forest threatnet july08 final reduced · sousouothethern rnrrn rerese eeareaearrchcch ch...

1
F F F F F F F o o o o o o o or r re e e e e e e e es s s s s s s s st t t t t t t t t T T T T T T T T T T T T Th h h h hr r r r r re e e e e e e ea at t t t t t tN N Ne e e e et t t t t t F F F F F F F F F F F F o o o o o o o o o o o o o r r r re re e e e e e e e e e s s s s s s s s s s s s s s t t t t t t t t t t t t t T T T T T T T T T T T T h h h h h h h r r r r r r re e r r re e e e e e e e e e e e a a a a a a a a a a t t t t t t t t t N N N Ne et t t N N N N N N N N N N N e e e e e e e e e e et t t t t t t t is is s s is is is is s s a a a a a a a a a Q Q Q Q Q Q Q Q Q Q Q ua ua ua ua ua ua ua u ua a uart rt rt rt rt rt rt rt rt rt rt rt ter er e er er er e er e e er rly y y y y y N N N N N N N N N New ew ew ew ew ew ew ew e ew w w e e ew wsl sl sl sl sl sl sl sl sl l l slet et et et et et t et t et t t t t t t et e e e e e te t t t te t t t t te t te t te e e e te ter r r r r r r r r r T T T T T Th h h h T Th T T Th h The e e e e e e Ea Ea Ea Ea a E Ea Ea a a E E st t st st t t s ster er er er er rn n n n n n n n n n n n Fo Fo Fo Fo Fo o o o Fo o o o F F re re re re re e e re re re e re e r rest st s st st E E E E En nv nv nv nv v nv nv nv v n n nv vir ir ir ir ir ir r i ir i i o o on on on n on n nme me me me e me me m me m me me e ent nt nt nt nt nt nt n al al al al al a a Th Th Th Th Th T Th Th Th T Th h Th T T re re r re re e re r re e re re e e e e e eat at at at at at a a a a a a a a at t a a a A A A A A A A A A Ass s ss ss ss ss ss s ss s ss ss ss s s s e e es es e e e e e e e e e sm sm sm m sm m men e en n en n en n n n en n nt t t t t t t t Ce Ce C Ce Ce Ce Ce e Ce Ce C Ce C nt nt n nt nt nt n n nt nt nt nt t t ter er er e e e e e e e e er r e e e (E (E (E (E (E E EF FE FE FE F F FE E FE FE FE FE F TA TA TA TA TA A TA A TA A TA A A TA A A TA TA T T A T A T A AC) C) C) C) C) C) C C C) C C C C) C C) C) ) i i i is s s s s an an a an n n n n n a a in nt nt n nter er er e e di di di di di di i i d d sc sc c c sc sc c c c cip i ip ip ip ip ip i i i i ip p li li li li li i i li li li l l li i i in n na n n na na na n n n n ry ry ry ry y ry y y y y y y y re re re re e re re e e re re e eso so so so o o so o o o o s sour ur u u u ur u u ur ur r r rce ce ce e ce c ce c ce e c a a a a a a a a a act ct ct ct ct ct c ct ctiv iv iv iv iv v iv iv v v iv vel el el el l l l l l ly y y y y y y de de de de de d ve v v ve ve ve ve ve e v velo lo l lopi pi pi pi pi pi p p pi pi p pi p ng ng ng g g ng ng ng g ng ng ng n n n n n n n n n n n new ew ew ew ew w w ew ew e ew te te e te te te te te e e te te ech ch ch ch ch ch h ch ch chno no no no o no no no o olo lo lo lo lo lo lo o o lo lo o o ogy g gy gy gy gy gy gy gy y g g g g a a a a a a a a a d nd nd nd nd nd nd nd nd nd nd nd d t t t t t too oo oo oo ools ls s ls ls ls s t t t t t t t to o o o o o o o o o o o o an a an an n n n n an a an an nti ti ti ti ti i ti ti ti t t c c c c ci ci ci ci ci c c c ci ci c ci c c pa pa pa pa pa p pa pa pa te te te te te te e e e e e te e te t t an an a a an an n an an n an a an a d d d d d d d d d d d d re re re e e re r sp sp sp sp sp sp pon on on on on n o o on o o d d d d d d d d d d d to to to o to to to o to to o e e e e eme m me m me m m m r rg rg rg rg rg rg g rg r rg rg rgin in in n n n n in n n n n ng g g g g g g g g g ea e ea ea ea ea a a ea ea ast st st st st s st s s ster er e e er r er r r r rn n n n n n n n n n n n fo fo fo fo o o o o fo fo o o o ore re r re re re re re e r rest st st s s st st t t st t st t t t t t t t t t t t t t thr hr hr hr hr r hr hr r hr hr h hr r r rea ea ea ea ea ea ea e e ea ea ea e e ts ts ts ts ts s t ts s t . . . T T T T T T The he he e he he e h C C C C C C C C C C C C C en en en en en en e en en e e e te te te t te te e e er r r r r r r r r r r r is s is s is i i i i i is i i i a a a a a a a jo jo jo j jo jo jo jo jo jo jo oin in in in n n in n in in n n in nt t t t t t t t t t e eff eff eff eff eff eff eff eff e eff eff eff or or or or or or or o o or or o o or o o o or rt t t t t t t t t t o of of of of of of o of f f t t t t t t t t t th h he he he he h h he he h h he h F F F F For o or or r r o or or r or o o e es es es es es es es e est t t t t t t t Se Se Se Se Se e Se Se Se e Se e e e e e Se S Serv rv rv r rv rv rv r rv rv rv r rv r ic ic i i ic ic c ce’ ee’ e e e e e e e s s s s s s s s R R R Re Re R Re Re e e e R R R R se se se se e e e e s s s se s se e e ear ar ar ar ar ar a ar r r r arch ch ch ch ch ch ch ch c ch c ch h h h a a a a a a a a a a a and nd d d nd nd nd nd nd n nd nd nd d D D D D D D Dev ev ev ev ev ev v v v ev v ev ev v v v v v vel el el e e el el el e e e e o o o op op op op op o op op op p o o opm m m me m me me me me me e m me e e me m me m nt nt nt nt n n nt nt nt nt n n n n , , , , , , , N N Na Na a a N Na N N N N ti ti ti ti ti t ti ti ti t ti t on on o on n on o o o on on n o al al al l al al al al l al al F F F F F F F F F F For or or or or o or or or or r r r res es es es es es s es es es e es es es est t t t t t t t t t t t t Sy Sy Sy Sy Sy Sy y yst s st s st st s e em em em em m em e e e , , an an an an an n n an a d d d d d d d d d d d d d S St S S St St t t t S S St St S S at a a a a a at at at at a at t t a at ate e e e e e e e a a a a an an n n a an a d d d d d d d Pr Pr Pr Pr Pr Pr Pr Pr Pr Priv iv iv iv iv iv iv v iv vat at at at at at at at at a at t at ate e e e e e e e Fo Fo Fo Fo Fo Fo Fo Fo Fo o o Fo F F Fo o F r r re re r r r re r r r re re e r r s st st st st t try ry ry y ry y ry y y a a a a a a a a a a a a a a and nd nd nd d nd nd n n n h h h h h h h h h h hou ou ou u u o o ou o ou ou ou u use se se s se e e se se e se s se se e e e e s s s s d d d d d d d d d d d wi wi w wi wi wi wi wi w w t th th h h th h h t t t t th h t t in in in n n in in in in t t t t t t t t t t the he he he he h he he he he h h he h S S S S S S S S S S S S Sou ou o o o ou ou o ou out th th th t t th h h t er er r er er r r e n n n n n n n n n n n n Re Re R Re R Re Re ese se se se se se e e e s se s sea ar ar ar ar ar ar a ar ar ar rch ch ch c ch h ch c c ch ch ch ch h ch c c c ch c St St St St St S a a a at a at at at t t a a i i io io io io on. n. . n n n n n Ed Ed Ed Ed d d Ed d Ed Ed Ed Ed E Ed d Ed dit it it it it tor or r or r or r r r Pe Pe Pe Pe Pe Pe Pe Pe Pe erd rd rd d rd rd d r it it it it it it it it i a a a a a a a a a Sp Sp Sp Sp Sp Sp Sp p p i i ri r ri i ri ri ri i i rigg gg gg g g gg s s s s s s s s Ea E Ea Ea a a ast t t te e e e e e ste t st rn rn rn rn rn rn rn For For For For For F F F Fo est est est est est st s En E E E En nvir v vir vir ir ir i ir vir iron onm n nm nm onm n onm m m me ent ent ent ent e ent enta al al a al al T T Thr Thr Thr hr hr Th T Thr h h T re e e e eat eat at ea ea at ea ea e Ass Ass Ass Ass Ass A ess ess ess ess e me me men en en en m me m m t C t C t C tC Ce en nt nt nt ent nt ent t e e er er er e C C C C Co Co o o o C Co Co o o Co o ont nt nt nt nt nt t nt nt t nt n ri ri ri ri r ri ri i i i ri ri ri ibu bu bu bu bu bu u b bu b t ti ti t ti ti ti ti t ti ti i ti t t ng ng ng ng ng ng ng ng W W W W W W W W W W W W W W Wri ri ri ri ri ri ri r r ri r r r te te te te te te te te t rs rs rs rs rs rs rs St St St St St t t t t t te e e e e ep ep ep ep ep ep e e ha ha ha ha a ha ha ha ha ha ani ni n ni n n ni n e e e e e e e e W W Wo Wo W Wo Wo Wo Wo Wo Wo W Wo W rl rl rl rl rl rl rl rl r rl r ey ey ey y ey-F -F F -F -Fir ir r i i ir rle le le le le e le e le le le e e ley y y y y y y y y y Eas Eas Ea as ste te te er er er er te te n F n F n F n F Fore ore ore ore ore r r r st st st st st st E En En Env nv nv v nv v n E iro iro iro iro o iro ro o onm nm m m m m nme me menta nta nta n l T l T l T l T Th h h hr re h hre re hre e re h h a at at at t a a at a a Ass Ass Ass ess ess ess s men m m me me e e en en n nt C t C t C t Ce e en e ent ent ent e er er er e e Ka Ka Ka K K K ri ri r rin n n n n n Li Li Li Li L ch ch ch ch ch hte te te te ens ns ns ns s s ste te te te te t t t te tein in n in i i in n Uni Uni Uni Uni Uni Un n n ver ver ve ve ver er er ersit sit si sit it t ty o y o yo yo o o yo y o y o y o y y f N f f f N f N fN fN fN fN f fNort or or ort t t t o h C h C h h C h C h C C Caro aro o ro o o o aro o a lin lin lin lin lin i a A aA a A aA aA A a A a a Ashe she sh s s she he h she he he he hevil vil vil vil vil vil i vil v vil ville’ le’ le le le le’ e’ e l l le le e s s s s s s Na Nat Nat Nat Nat Nat t t N Natio io io on on on io on nal al al l al Env Env Env nv nviro iro iro r n n nme me me me m menta nta nta ta ntal lM lM l M M l M M M Mode ode ode ode od ode ode od od od o od de el lin n n n n n li l li li g a g a g g a g a g a a a a a g a and nd nd nd nd nd n nd n n nd n nd d Ana Ana Analys lys ly y is is is is Cen Cen Cen n Cen nter ter ter er Co Co Co Co Co Co Co Co Co Co ont nt n nt nt nt nt t nt nt nt t tr ri ri ri i ri ri ri r bu bu bu bu bu bu bu bu bu bu b buti i ti ti ti ti t t t t t t ng n ng ng n ng ng ng n n n n P P P P P P P P Pho ho h ho ho ho ho ho ho o o ho o oto to o to to t t to to to to o o ogr gr gr gr gr gr gr r g gr gr rap ap ap ap ap a ap ap a ap p p ap p h he he h he he he h h r r r r r r r r r r r r r r r Ro Ro Ro Ro Ro R Rod d d d d d K K K Ki Ki K Ki K nd d nd nd nd nd nd d dlu l lu lu lu lu l l l l l nd nd nd n nd nd d d n nd n Sou Sou Sou Sou ou Sou Sou Sou Sou Sou Sou o Sou S the the he he the the he he t t rn rn r rn r Re Re e Re Res Res e e e ear ar r r r ea e ch c c c ch ch ch St Sta Sta ta Sta S Statio t tio tio tio o o on n n n L L La La La La La La La La La La La La Layo yo yo yo yo y yo yo yo o yout ut ut ut ut ut ut ut ut ut ut t t a a a and nd n nd nd nd d D D D D D D D D D D D D D D De e es es e es es es es es e e ig ig g g ig g g g g g gn n n, n, n n, n n, n n n, n, n Co Co o Co o o o ont nt nt nt nt nt nt nt nt nt nt tri ri ri ri ri ri ri ri ri r r bu b bu bu bu bu bu u bu bu bu bu b b ti ti ti ti ti ti ti ti ti ti t t ti t ng ng ng ng ng ng ng P P P Pho ho ho ho ho o o o o o oto to to to to to t t t t to o t gr gr gr r gr g gr r gr gr gr grap ap a ap ap ap ap ap ap p ap ap aphe he h he he he he he he he er r r r r r r r r r r r an an an an an an an an an a a d d d d d d Wr Wr Wr Wr Writ it it t it it t t t t t ite er er er er er er er e Br Br Br B Br B B B id id d d idg g ge ge ge ge e t t t t O’ O’ O’ O’ O O O O O Ha Ha Ha Ha Ha a ara ra ra ra a r Uni Uni Uni Un Uni niver ver v versit sit sit ty o y o y y y y y y o f N f N N N No or ort rt o orthC h C h aro a aro ro ro ro o aro r a lin lin in n lin l li a A a A A Ashe she s s evil vil il v v vil i le’ le’ le’ s s s Nat Nat Nat at Na Na ion ional al l a a a Env E E E E Env Env E viro iro iro ro ir n nme nme nm n nta nt nt ta nta nta a t l M lM l M M M l M Mode ode o o lin ling a g a a a and nd n n Ana Ana na a a a alys ys y ly ly y ys ysis s Cen C Cen e en Cen e ter ter ter er e Forest ThreatNet | Spring / Summer 2008 | www.forestthreats.org 3 Forest ThreatNet A popular spot for picking blueberries in Western North Carolina is Graveyard Fields on the Blue Ridge Parkway. It is hard to imagine how this place got its name. Rolling hills with small deciduous trees and blueberry bushes have replaced what has become one of the most imperiled forest types in the southeast—the spruce-fir forest. In the early 1900’s, a raging fire burned the stumps and fallen logs that gave the ‘graveyard’ appearance, scorching the soil organic matter and creating a perfect environment for blueberries. This may be good for those who like blueberries, but EFETAC ecologist Steve Norman says such changes present real problems for forest managers. As a vegetation ecologist, he is interested in why forests change and how natural environmental variation and management affect long-term outcomes. “For me, you can’t say ‘forest’ without implying change. Forests are all about change–trees establish, grow, and die, species compete, and the environmental backdrop also changes,” says Norman. “Climate variability has always affected the system as have disturbances, and in many forests humans have also been important. A forest is in constant flux.” He has been working on a decision process for predicting outcomes to account for uncertainties, called the Comparative Risk Assessment Framework and Tools (CRAFT). Norman has worked with former Pacific Southwest Research Station (PSW) research forester Jeff Borchers, PSW wildlife biologist Sandy Jacobson, EFETAC Director Danny Lee, and UNC Asheville’s National Environmental Modeling and Analysis Center project manager Karin Lichtenstein to use probability models called Bayesian Belief Networks (BBNs). He sees BBNs as an effective means to quantify consequences of actions and non-actions across the landscape, portray conditional risk, and create geospatial visualizations of outcomes that will provide a powerful interpretation and communication tool for forest managers. Building on the National Environmental Policy Act (NEPA) framework for managing public lands, CRAFT approaches forest issues comprehensively. CRAFT allows managers to consider ways an ecosystem will change if left completely alone, or if managed in a certain way at a certain time given the likelihood of disturbance. By providing forest managers with scenarios for possible choices, Norman hopes the tool will improve their ability to account for complexity while making tradeoffs more transparent. “CRAFT,” Norman says, “can be applied to the broadest, regional questions, such as climate change and land use change, or stand-level questions that public or private land owners may have. With CRAFT, forest planning that incorporates the science of uncertainty will become increasingly possible.” EFETAC ecologist Steve Norman is helping to develop a Comparative Risk Assessment Framework and Tools (CRAFT) that helps managers improve land management decisions. CRAFTing Tools for Forest Managers Scientist Encourages Comprehensive Approach to Forest Management By Bridget O’Hara, NEMAC and Karin Lichtenstein, NEMAC

Upload: others

Post on 18-Jul-2020

1 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Forest ThreatNet july08 final reduced · SouSouothethern rnrrn ReRese eeareaearrchcch ch StStaStatiottioon LLaLayoyyooutut aandnndd DDeese iggnn,n Coonttrirbubbuutittiing PPhootottoogrggrrapaapphehheer

FFFFFFFooooooooorrreeeeeeeeeessssssssssttttttttt TTTTTTTTTTTTThhhhhrrrrrreeeeeeeeaatttttttNNNeeeeeetttttttFFFFFFFFFFFFooooooooooooorrrrereeeeeeeeeessssssssssssssttttttttttttt TTTTTTTTTTTThhhhhhhrrrrrrreerrreeeeeeeeeeeeaaaaaaaaaatttttttttNNNNeetttNNNNNNNNNNNeeeeeeeeeeettttttttisisssisisisisss a aaaaaaaa QQ QQQQ Q QQQQQuauauauauauauauuaauartrtrtrtrtrtrtrtrtrtrtrtterereererereereeerrlyyyyyy N NNNN NNNNNeweweweweweweweweewwweeewwslslslslslslslslslllsletetetetetettettettttttteteeeee tettttetttttettetteeeeteterrrrrrrrrr

TTTTTThhhhTThTTThhThe eeeeee EaEaEaEaaEEaEaaaEE sttststttssterererererrn nn n nnnn nn n n FoFoFoFoFooooFooooFF rerererereeererereereerreststsstst E EEEEnnvnvnvnvvnvnvnvvnnnvviriririririrriirii ooonononnonnnmemememeemememmemmemeeentntntntntntntn alalalalalaa ThThThThThTThThThTThhThTT rererrereererreerereeeeeeeatatatatatataaaaaaaaattaaa AAAAAAAAAAssssssssssssssssssssssssss eeeseseeeeeeeee smsmsmmsmmmeneennennennnnennnt tttt ttt CeCeCCeCeCeCeeCeCeCCeC ntntnntntntnnntntntnttttererereeeeeeeeerreee

(E(E(E(E(EEEFFEFEFEFFFEEFEFEFEFEF TATATATATAATAATAATAAATAAATATATTATATAAC)C)C)C)C)C)CCC)CCCC)CC)C)) i iiisss ss ananaannnnnnaa i nntntnnterereree didididididiiidd scscccscscccccipiipipipipipiiiiippppplililililiiilililillliiiinnnannnananannnn ryryryryyryyyyyyyy rererereerereeerereeesosososooosooooossoururuuuuruuururrrrcececeececcecceec a aaaaaaaaactctctctctctcctctivivivivivvivivvvivvelelelellllllly yyy yyy dededededed vevvveveveveveevvelolollopipipipipipipppipippipppp ngngngggngngnggngngngggggggg nn n nn nnnnnn newewewewewwweweweew teteeteteteteteeeteteechchchchchchhchchchnonononoonononooolololololololooololoooogyggygygygygygygyygggg a aaaaaaaa dndndndndndndndndndndndd tt t tttoooooooooolslsslslslss tt ttttttoo oo ooooooooo anaanannnnnanaananntititititiititititt cccccicicicicicccciciccicc papapapapappapapappp teteteteteteeeeeeteetettananaaanannanannanaana ddddd d d dddd d rerereeerer spspspspspspponononononnooonoo d d ddddd d ddd tototootototoototoo eeeee memmemmemmm rrgrgrgrgrgrggrgrrgrgrginininnnnninnnnnng g ggggg g ggg eaeeaeaeaeaaaeaeaastststststsstsssterereeerrerrrrrnnn nnn n nnnnn

fofofofooooofofooooorererrerererereerrestststssststttsttsttt t t tttttt tttthrhrhrhrhrrhrhrrhrhrhhrrrreaeaeaeaeaeaeaeeeaeaeaee tststststssttsst . .. TTT T TTTheheheeheheeh CC C CCCCCCCCCCCeneneneneneneeneneee tetetetteteeeer rrrr r rr rrr r ississisiiiiiisiii aaaaaaa jojojojjojojojojojojooininininnninnininnninnt t tt tttttt eeffeffeffeffeffeffeffeffeeffeffefffffffffffffforororororororooororoooroooorrtt ttttt ttt oofofofofofofoofff tttttttttthhhehehehehhhehehhheh FFFFForoororrroororroroo eeseseseseseseseest tt ttttt SeSeSeSeSeeSeSeSeeSeeeeeeSeSServrvrvrrvrvrvrrvrvrvrrvr iciciiiciccce’e’e’eeeeeee ss ssss ss

RRRReReRReReeeeRRRR seseseseeeeessssesseeeeararararararaarrrrarchchchchchchchchcchcchhhh aaaaaaa aa a aandndddndndndndndnndndndd DDDDDDDevevevevevevvvvevvevevvvvvvveleleleeeleleleeee oooopopopopopoopopoppooopmmmmemmememememeemmeeememmem ntntntntnnntntntntnnnn , ,,,, ,,NNNaNaaaNNaNNNN tititititittititittit ononoonnonoooononno alalallalalalallalal F FFF FF F FFFForororororoororororrrrresesesesesesseseseseesesesestttttt ttt t t t t SySySySySySyyystsstsststs eememememmemeee , , ananananannnana d d d dddddddddd SStSSStSttttSSStStSS ataaaaaatatatataatttaatate ee ee eeeaaaaanannnaana d d ddd dd PrPrPrPrPrPrPrPrPrPrivivivivivivivvivvatatatatatatatatataattatateee eeeee FoFoFoFoFoFoFoFoFoooFoFFFooF rrrererrrrerrrrereerr sststststttryryryyryyryyy a aaaaaaaaaaaaaandndndnddndndnnn h hh hh hhhhhhouououuuooouoouououuusesesesseeeseseesesseseeeeessss dd d dddddd dd

wiwiwwiwiwiwiwiww tththhhthhhttttthhtt inininnninininin tt t t t tttttthehehehehehhehehehehhheh SSSSSSSSSSSS Sououoooououoououtthththttthhht ererrererrre nn n nnnn nnnnn ReReRReRReReeseseseseseseeeessesseaararararararaarararrchchchcchhchccchchchchhchcccchcc StStStStStS aaaataatatatttaa iiioioioioon.n..nnnnn

EdEdEdEdddEddEdEdEdEdEEddEddititititittororrorrorrrr

PePePePePePePePePeerdrdrddrdrddr ititititititititi aaaa a aaaa SpSpSpSpSpSpSpppp iirirriiriririiiriggggggggggg ssssssssEa EEa Eaaaastttteeeeeestetst rn rn rnrnrn rnrn ForForForForForFFFFo estestestesteststs En E EEEnnvirvvirviriririirvirirononmnnmnmonmnonmmmmeententententeententaal al aal al TTThrThrThrhrhrThTThrhhT reeeeeateatateaeaateaeae

AssAssAssAssAssA essessessesse mememenenenenmmemm t Ct Ct Ct CCeenntntntentntenttee ererere

CCCCCoCooooCCoCoooCooontntntntntnttntnttntn ririririrririiiiriririibubububububuubbub ttitittitititittitiititt ngngngngngngngng W W WWWWWWWWWWWWWriririririririrrrirrr tetetetetetetetet rsrsrsrsrsrsrs

StStStStSttttttteeeeeepepepepepepeephahahahaahahahahahaanininninnnin eeee ee ee WWWoWoWWoWoWoWoWoWoWWoW rlrlrlrlrlrlrlrlrrlr eyeyeyyey-F-FF-F-Firirriiirrleleleleleeleeleleleeeleyyyy y y y y yyyEasEasEaassteteteerererertete n Fn Fn Fn FForeoreoreoreorerrr st st st st stst EEnEnEnvnvnvvnvvnE iroiroiroirooirorooonmnmmmmmnmemementantantan l Tl Tl Tl TThhhhrrehhrerehreerehh aat at attaaataa

AssAssAsssessessesss menmmmemeeeenennnt Ct Ct Ct Ceeeneententente erereree

KaKaKaKKK ririrrin n nn nn LiLiLiLiL chchchchchhteteteteensnsnsnsssstetetetetetttteteininniniiinn UniUniUniUniUniUnnn ververveveverererersitsitsisitittty oy oy oy oooy oy oy oy oyy f Nfff Nf Nf Nf Nf Nf Nff Nortororortttto h Ch Chh Ch Ch CCCaroaroorooooarooa linlinlinlinlini a Aa Aa Aa Aa AAa Aaa Ashesheshssshehehshehehehehevilvilvilvilvilvilivilvvilville’le’lelelele’e’elllelee ssssssNaNatNatNatNatNatttNNatioioioonononioonnalalal lal EnvEnvEnvnvnviroiroiror nnnmememememmentantantatantall Ml Ml M Ml M MMModeodeodeodeododeodeodododooddeellinnnnnnlillili g ag ag g ag ag aaaaag aandndnd ndndndnndnnndnndd

AnaAnaAnalyslyslyy isisis is CenCenCennCennterterterer

CoCoCoCoCoCoCoCoCoCoontntnntntntnttntntntttrriririiriririr bububububububububububbutiitititititttttt ngnngngnngngngnnnn PPPPPPPPPhohohhohohohohohooohooototootototttotototoooogrgrgrgrgrgrgrrggrgrrapapapapapaapapaapppappphhehehhehehehh rrrrrrrrrrrrrrr

RoRoRoRoRoRRod d d d dd KKKKiKiKKiK nddndndndndndddlullululululllll ndndndnndndddnndn SouSouSouSououSouSouSouSouSouSouoSouS thethehehethethehehett rn rnrrn r ReReeReResRese eeeararrrreae chcccch chch StStaStataStaSStatiottiotiotioooonnnn

LLLaLaLaLaLaLaLaLaLaLaLaLaLayoyoyoyoyoyyoyoyooyoutututututututututututtt a aaandndnndndndd DDDDDD DDDDD DDDDeeeseseesesesesesee igigggigggggggnnn,n,nn,nn,nnn,n,n

CoCooCooooontntntntntntntntntntnttriririririririririrr bubbububububuubububububb tititititititititititttit ngngngngngngng P P P Phohohohohoooooootototototototttttoot grgrgrrgrggrrgrgrgrgrapapaapapapapapappapapaphehehheheheheheheheer r r rrrrrrrrr anananananananananaa dd dddd WrWrWrWrWrititittitittttttiteererererererere

BrBrBrBBrBBB ididddidgggegegegeeg tt tt O’O’O’O’OOOOO HaHaHaHaHaaararararaar UniUniUniUnUniniververvversitsitsitty oy oy yyyyy oy f Nf NNNNoorortrtoorth Ch Ch aroaarorororooarora linlininnlinlli a Aa AAAsheshess evilvililvvvili le’le’le’sssNatNatNatatNaNa ionional al laaa EnvEEEEEnvEnvE viroiroiroroir nnmenmenmn ntantnttantantaat l Ml Ml MMMl MModeodeoo linling ag aaaandnd nn

AnaAnanaaaaalysysylylyyysysis s CenCCeneenCene terterterere

Forest ThreatNet | Spring / Summer 2008 | www.forestthreats.org 3

Forest ThreatNet

A popular spot for picking blueberries in Western North Carolina is Graveyard Fields on the Blue Ridge Parkway. It is hard to imagine how this place got its name. Rolling hills with small deciduous trees and blueberry bushes have replaced what has become one of the most imperiled forest types in the southeast—the spruce-fir forest. In the early 1900’s, a raging fire burned the stumps and fallen logs that gave the ‘graveyard’ appearance, scorching the soil organic matter and creating a perfect environment for blueberries. This may be good for those who like blueberries, but EFETAC ecologist Steve Norman says

such changes present real problems for forest managers. As a vegetation ecologist, he is interested in why forests change and how natural environmental variation and management affect long-term outcomes.

“For me, you can’t say ‘forest’ without implying change. Forests are all about change–trees establish, grow, and die, species compete, and the environmental backdrop also changes,” says Norman. “Climate variability has always affected the system as have disturbances, and in many forests humans have also been important. A forest is in constant flux.”

He has been working on a decision process for predicting outcomes to account for uncertainties, called

the Comparative Risk Assessment Framework and Tools (CRAFT). Norman has worked with former Pacific Southwest Research Station (PSW) research forester Jeff Borchers, PSW wildlife biologist Sandy Jacobson, EFETAC Director Danny Lee, and UNC Asheville’s National Environmental Modeling and Analysis Center project manager Karin Lichtenstein to use probability models called Bayesian Belief Networks (BBNs). He sees BBNs as an effective means to quantify consequences of actions and non-actions across the landscape, portray conditional risk, and create geospatial visualizations of outcomes that will provide a powerful interpretation and communication tool for forest managers.

Building on the National Environmental Policy Act (NEPA) framework for managing public lands, CRAFT approaches forest issues comprehensively. CRAFT allows managers to consider ways an ecosystem will change if left completely alone, or if managed in a certain way at a certain time given the likelihood of disturbance. By providing forest managers with scenarios for possible choices, Norman hopes the tool will improve their ability to account for complexity while making tradeoffs more transparent.

“CRAFT,” Norman says, “can be applied to the broadest, regional questions, such as climate change and land use change, or stand-level questions that public or private land owners may have. With CRAFT, forest planning that incorporates the science of uncertainty will become increasingly possible.”

EFETAC ecologist Steve Norman is helping to develop a Comparative Risk Assessment Framework and Tools (CRAFT) that helps managers improve land management decisions.

CRAFTing Tools for Forest ManagersScientist Encourages Comprehensive Approach to Forest Management By Bridget O’Hara, NEMAC and Karin Lichtenstein, NEMAC