“forget antibodies. use aptamers!”. presentation contents: 1. introduction and background 2....
TRANSCRIPT
![Page 1: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/1.jpg)
“Forget Antibodies. Use Aptamers!”
![Page 2: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/2.jpg)
Presentation Contents:
1. Introduction and Background
2. Aptamer Introduction
3. Diagnostic Applications
4. Drug Discovery Applications
5. Delivery Applications
Presentation Contents:
1. Introduction and Background
2. Aptamer Introduction
3. Diagnostic Applications
4. Drug Discovery Applications
5. Delivery Applications
![Page 3: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/3.jpg)
![Page 4: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/4.jpg)
© 2007
Founder Highlights:
B.S. in Biochemistry, minor in MathematicsPhiladelphia College of Pharmacy and Science
Ph.D. in NeuroscienceHahnemann University(Drexel University College of Medicine)
Dissertation Thesis workYale University
Gaetano Tom Caltagirone, Ph.D.
Aptagen, a biotechnology company based in central Pennsylvania, offers aptamer custom-based services to replace antibodies in research, diagnostic platforms, drug discovery and therapeutics. The company was founded in 2004 by Dr. G. Thomas Caltagirone, and operations began at the current facility located in Jacobus, PA in 2006. Dr. Caltagirone has over 20 years of research and business experience in start-ups. A native of York, PA, he began his studies at The University of the Sciences in Philadelphia followed by Drexel University in Philadelphia and completed his thesis on “Proton-Sensitive Ribozyme Switches with Molecular Memory” at Yale University with a Ph.D. in Neuroscience. Aptagen has grown from a one-man operation with the help of local interns to a tight-knit developing business with clients ranging globally from research academics at top-tier institutions to BigPharma companies. Aptagen has been named as a finalist for the “Top Emerging Business of the Year” by Central Penn Business Journal. Aptamers are an emerging technology that is poised to become the next evolution in diagnostics and drug discovery. Aptagen continues to play a leading role in developing aptamer technology that will assist in the treatment and diagnosis of various diseases.
![Page 5: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/5.jpg)
Serving over 50 Companies, Serving over 50 Companies, Organizations, and Organizations, and
Universities globally.Universities globally.
![Page 6: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/6.jpg)
![Page 7: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/7.jpg)
Examples of Aptamer ShapesExamples of Aptamer Shapes
A.A. B.B.
A. Pseudoknot (ligand for HIV-1 reverse transcriptase)B. G-quartet (ligand for thrombin)C. Hairpin (ligand for bacteriophage for T4 polymerase)D. Stem loop/bulge (ligand for ATP)
A. Pseudoknot (ligand for HIV-1 reverse transcriptase)B. G-quartet (ligand for thrombin)C. Hairpin (ligand for bacteriophage for T4 polymerase)D. Stem loop/bulge (ligand for ATP)
C.C. D.D.
taken from McGown, et.al. (1995)taken from McGown, et.al. (1995)
![Page 8: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/8.jpg)
- pM to nM affinity
- Engineer out cross-reactivity…eliminate false positives(10,000 fold specificity, e.g.
Theophylline/Caffeine)
- Ligand binding against unknown and undiscovered biomarkers
- Manufacturing (pennies on the dollar)
- Stability (long shelf-life; heat denature/refold)
Apta-index™(database of aptamers)
![Page 9: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/9.jpg)
Basic Concept of ‘Directed Molecular Evolution’Basic Concept of ‘Directed Molecular Evolution’
Heterogeneous Population
of Molecules
Heterogeneous Population
of Molecules’sloppy’ copy to explore mutations
’sloppy’ copy to explore mutations
Target immobilized on column surfaceTarget immobilized on column surface
collectcollect
‘Fittest’molecules‘Fittest’molecules
Molecules that Bind to TargetMolecules that Bind to Target
discarddiscard
Molecules that do not Bind to TargetMolecules that do not Bind to Target
![Page 10: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/10.jpg)
General Aptamer Selection SchemeGeneral Aptamer Selection Scheme
determine oligo sequence(s) of aptamer(s)
determine oligo sequence(s) of aptamer(s)
random oligonucleotide poolrandom oligonucleotide pool
1014 single-stranded molecules1014 single-stranded molecules
Oligo synthesizerOligo synthesizer
(7 to 15 rounds)(7 to 15 rounds)
targettarget
Propagate(i.e. amplify by PCR)Propagate(i.e. amplify by PCR)
Captureligand-target complexes
discard unbound
collect bound oligo ligands
![Page 11: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/11.jpg)
Diagnostic Applications
![Page 12: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/12.jpg)
Conventional Antibody-based Diagnostics (ELISA) Method
Conventional Antibody-based Diagnostics (ELISA) Method
Plate coated with capture antibodyPlate coated with capture antibody
Incubation steps and wash steps before detection = total time >>2 hoursIncubation steps and wash steps before detection = total time >>2 hours
Add samplesAdd samples
Add detection antibodyAdd detection antibody
Add substrateAdd substrate
![Page 13: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/13.jpg)
Apta-beacon™ Diagnostic Assay(simple 1-step reaction, free in-solution)Apta-beacon™ Diagnostic Assay(simple 1-step reaction, free in-solution)
NegativeSampleNegativeSample
PositiveSamplePositiveSample
AnalyteAnalyte
No Incubation or wash steps = total time << 1 minute No Incubation or wash steps = total time << 1 minute
Quantitate based on a titration of controls Quantitate based on a titration of controls
![Page 14: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/14.jpg)
Biosensor and Biochip PlatformsBiosensor and Biochip Platforms
Point mutationto inactivate switch function
Detection of binding event intact
Aptamers easily tethered to solid interface through a wide variety of conjugation chemistries.
![Page 15: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/15.jpg)
FQ
F/Q removed
FlashGel™analysis
(5 minute run)
Apta-sensorsAptamers that produce an immediate output signal for detection of target analyte.
apta-beacons™ apta-switches™
![Page 16: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/16.jpg)
Target Example
Co2+, Ni2+, Cd2+
Zn2+, Mn2+
Caffeine
Rev Peptide
Phosphorylated ERK2,Unphosphorylted ERK2
Metal Ions
Small Organics
Peptides
Proteins
Apta-switch™ (aptamer that produces a self-cleavage output signal)
100 M
The
ophy
lline
Specificity Against Theophylline vs. Caffeine
100
90
80
70
60
Ladd
erDEPC o
nly
RXN Buf
fer o
nly
1 m
M C
affe
ine
100 M
Caf
fein
e10
M
Caf
fein
e
10
M T
heop
hyllin
e
1 M
Caf
fein
e1 M
The
ophy
lline
1 minute reaction at 23oC,then stopped with stop buffer containing excess EDTA.
1 m
M T
heop
hyllin
e
500-fold sensitivity range
![Page 17: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/17.jpg)
Negative/CounterSelection
5’
T7
PrimerExtension
5’
RNA library
Hammerhead ribozyme motif
N55
N55
5’
Mg++ dependentCleavage site
Transcription
Synthesized N55 random oligo library
Aptamer
PositiveSelection
RT-PCR
PAGEPartitioning
Promoter
Selection
PAGEPartitioning
(+) Target(-) Target(Buffer alone or Counter-target)
LibraryLibrary
Purify Pre-cleaved
Purify Cleaved
Random Region
Fluorophore
Optional:1. RT-PCR2. Transcription3. Refolding
Refolding
Apta-sw
itch Selection S
trategy
![Page 18: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/18.jpg)
Apta-beacons™ vs. CompetitionApta-beacons™ vs. Competition
antibodies aptamers apta-beacons™
ChemistryChemistry protein DNA/RNA RNA
Stable / RefoldingStable / Refolding ++++ ++++(with RNAse inhibitor)
HIGH affinityHIGH affinity ++++ ++++ ++++
HIGH selectivityHIGH selectivity + ++ ++++
Unknown or undiscovered biomarkersUnknown or undiscovered biomarkers ++++ ++++
Small targetsSmall targets + ++ ++++
Targets which are difficult to immobilizeTargets which are difficult to immobilize ++++
One-step detection:One-step detection:direct output signal from target bindingdirect output signal from target binding
++++
In-solution based detectionIn-solution based detection ++++
Biosensor implementationBiosensor implementation ++ ++++ ++++
Lower Cost to manufactureLower Cost to manufacture ++++ ++++
Sequences providedSequences provided + ++++
Client retains IPClient retains IP + ++++
![Page 19: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/19.jpg)
Apta-switch™Apta-switch™ Demonstration Kit Demonstration Kit(Theophylline/Caffeine)(Theophylline/Caffeine)
![Page 20: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/20.jpg)
Drug Discovery Applications
![Page 21: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/21.jpg)
Pharmaceutical Drug Development ProcessPharmaceutical Drug Development Process
Success RateSuccess Rate
55 Enter human clinical trialsEnter human clinical trials
> 8 years> 8 years50005000Animal Testing
of Drug candidates
In vitro or in vivo assays on drug candidates
Knowledge of Target / Mechanism
Pharmaceutical Drug Development(combinatorial, natural product screening, etc.)
>$1B>$1B
![Page 22: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/22.jpg)
MASS SCREENINGDrug Discovery ProcessMASS SCREENING
Drug Discovery Process(time consuming and labor intensive)(time consuming and labor intensive)
RandomHigh Volume
Screening
RandomHigh Volume
Screening
In VitroStudiesIn VitroStudies In Vivo
StudiesIn VivoStudies Clinical StudiesClinical Studies
HumansHumans
CombinatorialChemistry
CombinatorialChemistry
A positive hit in a “test” tube environment does not necessarily translate into a success in an in vivo environment. Compound has to be re-engineered and tested again in test tube, then back to animal. Back and forward through this iterative process costs time and money.
A positive hit in a “test” tube environment does not necessarily translate into a success in an in vivo environment. Compound has to be re-engineered and tested again in test tube, then back to animal. Back and forward through this iterative process costs time and money.
http://images.google.com/images?q=drug+discovery&btnG=Search&hl=en&lr=&ie=UTF-8http://images.google.com/images?q=drug+discovery&btnG=Search&hl=en&lr=&ie=UTF-8
![Page 23: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/23.jpg)
XXXX
Aptagen’s Drug Discovery in Whole-Animal ModelsAptagen’s Drug Discovery in Whole-Animal Models(Saving Time and Money)(Saving Time and Money)
RandomHigh Volume
Screening
RandomHigh Volume
Screening
In VitroStudiesIn VitroStudies
CombinatorialChemistry
CombinatorialChemistry
In VivoStudiesIn VivoStudies Clinical StudiesClinical Studies
HumansHumans
By eliminating the “test” tube step, and performing drug discovery ‘directly’ in an animal model, we are one step closer to human clinical trials, thereby saving time and money.
http://images.google.com/images?q=drug+discovery&btnG=Search&hl=en&lr=&ie=UTF-8
![Page 24: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/24.jpg)
Reasons for Failures of Aptamer Drug CandidatesReasons for Failures of Aptamer Drug Candidates
Typical Aptamer Strategy: Develop aptamers in vitro against a known protein target of interest to block disease pathway.Typical Aptamer Strategy: Develop aptamers in vitro against a known protein target of interest to block disease pathway.
however…however…In vitro selected aptamers do not necessarily operate/functionin vivo as therapeutic candidates.In vitro selected aptamers do not necessarily operate/functionin vivo as therapeutic candidates.
Aptamers are sensitive to the environmental conditions in which they are selected.Aptamers are sensitive to the environmental conditions in which they are selected.
In VitroStudiesIn VitroStudies In Vivo
StudiesIn VivoStudies Clinical StudiesClinical Studies
HumansHumans
The Conventional Paradigm in preclinical development is deficient.The Conventional Paradigm in preclinical development is deficient.
DELIVERY is always an issue!DELIVERY is always an issue!http://images.google.com/images?q=drug+discovery&btnG=Search&hl=en&lr=&ie=UTF-8http://images.google.com/images?q=drug+discovery&btnG=Search&hl=en&lr=&ie=UTF-8
![Page 25: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/25.jpg)
W H O L E - A N I M A L S E L E C T I O N W H O L E - A N I M A L S E L E C T I O N Animal Model of disease or conditionAnimal Model of disease or condition
Molecular LibraryMolecular Library(bolus injection, nasal, or oral administration)
(bolus injection, nasal, or oral administration)
Isolate and process tissue or organ of pathological interest
Isolate and process tissue or organ of pathological interest
Replicate (Amplify), enrich,and reselect MOLECULES associated with pathological marker
Replicate (Amplify), enrich,and reselect MOLECULES associated with pathological marker
PathologicalMarker
PathologicalMarker Normal Tissue
AreaNormal Tissue
Area
Tissue Selection
Tissue Selection
http://images.google.com/images?q=drug+discovery&btnG=Search&hl=en&lr=&ie=UTF-8http://images.google.com/images?q=drug+discovery&btnG=Search&hl=en&lr=&ie=UTF-8
![Page 26: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/26.jpg)
In drug development, DELIVERY is always an issue!In drug development, DELIVERY is always an issue!
Selection in Whole-Animals solves DELIVERY issues.Selection in Whole-Animals solves DELIVERY issues.(Use molecular bullet to attach known drug to increase specificity)(Use molecular bullet to attach known drug to increase specificity)
Chemical Diversity solves drug-like effects.Chemical Diversity solves drug-like effects.
![Page 27: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/27.jpg)
Potential for ‘smart’ molecular bullets with Drug-like properties
Potential for ‘smart’ molecular bullets with Drug-like properties
Initial roundInitial round
Progression of Selection with gradualdisappearance of pathologicalmarker…
Progression of Selection with gradualdisappearance of pathologicalmarker…
Normal tissue -no sign ofpathology
Normal tissue -no sign ofpathology
Nth round of ‘natural’ selection…
Nth round of ‘natural’ selection…
![Page 28: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/28.jpg)
Key Requirements for Successful Selection:Key Requirements for Successful Selection:
1) Self-replicating molecules1) Self-replicating molecules2) Animal Model2) Animal Model3) Characteristic Phenotype for Visualization
(of Target or Biomarker)3) Characteristic Phenotype for Visualization
(of Target or Biomarker)
Disease, Infection (bacterial or viral), etc...Disease, Infection (bacterial or viral), etc...
Could possibly Influence behavior? Enhanced cognitive abilities? etc…Could possibly Influence behavior? Enhanced cognitive abilities? etc…
![Page 29: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/29.jpg)
Delivery Applications
![Page 30: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/30.jpg)
Preliminary Experiment: Targeting Major Organs & In Vivo StabilityPreliminary Experiment: Targeting Major Organs & In Vivo Stability
Tail vein injection2’-F-RNA library
Tail vein injection2’-F-RNA library
(-) Library(-) Library
nanomolar amountsnanomolar amounts
40 minutespost-IV
40 minutespost-IV
Isolate variousorgans/tissue
Isolate variousorgans/tissue
Tissue HarvestingTissue Harvesting
Purification of Rare 2’-F-RNA speciesPurification of Rare 2’-F-RNA species
RT-PCRRT-PCR
Lane:Lane: 1 2 3 gel DNA
Ladder no band
![Page 31: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/31.jpg)
2’-F-RNA Targeting to Major Organs of the Mammalian Anatomy2’-F-RNA Targeting to Major Organs of the Mammalian Anatomy
![Page 32: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/32.jpg)
2’-F-RNA LUNG Targeting2’-F-RNA LUNG Targeting
focused on LUNG enrichment...focused on LUNG enrichment...
Enrichment Ratio = qPCR of ‘extracted’ library relative to ‘input’ library
![Page 33: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/33.jpg)
LIBRARY C L O N E S
Family # of Clones 5’- gggcgacccugaugag [Consensus Sequence][Consensus Sequence] cgaaacggugaaagccguagguugccc -3’
Group A 12 [UGACUGCUCCGUUCCGUUAUGACAGCUGCACCCAGUUAAAGC:GGUUCUGGGUCCGGA]
G9A2
Group B 7 [CCUUUUUGAACAACUGUGCGAUUUGAUUG:AAAAUUCUCUCUGAUCCCACCGUGACG]
G9B1
Group C 2 [UCUAGAGCGCAGAAACUUCUCUCAACGAUUCCCCACGUCCUCGCCCCGCCCGGU]
G9C4
ΔG -43.49 kcal.mole-1Tm 73.6oC
SecondaryStructures(MFOLD)
ΔG -36.17 kcal.mole-1Tm 75.6oC
ΔG -37.45 kcal.mole-1Tm 65.9oC
**
*
6.00E-02
5.00E-02
4.00E-02
3.00E-02
2.00E-02
1.00E-02
0.00E+00G9 G9A2 G9B1 G9C4
En
ric
hm
en
t R
AT
IO
![Page 34: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/34.jpg)
Fluorescence MicroscopyFluorescence Microscopy
LungLung
LiverLiverNote:brain, spleen, heart, kidney were NEGATIVENote:brain, spleen, heart, kidney were NEGATIVE
1) 5’-end labeled G9C4 RNA aptamer with ADO™550/5702) Washed with PBS & Fixed tissues with acetone3) In situ bound (~4 mg) aptamer for 40 minutes at room temperature, and wash
1) 5’-end labeled G9C4 RNA aptamer with ADO™550/5702) Washed with PBS & Fixed tissues with acetone3) In situ bound (~4 mg) aptamer for 40 minutes at room temperature, and wash
1/6 sec exposure1/6 sec exposure
1/3 sec exposure1/3 sec exposure
![Page 35: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/35.jpg)
Aptamer Selection for Surface BindersAptamer Selection for Surface Binders
Figure 1. Schematic of Strategy. Linear template will undergo circularization via LCR (Ligation Chain Reaction). The circularized aptamers will be incubated with PC3-PSMA cells for positive selection. Aptamers specific for PSMA will be amplified; the selection process will be repeated for approximately five generations, before beginning a negative selection process with parental PC3 cells.
Figure 1. Schematic of Strategy. Linear template will undergo circularization via LCR (Ligation Chain Reaction). The circularized aptamers will be incubated with PC3-PSMA cells for positive selection. Aptamers specific for PSMA will be amplified; the selection process will be repeated for approximately five generations, before beginning a negative selection process with parental PC3 cells.
TemplateTemplate
LCRLCR
Circular DNACircular DNA
Positive Selection(G0-G5)
Positive Selection(G0-G5)
PCR Amplification of bound aptamers
PCR Amplification of bound aptamers
PC3-PSMA
WASTE
PC3
BoundaptamersBound
aptamers
Unbound aptamersUnbound aptamers
Negative Selection
G6-Gx
Negative Selection
G6-Gx
(Optional) PCR Amplification of
unbound aptamers
(Optional) PCR Amplification of
unbound aptamers
![Page 36: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/36.jpg)
Flow Cytometry of Enriched Aptamer Library on (-) Parental CellsFlow Cytometry of Enriched Aptamer Library on (-) Parental Cells
Figure 7. Enrichment of the circular ssDNA library specific for PC3 monitored by flow cytometry. 5 x 105 PC3 cells were incubated with G0 (scrambled), G19 (enriched), or unlabeled (binding buffer only) library for 30 min at 4°C.
a. Flow cytometry dotplot results of unlabeled (left), G0 (center), and G19 (right) labeled PC3 cells. The top row represents side scatter (y-axis) and forward scatter (x-axis) cell morphology by identification of the cells, and excluding any debris and dead cells from the PC3 cells. The bottom row shows fluorescence (x-axis) and side scatter (y-axis) of the FITC fluorescently-library that has bound to the PC3 cells.Ref:[Notebook, AN Priya Book 3, 124-127]
b. Histogram of flow cytometry Fluorescence intensity (x-axis) as a function of the number of viable cells (y-axis) analyzed with Flowing Software v1.6.0. The G19 library (blue) is shifted to the right of the G0 (red) and unlabeled library (black) after incubation with PC3 cells.Ref:{Notebook, AN Priya Book 3, 124-127]
Figure 7. Enrichment of the circular ssDNA library specific for PC3 monitored by flow cytometry. 5 x 105 PC3 cells were incubated with G0 (scrambled), G19 (enriched), or unlabeled (binding buffer only) library for 30 min at 4°C.
a. Flow cytometry dotplot results of unlabeled (left), G0 (center), and G19 (right) labeled PC3 cells. The top row represents side scatter (y-axis) and forward scatter (x-axis) cell morphology by identification of the cells, and excluding any debris and dead cells from the PC3 cells. The bottom row shows fluorescence (x-axis) and side scatter (y-axis) of the FITC fluorescently-library that has bound to the PC3 cells.Ref:[Notebook, AN Priya Book 3, 124-127]
b. Histogram of flow cytometry Fluorescence intensity (x-axis) as a function of the number of viable cells (y-axis) analyzed with Flowing Software v1.6.0. The G19 library (blue) is shifted to the right of the G0 (red) and unlabeled library (black) after incubation with PC3 cells.Ref:{Notebook, AN Priya Book 3, 124-127]
![Page 37: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/37.jpg)
Flow Cytometry of Enriched Aptamer Library on (+) CellsFlow Cytometry of Enriched Aptamer Library on (+) Cells
Figure 6. Enrichment of the circular ssDNA library specific for PSMA-PC3 monitored by flow cytometry. 2.5 x 105 PSMA-PC3 cells were incubated with G0 (scrambled), G19 (enriched), or unlabeled (binding buffer only) library for 30 min at 4°C.
a. Flow cytometry dotplot results of unlabeled (left), G0 (center), and G19 (right) labeled PSMA-PC3 cells. The top row represents side scatter (y-axis) and forward scatter (x-axis) cell morphology by identification of the cells, and excluding any debris and dead cells from the PSMA-PC3 cells. The bottom row shows fluorescence (x-axis) and side scatter (y-axis) of the FITC-labeled library that has bound to the PSMA-PC3 cells.Ref:{Notebook, AN Priya Book 3, 124-127]
b. Histogram of flow cytometry Fluorescence intensity (x-axis) as a function of the number of viable cells (y-axis) analyzed with Flowing Software v1.6.0. The G19 library (blue) is shifted to the right of the G0 (red) and unlabeled library (black) after incubation with PSMA-PC3 cells.Ref:{Notebook, AN Priya Book 3, 124-127]
Figure 6. Enrichment of the circular ssDNA library specific for PSMA-PC3 monitored by flow cytometry. 2.5 x 105 PSMA-PC3 cells were incubated with G0 (scrambled), G19 (enriched), or unlabeled (binding buffer only) library for 30 min at 4°C.
a. Flow cytometry dotplot results of unlabeled (left), G0 (center), and G19 (right) labeled PSMA-PC3 cells. The top row represents side scatter (y-axis) and forward scatter (x-axis) cell morphology by identification of the cells, and excluding any debris and dead cells from the PSMA-PC3 cells. The bottom row shows fluorescence (x-axis) and side scatter (y-axis) of the FITC-labeled library that has bound to the PSMA-PC3 cells.Ref:{Notebook, AN Priya Book 3, 124-127]
b. Histogram of flow cytometry Fluorescence intensity (x-axis) as a function of the number of viable cells (y-axis) analyzed with Flowing Software v1.6.0. The G19 library (blue) is shifted to the right of the G0 (red) and unlabeled library (black) after incubation with PSMA-PC3 cells.Ref:{Notebook, AN Priya Book 3, 124-127]
![Page 38: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/38.jpg)
Cell-based Selection for Intracellular-targeting AptamersCell-based Selection for Intracellular-targeting Aptamers
>100-fold preference for cells expressing intracellular target versus control cells>100-fold preference for cells expressing intracellular target versus control cells
Captureligand-target complexes
Captureligand-target complexes
intracellular targetintracellular target Circular-ssDNA libraryCircular-ssDNA library
discard unbounddiscard unbound
isolate intracellular bound oligo ligandsisolate intracellular bound oligo ligands
![Page 39: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/39.jpg)
Microscopy of Internalized Polyclonal Aptamer LibraryMicroscopy of Internalized Polyclonal Aptamer Library
(-) counter cells expressing mutant receptor(-) counter cells expressing mutant receptor
Figure 2B. Phase contrast and fluorescent images of (-) Mutant receptor cell line following exposure to the TAMRA labeled G12 library. Mutant receptor cells, grown to 100% confluency in a 100 mm TPP tissue culture dish, were exposed to 0.06 µM TAMRA labeled G12 library in 3ml of binding buffer (0.1mg/ml yeast tRNA, 1mg/ml BSA in wash buffer) for 30 minutes at 370C. The unbound library was aspirated from the dish (transferred to Positive target cells); cells were washed twice with 5 mL wash buffer, scraped from their plate into 1 mL of wash buffer. A 20 ul aliquot was placed on a glass slide for microscopy. Both the phase contrast (left image) and fluorescent (right image) images were taken at 40X magnification of the same field using a Tsview 1.4 MP CCD COOLED camera. These images suggest the library does not bind to the (-) Mutant receptor cell line. [Ref: Notebook, NSR 3 – 43]
Figure 2B. Phase contrast and fluorescent images of (-) Mutant receptor cell line following exposure to the TAMRA labeled G12 library. Mutant receptor cells, grown to 100% confluency in a 100 mm TPP tissue culture dish, were exposed to 0.06 µM TAMRA labeled G12 library in 3ml of binding buffer (0.1mg/ml yeast tRNA, 1mg/ml BSA in wash buffer) for 30 minutes at 370C. The unbound library was aspirated from the dish (transferred to Positive target cells); cells were washed twice with 5 mL wash buffer, scraped from their plate into 1 mL of wash buffer. A 20 ul aliquot was placed on a glass slide for microscopy. Both the phase contrast (left image) and fluorescent (right image) images were taken at 40X magnification of the same field using a Tsview 1.4 MP CCD COOLED camera. These images suggest the library does not bind to the (-) Mutant receptor cell line. [Ref: Notebook, NSR 3 – 43]
![Page 40: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/40.jpg)
Microscopy of Internalized Polyclonal Aptamer LibraryMicroscopy of Internalized Polyclonal Aptamer Library
(+) target receptor expressing cells(+) target receptor expressing cells
Figure 2A. Phase contrast and fluorescent images of Target receptor cell line following exposure to TAMRA labeled G12 library. Target cells, grown to 100% confluency in a 60mm TPP tissue culture dish, were exposed to TAMRA labeled G12 library (3 ml of the unbound fraction after (-) Mutant selection), for 30 minutes at 370C. The excess library was aspirated from the dish; cells were washed twice with 5 mL wash buffer (1X PBS supplemented with 4.5 mg/mL glucose and 5mM MgCl2); scraped from their plate into 1 mL of wash buffer. A 20 ul aliquot was placed on a glass slide for microscopy. Both the phase contrast (left image) and fluorescent (right image) images were taken at 40X magnification of the same field using a Tsview 1.4 MP CCD COOLED camera. The images suggest that the G12 library was internalized. [Ref: Notebook, NSR 3 – 43]
Figure 2A. Phase contrast and fluorescent images of Target receptor cell line following exposure to TAMRA labeled G12 library. Target cells, grown to 100% confluency in a 60mm TPP tissue culture dish, were exposed to TAMRA labeled G12 library (3 ml of the unbound fraction after (-) Mutant selection), for 30 minutes at 370C. The excess library was aspirated from the dish; cells were washed twice with 5 mL wash buffer (1X PBS supplemented with 4.5 mg/mL glucose and 5mM MgCl2); scraped from their plate into 1 mL of wash buffer. A 20 ul aliquot was placed on a glass slide for microscopy. Both the phase contrast (left image) and fluorescent (right image) images were taken at 40X magnification of the same field using a Tsview 1.4 MP CCD COOLED camera. The images suggest that the G12 library was internalized. [Ref: Notebook, NSR 3 – 43]
![Page 41: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/41.jpg)
Aptagen’s Capability Against a Wide Range of TargetsAptagen’s Capability Against a Wide Range of Targets
![Page 42: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/42.jpg)
![Page 43: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/43.jpg)
![Page 44: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/44.jpg)
The AptabodyTM Technology
![Page 45: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/45.jpg)
Conceptual RelationshipsConceptual Relationships
aptameraptameraptabodyTMaptabodyTM
Naked nucleic acidNaked nucleic acid Conjugated nucleic acidConjugated nucleic acidFunctionalized
nucleic acidFunctionalized
nucleic acid
DeliveryDelivery Improve PK/PDImprove PK/PD
Effective DrugEffective Drug
![Page 46: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/46.jpg)
AptabodyTM LibraryAptabodyTM Library(>1014 molecules)(>1014 molecules)
unique SupraMolecular structuresunique SupraMolecular structures
(activity arises from the precise positioningof functional groups within scaffold)
(activity arises from the precise positioningof functional groups within scaffold)
Diversity of Functional GroupsDiversity of Functional Groups
• organics• metals
• organics• metals
* fatty acids* sugars* fatty acids* sugars
* amino acids* small molecule drugs* amino acids* small molecule drugs
*molecular sizes are not relatively proportional*molecular sizes are not relatively proportional
![Page 47: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/47.jpg)
val
leu
ser
tyr
pro
NC
G
A
T
C
5’
3’
Largest
Yes
Yes
None
Yes
Large (<60 KD)
Small
Yes
n/a
One
Yes
Large (<30 KD)
Moderate
Yes
Moderate
Small
Yes
Moderate to Largest (up to 180 KD for Antibody)
Large
Yes
Moderate
Largest
No
Small (300-500D)
Chemical Diversity
Serum stability
DELIVERY
Drugs on the Market
‘In Vivo Selection’ Capability
Molecular Size
Comparison of Pharmaceutical Drug Formats Comparison of Pharmaceutical Drug Formats
organics & Biologics Nucleic Acid Aptabody™natural products Peptides & Proteins Aptamer (postulated)
Small molecule drugs
Most favorable condition
Flexibility to Improve PK/PD properties Smallest Moderate Moderate Largest
![Page 48: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/48.jpg)
1-717- Aptagen
![Page 49: “Forget Antibodies. Use Aptamers!”. Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery](https://reader035.vdocuments.us/reader035/viewer/2022062315/56649dab5503460f94a99f63/html5/thumbnails/49.jpg)