foundations for synthetic biology - amazon s3 · introduction to synthetic biology topic 2 topic 3...

53
Topic 1 Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering Department Imperial College London

Upload: others

Post on 05-Aug-2020

5 views

Category:

Documents


2 download

TRANSCRIPT

Page 1: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Topic 1

Introduction to Synthetic Biology

Topic 2 Topic 3 Topic 4 Topic 5

Foundations for Synthetic Biology

Vincent RouillyBioengineering Department

Imperial College London

Page 2: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Topic 1

Introduction to Synthetic Biology

Topic 2 Topic 3 Topic 4 Topic 5

Standardfor Physical DNA Composition

Vincent RouillyBioengineering Department

Imperial College London

Page 3: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Topic 1

Introduction to Synthetic Biology

Topic 2 Topic 3 Topic 4 Topic 5

Standards for Functional Composition

Vincent RouillyBioengineering Department

Imperial College London

Page 4: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Topic 1

Introduction to Synthetic Biology

Topic 2 Topic 3 Topic 4 Topic 5

Characterising Biological Parts

Vincent RouillyBioengineering Department

Imperial College London

Page 5: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Topic 1

Introduction to Synthetic Biology

Topic 2 Topic 3 Topic 4 Topic 5

Building Systems from BioBricks

Vincent RouillyBioengineering Department

Imperial College London

Page 6: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Be Aware

Science in the Making

Cutting Edge Research

HELPWANTED

Page 7: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Topic 1

Introduction to Synthetic Biology

Topic 2 Topic 3 Topic 4 Topic 5

Foundations for Synthetic Biology

Vincent RouillyBioengineering Departement

Imperial College London

Press Review CurrentResearch

Finding our SB Definition

SBPrinciples

Ethics& Society

Page 8: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Press Review

Page 9: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Press Review: Main Stream

Page 10: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Press Review: Science/Tech

Page 11: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Press Review: Govt Institutions

Page 12: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Seminal Research Papers

Cited +600X

year 2000

Page 13: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Seminal Research Papers

Cited +500X

Cited +600X

year 2000

Page 14: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Science in the Making

Nature

PNAS

Biotechnol.

Nat. Computing.

Chem. Eng

Page 15: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Current Research: Biomedical

Tumor-Killing Bacteria, JC Anderson et al, 2004.

Page 16: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Current Research: Environment

Arsenic Biosensor, iGEM 2006, Edinburgh Team

Page 17: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Current Research: Bio-Energy

Butanol

Ethanol

Bio-diesel

Biomass

Page 18: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Current Research: Drug Development

* from Austin Che's presentation

Page 19: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Current Research: Information Processing

“AND Gate”, JC Anderson et al

“Bacterial Edge Detector”, Jeffrey Tabor

Page 20: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Synthetic Biology Definition

...

Page 21: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Defined by its areas of application ?

Biology

Bio-Energy

Bio-Materials

Bio-Sensors

Drug Development

Nanotechnologies

Synthetic Biology

Page 22: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Defined by its areas of application ?

Biology

Bio-Fuels

Bio-Materials

Bio-Sensors

Drug Development

Nanotechnologies

1% US GDP (+20% growth)*

Genetic Engineering

Tissue Enginering

Metabolic Engineering

Protein Engineering

* Carlson, 2008.

Page 23: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Defined by its technological platform ?

Synthetic BiologyToolbox

Recombinant DNA

Cloning – Directed EvolutionHigh-throughput technologies

(NMR, micro-arrays, automation)

ComputationalModelling

DNA SequencingDNA Synthesis

Page 24: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Defined by its technological platform ?

Synthetic BiologyToolbox

Recombinant DNA

Cloning – Directed EvolutionHigh-throughput technologies

(NMR, micro-arrays, automation)

ComputationalModelling

DNA SequencingDNA Synthesis

Genetic Engineering Metabolic Engineering

Protein Engineering Tissue Enginering

Page 25: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

SyntheticBiology.org

Synthetic Biology

Page 26: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

SyntheticBiology.org

Genetic Engineering Metabolic Engineering

Protein Engineering Tissue Enginering

Synthetic Biology

Page 27: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

iGEM Perspective

www.parts.mit.edu/wiki

Page 28: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

iGEM Perspective

www.parts.mit.edu/wiki

Standard Interchangeable Parts

Genetic Engineering Metabolic Engineering

Protein Engineering Tissue Enginering

True Engineering Approach to Biology

Page 29: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Engineering Approach

Industrial Revolutions

Machine Tool

Nuts & BoltsCommunication protocols

File Format

Hardware

Mechanical Transport Chemical Digital

Trains

Car / Road

Large scale production

Page 30: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Abstraction Standardisation Quality Control

Engineering Approach

Industrial Revolutions

Mechanical Transport Chemical Digital

Machine Tool

Nuts & BoltsCommunication protocols

File Format

HardwareTrains

Car / Road

Large scale production

Page 31: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Abstraction

Abstraction Principle

Standardisation Quality Control

Andrianantoandro et al, 2006

Page 32: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Abstraction

Abstraction Principle

Standardisation Quality Control

Abstraction Hierarchy

Abstraction Layer

ModularityInputs / Outputs

Decoupling

Break down complexity

Andrianantoandro et al, 2006

Page 33: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Abstraction

Abstraction Principle for SB

Standardisation Quality Control

DNA ACACTTCAAACCAAACCTTATTTCTAATTGAGAAGGGCCGGTTGA

Page 34: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Abstraction

Abstraction Principle for SB

Standardisation Quality Control

DNA

Parts

ACACTTCAAACCAAACCTTATTTCTAATTGAGAAGGGCCGGTTGA

BA

Page 35: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Abstraction

Abstraction Principle for SB

Standardisation Quality Control

DNA

Parts

Devices

ACACTTCAAACCAAACCTTATTTCTAATTGAGAAGGGCCGGTTGA

BA

A B

Page 36: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Abstraction

Abstraction Principle for SB

Standardisation Quality Control

DNA

Parts

Devices

Systems

ACACTTCAAACCAAACCTTATTTCTAATTGAGAAGGGCCGGTTGA

BA

A B

A B B CAC

Page 37: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Abstraction Standardisation

Standardisation Principle

Quality Control

Page 38: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Abstraction Standardisation

Standardisation Principle

Quality Control

Uniform and agreed Inter-operability Re-usability Economical Benefits

Page 39: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Standardisation Principles for SB

Abstraction Standardisation Quality Control

Standard Physical DNA composition

Standards Functional Composition

Standard Culture Conditions

Standard Measurements

Standard Cell Host (Chassis)

Topic 2

Topic 3

Topic 4

+ Practical

Page 40: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Quality Control Principle

Abstraction Standardisation Quality Control

Page 41: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Quality Control Principle

Abstraction Standardisation Quality Control

Specification Sheet TrustTolerances / ReliabilityCharacterisation

under Standard Conditions

Page 42: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Quality Control Principle

Abstraction Standardisation Quality Control

Registry of Standard Biological Parts

Page 43: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Synthetic Biology Methodology

Biology

Bio-Fuels

Bio-Materials

Bio-Sensors

Drug Development

Nanotechnologies

Genetic Engineering

Tissue Enginering

Metabolic Engineering

Protein Engineering

Page 44: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Synthetic Biology Methodology

Biology

Bio-Fuels

Bio-Materials

Bio-Sensors

Drug Development

Nanotechnologies

Genetic Engineering

Tissue Enginering

Metabolic Engineering

Protein Engineering

Synthetic BiologyMethodology

'build more success on previous success'

Registry of Standard

Biological Parts

Page 45: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

But ....Engineering Challenges Ahead

DiffusionCross-Talk

Noisy

MutationEvolution

Growth Death

“What I cannot create, I do not understand.”

Richard Feynman (1918-1988)

inspired by Austin Che's presentation

Page 46: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Ethics and Society

What will be the impact of

making biology easier to engineer ?

from Drew Endy's talk, Tianjin 2007

Page 47: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Ethics and Society

What will be the impact of

making biology easier to engineer ?

from Drew Endy's talk, Tianjin 2007

More People More PowerfulDNA Programs

FasterDevelopment

Page 48: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Ethics and Society

Resulting Issues

from Drew Endy's talk, Tianjin 2007

Bio Safety

Bio Security

Ownership, Sharing, Innovation

Ethics

Community

Page 49: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Ethics and Society

Asilomar (1975)Recombinant DNA conference

from Drew Endy's talk, Tianjin 2007

What has changed ?

1. Databases populated with sequence information. 2. The Internet3. Early improvements in automated DNA construction technology. 4. Overnight shipping.5. Expanded concern re: active misapplication of biotech.

Page 50: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Ethics and Society

from Drew Endy's talk, Tianjin 2007

Revitalise knowledge of biological safety

Avoid re-militarisation of biological technologies

RegardlessRegardless, expect that technology will be misapplied. Prepare.

Develop an ownership & sharing framework that maximizes innovation and equity.

Build a community who can lead development of a constructive culture in Biological Engineering.

Page 51: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Synthetic Biology Community

You are now part of it !!!Engage ... Challenge ... Contribute

Page 52: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

References

> Drew Endy's Talks (on OWW) > Austin Che Presentations> OpenWetWare Folks> iGEM Competition> BioBricks Foundation

Page 53: Foundations for Synthetic Biology - Amazon S3 · Introduction to Synthetic Biology Topic 2 Topic 3 Topic 4 Topic 5 Foundations for Synthetic Biology Vincent Rouilly Bioengineering

Example: iPod

Features:

Audio / Video / PhotosExternal hard driveCalendar / Contacts

GamesCar Integration