from genetics to genomics – european perspectives for an integrated approach … ·...
TRANSCRIPT
![Page 1: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal](https://reader033.vdocuments.us/reader033/viewer/2022060308/5f0a0db47e708231d429ca2d/html5/thumbnails/1.jpg)
EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme
Peter M. SchneiderInstitute of Legal Medicine
University of Cologne (Germany)
26/05/2016 Slide no 1
From Genetics to Genomics – European Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal Investigations
![Page 2: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal](https://reader033.vdocuments.us/reader033/viewer/2022060308/5f0a0db47e708231d429ca2d/html5/thumbnails/2.jpg)
EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme
Forensic DNA testing in criminal cases
• … has become the most successful tool for criminal
investigations, and has led to the introduction of national
DNA databases throughout Europe
• The European Standard Set (ESS) of (STR) markers has
enabled since 2005 (Treaty of Prüm) the European-wide
exchange of DNA profiles from unsolved crimes
• The German DNA Analysis Database (DAD)
Status in 03/2016:
- 1,143,150 records (854,350 persons, 288,800 stains)
- 216,300 hits (171,300 person-stain, 45,000 stain-stain)
![Page 3: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal](https://reader033.vdocuments.us/reader033/viewer/2022060308/5f0a0db47e708231d429ca2d/html5/thumbnails/3.jpg)
EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme
0
2000000
4000000
6000000
8000000
10000000
12000000
14000000
2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015
Year Persons
The Growth of DNA Databases in Europe 2003 – 2015
1.6 millionunsolved crime cases
+450% +600%
![Page 4: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal](https://reader033.vdocuments.us/reader033/viewer/2022060308/5f0a0db47e708231d429ca2d/html5/thumbnails/4.jpg)
EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme
STR Typing by Electrophoresis
1996: 4 dyes / 10 marker
2016: 6 dyes / 24 marker
![Page 5: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal](https://reader033.vdocuments.us/reader033/viewer/2022060308/5f0a0db47e708231d429ca2d/html5/thumbnails/5.jpg)
EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme
STR Typing by CE: Advantages
• Standardization
– Commonly used nomenclature of alleles and genotypes
– Allele frequency estimates based on world-wide population studies
• Reliability
– Excellent reproducibility of results within and between laboratories
– Sensitive detection of „low level“ DNA amounts
• Acceptance
– National DNA databases
– Non-coding markers: „built-in“ privacy protection
– Good cost/benefit relationship
![Page 6: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal](https://reader033.vdocuments.us/reader033/viewer/2022060308/5f0a0db47e708231d429ca2d/html5/thumbnails/6.jpg)
EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme
STR Typing by CE: Limitations
• Challenging DNA samples
– Loss of information due to degradation
– Complex mixtures cannot be resolved
• Kinship testing
– Not sufficiently powerful for distant family relationships (e.g.for identification of human remains)
– Number of alleles/locus too small � allele frequencies too high
• Technical restrictions
– Multiplex typing using CE restricts number of markers per assay
– PCR/CE artifacts compromise detection sensitivity
![Page 7: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal](https://reader033.vdocuments.us/reader033/viewer/2022060308/5f0a0db47e708231d429ca2d/html5/thumbnails/7.jpg)
EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme
Massively Parallel Sequencing (MPS):Examples of D12S391 allele 21 subtypes
D12S391[21]:AGAT[11]AGAC[9]AGAT[1]
D12S391[21]:AGAT[11]AGAC[10]
D12S391[21]:AGAT[12]AGAC[8]AGAT[1]
D12S391[21]:AGAT[12]AGAC[9]
D12S391[21]:AGAT[13]AGAC[7]AGAT[1]
D12S391[21]:AGAT[13]AGAC[8]
D12S391[21]:AGAT[13]GGAC[1]AGAC[7]
D12S391[21]:AGAT[14]AGAC[6]AGAT[1]
(Table from Gelardi et al 2014)
![Page 8: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal](https://reader033.vdocuments.us/reader033/viewer/2022060308/5f0a0db47e708231d429ca2d/html5/thumbnails/8.jpg)
EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme
0
200
400
600
800
1000
1200
1400
1600
1800
2000
15 16 17
2-Person Mixture
Major
Major
Minor
Shared
AGAT .. AGAC
AGAT .. AGATAGAT .. AGAT
2:1 major/minor mixture
16, 17 and 16, 17*
Stutter
Stutter
![Page 9: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal](https://reader033.vdocuments.us/reader033/viewer/2022060308/5f0a0db47e708231d429ca2d/html5/thumbnails/9.jpg)
EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme
MPS for Forensic SNP Typing
• gDNA SNP profiling
– Identity SNPs (autosomal, non-coding)
– Lineage SNPs (Y-Chr. / mtDNA, non-coding)
– Ancestry informative SNPs (both coding and non-coding)
– Phenotyping SNPs (FDP, mostly coding)
– X-Chr. SNPs for kinship cases (non-coding)
• DNA methylation profiling
– CpG islands associated with cell-specific gene expression
– Age prediction & body fluid / tissue identification
• mRNA profiling
– body fluid / tissue identification from cDNA
– Combined with coding SNP typing � donor identification
![Page 10: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal](https://reader033.vdocuments.us/reader033/viewer/2022060308/5f0a0db47e708231d429ca2d/html5/thumbnails/10.jpg)
EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme
Forensic Sci. Int. Genet. 2016
10
- 8 genomic control DNA samples
- 552 test samples from 14 global populations
![Page 11: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal](https://reader033.vdocuments.us/reader033/viewer/2022060308/5f0a0db47e708231d429ca2d/html5/thumbnails/11.jpg)
Concordance
11
Inter-lab concordance
• 4 labs
• 8 control samples + 37 analyses
• 20 no-call genotypes in 8 SNPs
• 9 discordant genotypes in 4 SNPs
observed in 3 samples
Public genomic database concordance
• 2 databases: 1000 Genomes
Complete Genomics
• 4 / 5 control samples
• 21 analyses
• 14 no-call genotypes in 8 SNPs
• 4 discordant genotypes in 1 SNP
100% = 2688 genotypes
100% = 4736 genotypes
![Page 12: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal](https://reader033.vdocuments.us/reader033/viewer/2022060308/5f0a0db47e708231d429ca2d/html5/thumbnails/12.jpg)
Problematic Marker: rs2080161
12
rs2080161
NA11200 lab 1578 % + -
A: 53 9 47 6
C: 524 91 112 412
G: 0
T: 1 0 0 1
340 % + -
A: 92 27 90 2
C: 188 55 54 134
G: 0
T: 60 18 8 52
Exclusion of rs2080161 from any further analysis
False positive
insertionof C
TGGACTTTATGGGTTGTTGTTTTTTTGGTTTTTTTTTTGTTTTTTTTTTGCACTCATCACATTTTTTCATAGTGGAACAATTAAAAGAATAAGCAAATGGT
NA11200 lab 2
![Page 13: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal](https://reader033.vdocuments.us/reader033/viewer/2022060308/5f0a0db47e708231d429ca2d/html5/thumbnails/13.jpg)
EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme
Global AIMs SNP Panel
• Ion PGM™ study – 5 EUROFORGEN labs (IMU, KCL, UCPH, USC, UHC)
• Extension of European – African – East Asian ancestry comparison & inclusion of
Native American and Oceanian ancestry
• Focus of marker selection – equivalent levels of differentiation between 5 global
populations:
13Phillips et al., FSI Genetics 11 (2014) 13-25, Building a forensic ancestry panel from the ground up: The EUROFORGEN Global AIM-SNP set
Europe33
Africa8
East Asia31
Oceania28
America28
128 SNPsEUROFORGEN-NoE
Global AIM SNP Panel
tri6
![Page 14: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal](https://reader033.vdocuments.us/reader033/viewer/2022060308/5f0a0db47e708231d429ca2d/html5/thumbnails/14.jpg)
EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme
Sensitivity: 10ng – 10pg DNA input (NA07000
14
• Full profiles 10 ng – 100pg
• A single no-call, no allele or locus drop-out for samples ≥100pg
• 10.1% allele drop-outs in heterozygous genotypes ≤50pg
• 0.8% allele drop-in ≤50pg
• 10pg:
48.4% correct genotypes
38.3% locus drop-out
5.3% allele drop-out
0.8% allele drop-in
25
cycles
25+5
cycles
25+5
cycles25
cycles
25+5
cycles
![Page 15: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal](https://reader033.vdocuments.us/reader033/viewer/2022060308/5f0a0db47e708231d429ca2d/html5/thumbnails/15.jpg)
EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme
Mixture Analysis
15
homozygousno-call heterozygous
Loss of sensitivity due to min_allele_freq = 0.1
![Page 16: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal](https://reader033.vdocuments.us/reader033/viewer/2022060308/5f0a0db47e708231d429ca2d/html5/thumbnails/16.jpg)
EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme
Red: unmixed 1000 Genomes/CEPH populations
Yellow: admixed 1000 Genomes/CEPH populations
Green: 14 global populations typed in EUROFORGEN labs
Selection of populations for study
16
East Timor
Fiji
Jamaica
Sierra LeoneIvory CoastGhana
Csango/RomaniaSzekely/Hungary
Kurdish Iraq
Somalia
Greenland/Nuuk
India
Vietnam
Afghanistan
![Page 17: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal](https://reader033.vdocuments.us/reader033/viewer/2022060308/5f0a0db47e708231d429ca2d/html5/thumbnails/17.jpg)
EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme
Population Analysis
Unmixed reference populations (1000 Genomes/CEPH)
Admixed study populations vs reference populations
17
East Timor
Somalia
Afghanistan
East Asia Oceania
America
Africa
Central South
Asia
Europe
![Page 18: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal](https://reader033.vdocuments.us/reader033/viewer/2022060308/5f0a0db47e708231d429ca2d/html5/thumbnails/18.jpg)
EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme
Ion PGM™ Global AIMs Study - Summary
• 127/128 SNPs with reliable performance (1 SNP excluded)
• > 99% concordance for inter-lab and public genomic database
comparison
• Full SNP profiles down to 100pg
• 5 + 1 global unmixed reference populations differentiated:
Africa - Europe - Central South Asia - East Asia - Oceania - America
• Unmixed EFG study populations in compliance with reference
populations
• Admixed EFG study populations clustered between different
reference populations
18
![Page 19: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal](https://reader033.vdocuments.us/reader033/viewer/2022060308/5f0a0db47e708231d429ca2d/html5/thumbnails/19.jpg)
EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme
MPS: SWOT Analysis
STRENGTHS
• „All-inclusive“ approach for all forensic markers
• Maximal amount of data from minimal amount of sample
• Deconvolution of complex mixtures
WEAKNESSES
• Long sample-to-data period
• Expensive (for the time being)
• Lack of standardization
• Requires new resources for bioinformatics and data storage
![Page 20: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal](https://reader033.vdocuments.us/reader033/viewer/2022060308/5f0a0db47e708231d429ca2d/html5/thumbnails/20.jpg)
EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme
MPS: SWOT Analysis
OPPORTUNITIES
• May provide new intelligence leads on
previously unsolved cases
• Allows to generate all data in advance, and
irrespective of available information at the
time of the analysis
THREATS
• All-inclusive typing kits may collect more
information than needed
• Entering the „slippery slope“ of
accumulating sensible personal data
– Why not sequence the entire genome?
• How can the massive amounts of data be
secured and filtered?
![Page 21: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal](https://reader033.vdocuments.us/reader033/viewer/2022060308/5f0a0db47e708231d429ca2d/html5/thumbnails/21.jpg)
EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme
MPS in Forensics: Conclusions
• MPS is only a new technology, but
– … the limitations have neither been explored nor defined
– … has created a demand to collect more data than needed
– … there is a growing interest, both from industry, to sell a new product, and from the forensic community to use what is available
The unlimited application in casework and for national DNA databases may eventually lead to a paradigm shift.
What can be done?
![Page 22: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal](https://reader033.vdocuments.us/reader033/viewer/2022060308/5f0a0db47e708231d429ca2d/html5/thumbnails/22.jpg)
EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme
MPS in Forensics: Conclusions
What can be done:
– Create separate modules (primer sets) for coding / non-coding / ancestry informative markers
• to be used alone or in combination
• depending on depth of investigation, or the legal framework
– Keep sensible genetic data separated from national databases
– Use bioinformatic filters to mask sensible personal data
– Develop a ‚privacy by design‘ framework of probabilities to communicate results of FDP and ancestry typing without disclosing real DNA data to the end-user
![Page 23: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal](https://reader033.vdocuments.us/reader033/viewer/2022060308/5f0a0db47e708231d429ca2d/html5/thumbnails/23.jpg)
www.ialm2016venice.org
![Page 24: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal](https://reader033.vdocuments.us/reader033/viewer/2022060308/5f0a0db47e708231d429ca2d/html5/thumbnails/24.jpg)
EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme
EUROFORGEN Conference - June 23, 2016Forensic DNA analysis in the light of the new security needs
Session 1: FROM CRIME SCENE TO COURT ROOM
• John Butler (NIST), Sarah Chu (New York), Peter Gill (Oslo)
Session 2: FROM GENOTYPE TO PHENOTYPE
• A. Valdes (KCL), W. Branicki (JU), C. Phillips (USC)
Session 3: SCIENCE IN SOCIETY
• L. Roewer (Berlin), E. Murphy (NYU Law School),
H. Machado (Coimbra), M. Wienroth (Northumbria)
L. Prieto (Madrid), K. Reid (London)
Roundtable Discussion
• Current challenges in ethical, legal & social aspects in different
European countries – R. Williams (chair)
![Page 25: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal](https://reader033.vdocuments.us/reader033/viewer/2022060308/5f0a0db47e708231d429ca2d/html5/thumbnails/25.jpg)
EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme
EUROFORGEN Conference - June 23, 2016
• Venue and registration details
– www.ialm2016venice.org
– Venice Convention Center, Lido Island
– Reduced registration for IALM partner societies available until May 31st, 2016
– Current members of the EUROFORGEN Virtual Institute will get an additional discount after the conference
– Includes access to all sessions of IALM Symposium
• Session on Forensic Genetics and Genomics, June 24th
– Speakers: A. Carracedo, M. Kayser, W. Parson, P. Schneider
– Short presentations
![Page 26: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal](https://reader033.vdocuments.us/reader033/viewer/2022060308/5f0a0db47e708231d429ca2d/html5/thumbnails/26.jpg)
26/05/2016 Slide no 26
Please do not forget to join our Facebook group!… already 281 members!
![Page 27: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal](https://reader033.vdocuments.us/reader033/viewer/2022060308/5f0a0db47e708231d429ca2d/html5/thumbnails/27.jpg)
26/05/2016 Slide no 27
![Page 28: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal](https://reader033.vdocuments.us/reader033/viewer/2022060308/5f0a0db47e708231d429ca2d/html5/thumbnails/28.jpg)
EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme
Thank you very much for your attention!
26/05/2016 Slide no 28
![Page 29: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal](https://reader033.vdocuments.us/reader033/viewer/2022060308/5f0a0db47e708231d429ca2d/html5/thumbnails/29.jpg)
EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme
For Forensic or Paternity Use Only. When used for purposes other than Human Identification the instruments and software modules cited are for Research Use Only. Not for use in diagnostic procedures. Speaker was provided travel and hotel support by Thermo Fisher Scientific for this presentation, but no remuneration
26/05/2016 Slide no 29