is. For example, a pair

of scissors or a letter opener.

Adapted from Machines mAGic Kit


Name______________________________ Today’s Date___________

Directions: In the time frame set by your teacher, begin searching for simple machines that

we use in everyday life. Use only the locations set up by your teacher and make sure to

write either the name of the object or a description of the object so other students will know

what you have found. Happy Hunting!

# of Items Found Name of Machine

Found

What Category of

Simple Machine?

Location

One pair Scissors Lever Mrs. Smith’s Desk

in Homeroom


What I Eat!

Objective: After completing this activity, students will have explored, compared and contrasted the nutritional habits of individuals all around the United States. They will also be able to investigate how weather, landscape and soil types affect agriculture all around the world. Common Core: Language Arts: CCSS.ELA-Literacy.RI.4.2; RI.4.3; RI.4.6; RI.4.7; RF.4.4; W.4.3; W.4.7; SL.4.2


Life Cycles & Traits: 3-LS3-2

Weather & Climate: 3-ESS2-2

Directions: 1. Begin by having students keep a journal of everything they eat for one day. This should include serving size, number of servings consumed, and total calories consumed. 2. Discuss the book, What I Eat: Around the World in 80 Diets. 3. Assign 1 person from the book to each student. Give the students a photocopy of their person

from the book including all pages with the details about their assigned person. Some details to look at are the age, height and weight of the individual. The information on these pages also gives some details about the individual’s family and community.

4. Have the students write a report on what their assigned person ate compared to what they ate

themselves. Students should also investigate the state/country from which their assigned individual came. Their report should include agricultural aspects as well, such as weather/climate, topography/landscape, soil types, etc. Each student should use these findings in their discussion of why the individual of their assigned state/country can grow specific foods and why they can’t grow other types of food. Students should also discuss nutritional aspects. Does the food purchased fulfill all of the nutritional needs of the person in the photo?

5. After writing their report, have the students prepare a short presentation about their assigned

individual. This could be done with a PowerPoint presentation or just a general sharing session.

6. After all students have shared their findings, discuss how the United States differs from other

countries. What kind of land and climate do we have? What types of food do we buy? Did all of the Americans buy similar types of food? Which person in the book ate most nutritiously?

7. Use What I Eat as a reference to have students explain how a selected image from the book,

as well as other images, contribute to clarify their understanding. Lesson Extender! 1. Have students compare and contrast different families from the book. They could compare

types of food eaten, obesity rates, nutritional value, etc.


Mighty Microbes

Objective: Students will determine the source and cause of an illness that makes many

picnickers sick. They will interpret data tables, classify items, and read samples of newspaper

articles that are incorporated into this investigative epidemiological mystery.

Common Core: Language Arts: CCSS.ELA-Literacy.RL.4.3; RI.4.3; RI.4.5; RI.4.7; RF.4.4;

W.4.1; W.4.3


Structures and Properties of Matter: 5-PS1-1; 5-PS1-2; 5-PS1-3; 5-PS1-4


Vocabulary Terms:

Epidemiology- The study of the patterns, causes, and effects of health and disease conditions

in defined populations.

Outbreak- An occurrence of disease greater than would otherwise be expected at a

particular time and place.

Dichotomous- Divided into two parts or classifications.

Materials Needed:

For each student:

1. What Caused the Illness? Student page

2. What Caused the Foodborne Illness? Dichotomous Key

3. Samples of newspaper articles

Directions:

1. Explain to the students that they will become epidemiologists and determine the cause of an

illness that affected many people in a community. Have someone read the dictionary

definition for “epidemiology” and discuss its meaning. Also, discuss that actual epidemiology

cases are much more complex than the hypothetical case they are about to analyze.

2. As a class read the foodborne illness outbreak scenario on page 10.

3. Discuss the terms “outbreak” and “dichotomous,” as well as any others the students may find

difficult. Create a class vocabulary list if necessary. Have student duos complete the activity

as described on the student worksheet.

Answer Key:

The unhealthy microbes in the fruit juice were most likely transmitted by an ill worker who had a

foodborne illness himself. His improper handling of the cups and juice, along with warm

temperatures, spread the disease to the juice. The dichotomous path used to reach this

conclusion is: 1a, 2a, 3a, 4a, 5a.

* Have newspaper articles handy for students to use as a guideline for writing their news article

as described on the next page. Adapted from California Ag in the Classroom


What Caused the Illness?

Scenario

The local hospital has treated numerous people for dehydration due to uncontrollable vomiting followed by

diarrhea. The county health department is conducting an investigation to determine the causative agent. It

was determined that all the patients ate at a community get-together on May 16 and that the illnesses were

caused by a foodborne pathogen, a disease-causing microorganism obtained from something the people

ate or drank. Look at the data chart on page 32. Each of the 20 people in the chart were hospitalized.

Determine what food was responsible for the food poisoning.

1. From the data above, what food do you suspect caused the illness?

_____________________________________________________________________________________

2. In one complete sentence, describe your reasoning.

_________________________________________________________________________________________

_________________________________________________________________________________________

3. Discuss your reasoning with the lead epidemiologist (your teacher) and then obtain the dichotomous

key to continue your investigation.

4. Using the dichotomous key, determine the actual source of the illness. Complete the following

statement. “Through scientific investigation, my team has determined that the people at the get

together on May 16 became ill because

______________________________________________________________________

5. Suppose you are a reporter for the local newspaper. Write a three to five paragraph article that

describes what happened, why it happened, and how the foodborne illness could have been avoided.

Before writing your story, examine a newspaper article to see how it is set up. Make sure your article

has:

a headline

authors listed

facts of what happened

facts about foodborne illnesses in general

how this incidence could have been avoided

quotes from experts or witnesses (pretend you interviewed patients, event planners, food handlers,

epidemiologists, etc.)

been proofed for spelling, capitalization, proper punctuation, sentence structure, and flow of story

Adapted from California Ag in the Classroom


What Caused the Foodborne Illness? Dichotomous Key

Instructions: Read number 1. Determine which statement, a or b, best reflects the incident and information. Proceed as

directed, until the illness is traced back to its source. This is called a “trace-back,” something that epidemiologists do on a

regular basis.

2. Water used to dilute the juice concentrate came from the tap and is tested by the city’s Public Works Department on a

regular basis. Here are the data for a 3-week period.

a. If the bacterial level of the water was 0 or less, the water was not the cause. Go to 3.

b. If the bacterial level of the water was 1 or higher, bacteria from the water could be the culprit.

Juice Batch No. Bacterial Count

10393-PR 0 per 3 mL juice

10394-PR 0 per 3 mL juice

10395-PR 0 per mL juice

Test

Performed

May 10 May 17 May 24

Level

Max.

Allowable

Bacterial

Count

None None None None

Copper (ppm) 40 30 40 170

Nitrates (mg/l)* 22 19 21 45

Calcium (ppm)

**

48.2 41.7 48.1 300

Lead (ppb)*** None None None None

Fluoride (ppb)

***

110 98 110 2000

3. Ice was added to the juice. The ice came from ice cubes made of city water and were made fresh with clean ice cube

trays.

a. The ice was probably not the source of illness. Go to 4.

b. The ice could have been the problem. Adapted from California Ag in the Classroom

1. The fruit juice was made from frozen fruit juice concentrate, which was pasteurized at the plant. Pasteurization is when

something is heated to a temperature high enough to kill microorganisms. The can had a batch number of 10394-PR on its

end. A bacterial count was determined from a frozen concentrate with the same batch number. Look at the chart above.

a. If the bacterial count was 0 in 3 milliliters of juice, the illness was not likely caused by the concentrate itself. Go

to 2.

b. If the bacterial count was 1 per 3 milliliters of juice or greater, the illness was likely caused by

the bacteria in the concentrate before preparation. Illness came from fruit juice concentrate.


5. A quick survey of the overall health of the workers indicated that one of the workers at the fruit juice station

had a severe stomachache and was feverish the night before the event.

a. A sick worker could have spread a foodborne

illness to the guests at the event.

b. A sick worker could not have spread a foodborne

illness to the guests. Go to 6.

6. Most bacteria grow best between the temperatures of 40°F and 140°F.

View the chart below and the description in 4 and determine whether the

outside temperature could have aided in bacterial contamination.

a. Outdoor temperatures could have caused contamination.

b. Most likely outdoor temperatures did not contribute to the illness.

Go to 7.

7. How the juice was dispensed or stored could be the problem.

a. The juice could have sat in the cup for longer than two hours, as

much time as it takes for harmful bacteria to reach a population that

could cause illness. Juice that was not kept cool enough was most likely

the problem.

b. The illness was caused by something other than handling. Further

investigation needs to occur before a probable cause can be determined

at this time.


Temperatures at Park

on May 16

Time Temperature

10 a.m. 62

11 a.m. 69

Noon 71

1 p.m. 80

2 p.m. 85

3 p.m. 86

4 p.m. 88

5 p.m. 88

6 p.m. 87

7 p.m. 82

8 p.m. 75

9 p.m. 69

10 p.m. 61

4. The prepared juice was at the park for the entire event on May 16 from 2 pm- 5 pm. Use the following

Information gathered from the event manager to make an appropriate choice. The juice was prepared at noon

on May 16th in insulated jugs that each hold 5 gallons. The juice concentrate was frozen at the time it was made

and was mixed with tap water. The coordinator made the volunteers wash their hands before making the juice. A

few ice cubes were put into the insulated container, which the volunteers rinsed out with hot, soapy water prior

to using. It was stored at room temperature until 1 p.m. at which time it was taken outside to the picnic tables. At

the event, juice was removed from the container through the push button spout and placed into paper cups. The

filled cups were on the table throughout the event. When necessary, new paper cups were filled with juice. The

coordinator said that less people attended the event than expected but that everyone had a great time. The

event ended at 5 p.m.

a. The juice seemed to be prepared following food safety procedures. Go to 5.

b. The juice was not prepared following basic food safety procedures. Go to 6.


DNA Bracelet

Objective: Every living thing is composed of cells. Construct a 3-D model of a

DNA Helix and investigate how our cells make us look like we do.

Common Core: Language Arts: CCSS.ELA-Literacy.RI.4.5; RF.4.4 Next Generation Science Standards: Life Cycles & Traits: 3-LS1-1; 3-LS3-1 Structure & Properties of Matter: 5-PS1-1

Materials Needed:

Pony Beads in the following colors: Purple, Yellow, Green and Pink

Pipe cleaners or bracelet string from a craft store.

Directions:

1. Choose one DNA code from the chart provided by your teacher. You will need this chart to

follow the DNA pattern to make your bracelet.

2. Thread a bead onto your first pipe cleaner. Then on the second pipe cleaner thread the

matching bead. Use the guide below to help. Example would be if your first bead on the

first pipe cleaner is Pink (T) then on your second pipe cleaner the bead would be Green

(A), because T always pairs with A.

3. Finish out both sides of your DNA strands following the pattern provided by your teacher.

4. Once all your beads have been placed on the pipe cleaners twist them into the form of a

Helix (sometimes referred to as the DNA ladder).

5. Tie the pipe cleaners together to form a bracelet to fit your wrist. See if your friends can

figure out what plant or animal you are based on your DNA.

Base Pair Chart

A (green) pairs with T

T (pink) pairs with A

C (yellow) pairs with G

G (purple) pairs with C

Adapted from www.ology.amnh.org/explore/ology/genetics#

http://www.ology.amnh.org/explore/ology/genetics


DNA Codes

Monarch Butterfly (Danaus Plexippus)

gaggctaccaagtttccgatctgcaggagatgcattgaaagatcgtttcg

Grizzly Bear (Ursus Arctos)

atgaccaacatccgaaaaacccacccattagctaaaatcatcactacte

Sunflower (Helianthus Annuus)

tgagatgctagaaggtgcaaaatcaatagggcccggagctgctacaattg

Chimpanzee (Pan Troglodytes)

tgaccccgacacgcaaaattaacccactaataaaattaattaatcactca

Human (Homo Sapiens)

tgaccccaatacgcaaaattaaccccctaataaaattaattaaccgctca

African Elephant (Loxodonta Africana)

atcaccgacattcgaaaatctcatccttcactcaaaatgatgaataaatc

Apple Tree (Malus Domestica)

gaattcggcacgagaagaaacgaagagagagagagagag-caaaaatggtt

Red Flour Beetle (Tribolium Castaneum)

cacaacctcggggatcgccttcgccatcctctgcctggccgagaatccca

Brown Trout (Salmo Trutta)

ctttggctcactcttaggcttgtgtctagccacccaaatcttaccggac

Human Heart

gttgctggtacaatctcataaaatcgggctccagtgtttagagaaggacag


Exploring Cells

Objective: Students will learn about the similarities and differences of plant and animal cells during

this activity.

Common Core: Language Arts: CCSS.ELA-Literacy.RF.4.3; RF.4.4; W.4.7


Structure & Properties of Matter: 5-PS1-1; 5-PS1-3


Directions:

The goal of this exercise is to design a creative and colorful amusement park map. The animal cell

or the plant cell will serve as your “amusement park.” This brochure will provide visitors with a tour

of the cell. Maps at amusement parks always explain the location of each attraction and what it does.

Be sure to include this on your map! Each attraction in the map should come from the organelles

that make up either the animal or plant cell.

1. Select from the animal or plant cell.

2. Make a list of the organelles found in your selected cell. Each organelle should serve as a stop

on your amusement park map. On a scrap piece of paper, create a rough draft on how you want

your brochure to appear.

3. Once you have designed your amusement park tour acquire the paper plates needed to create

your brochure.

Paper Plate Booklet:

1. Fold the first paper plate in half and cut a narrow window out of the folded edge. Start the window

after the ruffled edge and end before the other ruffled edge.

2. Any additional pages should be folded and then reopened. On the fold, cut one slit starting from

the edge of the plant and ending at the ruffle (cuts should be no longer than an inch). Make a

second slit directly opposite the first one.

3. To assemble the booklet. Fold, but do not crease, the paper plate with the slits in half so that the

two slits meet. With the plate folded in half, push the plate through the slit. Open the plate,

moving one slit to the top of the window and one slit to the bottom of the window.

4. Close the brochure so all the plates are folded in half. Design the front cover to match your cell.

5. Use the inside pages to serve as the maps to the amusement park attractions.

Adapted from Dinah Zike’s Foldables


Animal Cell

Cell Membrane

Nucleus

Vacuole

Ribosome

Mitochondria


Plant Cell

Cell Membrane

Nucleus

Vacuole

Ribosome

Mitochondria

Cell Wall Chloroplast


Urban vs. Rural

Objective: 1. The students will be able to examine and identify similarities and

differences between urban and rural communities. 2. The students will be able to use language arts skills to read from

the poster boards. 3. The students will be able to use primary sources to determine the

characteristics of different types of communities.

Common Core: Language Arts: CCSS.ELA-Literacy.RL.4.1; RL.5.3; W.4.2; W.5.2

Next Generation Science Standards: Interdependent Relationships in Ecosystems: 3-LS2-1; 3-LS4-3 Weather and Climate: 3-ESS2-2 Earth’s Systems: 5-ESS3-1

Materials Needed: Poster Board Magic Markers Magazines Newspapers Scissors Glue

Directions: Ask the students to list the characteristics of urban and rural communities. Make a list on the board or on chart paper. Encourage students to discuss the following aspects of communities: transportation, schools, homes, shopping, nature, businesses. 1. Read with students the book Town Mouse, Country Mouse by Jan Brett. 2. After reading the book, look again at the list you made of characteristics of urban and rural

communities. 3. Give each student a copy of the venn diagram and ask them to list characteristics of each

that they observed in the book. Be sure to have them include areas where the two communities were similar in the middle part of the venn diagram.

4. Have students discuss what characteristics define each community and which are similar to both communities.

Lesson Extender! 1. What type of community do you live in? Ask students to cut out pictures from magazines

or newspapers of anything that reminds them of their community. They will take these pictures and paste them to poster board to make a collage. In class, they can share their collages with their classmates and discuss similarities and differences of the collages that they have made. What type of community has the most people in it? How are the communities different? How are the communities the same?


Venn Diagram

Write details that tell how the subjects are different in the outer circles. Write details that tell

how the subjects are alike where the circles overlap.

Rural

Urban


Objective: After completing this lesson, students will have more knowledge of Illinois pumpkin facts and will learn more about the process from the pumpkin seeds to the mature pumpkins.

Common Core: Language Arts: CCSS.ELA-Literacy.RL.4.3; W.4.2


Animals, Plants & their Environment: K-LS1-1


Materials Needed:

Orange construction paper

Green construction paper

Hole punch

2 paper fasteners for each pumpkin

Scissors

Directions:

1. Begin by reading the Pumpkin Ag Mag.

2. Cut 3 strips about 1 in. wide down the short side of the orange paper.

3. Write a pumpkin fact on each strip.

4. Holding the strips together in a stack, use a paper punch to make 3 holes in the strips. Punch one in the middle and one 1/2 inch from each end.

5. Cut strips of green construction paper into 1 inch by 1 inch squares. Punch a hole in the middle of these squares. This will be the pumpkin’s stem.

6. Still holding the strips together, place the stem on top of the middle hole and put a paper fastener through the stem and the orange strips of paper in the middle hole.

7. Bring the ends of the long orange strips and fasten them all together.

8. Spread out the paper strips to form a pumpkin.

Another Variation: Trace your hand for the leaf, keeping your fingers together. Cut strips of green and curl them with a pencil for vines. Finish pumpkin by completing steps 7 and 8.

3-D Pumpkins


Objective: Use this activity to learn more about the life

cycle of an Illinois apple.

Common Core: Language Arts: CCSS.ELA-Literacy.RL.4.3;

W.4.2


Animals, Plants & their Environment: K-LS1-1

Weather & Climate: 3-ESS2-1


Materials Needed:

2 red paper plates per student (or white plates to be colored)

Crayons

Glue

Scissors

Construction paper (yellow, pink, brown and green)

Hole punch

Tape

Yarn

Apple Chain templates from http://www.agintheclassroom.org

Stapler

Directions:

1. Cut each item out of construction paper: seed, tree, blossom, bee, little green apple.

Punch a hole on each side of the items you made with construction paper. The brown

seed only gets one hole punch.

2. Glue two red paper plates together around 2/3 of the edge. Leave the other 1/3 open. Allow time for it to dry. You can also staple plates together depending on age of student.

3. Tape or staple a piece of yarn to the inside of the paper plates and extend the yarn out of the opening.

4. Add a stem and leaf to the red paper plates to make them look like an apple.

5. Tie the little green apple to the yarn coming out of the apple. Tie the bee to the little green apple. Tie the blossom to the bee. Tie the bee to the tree. Tie the tree to the seed. These should all form a chain.

6. Tuck the green apple, bee, blossom, tree, and seed into the apple. Starting with the seed,

slowly pull shapes out of the apple and tell the story of how apples grow.

Apple Chain

http://www.agintheclassroom.org


Other Online Resources Illinois Farm Families

www.watchusgrow.org

Illinois Farm Families is a coalition of farmers committed to:

Showing you how we grow your food

Answering your questions about farms, farmers and farming

Sharing with you what really happens on modern Illinois farms

We know you care about how your food is raised. We do, too. Because we feed our families the same food

we grow for you and your family. We also realize that you probably have a lot of questions about farming

about why, when and how we use chemicals, antibiotics and hormones, about how we care for our animals.

We want to answer those questions. We may not agree on everything, but we want you to know the facts

about your food from the people who grow it.

Emily Webel—Farmington, Illinois

http://webelfamilyfarm.blogspot.com/

I remember laughing when my grandma told my fiance

(now husband) that everywhere in my background was

"farm." My husband was in the ag industry, but I thought

that moving to the farm was so far off, even far fetched!

Ha! Now, nine years of marriage, four kids, and a remod-

eled farmhouse later, we are here, in the thick of America-

na, farming away.

Holly Spangler—Marietta, Illinois

http://farmprogress.com/blogs.aspx?b=4

Holly Spangler has covered Illinois agriculture for the past 13 years, beginning her ca-

reer with Prairie Farmer even before graduating from college. As associate editor, she

brings real-world production agriculture experience to the topics she covers, including

a range of production, management and issue-oriented stories. She also shares the

trials and tribulations of young farmers through her monthly column, My Generation,

and her blog at www.prairiefarmer.com.

Holly and her husband, John, farm in western Illinois where they raise corn, soybeans

and cattle on 2,000 acres. Their operation includes 100 head of commercial cows in a cow/calf operation,

plus several Shorthorns for the local show calf market. The family operation includes John’s parents, and their

three children, Jenna, Nathan and Caroline.

Find links to other useful websites, blogs, and online resources on our website:


under the “Links” tab at the top, or the “IL Farm Life” link on the left

http://www.watchusgrow.org


http://farmprogress.com/blogs.aspx?b=4

http://www.prairiefarmer.com




Recommended Reading

Earth Day/Energy

Ethanol and Other New Fuels by Tea Benduhn (ISBN-13: 978-0836893595)

Generating Wind Power by Niki Walker (ISBN-10: 0836893646)

Michael Recycle by Ellie Bethel (ISBN-13: 978-1600102240)

Soil

A Handful of Dirt by Raymond Bial (ISBN-13: 978-0802786982)

Seed Soil Sun by Cris Peterson (ISBN-13: 978-1-59078-713-7)

Diary of a Worm by Doreen Cronin (ISBN-13: 978-0060001506)

Investigate Rocks and Soil by Charlotte Guillain (ISBN-13: 978-1-4329-1411-0)

Corn

Anna’s Corn by Barbra Santucci (ISBN-13: 978-0802851192)

Awesome Agriculture: Corn an A-to-Z Book by Susan Anderson & JoAnne Buggey (ISBN-13: 978-1-926781-02-0)

Awesome Agriculture: Corn in the Story of Agriculture by Susan & JoAnne Buggey (ISBN-13: 978-1-926781-03-7)

Corn by Gail Gibbons (ISBN-13: 978-0823422456)

Corn Belt Harvest by Raymond Bial (ISBN-10: 0-395-56234-1)

Soybean

Awesome Agriculture: Soybeans an A-to-Z Book by Susan Anderson & JoAnne Buggey (ISBN-13: 978-0-9811335-1-5)

Awesome Agriculture: Soybeans in the Story of Agriculture by Susan Anderson & JoAnne Buggey

(ISBN-13: 978-1-926781-03-7)

Oh Say Can You Seed? by Bonnie Worth (ISBN13: 9780375810954)

One Bean by Anne Rockwell (ISBN-13: 978-0802775726)

The Super Soybean by Raymond Bial (ISBN-13: 978-0-8075-7549-9)

Wheat

Farmer George Plants a Nation by Peggy Thomas (ISBN-13: 978-1590784600)

Bread Comes to Life by George Levenson (ISBN 1-58246-114-7)

Bread, Bread, Bread by Ann Morris (ISBN-13: 978-0-688-12275-1)

From Wheat to Pasta by Robert Egan (ISBN 0-516-26069-3)

Animals

Amazing Grazing by Cris Peterson (ISBN-10: 1-56397-942-X)

Awesome Agriculture: Pigs an A-to-Z Book by Susan Anderson & JoAnne Buggey (ISBN-13: 978-1-926781-00-6)

Awesome Agriculture: Pigs & Pork in the Story of Agriculture by Susan Anderson & JoAnne Buggey

(ISBN-13: 978-1-926781-01-3)

Awesome Agriculture: Beef Cattle an A-to-Z Book by Susan Anderson & JoAnne Buggey (ISBN-13: 978-1-926781-08-2 3)

Awesome Agriculture: Beef Cattle in the Story of Agriculture by Susan Anderson & JoAnne Buggey

(ISBN-13: 978-1-926781-09-9)

Heart of a Shepherd by Roseanne Parry (ISBN-13: 978-0375848032)

Little Joe by Sandra Neil Wallace (ISBN-13: 978-0375860973)

Pig 05049 by Christien Meindertsma (ISBN-13: 978-90-812413-1-1)

The Beef Princess of Practical County by Michelle Houts (ISBN-13: 978-0440422709)

War Horse by Michael Morpurgo (ISBN-13: 978-0439796644)

Roll of Thunder, Hear My Cry by Mildred D. Taylor (ISBN-13: 978-0140384512)

...And Now Miguel by Joseph Krumgold (ISBN-13: 978-0064401432)

Gracias The Thanksgiving Turkey by Joy Cowley (ISBN-13: 978-0439769877)

Dairy

Clarabelle: Making Milk and So Much More by Cris Peterson (ISBN-10: 1-59078-310-7)

Click, Clack, Moo by Doreen Cronin & Betsy Lewin (ISBN-13: 978-1442433700)

Extra Cheese, Please! by Cris Peterson (ISBN-13: 978-1590782460)


Recommended Reading

Nutrition

Pizza for the Queen by Nancy F. Castaldo (ISBN-13: 978-0823418657)

Hungry Planet: What The World Eats by Peter Menzel & Faith D’Aluisio (ISBN-13: 978-0984074426)

What the World Eats by Peter Menzel & Faith D’Aluisio (ISBN-13: 978-1582462462)

What I Eat: Around the World in 80 Diets by Peter Menzel & Faith D’Aluisio (ISBN 978-0-9840744-0-2)

Biotechnology

Gregor Mendel: The Friar Who Grew Peas by Cheryl Bardoe (ISBN-13: 978-0-8109-5475-5)

Enjoy Your Cells by Fran Balkwill (ISBN-13: 978-0879695842)

Urban

Country Kid, City Kid by Julie Cummins (ISBN-13: 978-0805064674)

The City Kid & The Suburb Kid by Deb Pilutti (ISBN-13: 978-1402740022)

Apple

Apples by Gail Gibbons (ISBN-10: 0-8234-1669-0)

Apples to Oregon by Deborah Hopkinson (ISBN-10: 0689847696)

Pumpkin

How Many Seeds in a Pumpkin? by Margaret McNamara (ISBN13: 9780375940149)

Pumpkins by Gail Gibbons (ISBN-10: 0-8234-1636-4)

Too Many Pumpkins by Linda White (ISBN-10: 0-8234-1320-9)

Specialty Crop

Harvest Year by Cris Peterson (ISBN-10: 1-56397-571-8)

The Scrambled States of America by Laurie Keller (ISBN-13: 978-0805068313)

Who Grew My Soup? by Tom Darbyshire (ISBN-13: 978-1412745444)


Sponsored by:

1701 Towanda Ave.

Bloomington, IL 61701

Phone: 309-557-3334



from the ground and all around - illinois aitc booklets/sai... · from the ground and all around...

Documents

Ground-Water Quality and Availability In and Around Bruni

INVERTEBRATES AND FLUID DYNAMICS : OFF THE GROUND & MOVIN’ AROUND

AITC Teacher Instructions

INVERTEBRATES AND FLUID DYNAMICS: OFF THE GROUND & MOVIN’ AROUND

AITC Week 2012aitc.jp/events/20120829_30-Week/data/20120830_1_UXD_NDA_1.pdf · AITC Week 2012 ユーザーエクスペリエンス技術部会 & ネットデバイスアプリケーション部会

A Capabilities Presentation - AITCVmWare / Citrix / Wyse CA / Solarwinds / WhatsUp Xerox / Canon / Brother APC / Tripp Lite / Liebert ... TEAM AITC AITC PM / Lead System Engineer

aitc fts watermelon brochure 08 2 - Welcome Page - …okfarmtoschool.com/.../aitc-fts-watermelon-brochure-08-2.pdfResources Needed: seedless melon, blender, ice cube trays, aluminum

AITC-039-full - AIT Solutionssolutions.ait.ac.th/wp-content/uploads/2015/08/AITC-039-full-SMALL... · cement sand mortar ferro cement corrugated slab ferro cement is a technique of

Campfire Safety - stittsvillescouts.org€¦ · Campfire Safety • Build on bare ground in established fire pit • Have rocks or other barrier around fire • Clear ground around

Hardwood Laminating Specifications, AITC 119-96aitc-glulam.org/wp-content/uploads/Design_Standards/AITC...Hardwood Laminating Specifications, AITC 119-96 3 laminations causing bending

Predicting and Controlling Ground Movements Around Deep Excavations

Surface Ground Movement Around a Steel Pipe Pile

Analysis of Ground Water Quality Parameters around Kushmhi ... · Analysis of Ground Water Quality Parameters around Kushmhi Railway Station Area Surendra Kumar1, Miss. Sunayana2

Aitc Lam Timber Arch Us Final

Laminated Timber Design Guide - Welcome to AITC Timber Design Guide American Institute of Timber Construction (AITC) Representing the glued lami-nated timber industry since 1952, AITC

Hydro-Chemical Evaluation of Ground Water of Area Around

The Settlers of Saskatchewan - AITC

10+ Activities to Do Around the School Ground education

AITC 1411 Obstructive Sleep Apnea

Ground effects on the stability of separated flow around a

Aitc candidate-list

Aitc technology magazine ebook 17 12 2015

AITC MAGAZINE ISSUE JUNE/2015...AITC MAGAZINE ISSUE JUNE/2015 ASOFIA Queensland Apprentice of the Year College Leaders Making a Difference Redlands Campus for AITC Reflections on English

AN OUTLINE OF ITALIAN JUDICIARY SYSTEM Author: Avv. Carlo Poli Annual Meeting AITC September 4° and 5° 2009 Florence AITC 1

Aitc 117-04-With Errata Incorporated

AITC-035 AFFORDABLE HOUSING IN BHAWALPUR, PUNJABsolutions.ait.ac.th/wp-content/uploads/2015/08/AITC-035-FINAL1.pdf · AFFORDABLE HOUSING IN BHAWALPUR, PUNJAB MAP SITE SADIQ GHAR DERAWR

ag mag - Illinois AITC...Livestock production is an important part of Illinois agriculture. Farmers supply us with products we depend on. Our lives revolve around having access to

AITC MAGAZINE ISSUE DEC/2015 - Australian Industry … · 2016-04-21 · AITC MAGAZINE ISSUE DEC/2015 Northern Campus Set to Open in January ... Japanese naval ships, ... at harvest

AITC to the Core - IAITC Home Booklets/SAI Booklet... · AITC to the Core A Complementary Lesson Booklet for IAITC’s Summer Agriculture Institute. 2 Illinois Agriculture in the

PRIVATE FROM THE GROUND UP, DESIGNED AROUND SECURITY … › ARMR_Whitepaper_v.0.5.pdf · PRIVATE FROM THE GROUND UP, DESIGNED AROUND SECURITY AND ANONYMITY. WHITEPAPER REVISION 0.5

Academic Industry - Department of Labor and Employmentro11.dole.gov.ph/fndr/mis/files/AITC-VCGP-Final-Signed.… · · 2012-05-15Academic Industry (AITC) - Region 11 ... occupational,

Prediction of ground thaw formations around an oil well

Geochemical Analysis of Surface and Ground Waters Around Cle … · Geochemical Analysis of Surface and Ground Waters Around Cle Elum, WA; Implications for the Proposed Exempt Well

AITC Literacy Project 2016

Ground Behaviour Around a Tunnel Using Various Soil Modelseprints.utm.my/id/eprint/47038/1/NamaziE2012_Ground... · 2017-08-09 · - 609 - Ground Behaviour Around a Tunnel Using Various