INTRODUCTION

Signaling by Wnt/wg proteins regulates multiple cellular anddevelopmental processes that include control of cellproliferation, specification of cell fate and generation of cellpolarity (reviewed in Wodarz and Nusse, 1998; Shulman et al.,1998). In addition to short-range effects, Wnt proteins can alsoinfluence cells over long distances suggesting that thesesecreted signaling molecules can function as morphogens inembryonic tissue patterning (Struhl and Basler, 1993; Hopplerand Bienz, 1995). Genetic and biochemical dissection of theWnt signaling pathway has led to the identification ofcomponents and understanding of the mechanism of signaltransduction (reviewed in Wodarz and Nusse, 1998). Wntsignaling results in stabilization of β-catenin and in itsaccumulation in the cytoplasm and nucleus (Hinck et al., 1994;Van Leeuwen et al., 1994). In the nucleus, association of β-catenin with members of the LEF1/TCF family of transcriptionfactors, which alone have no transcription activation potential,mediates a response to Wnt signals and augments expressionof target genes (Behrens et al., 1996; Huber et al., 1996;Molenaar et al., 1996; van de Wetering et al., 1997; Hsu et al.,1998). Target genes of LEF1/TCF proteins include thepatterning genes Ultrabithorax in Drosophila and siamois andnodal-related gene-3 in Xenopus (Riese et al., 1997; Brannonet al., 1997; McKendry et al., 1997). In addition, the humangenes c-myc and cyclin D1, which influence cell proliferation,are regulated by LEF1/TCF proteins in association with β-

catenin (He et al., 1998; Tetsu and McCormick, 1999;Shtutman et al., 1999).

The developmental specificities of Wnt signaling can beaccounted for, in part, by the cell-type-specific expression ofWnt genes and Lef1/Tcf genes. In the mouse embryo, at leastseventeen Wnt genes are expressed in specific but overlappingpatterns (Parr et al., 1993; Hollyday et al., 1995; Grove et al.,1998; Wodarz and Nusse, 1998). Likewise, four closelyrelated Wnt-responsive transcription factors, LEF1, TCF1,TCF3 and TCF4, have been identified in the mouse (Traviset al., 1991; van de Wetering et al., 1991; Korinek et al.,1998a). Lef1 and Tcf1, which are expressed in overlappingpatterns in the primitive streak and limb buds of the earlymouse embryo, regulate paraxial mesoderm formation andlimb development in a redundant manner (Oosterwegel et al.,1993; Galceran et al., 1999). Lef1−/− Tcf1−/− mice have adefect in paraxial mesoderm formation that is virtuallyidentical to that observed in Wnt3a-deficient mouse embryos,consistent with the function of LEF1 and TCF1 in Wntsignaling (Galceran et al., 1999). In the developing brain,Lef1 is abundantly expressed in the mesencephalon and in thethalamus (Oosterwegel et al., 1993; van Genderen et al.,1994). Targeted inactivation of Lef1 was noted to impair thegeneration of the mesencephalic nucleus of the trigeminalnerve (van Genderen et al., 1994). Tcf1 and Tcf4, which arealso expressed in the brain, are apparently dispensable forbrain development (Verbeek et al., 1995; Korinek et al.,1998b), raising the question as to whether Lef1 acts

469Development 127, 469-482 (2000)Printed in Great Britain © The Company of Biologists Limited 2000DEV1484

Lef1 and other genes of the LEF1/TCF family oftranscription factors are nuclear mediators of Wntsignaling. Here we examine the expression pattern andfunctional importance of Lef1 in the developing forebrainof the mouse. Lef1 is expressed in the developinghippocampus, and LEF1-deficient embryos lack dentategyrus granule cells but contain glial cells and interneuronsin the region of the dentate gyrus. In mouse embryoshomozygous for a Lef1-lacZ fusion gene, which encodes aprotein that is not only deficient in DNA binding but also

interferes with β-catenin-mediated transcriptionalactivation by other LEF1/TCF proteins, the entirehippocampus including the CA fields is missing. Thus,LEF1 regulates the generation of dentate gyrus granulecells, and together with other LEF1/TCF proteins, thedevelopment of the hippocampus.

Key words: LEF1/TCF, Hippocampus, Dentate gyrus, Granule cells,Wnt

SUMMARY

Hippocampus development and generation of dentate gyrus granule cells is

regulated by LEF1

Juan Galceran1,*, Emily M. Miyashita-Lin2, Eric Devaney1, John L. R. Rubenstein2 and Rudolf Grosschedl1,*,‡

1Howard Hughes Medical Institute and Departments of Microbiology and Biochemistry and 2Nina Ireland Laboratory ofDevelopmental Neurobiology and Department of Psychiatry, University of California, San Francisco, CA 94143, USA*Present address: Gene Center and Institute of Biochemistry, University of Munich, Feodor Lynenstrasse 25, 81377 Munich, Germany‡Author for correspondence (e-mail: rgross@lmb.uni-muenchen.de)

Accepted 16 November 1999; published on WWW 12 January 2000

470

redundantly with other Tcf genes to regulate braindevelopment.

Wnt signaling is involved in development of the midbrainand hindbrain and the spinal cord. In particular, Wnt1−/− micelack derivatives of the isthmic organizer region includingthe cerebellum (McMahon and Bradley, 1990; Thomas andCapecchi, 1990). Expression of Wnt genes and bonemorphogenetic protein (BMP) genes in the dorsal midline(roof plate) of the spinal cord has been implicated in dorsalspecification of the spinal cord (Liem et al., 1995, 1997; Ikeyaet al., 1997; Chang and Hemmati-Brivanlou, 1998; Lee et al.,1998). Likewise, Wnt and Bmp genes are expressed in thedorsal midline of the brain (reviewed in Tole and Grove,1999). In regions of the dorsal midline that form thetelencephalic choroid plexus, expression of Wnt and Bmpgenes tends to be highest in the epithelium known as thefimbria or hem (Grove et al., 1998). In the telencephalon, thefimbria is flanked dorsomedially by the choroid plexus andventrolaterally by the neuroepithelium, which generates thehippocampal complex. Based on their expression patterns,Wnt and Bmp genes have been hypothesized to regulatehippocampal development (Tole and Grove, 1999). Thehippocampal complex consists of the dentate gyrus, the CAfields and the parahippocampal (subicular) cortex (Stanfieldand Cowan, 1988). Each of these domains may be derivedlargely from distinct proliferative zones of the wall of thedorsal telencephalon (medial pallium; Altman and Bayer,1990a,b). The primordium of the dentate gyrus is postulatedto lie adjacent to the Wnt-expressing fimbria, followed by theCA fields and the subicular cortex. Thus, Wnt proteins mayform a morphogenetic gradient that could pattern the medialpallium.

With the aim of gaining insight into the functionalimportance of Wnt signaling for the development of thetelencephalon, we analyzed mice carrying two types ofmutations in the Lef1 locus. Analysis of the telencephalicphenotype of a Lef1 null mutation indicated that LEF1regulates the differentiation of a specific cell type in thehippocampus complex, the dentate gyrus granule cells. Micecarrying a mutant allele of Lef1 that also interferes with thefunction of other Tcf genes, lack the entire hippocampuscomplex. Thus, the nuclear mediators of Wnt signaling controlmultiple steps in hippocampal development.

MATERIALS AND METHODS

Generation of an in-frame fusion of Lef1 and lacZAn in-frame fusion of the murine Lef1 locus and the bacterial lacZgene was generated by homologous recombination of a targetingconstruct in murine embryonic stem (ES) cells. For the generation ofthe targeting construct, a HindIII-XhoI fragment, containing both β-galactosidase-coding (lacZ) sequences and the PGK-neo gene with apolyadenylation signal from the bovine growth hormone gene, wasisolated from plasmid pSAβgal (Friedrich and Soriano, 1993). Theisolated DNA fragment was inserted into the single SmaI site of an 8kb genomic SalI-XhoI subclone from the murine Lef1 locus containingan HMG domain exon (van Genderen et al., 1994). The resulting geneconstruct encodes an in-frame fusion between amino acid 342 ofLEF1 and the amino terminus of β-galactosidase. The final genetargeting construct was generated by insertion of an XhoI fragmentcontaining the PGK-tk gene. The gene targeting construct was

linearized with SalI and electroporated into D3 ES cells (vanGenderen et al., 1994).

Homologous recombinants were identified by DNA blot analysis(van Genderen et al., 1994). The targeted ES clones were injected intoC57BL/6 blastocysts and the chimeric animals were screened forgermline transmission. Genotyping of mice was performed by PCRamplification as described (Galceran et al., 1999) using the Lef1-specific primers D8: 5′CCGTTTCAGTGGCACGCCCTCTCCTCC,and LPP2.2: 5′TGTCTCTCTTTCCGTGCTAGTTC and the lacZprimer LAC1: 5′CGTTCGGATTCTCCGTGGGAACAAAC. Micewere also genotyped by X-gal staining of tail biopsies from adultanimals or from embryonic tissues without previous fixation. X-galstaining was performed in X-gal staining solution (PBS, 2 mM MgCl2,0.01% (w/v) deoxycholate, 0.02% (v/v) Nonidet P-40, 5 mMpotassium ferricyanide, 5 mM potassium ferrocyanide, 0.5 mg/ml X-gal) at 37°C until signal was developed from control tissues.

Transient transfections and reporter gene assaysNeuro2A cells were grown in Eagle’s minimal essential medium withEarle’s balanced salt solution medium containing 5% fetal bovineserum. Transient transfections were performed by the Lipofectamine[Gibco] procedure according to the manufacturer’s protocol. TheLEF-CAT reporter gene, containing seven multimerized wild-typeLEF1 binding sites linked to the fos-chloramphenicolacetyltransferase (CAT) gene, was transfected alone or in combinationwith expression plasmids for β-catenin, LEF1 or TCF1 as described(Hsu et al., 1998). The LEF1-βGAL expression plasmid wasconstructed by inserting the SmaI fragment from the genomic Lef1-lacZ targeting construct (see above and Fig. 1A) into the SmaI site ofthe expression plasmid for LEF1 to generate an in-frame fusionbetween LEF1 and β-galactosidase. A RSV-luciferase control plasmidwas included in each transfection experiment to control for theefficiency of transfection. The total DNA concentration in eachtransfection was kept constant and the amounts of expression plasmidsencoding LEF1, TCF1 and β-catenin were chosen to yieldsubmaximal transactivation. The accumulation of LEF1-βGALprotein was assayed by measuring β-galactosidase activity asdescribed (Hsu et al., 1998). Luciferase activity was measured withthe Luciferase Assay System (Promega) according to themanufacturer’s protocol.

X-gal stainingFor X-gal staining of embryonic brains, embryos were dissected incold PBS and fixed in freshly prepared 4% formaldehyde in PBS pH7.4 for 1 hour at 4°C. After extensive washing in cold PBS, embryoswere cryoprotected in 30% sucrose in PBS, embedded and orientedin OCT (Miles Scientific) and frozen in a dry ice/ethanol bath. 12-14µm cryosections were postfixed for 1 minute in freshly made 4%formaldehyde and washed in PBS. β-galactosidase staining wasperformed in freshly made X-gal staining solution at 37°C overnightor until no more signal was detected. Sections were counterstainedwith Nuclear Fast Red and mounted in Permount.

For whole-mount X-gal staining of embryonic brains from E9.5 to12.5 embryos, isolated brains were fixed in freshly prepared 4%formaldehyde in PBS pH 7.4 for 1 hour at 4°C. After extensivewashing in PBS, mesenchymal tissue was removed under a dissectingmicroscope and the brains were stained overnight at 37°C in X-galstaining solution as described above. After staining, tissues werewashed in PBS, postfixed in 4% paraformaldehyde overnight, washedand photographed.

5-bromodeoxyuridine incorporation,immunohistochemistry and TUNEL assaysFor proliferation assays, pregnant females were injectedintraperitoneally with a solution of 5-bromodeoxyuridine (BrdU) in0.1 M Tris-HCl pH 7.5 at a ratio of 50 µg of BrdU per gram of bodyweight. After the indicated times, embryos were dissected out in cold

J. Galceran and others

471Forebrain development and lef1

PBS and fixed in Carnoy’s fixative (60% ethanol, 30% chloroform,10% acetic acid). Brains from embryos older than E16.5 weredissected out from the skull in cold PBS and fixed by immersion inCarnoy’s fixative. Tissues were dehydrated in ethanol, embedded inparaffin, sectioned at 7 µm and processed for immunohistochemistryas follows. Rehydrated sections were postfixed in fresh 4%paraformaldehyde in PBS, endogenous peroxidases were quenched in3% H2O2 in PBS containing 10% methanol, and sections were treatedwith 2 N HCl at 37°C for 30 minutes. Sections were neutralized in0.1 M borate buffer pH 8 and blocked in 10% goat serum 3% BSA0.1% Tween-20 in PBS. Cells that incorporated BrdU weredetected with mouse monoclonal antibody 85-2C8 against 5-bromodeoxyuridine [Novocastra] followed by biotinylated goat anti-mouse IgG1 and Vectastain ABC kit from Vector. Developing wasperformed with either DAB/H2O2 or peroxidase substrate Kit VectorVIP.

Immunohistochemistry was performed on frozen sections (10 µm)of paraformaldehyde-fixed embryos following essentially the sameprocedure as the BrdU immunohistochemistry, except that the 2 NHCl incubation step and neutralization in borate buffer were omitted.Rabbit antibodies against Calretinin and GFAP (Chemicon) were usedat 1:1000 dilution. Rabbit antiserum against Dlx-2 was used at 1:200dilution.

For the detection of apoptosis, serial coronal cryosections (12 µm)from paraformaldehyde-fixed embryos were subjected to TUNELtreatment following the manufacturers protocol (in situ ApoptagPlus-Peroxidase, and FITC. Oncor). Sections were counterstainedwith Methyl Green and mounted in Permount. For the quantificationof the numbers of proliferating and apoptotic cells, serial sections ofthe whole brain were photographed after the immunohistochemistryprocedure. A minimum of eight equivalent sections of wild-type andmutant brains were used to count the numbers of positive cells inthe designated areas. The areas were defined based on themorphology of the region and divided into two parts: dentate gyrusand dentate ventricular zone plus secondary proliferation populationzone.

In situ hybridizationFor whole-mount in situ hybridization, embryos were fixed for 1 hourin freshly prepared 4% formaldehyde. Heads were processed for insitu hybridization as follows: after extensive washing in cold PBS,heads were prepared under a dissecting microscope by removing allmesenchymal tissue from the nervous tissue. Isolated brains werepostfixed overnight in freshly prepared 4% formaldehyde andprocessed for in situ hybridization as previously described (Galceranet al., 1999). In vitro transcribed and DIG-labeled antisense RNAprobes were obtained from the following genes: Lef1, encoding aminoacids 1 to 243, Tcf1 clone M2a, Tcf3 and Tcf4 IMAGE clones 444295and 764951, respectively, as described in Galceran et al. (1999).Representative 12 µm cryosections from fixed embryos were collectedon slides and processed for in situ hybridization as follows. Sectionswere incubated in 4% paraformaldehyde in PBS for 20 minutes,transferred to 3× PBS and then to two washes in 1× PBS for 4 minuteseach. Slides were then rinsed in DEPC water and allowed to brieflyair dry. Sections were incubated with Proteinase K (10 µg/ml) (0.05 MEDTA pH 8.0 and 0.1 M Tris-HCl pH 8.0) for 20 minutes at 25°C,rinsed in 1× PBS. The sequence of steps was repeated with theexception that the fixation in 4% paraformaldehyde was only 5minutes. Slides were air dried briefly and acetylated in TEA(triethanolamine) and acetic anhydride. The slides were rinsed twicein DEPC water, air dried and hybridized with 2.5×105-2×106

cts/minute of 35S-labeled riboprobe in hybridization buffer aspreviously described. Slides were washed, immersed in emulsion(Kodak), exposed at 4°C and developed as previously described(Bulfone et al., 1993). For sections, in situ hybridization using DIG-labeled riboprobes was done essentially as above with the followingmodifications: embryos were fixed for one hour prior to

cryoprotection and embedding, proteinase K treatment was omittedand development of the signal was as described for whole-mount insitu hybridization.

RESULTS

Targeted insertion of a lacZ gene into the Lef1 locusWith the aim of visualizing individual cells that express theLef1 gene and generating a mutation in Lef1 that may interferewith the function of co-expressed LEF1/TCF proteins, weinserted a lacZ gene into the Lef1 locus by homologousrecombination. Previous experiments suggested that two typesof alterations in LEF1 protein impair its function and that ofco-expressed LEF1/TCF proteins. First, deletion of the β-catenin interaction domain of LEF1 generates a protein thatbinds DNA but is unresponsive to Wnt signals. At highconcentration, this mutant protein interferes withtranscriptional activation by β-catenin in transfection assayseven in the presence of other intact TCF proteins (Molenaar etal., 1996; van de Wetering et al., 1997; Brannon et al., 1997;Fan et al., 1998; Vleminckx et al., 1999). Second, deletion ofsequences that comprise both the DNA-binding domain ofLEF1, referred to as the HMG domain, and a nuclearlocalization sequence (NLS) results in a mutant protein that ispredominantly cytoplasmic and has the ability to interact withβ-catenin (Behrens et al., 1996; Prieve et al., 1998). However,the function of this mutant protein has not been examined.

We generated a targeting construct that allowed for in-frameinsertion of the lacZ gene into one of the exons encoding theHMG domain of LEF1 (Fig. 1). This insertion inactivates theDNA-binding domain similar to the previously generated neoallele of the Lef1 locus (van Genderen et al., 1994). In contrastto the Lef1-neo allele, which does not generate any detectableLEF1 polypeptide (van Genderen et al., 1994), expression ofthe Lef1-lacZ allele yields a stable LEF1-βGAL fusion proteinthat can be detected by X-gal histochemistry and immunoblotanalysis (Fig. 2 and data not shown). Moreover, the fusionprotein is located predominantly in the cytoplasm (data notshown), consistent with the removal of the nuclear localizationsignal (Prieve et al., 1998). Thus, mice heterozygous for theLef1-lacZ allele should allow for an easy visualization ofLEF1-expressing cells. In addition, mice homozygous for theLef1-lacZ mutation may also interfere with the function of co-expressed TCF proteins and may therefore have a more severephenotype than the Lef1-neo allele.

The LEF1-βGAL fusion protein interferes with β-catenin-mediated activation of transcription intransfected cells To examine the possibility that the mutant LEF1-βGAL fusionprotein interferes with β-catenin-mediated transcriptionalactivation by LEF1/TCF proteins, we generated a cDNAconstruct encoding the same fusion protein that is encodedby the targeted genomic Lef1-lacZ allele (Fig. 1A). Asanticipated, transfection of a LEF1 expression plasmid intoNeuro 2A cells, together with a β-catenin expression plasmid,activates a fos-CAT reporter gene containing multimerizedLEF1 binding sites. Transfection of increasing amounts of aLEF1-βGAL expression plasmid, together with the LEF1 andβ-catenin plasmids impairs transcriptional activation in a

472

dose-dependent manner (Fig. 1B). This inhibition oftranscriptional activation by LEF1-βGAL can be overcome byincreasing the amount of transfected β-catenin plasmid,demonstrating the specificity of inhibition. A similar effectof the LEF1-βGAL fusion protein on β-catenin-mediatedtranscription is also observed in the presence of a transfectedTCF1 expression plasmid, suggesting that LEF1-βGAL caninterfere with the function of multiple members of theLEF1/TCF family of transcription factors.

Lef1 is expressed in the primordium of thehippocampus and in putative migratory granule cellprecursorsTo determine whether the Lef1-lacZ allele is expressed in thesame pattern as the wild-type Lef1 allele, we compared thewhole-mount in situ hybridization pattern of Lef1 in wild-typemouse brains at embryonic day 11.5 (E11.5) with the patternof β-galactosidase activity in equivalent whole mounts fromheterozygous Lef1-lacZ (b/+) mice (Fig. 2Aa,b,d,e). Theexpression patterns of Lef1 RNA and the LEF1-βGAL productare indistinguishable in all brain regions, including thetelencephalon (T), mesencephalon (M), diencephalon (D),hypothalamus (Hy) and the dorsomedial telencephalon (medial

pallium, MP), which includes the primordium of thehippocampus. Mice homozygous for the Lef1-lacZ allele (b/b)showed a similar pattern of expression, although the level ofβ-galactosidase activity, as judged by the intensity of X-galstaining, is consistently higher than in heterozygous embryos(Fig. 2Ac,f).

Analysis of the expression patterns during forebraindevelopment using X-gal histochemistry on brain sectionsfrom heterozygous Lef1-lacZ mice revealed initial expressionin the dorsomedial telencephalon at E10.5 (data not shown).By E11.5, a gradient of expression is detected in the medialpallium (Fig. 2Ba,h). The levels of expression are highimmediately adjacent to the fimbria (Fi), which itself isnegative for expression and progressively decrease toward thedorsal cerebral cortex. Based on morphological criteria, theregion of strongest expression is the ventricular zone of thedentate gyrus anlage (Dvz) (Stanfield and Cowan, 1988;Altman and Bayer, 1990). This interpretation is confirmed byanalysis of heterozygous Lef1-lacZ mice at E14.5 and E16.5,which express LEF1-βGAL in the ventricular zone adjacent tothe fimbria and in cells that migrate from the Dvz to form asecondary proliferative population (SPP; Fig. 2Be,g,n). Thissecondary proliferative zone is thought to generate the dentate

J. Galceran and others

Fig. 1. Generation and functional analysis of a LEF1-βGAL fusion protein. (A) Targeted in-frame insertion ofthe bacterial lacZ gene into the murine Lef1 gene locus.LEF1 protein is shown schematically on the top. The β-catenin binding domain (βBD; horizontally hatched),context-dependent activation domain (CAD; dotted) andhigh mobility group DNA-binding domain (HMG;vertically hatched) are shown. Below, the wild-type (wt)genomic Lef1 locus is represented by a line with thelocation of the exon encoding the C-terminal part of theHMG domain indicated as a black box. The targetingconstruct includes the β-galactosidase-coding (lacZ)sequence (grey box), fused in frame with amino acid 342of LEF1 (black box). The targeting construct contains alsothe PGK-neor gene with a polyadenylation site from thebovine growth hormone gene (open box) and the PGK-thymidine kinase gene (hatched bar) for negativeselection. The transcriptional polarity of the lacZ gene andthe neor gene is represented by an arrow. The LEF1-βGAL fusion protein is shown schematically below theLef1-lacZ locus. Representative restriction sites areindicated as: B, BamHI; R, EcoRI; N, NdeI; S, SalI; Sm,SmaI; X, XhoI. (B) LEF1-βGAL protein antagonizestranscriptional activation by LEF1 and TCF1 proteins.Neuro2A cells were transiently transfected with 500 ngLEF-CAT reporter gene, containing multimerized LEF1binding sites linked to a fos-chloramphenicol transferase(CAT) gene (Hsu et al., 1998), together with expressionplasmids encoding LEF1, TCF1, β-catenin or LEF1-βGAL. The amounts of transfected plasmids are indicated.The levels of CAT activity are normalized for theexpression of a co-transfected Rous sarcoma virus-luciferase expression plasmid. Fold activation is quantifiedrelative to the level of CAT activity from cells transfectedwith the LEF1 (left) or TCF1 (right) expression plasmid.Means with error bars represent standard errors frommultiple experiments.

473Forebrain development and lef1

gyrus (Altman and Bayer, 1990). Hippocampal expression ofLEF1-βGAL protein and Lef1 RNA decreases at the end ofgestation and later can be detected only in a few cells of thedentate gyrus (data not shown). LEF1-βGAL is also expressedin several other developing brain regions, including the choroidplexus (CP), the dorsal thalamus (Th), epithalamus (Fig.2Bf,l,m), and tectum, all of which have been reported tocontain Lef1 RNA (Oosterwegel et al., 1993; van Genderen etal., 1994). In homozygous Lef1-lacZ mice, we note a dorsalexpansion of lacZ expression relative to heterozygous Lef1-lacZ mice (Fig, 2Ba,b). This expanded lacZ expression domaincould be due to the increase in signal strength, which mayallow detection of an otherwise weak signal. Alternatively, theabsence of LEF1 may result in an expanded domain ofexpression.

Comparison of the effects of the Lef1-neo/neo andLef1-lacZ/lacZ mutations on development of thetelencephalonBased on the cellular expression patterns of the Lef1 locus atvarious stages of hippocampal development, which includeexpression in cells that appear to migrate towards the dentategyrus, we analyzed the hippocampal phenotypes ofhomozygous Lef1-neo/neo (n/n) and Lef1-lacZ/lacZ (b/b)embryos. Analysis of Nissl-stained sections of Lef1-neo/neomice at E16.5, E18.5, postnatal day 0 (P0) and P5, shows anabsence of a morphologically detectable dentate gyrus (DG),and an abnormal appearance of the CA fields (Fig. 3b,e,h,k,and data not shown). In contrast, comparable sections of E16.5Lef1-lacZ/lacZ embryos show a complete lack of allhippocampal structures (Fig. 3c,f,i). In addition, the brains ofthese mutant embryos have cystic defects in external capsule(asterix in Fig. 3c,f) which may be due to vascularabnormalities because Lef1 is expressed in the developingblood vessels (see Fig. 2Bf). Other forebrain regions of themutant embryos that express Lef1 (e.g. choroid plexus anddorsal thalamus) appear normal. Embryos that areheterozygous for the Lef1-neo allele or the Lef1-lacZ alleleshow no apparent mutant phenotype (data not shown). Thus,the expression of LEF1-βGAL protein from two mutant allelesresults in a mutant phenotype that is more severe than thatcaused by the Lef1-neo/neo null mutation.

Lef1-neo/neo mutants do not form dentate gyrusgranule cellsTo confirm the defect in the formation of dentate gyrus inLef1-neo/neo embryos, we examined the expression of genesthat mark distinct hippocampal regions and cell types (Fig.4A). The SCIP homeobox gene is expressed in the neocortex,subiculum and the CA1 field (Tole et al., 1997). Neuropilin2 (NP2), a receptor for semaphorin E and IV (Chen et al.,1997), is thought to be expressed in the entire hippocampus,with a boundary that approximates the transition of theparahippocampal gyrus (e.g., subiculum) with the mediallimbic neocortex (e.g., cingulate and retrosplenial cortex).The Prox1 homeobox gene is expressed in the medialpallium, in the secondary proliferative population (SPP) ofthe dentate gyrus and fimbria, and in immature cells of thedentate gyrus-proper (Oliver et al., 1993 and this study).Finally, Calretinin, a calcium-binding protein, is expressedin immature dentate granule cells and in the Cajal-Retizius

cells of the hippocampal outer marginal zone (Super et al.,1998).

In E16.5 Lef1-neo/neo embryos, expression of SCIP andNP2 appear normal in the parahippocampal and CA regions(Fig. 4Ab,d). However, in the region of the dentate gyrus,expression of both Prox1 and Calretinin is reduced to a smallarea in the marginal zone (see asterisk in Fig. 4Af,h).Expression of Prox1 is maintained in the thalamus and in athin subpial strip, which might correspond to the migratorystream from the hippocampal and fimbrial ventricular zones.Because Prox1 and Calretinin are molecular markers for theimmature granule cells in the dentate gyrus, the loss of thesemarkers in the dentate gyrus of Lef1-neo/neo embryos couldsuggest that LEF1 may be required for the generation of thedentate gyrus granule cells. However, loss of these markerscould also result from misspecification of the progenitors,rather than a block in the differentiation and/or proliferationof granule cells.

In principle, the loss of granule cell markers in the dentategyrus could be due to defects in the specification, migration,proliferation and/or survival of granule cells. Dentate granulecell precursors are specified in the ventricular zone that isintercalated between the primordia of the fimbria and the CAfields (Altman and Bayer, 1990a). Immature dentate gyrus cellsmigrate from this ventricular zone and form a secondaryproliferative population that follows a migratory stream to thehilus of the dentate gyrus. There, cells continue to divide, evenin adults, and undergo further migration to the granule layer ofthe dentate gyrus (Stanfield and Cowan, 1988; Altman andBayer, 1990b; Eriksson et al., 1998; Gage et al., 1998). TUNELassays to detect apoptotic cells did not reveal any significantdifference between wild-type and Lef1-neo/neo embryos atE17.5 (Fig. 4Bg,h). To examine the proliferation and migrationof cells, mitotically active cells were labeled by injectingpregnant mice with a single pulse of bromodeoxyuridine(BrdU) 1 hour prior to the isolation of embryos at E18.5.Immunohistochemical detection of BrdU-labeled cells in wild-type and Lef1-neo/neo littermates revealed a 3.4-fold decreasein the number of BrdU-labeled cells in the dentate gyrusof mutant embryos (Fig. 4Ba,b). This decrease in thenumber of proliferating cells was also confirmed byimmunohistochemical detection of proliferating cell nuclearantigen (PCNA; Fig. 4Be,f). However, no significant change inthe number of proliferating cells is observed throughout theventricular zone of the hippocampal and fimbrial regions, andin the area of cells migrating towards the dentate gyrus (Fig.4Ba,b). Because mitotically active glial precursors follow asimilar migration pathway as immature granule cells (Sieverset al., 1992), the decrease in the number of migratingmitotically active granule cells could be underestimated by thepresence of dividing glia cells.

To further address the role of LEF1 in the migration ofgranule cells, we performed a BrdU pulse experiment byinjection of pregnant mice with BrdU at E16.5 and analysis atE18.5. A clear reduction in the number of BrdU-labeled cellswas observed in the dentate gyrus of homozygous mutantembryos relative to wild-type embryos, but not in theventricular zone, secondary proliferative zone and migratorystream (Fig. 4Bc,d). Some BrdU-labeled cells are present inthe dentate gyrus remnant of mutant embryos, consistent withthe presence of some cells in Nissl-stained specimens in this

474

region (see Fig. 3i). The BrdU pulse experiment suggests thatthe second phase of migration may not take place.

Although granule cells represent the majority of the neuronsin the dentate gyrus, inhibitory interneurons and astroglia arealso present in this region (Rickmann et al., 1987; Sievers etal., 1992). Lef1-neo/neo embryos have roughly normalnumbers of DLX2-expressing interneurons in the region of thedentate gyrus (Fig. 4Ca,b). In mutant embryos, we alsodetected expression of the glial cell marker GFAP in the regionof the ventricular zone and fimbria, and in an apparent streamof cells that co-localizes with the migratory stream of dentate

granule cell precursors (Fig. 4Bc-f). In addition, we detectedMash1 expression in a similar pattern, suggesting that Mash1may also mark glial cell precursors. Taken together, these datasuggest that dentate granule cells, but not interneurons andastroglia, are specifically lost in the Lef1-neo/neo mutants.

Lef1-lacZ/lacZ mice lack the entire hippocampal fielddue to defects in patterning and proliferationThe morphological analysis of Lef1-lacZ/lacZ embryosindicated that the entire hippocampus is missing. To determinewhether the morphologically abnormal dorsomedial

J. Galceran and others

Fig. 2. Expression patterns of Lef1 and Lef1-lacZ at various stages of brain development. (A) Lateral and dorsal views of the expressionpatterns of Lef1 RNA (a,d) and LEF1-βGAL protein (b,c,e,f) in the brain of E11.5 embryos. Lef1 RNA is detected by whole-mount in situhybridization of wild-type (wt) embryos and LEF1-βGAL protein is visualized by X-gal staining of Lef1-lacZ/wt (b/+) embryos and Lef1-lacZ/lacZ (b/b) embryos. Lef1 and LEF1-βGAL expression is detected in the telencephalon (T), diencephalon (D) and mesencephalon (M).Within the telencephalon, the dorsal view shows restricted expression in the medial pallium (MP). Stronger expression of LEF1-βGAL isobserved in (b/b) embryos. Other abbreviation: Hy, hypothalamus. (B) LEF1-βGAL expression in rostral and caudal sections of (b/+) and (b/b)embryos at E11.5 (a,b,h,i), E14.5 (c,d,j,k) and E16.5 (e,f,g,l,m,n). Rostral sections of E11.5 embryos show LEF1-βGAL expression in thehippocampal primordia dorsal to the fimbria (Fi), which is seen more clearly in the enlarged insets corresponding to the boxed areas (a,b). Inhomozygous mutant embryos, the area of LEF1-βGAL expression is extended and the level of expression is increased. LV, lateral ventricle; Th,thalamus. (h) The arrow in the E11.5 caudal section indicates hippocampal expression of LEF1-βGAL. The area of the developinghippocampus (H) in E14.5 (b/+) embryos (e) is enlarged in g and further magnified in n. Abundant expression can be detected in the ventricularzone of the dentate gyrus (Dvz) and in some positive cells in the secondary proliferative population (SPP). Lower levels of expression are alsofound in the choroid plexus (CP). The boxed area in f is enlarged in the inset and shows LEF1-βGAL expression in blood vessels. Scale bar:(A) a-f, 0.9 mm; (B) a,b, 0.9 mm; c,d, 0.7mm; e,f, 0.8mm; g, 0.2mm; h, 0.02mm.

475Forebrain development and lef1

telencephalon also lacks molecular characteristics of thedeveloping hippocampus, we analyzed the expression patternof SCIP, NP2 and Prox1 at E16.5 (Fig. 5A). Unlike the Lef1-neo/neo mutants, Lef1-lacZ/lacZ embryos lack molecularproperties of the subiculum and CA fields (expression of NP2;Fig. 5Ac,d) and the dentate gyrus (expression of Prox1; Fig.5Ae,f). Note that a small remnant of expression of both genesis present adjacent to the fimbria (asterisks in Fig. 5Ad,f). SCIPexpression is extended to the transition of the cortex with thefimbria in the Lef1-lacZ/lacZ mutants, consistent with the lossof the entire hippocampal field (Fig. 5Ab).

The absence of the hippocampal region at E16.5 couldresult from improper regional specification, cell death and/ordecreased proliferation of the primordium. To examinewhether cells in the hippocampal primordium are re-specifiedin Lef1-lacZ/lacZ embryos, we analyzed the expression ofseveral regulatory genes at E11.5 and E12.5 by in situhybridization (Fig. 5B and data not shown). Bf1 encodes awinged-helix transcription factor that is required forpatterning and growth of the telencephalon (Xuan et al.,1995; Dou et al., 1999). In wild-type embryos, Bf1 isexpressed in a decreasing gradient through the hippocampalarea and, like Lef1, is not expressed in the fimbria (Fig. 5Bc,d;Furuta et al., 1997). Prox1 is expressed both in thehippocampal primordium and the fimbria (Oliver et al.,1993), which also expresses high levels of bone

morphogenetic proteins that inhibit Bf1 expression (Furuta etal., 1997). The fimbria also expresses high levels of Wnt2,Wnt3a, Wnt5a and Wnt7b (Fig. 5; Parr et al., 1993; Hollydayet al., 1995; Tole et al., 1997; Grove et al., 1998; Tole andGrove, 1999). The Lef1-lacZ/lacZ embryos show defects inthe expression of Lef1, Bf1 and Prox1. Expression of theLef1-lacZ allele is significantly increased relative to the wild-type allele and is graded with its highest level adjacent to thefimbria (Fig. 5Bb). In the mutant embryos, Bf1 loses itsgraded expression towards the fimbria, but rather is expressedat a constant level up to a sharp boundary at the fimbria (Fig.5Bd). Moreover, Prox1 expression is maintained in thefimbria, but is lost in the region of the hippocampalprimordium (Fig. 5Bf). In contrast, the expression of genesencoding the signaling molecules Wnt7b (Fig. 5Bg,h) andBmp6 and Bmp7 (not shown) did not show any obviouschanges. Thus, molecular defects in the hippocampalprimordium can be detected prior to the appearance ofobvious morphological abnormalities in this region,suggesting that the regional specification of the hippocampusmay be abnormal in Lef1-lacZ/lacZ embryos.

Analysis for apoptosis at E11.5, E12.5 and E14.5, stagesbefore the appearance of a morphological defect, did notprovide evidence for increased cell death in the medial pallium(Fig. 5Ce,f and data not shown). Analysis of cell proliferationfollowing a single injection of BrdU at E11.5 showed a 30%

Fig. 3. Lef1-neo/neo and Lef1-lacZ/lacZembryos show histological abnormalitiesin the hippocampus. Nissl-stained coronalsections of wild-type (wt) mice (a,d,g,j),Lef1-neo/neo (n/n) mice (b,e,h,k) and Lef1-lacZ/lacZ (b/b) mice (c,f,i) at E16.5 (a-i) orpostnatal day 5 (P5; j-k). Caudal sections(d-f) with increased magnification of thedentate gyrus (DG) region (g,h) show thelack of a morphologically discernable DGin Lef1-neo/neo embryos (h), as denotedby the arrowhead. In Lef1-lacZ/lacZembryos, the entire hippocampal complexis not morphologically apparent, markedwith a black arrow. (c,f,i) The asterisksshow tissue damage possibly caused bydefective blood vessels. In P5 mice, thehilus (hi), granular cell layer (GCL) andmolecular cell layer (MCL) of the dentategyrus are not identifiable in the Lef1-neo/neo mice (k) when compared with wtmice (j). The pyramidal cell layer of CA1and CA3 has an abnormal appearance (k).Other abbreviations: 3, third ventricle; CP,choroid plexus; H, hippocampus; LV,lateral ventricle; NC, neocortex; PC,piriform cortex; S, striatum; Th, thalamus.Scale bars: a-f, 1.2 mm; g,h, 0.2 mm; j-k,0.4 mm.

476 J. Galceran and others

Fig. 4. Characterization of the dentate gyrus defect in Lef1-neo/neo embryos. (A) In situ hybridization and immunohistochemistry of markersthat distinguish regions of the hippocampus (SCIP, Neuropilin2 (NP2), Prox1 and Calretinin) in coronal sections of brains from E16.5 Lef1wild-type (wt) embryos (a,c,e,g) and Lef1-neo/neo (n/n) embryos (b,d,f,h). In both wt and (n/n) mutant embryos, SCIP is expressed in theneocortex and CA1 field of the hippocampus but not in CA3 field (arrow in a,b). NP2 expression is absent in mutant embryos in the region ofthe dentate gyrus (DG; arrowhead in d) whereas normal expression can be detected in the CA fields. Expression of Prox1 is reduced in the areaof the dentate gyrus in mutant embryos (asterisk in f), but is normal throughout the hippocampal ventricular zone (Hvz), the area of themigratory stream (MS) and the thalamus (Th). Calretinin expression is also severely impaired in the area where the dentate gyrus is normallylocated (asterisk in h). (B) Analysis of cell proliferation and apoptosis at E16.5 and E18.5. Wild-type embryos pulsed with 5´-bromodeoxyuridine (BrdU) 1 hour or 48 hours before sacrificing at E18.5. The numbers of BrdU-positive cells in the region of the dentategyrus (DG; asterisk in b,d) were determined as 134±20 (n=8) for wild-type and 39±16 (n=11) for n/n mutant embryos. In contrast, in thedentate ventricular zone (Dvz), the numbers were 120±22 for wild-type and 171±17 for mutant embryos (see Materials and methods forcalculation of the numbers). Antibody against PCNA (proliferating cell nuclear antigen) also identifies fewer proliferating cells in the DGregion of mutant embryos (asterisk in f). TUNEL assay to detect apoptotic cells in wt and (n/n) embryos at E17.5 (g,h). Similar numbers ofapoptotic cells (small arrows) are detected in multiple sections in the DG region of wt and mutant embryos. (C) In situ hybridization andimmunohistochemistry of the cell type markers DLX2, Mash1 and glial filament associated protein (GFAP) to detect interneurons and glia inwild-type embryos (a,c,e) and Lef1-neo/neo embryos (b,d,f). DLX2-expressing interneurons can be detected throughout the hippocampalcomplex of mutant embryos (asterisk in b). Mash1 is expressed normally in the fimbria (Fi) and in cells of the migratory stream in wt andmutant embryos (arrows in c,d). In wt and mutant embryos, GFAP labels glial cells that are emanating from the transition of the fimbria withthe hippocampal complex and populate the migrating stream (e,f). Scale bars: (A) a,b, 1.1 mm; c-h, 0.5 mm; (B) a,b, 0.43 mm; c,d, 0.5 mm; e-h, 0.3mm; (C) a-f, 0.7 mm.

477Forebrain development and lef1

reduction in the number of mitotically active cells in the regionof the hippocampal primordium closer to the fimbria (Fig.5Ca,d).

Overlapping expression of Lef1 and Tcf3 in themedial palliumThe more severe phenotype of the Lef1-lacZ/lacZ mutationrelative to the phenotype of the Lef1-neo/neo mutation could beaccounted for by an interference of LEF1-βGAL protein with

the function of other members of the LEF1/TCF family.Therefore, we examined potential co-expression of Lef1 withTcf1, Tcf3 and Tcf4 by whole-mount in situ hybridizationanalysis (Fig. 6). At E10.5, Lef1 is clearly co-expressed withTcf3 in the medial pallium, and probably also with low levelsof Tcf1. At E11.5 and E12.5, expression of Lef1 and Tcf3 canbe detected in an overlapping pattern in the medial pallium (Fig.6c,d,k,l). We also note a reciprocal gradient for Lef1 and Tcf3.In contrast, Tcf1 and Tcf4 are expressed at a low level in the

Fig. 5. Characterization ofhippocampal development inLef1-lacZ/lacZ embryos.(A) In situ hybridization ofSCIP, Neuropilin2 (NP2) andProx1 in the medial palliumregion of wild-type (wt), Lef1-lacZ heterozygous (b/+) andLef1-lacZ homozygous (b/b)embryos at E 16.5. (b) SCIPexpression, is maintained inb/b mice, but now extends tothe fimbria (indicated byarrow). (d) In the (b/b) mutant,NP2 expression is severelyimpaired throughout the CAfields and subiculum (Sub),except for a small areadesignated by an asterisk.(f) Hippocampal expression ofProx1 is absent in theventricular zone and dentategyrus (DG) but is detected in asmall area next to the fimbriain the DG. Otherabbreviations: Ci, cingulatecortex; Hvz, hippocampalventricular zone; NC,neocortex; Th, thalamus.(B) In situ hybridization ofLef1, Bf1, Prox1 and Wnt7b in(b/+) embryos (a,c,e,g) and(b/b) embryos (b,d,f,h) atE12.5. The boxes highlight themedial pallium and are shownat higher magnification belowof each panel. Lef1 expressionis detected in the developinghippocampus (H) but is absentin the fimbria (Fi; a,b). The b/bmutant shows Lef1 expressionin an area, designated X, thatcorresponds to the regionwhere the hippocampusnormally forms (b). Bf1 isexpressed in a gradient withinthe hippocampus in (b/+)embryos (c) but its expressionis uniform in region X of (b/b) mutant embryos (d). In homozygous mutant mice, Prox1 expression is abrogated in region X, but is detected inthe fimbria (f). Wnt7b expression is restricted to the mantle zone (MZ) and the fimbria in both the (b/+) and (b/b) embryos (g,h).(C) Proliferation and apoptosis assays in (b/+) embryos (a,c,e) and (b/b) mutant embryos (b,d,f). BrdU was injected at E11.5 and embryos wereharvested 1 hour later. BrdU-positive cells are observed in the ventricular zone of the thalamic and hippocampal primordia (Th, thalamus; H,hippocampus) with a 27±4% (11 sections) decrease of mitotically active cells in the mutant (a,b). Higher magnification view of the boxed areais shown in c,d. TUNEL assays at E11.5 show no difference between b/+ control and b/b mutant embryos. Other abbreviation: CP, choroidplexus. Scale bars: (A) a,b, 0.8mm; c, 0.9mm; d-f, 0.7mm; (B) a-h, 0.6mm; insets, 0.19 mm; (C) a,b, 0.6 mm; c,d, 0.34 mm; e,f, 0.1 mm.

478

medial pallium at E11.5 and E12.5 (Fig. 6g,h,o,p). Thus, inLef1-neo/neo mutants, TCF3 protein may compensate for theloss of LEF1, whereas the LEF1-βGAL protein may inhibit thefunction of all TCF proteins expressed in the medial pallium.

DISCUSSION

Our study shows that LEF1, a nuclear mediator of Wntsignaling that is expressed in the primordium of thehippocampus, is required for the generation of granule neuronsof the dentate gyrus. In addition, LEF1, together with othermembers of the LEF1/TCF family, has an earlier role in thespecification of the entire hippocampus. Thus, signaling byWnt proteins, which are expressed in the region of the fimbria,may control multiple steps in the development of thehippocampus.

Role of Wnt and BMP signaling in patterning of themedial palliumWnt signaling has been implicated in regulating the functionof the isthmic organizer (McMahon and Bradley, 1990;Thomas and Capecchi, 1990), patterning of the dorsal spinalcord and cell proliferation (Ikeya et al., 1997). Bmp genes areoften expressed in the same region as Wnt genes and have beenimplicated in patterning of the spinal cord (Liem et al., 1995,1997; Lee et al., 1998), cell type specification (Lee et al., 1998)and cell survival (Graham et al., 1994). With regard to thedorsoventral axis of the central nervous system, the medial wallof the dorsal telencephalon (medial pallium) is topographicallyequivalent to the dorsal parts of the spinal cord. The medialpallium is located in the area in which the primordia of thechoroid plexus, fimbria and hippocampal complex (dentategyrus, CA fields and subicular complex) develop (reviewed inRubenstein et al., 1999). In the medial pallium, Wnt and Bmp

genes are expressed in the fimbria (Grove et al., 1998). Lowerlevels of Wnt and Bmp gene expression are found in theadjacent neuroepithelium and Bmp genes are additionallyexpressed in the epithelium of the choroid plexus (Tole et al.,1997; Furuta et al., 1997; Grove et al., 1998).

In homozygous mutant Lef1-lacZ/lacZ embryos, in whichWnt-mediated activation of LEF1 is abrogated and that ofTCF3 may be attenuated, we observe three molecular defectsin medial patterning of the telencephalon (see scheme in Fig.7). First, the expression of the Lef1-lacZ locus is increased,both at the RNA and protein level. This result suggests thatLEF1 protein normally downregulates expression of its owngene, either directly or indirectly by antagonizing pathwaysthat activate Lef1 gene expression. The increase in Lef1-lacZexpression in homozygous mutant mice is likely to beimportant for the attenuation of Wnt signaling by othermembers of the LEF1/TCF family. In the heterozygous mutantmice, no obvious mutant phenotype is observed, suggestingthat the Lef1-lacZ gene does not function as a dominantnegative allele and that the concentration of the encoded fusionprotein may be critical for its interference with Wnt signaling.Homozygous Lef1-lacZ mice also show an expanded domainof lacZ expression, which could account for the dorsalexpansion of the hippocampal defects in this mutantbackground relative to the Lef1-neo/neo background. Inaddition, Lef1 is expressed in a gradient, consistent with anactivation of Lef1 expression by BMP signals (Figs 5, 7).BMP4 has been shown to induce the expression of Lef1 in themesenchyme of dental organ cultures from E11.5 embryos(Kratochwil et al., 1996). However, a simple correlation ofBmp and Lef1 expression is unlikely because the BMP-richfimbria does not express Lef1.

The second molecular defect in Lef1-lacZ/lacZ embryos isthe loss of a gradient of Bf1 expression in the medial pallium.Targeted mutation of the transcription factor gene Bf1 has been

J. Galceran and others

Fig. 6. In situ hybridization of thebrain of E10.5, E11.5 and E12.5wild-type embryos to detect RNAfrom the transcription factor genesLef1, Tcf1, Tcf3 and Tcf4. Lateralviews (a,e,i,m), dorsal views(b,d,f,h,j,l,n,p) and frontal sections(c,g,k,o) of the expression pattern ofLef1 (a-d), Tcf1 (e-h), Tcf3 (i-l) andTcf4 (m-p). Lef1 is detected in agradient in the hippocampus ofE11.5 embryos (c), Tcf3 is detectedin the same region as Lef1, but it canalso be detected in the fimbrialregion and presents a gradient ofexpression in the medial palliumthat is the inverse of that of Lef1 (k).Tcf1 and Tcf4 are expressed at verylow levels in the medial pallium(g,h). Large arrows indicateexpression in the medial pallium(MP). Labeling is the same as inFig. 2; R, rhombencephalon. Scalebars: a,b,e,f,i,j,m,n, 0.5 mm; c,g,k,o,0.3 mm. Insets 0.5 mm; d,h,l,p, 0.9mm.

479Forebrain development and lef1

reported to result in hypoplasia of the entire telencephalon,apparently due to premature cell differentiation and decreasedcell proliferation (Xuan et al., 1995). In addition, thetelencephalon of Bf1 mutants is dorsalized, as reflected by awide-spread ectopic expression of BMP4 (Dou et al., 1999).Therefore, BF1 protein may downregulate expression of Bmpgenes. Furthermore, BMP proteins have also been shown torepress Bf1 expression (Furuta et al., 1997). This reciprocalnegative feedback loop may explain why Bf1 is expressed inthe medial pallium in a gradient that decreases in the vicinityof the BMP-rich fimbria. This change in Bf1 expression maybe directly related to reduced Wnt signaling.

Finally, expression of the Prox1 homeobox gene in Lef1-lacZ/lacZ embryos is not detectable in the hippocampalprimordium, in which Prox1 is co-expressed with Lef1. Thefunction of Prox1 in the vertebrate central nervous system hasnot been fully elucidated, although Prox1 may be required forneurogenesis and expression of Prox1 can be induced byMash1 (Torii et al., 1999). The Drosophila orthologue ofProx1, Prospero, has an essential role in neuronal specification(Broadus and Doe, 1997). Therefore, the absence of Prox1expression in both the hippocampal primordium of Lef1-lacZ/lacZ embryos and dentate gyrus granule cells of Lef1-neo/neo embryos, raises the possibility that Prox1 is adownstream target of LEF1. Together, these defects reflect anabnormal patterning of the hippocampal domain of the medial

pallium, which results in a morphological and molecular lossof the dentate gyrus, CA fields and subicular complex. Inaddition to the patterning defects, Lef1-lacZ/lacZ embryosshow a proliferative defect in the developing medial pallium,which shows a 30% decrease in the number of dividing cells.Thus, nuclear mediators of Wnt signaling, LEF1/TCF proteins,may participate in the regulation of patterning and outgrowthof the entire hippocampal primordium.

Role of LEF1 in the differentiation of a specifichippocampal cell type: dentate granule cellsLef1/Tcf genes appear to be required during multiple stages ofhippocampal development. In addition to the regulation ofearly hippocampal development, Lef1 is essential to generatedentate granule cells. Lef1 is expressed in the proliferatingprecursors of granule cells in the ventricular zone and in themigratory secondary proliferative population. Consistent withthis expression pattern, Lef1-neo/neo embryos lack molecularmarkers of dentate granule cells (Prox1 and Calretinin) in theregion of the dentate gyrus. In addition, the dentate gyrusremnant of Lef1-neo/neo embryos contains approximately 2.5-fold reduced number of proliferating cells. BrdU-pulseexperiments suggest that granule cells, or their precursors, donot arrive at the dentate gyrus. Therefore, the observeddecrease in the number of proliferating cells may reflect theabsence of dentate granule cells. The residual proliferatingcells are likely glia, which are present in the region of thedentate gyrus remnant and are known to be mitotically activein the SSP and migratory stream (Sievers et al., 1992).

The absence of a specific cell type, the dentate gyrus granulecells, in Lef1-neo/neo mice provides insight into the generationof granule cells, glia and interneurons. We hypothesize that thehippocampal ventricular zone adjacent to the fimbria, whichexpresses the highest levels of LEF1, contains the granule cellprogenitors. In Lef1-neo/neo embryos, these cells are incapableof differentiating into granule cells as evidenced by the loss ofProx1 expression in the dentate gyrus remnant. In contrast, theventricular zone flanking this region is able to producepyramidal cells of the CA field. In addition, GFAP-expressingglia cells continue to be produced in the mutant mice,consistent with the model that these cells are derived from thefimbria, which does not express Lef1 (Altman and Bayer,1990). Finally, the distribution of Dlx2-expressing immatureinterneurons is not affected by the Lef1-neo/neo mutation,consistent with the model that cortical (including hippocampal)interneurons are derived from the basal ganglia (Anderson etal., 1997, 1999).

Transcriptional control of hippocampal developmentInroads into understanding the genetic hierarchy that controlshippocampal development have been made possible throughtargeted mutagenesis of several transcription factors in mice.To date, seven mutations have been reported that affecthippocampal patterning and/or proliferation. Mutations of theLIM homeodomain genes Lhx2 (Porter et al., 1997) and Lhx5(Zhao et al., 1999) eliminate the entire hippocampus. Emx2mutants lack the dentate gyrus and show hypoplasia of the CAfields (Pellegrini et al., 1996; Yoshida et al., 1997). Targetedinactivation of the transcription factor gene Gli3 results in theabsence of the choroid plexus and a dysmorphic, but poorlycharacterized hippocampus (Frantz, 1994; Grove et al., 1998).

Fig. 7. Schematic representation of patterns of gene expression in themedial pallium of wild-type (top) and Lef1-lacZ/lacZ (bottom)embryos at E12.5. Coronal hemisections show expression of Lef1(gradient of blue) and Prox1 (black stripes) on the lefthand side andexpression of Bf1 (gradient of green) and representative expressionof Wnt and Bmp genes (red) on the righthand side. The expressionpatterns of these genes have been simplified to focus on the medialpallium. For instance, Prox1 is also expressed in the basaltelencephalon and different Bmp and Wnt genes have distinctexpression patterns that include expression in the cerebral cortex.BMP molecules are also expressed in the choroid plexus. Thelocations for putative primordia of brain regions are indicated: CP,choroid plexus; DG, dentate gyrus; EMT, eminentia thalami; Fi,Fimbria; H (CA), CA fields of the hippocampus; NC, neocortex;NC*, neocortical region of the Lef1-lacZ/lacZ mutant (the type ofneocortex that develops in this region is unknown).

480

Gli3 has been implicated as a regulator of Wnt signaling andin Gli3-deficient mice, Wnt expression is abrogated in thecortical hem (Grove et al., 1998). Otx1−/−Otx2+/− mice have aform of holoprosencephaly that includes loss of medial pallialtissues (Matsuo et al., 1995; Acampora et al., 1997). Finally,NeuroD-deficient mice lack the dentate gyrus and cerebellargranular neurons apparently due to increased cell death(Miyata et al., 1999).

The Lef1-neo/neo and Lef1-lacZ/lacZ mutations are distinctfrom each of these mutations in several aspects. First, Lef1 isexpressed relatively late in brain development, compared toLhx2, Lhx5, Emx2, Otx1 and Otx2, which are all known to beexpressed in the neural plate (Simeone et al., 1992; Sheng et al.,1997; Porter et al., 1997). Second, within the telencephalon, Lef1has the most restricted domain of expression, whereas Lhx2,Emx2, Otx1, Otx2 and Gli3 are more broadly expressed. Theexpression of Lhx5 resembles that of Lef1 with the exception thatLhx5 is also expressed in the fimbria, which may account for theabsence of fimbrial Wnt5a and Bmp7 expression in Lhx5-deficient embryos (Zhao et al., 1999). The loss of thesepatterning signals may have a primary role in the Lhx5-deficientphenotype. The overlapping expression of Lef1 with otherLef1/Tcf genes in regions of the lateral neural plate suggest thatmultiple members of this family of transcription factors mayregulate hippocampal development in an, at least partially,redundant manner. Although the analysis of Lef1-lacZ/lacZ micesupports this view, the analysis of hippocampal development inLef1−/−Tcf1−/− mutants is hampered by the early lethality aroundE9.5 (Galceran et al., 1999).

The mechanism by which Lef1-lacZ/lacZ mice exhibit astronger mutant phenotype than a homozygous null allele isstill unclear. Although our transfection data indicate that theLEF1-βGAL protein can interfere with β-catenin-mediatedtranscriptional activation, an approximately 20-fold molarexcess of LEF1-βGAL relative to LEF1 or TCF1 is needed. Itis possible that a smaller amount of β-catenin is involved intranscriptional activation in vivo relative to transfectionexperiments. Such a difference could account for therequirement of a molar excess of LEF1-βGAL in vitro, whichhas also been observed for the inhibition of β-catenin-mediatedtranscriptional activation by SOX17β in Xenopus embryos(Zorn et al., 1999). However, we cannot rule out that the LEF1-βGAL protein interferes with β-catenin function by some othermechanism.

The Lef1-neo/neo mutation eliminates a specifichippocampal cell type: dentate granule cells. We are unawareof other reported mutations that affect the generation of aspecific hippocampal cell type. The dentate granule cells areamong the few neurons that continue to be produced in adultanimals (Stanfield and Cowan, 1988; Gage et al., 1998).Moreover, the granule cells of the dentate gyrus have beenrecently shown to represent a stem-cell-like population thatmaintains proliferative capacity in human adults (Erikkson etal., 1998). Notably, Tcf4, a member of the LEF1/TCF familythat is expressed in colon epithelia, has been show to berequired for the maintenance of the crypt stem cells of the smallintestine (Korinek et al., 1998b). Thus Wnt signaling may beinvolved in the maintenance of cells that have stem cellcharacteristics in both brain and colon. The renewal andsurvival of dentate gyrus granule cells have been implicated inthe formation of new memories, and dysfunction of these cells

may be related to epilepsy. Thus, further studies are warrantedto elucidate the mechanism(s) through which Lef1 controls thegeneration and/or maintenance of dentate gyrus granule cells.

We thank Isabel Fariñas for the initial observation of a hippocampaldefect in Lef1-lacZ/lacZ mouse embryos and Carla Shatz fordiscussions and critical reading of the manuscript. This work wassupported by the Howard Hughes Medical Institute and by grants fromNina Ireland, NARSAD, NINDS Grant no. NS34661-01A1 andNIMH K02 MH01046-01 to J. L. R. R.

REFERENCES

Acampora, D., Avantaggiato, V., Tuorto, F. and Simeone, A. (1997). Geneticcontrol of brain morphogenesis through Otx gene dosage requirement.Development 124, 3639-3650.

Altman, J. and Bayer, S. A. (1990a). Mosaic organization of the hippocampalneuroepithelium and the multiple germinal sources of dentate granule cells.J. Comp. Neurol. 301, 325-342.

Altman, J. and Bayer, S. A. (1990b). Migration and distribution of twopopulations of hippocampal granule cell precursors during the perinatal andpostnatal periods. J. Comp. Neurol. 301, 365-381.

Anderson, S. A., Eisenstat, D. D., Shi, L. and Rubenstein, J. L. R. (1997).Interneuron migration from basal forebrain to neocortex: dependence on Dlxgenes. Science 278, 474-476.

Anderson, S., Mione, M., Yun, K. and Rubenstein J. L. R. (1999).Differential origins of neocortical projection and local circuit neurons: roleof Dlx genes in neocortical interneuronogenesis. Cereb. Cortex, in press.

Behrens, J., von Kries, J. P.,Kühl, M., Bruhn, L., Wedlich, D., Grosschedl,R. and Birchmeier. W. (1996). Functional interaction of β-catenin with thetranscription factor LEF-1. Nature 382, 638-642.

Brannon, M., Gomperts, M., Sumoy, L., Moon, R. T. and Kimelman, D.(1997). A beta-catenin/XTcf-3 complex binds to the siamois promoter toregulate dorsal axis specification in Xenopus. Genes Dev. 11, 2359-2370.

Broadus, J. and Doe, C. Q. (1997). Extrinsic cues, intrinsic cues andmicrofilaments regulate asymmetric protein localization in Drosophilaneuroblasts. Curr. Biol. 7, 827-835.

Bulfone, A., Puelles, L., Porteus, M. H., Frohman, M. A., Martin, G. R.and Rubenstein, J. L. R. (1993). Spatially restricted expression of Dlx-1,Dlx-2 (Tes-1), Gbx-2, and Wnt-3 in the embryonic day 12.5 mouse forebraindefines potential transverse and longitudinal segmental boundaries. J.Neurosci. 13, 3155-3172

Chang, C. and Hemmati-Brivanlou, A. (1998). Neural crest induction byXwnt7B in Xenopus. Dev. Biol. 194, 129-134.

Chen, H., Chedotal, A., He, Z., Goodman, C. S. and Tessier-Lavigne, M.(1997). Neuropilin-2, a novel member of the neuropilin family, is a highaffinity receptor for the semaphorins Sema E and Sema IV but not Sema III.Neuron 19, 547-59.

Dou, C. L., Li, S. and Lai, E. (1999). Dual role of brain factor-1 in regulatinggrowth and patterning of the cerebral hemispheres. Cereb. Cortex, in press.

Eriksson, P. S., Perfilieva, E., Bjork-Eriksson, T., Alborn, A. M.,Nordborg, C., Peterson, D. A. and Gage, F. H. (1998). Neurogenesis inthe adult human hippocampus. Nat. Med. 4,1313-1317.

Fan, M. J., Gruning, W., Walz, G. and Sokol, S. Y. (1998). Wnt signalingand transcriptional control of Siamois in Xenopus embryos. Proc. Natl.Acad. Sci. USA 95, 5626-5631.

Franz, T. (1994). Extra-toes (Xt) homozygous mutant mice demonstrate a rolefor the Gli-3 gene in the development of the forebrain. Acta Anat. 150, 38-44.

Friedrich, G. and Soriano, P. (1993). Insertional mutagenesis by retrovirusesand promoter traps in embryonic stem cells. Methods Enzymol. 225, 681-701.

Furuta, Y., Piston, D. W. and Hogan, B. L. (1997). Bone morphogeneticproteins (BMPs) as regulators of dorsal forebrain development.Development 124, 2203-2212.

Gage, F. H., Kempermann, G., Palmer, T. D., Peterson, D. A. and Ray, J(1998). Multipotent progenitor cells in the adult dentate gyrus. J. Neurobiol.36, 249-266.

Galceran, J., Fariñas, I., Depew, M. J., Clevers, H. and Grosschedl, R.(1999). Wnt3a−/– like phenotype and limb deficiency in Lef1(−/−)Tcf1(−/−)mice. Genes Dev. 13, 709-717.

Graham, A., Francis-West, P., Brickell, P. and Lumsden, A. (1994). The

J. Galceran and others

481Forebrain development and lef1

signalling molecule Bmp4 mediates apoptosis in the rhombencephalicneural crest. Nature. 372, 684-686.

Grove, E. A., Tole, S., Limon, J., Yip, L. and Ragsdale, C.W. (1998). Thehem of the embryonic cerebral cortex is defined by the expression ofmultiple Wnt genes and is compromised in Gli3-deficient mice.Development 125, 2315-2325.

He, T. C., Sparks, A. B., Rago, C., Hermeking, H., Zawel, L., da Costa, L.T., Morin, P. J., Vogelstein B. and Kinzler, K. W. (1998). Identificationof c-MYC as a target of the APC pathway. Science 281, 1509-1512.

Hinck, L., Nathke, I. S., Papkoff, J. and Nelson, W. J. (1994). Beta-catenin:a common target for the regulation of cell adhesion by Wnt-1 and Srcsignaling pathways. Trends Biochem. Sci. 19, 538-542.

Hollyday, M., McMahon, J. A. and McMahon, A. P. (1995). Wnt expressionpatterns in chick embryo nervous system. Mech. Dev. 52, 9-25.

Hoppler, S. and Bienz, M. (1995). Two different thresholds of winglesssignalling with distinct developmental consequences in the Drosophilamidgut. EMBO J. 14, 5016-5026.

Hsu, S.-C., Galceran, J. and Grosschedl, R. (1998). Modulation oftranscriptional regulation by LEF-1 in response to Wnt-1 signaling andassociation with β-catenin. Mol. Cell. Biol. 18, 4807-4818.

Huber, O., Korn, R., McLaughlin, J., Ohsugi, M.,. Herrmann, B. G. andKemler R. (1996). Nuclear localization of β-catenin by interaction withtranscription factor LEF-1. Mech. Dev. 59, 3-10.

Ikeya, M., Lee, S. M., Johnson, J. E., McMahon, A. P. and Takada, S.(1997). Wnt signalling required for expansion of neural crest and CNSprogenitors. Nature 389, 966-970.

Korinek, V., Barker, N., Willert, K., Molenaar, M., Roose, J., Wagenaar,G., Markman, M., Lamers, W., Destree, O. and Clevers, H. (1998a). Twomembers of the Tcf family implicated in the Wnt/b-catenin signaling duringembryogenesis in the mouse. Mol. Cell. Biol. 18, 1248-1256.

Korinek, V., Barker, N., Moerer, P., van Donselaar, E., Huls, G., Peters, G.P. J. and Clevers, H. (1998b). Depletion of epithelial stem-cellcompartments in the small intestine of mice lacking Tcf-4. Nat. Genet. 19,379-383.

Kratochwil, K., Dull, M., Fariñas, I., Galceran, J. and Grosschedl, R.(1996). Lef1 expression is activated by BMP-4 and regulates inductive tissueinteractions in tooth and hair development. Genes Dev. 10, 1382-1394.

Lee, K. J., Mendelsohn, M. and Jessell T. M. (1998). Neuronal patterningby BMPs: a requirement for GDF7 in the generation of a discrete class ofcommissural interneurons in the mouse spinal cord. Genes Dev. 12, 3394-3407.

Liem, K. F., Jr., Tremml, G., Roelink, H. and Jessell, T. M. (1995). Dorsaldifferentiation of neural plate cells induced by BMP-mediated signals fromepidermal ectoderm. Cell 82, 969-979.

Liem, K. F., Tremml, G. and Jessell, T.M. (1997). A role for the roof plateand its resident TGFβ-related proteins in neuronal patterning in the dorsalspinal cord. Cell 91, 127-138.

Matsuo, I., Kuratani, S., Kimura, C., Takeda, N. and Aizawa, S. (1995).Mouse Otx2 functions in the formation and patterning of rostral head. GenesDev. 9, 2646-2658.

McKendry, R., Hsu, S.-C., Harland, R. M. and Grosschedl, R. (1997). LEF-1/TCF proteins mediate wnt-inducible transcription from the Xenopusnodal-related 3 promoter. Dev. Biol. 192, 420-431.

McMahon, A.P. and Bradley, A. (1990). The Wnt-1 (int-1) proto-oncogeneis required for development of a large region of the mouse brain. Cell 62,1073-85.

Miyata, T., Maeda, T. and Lee, J. E. (1999). NeuroD is required fordifferentiation of the granule cells in the cerebellum and hippocampus.Genes Dev. 13, 1647-1652.

Molenaar, M., van de Wetering, M., Oosterwegel, M., Peterson-Maduro,J., Godsave, S., Korinek, V., Roose, J., Destree, O. and Clevers H. (1996).Xtcf-3 transcription factor mediates β-catenin-induced axis formation inXenopus embryos. Cell 86, 391-399.

Oliver, G, Sosa-Pineda, B., Geisendorf, S., Spana, E.P., Doe, C.Q. andGruss, P. (1993). Prox1, a prospero-related homeobox gene expressedduring mouse development. Mech. Dev. 44, 3-16.

Oosterwegel, M., van de Wetering, M., Timmerman, J., Kruisbeek, A.,Destree, O., Meijlink, F. and Clevers, H. (1993). Differential expressionof the HMG box factors TCF-1 and LEF-1 during murine embryogenesis.Development 118, 439-448.

Parr, B. A., Shea, M. J., Vassileva, G. and McMahon, A. P. (1993). MouseWnt genes exhibit discrete domains of expression in the early embryonicCNS and limb buds. Development 119, 247-261.

Pellegrini, M., Marsouri, A., Simeone, A., Boncinelli, E. and Gruss, P.

(1996). Dentate gyrus formation requires Emx2. Development 122, 3893-3898.

Porter, F. D., Drago, J., Xu, Y., Cheema, S. S., Wassif, C., Huang, S. P.,Lee, E., Grinberg, A., Massalas, J. S., Bodine, D., Alt, F. and Westphal,H. (1997). Lhx2, a LIM homeobox gene, is required for eye, forebrain, anddefinitive erythrocyte development. Development 124, 2935-2944.

Prieve, M. G., Guttridge, K. L., Munguia, J. and Waterman, M. L. (1998).Differential importin-alpha recognition and nuclear transport by nuclearlocalization signals within the high-mobility-group DNA binding domainsof lymphoid enhancer factor 1 and T-cell factor 1. Mol. Cell. Biol. 18, 4819-4832.

Rickmann, M., Amaral, D. G. and Cowan, W. M. (1987). Organization ofradial glial cells during the development of the rat dentate gyrus. J. Comp.Neurol. 264, 449-479.

Riese, J., Yu, X., Munnerlyn, A., Eresh, S., Hsu, S.-C., Grosschedl, R. andBienz, M. (1997). LEF-1, a nuclear factor coordinating signaling inputsfrom wingless and decapentaplegic. Cell 88, 777–787.

Rubenstein, J. L. R., Anderson, S., Shi, L., Miyashita-Lin, E., Bulfone, A.and Hevner, R. (1999). Genetic Control of Cortical Regionalization andConnectivity. Cereb. Cortex, in press.

Sheng, H. Z., Bertuzzi, S., Chiang, C., Shawlot, W., Taira, M., Dawid, Iand Westphal, H. (1997). Expression of murine Lhx5 suggests a role inspecifying the forebrain. Dev. Dyn. 208, 266-277.

Shtutman, M., Zhurinsky, J., Simcha, I., Albanese, C., D’Amico, M.,Pestell, R. and Ben-Ze’ev, A. (1999). The cyclin D1 gene is a target of thebeta-catenin/LEF-1 pathway. Proc. Natl. Acad. Sci. U S A 96, 5522-5527

Shulman, J. M., Perrimon, N. and Axelrod, J. D. (1998). Frizzled signalingand the developmental control of cell polarity. Trends Genet. 14, 452-8

Sievers, J., Hartmann, D., Pehlemann, F.W. and Berry, M. (1992).Development of astroglial cells in the proliferative matrices, the granule celllayer and the hippocampal fissure of the hamster dentate gyrus. J. Comp.Neurol. 320, 1-32.

Simeone, A., Acampora, D., Gulisano, M., Stornaiuolo, A and Boncinelli,E. (1992). Nested expression domains of four homeobox genes indeveloping rostral brain. Nature. 358, 687-690.

Stanfield, B. B. and Cowan, W. M. (1988). The development of thehippocampal region. In Cerebral Cortex, volume 7. (ed. A. Peters and E. G.Jones) Plenum Press. New York.

Struhl, G and Basler, K (1993). Organizing activity of wingless protein inDrosophila. Cell 72, 527-540.

Super, H., Martinez, A., Del Rio, J. A. and Soriano, E. (1998). Involvementof distinct pioneer neurons in the formation of layer-specific connections inthe hippocampus. J. Neurosci. 18, 4616-4626.

Tetsu, O. and McCormick, F. (1999). Beta-catenin regulates expression ofcyclin D1 in colon carcinoma cells. Nature 398, 422-6

Thomas, K. R. and Capecchi, M. R. (1990). Targeted disruption of themurine int-1 proto-oncogene resulting in severe abnormalities in midbrainand cerebellar development. Nature 346, 847-50

Tole, S., Christian, C. and Grove, E.A. (1997). Early specification andautonomous development of cortical fields in the mouse hippocampus.Development 124, 4959-4970.

Tole, S. and Grove, E. (1999). Patterning events and specification signals inthe developing hippocampus. Cereb. Cortex, in press.

Torii, M., Matsuzaki, F., Osumi, N., Kaibuchi, K., Nakamura, S.,Casarosa, S., Guillemot, F and Nakafuku, M. (1999). Transcriptionfactors Mash-1 and Prox-1 delineate early steps in differentiation of neuralstem cells in the developing central nervous system. Development 126, 443-456.

Travis, A., Amsterdam, A., Belanger, C. and Grosschedl, R. (1991). LEF-l, a gene encoding a lymphoid-specific protein with an HMG domain,regulates T cell receptor α enhancer function. Genes Dev. 5, 880-894.

van de Wetering, M., Oosterwegel, M,, Dooijes, D. and Clevers, H. (1991).Identification and cloning of TCF-1, a T lymphocyte-specific transcriptionfactor containing a sequence-specific HMG box. EMBO J. 10, 123-132.

van de Wetering, M., Cavallo R., Dooijes D., van Beest M., van Es J.,Loureiro J., Ypma A., Hursh D., Jones T., Bejsovec A., Peifer M.,Mortin M. and Clevers H. (1997). Armadillo co-activates transcriptiondriven by the product of the Drosophila segment polarity gene dTCF. Cell88, 789-799.

van Genderen, C., Okamura, R., Fariñas, I., Quo, R., Parslow, T., Bruhn,L. and Grosschedl, R. (1994). Development of several organs that requireinductive epithelial mesenchymal interactions is impaired in LEF-1 deficientmice. Genes Dev. 8, 2691-2703.

van Leeuwen, F., Samos, C. H. and Nusse, R. (1994). Biological activity of

482

soluble wingless protein in cultured Drosophila imaginal disc cells. Nature368, 342-344

Verbeek, S., Izon, D., Hofhuis, F., Robanus-Maandag, E., te Riele, H., vande Wetering, M., Oosterwegel, M., Wilson, A., MacDonald, H. R. andClevers H. (1995). An HMG-box-containing T-cell factor required forthymocyte differentiation. Nature 374, 70-74.

Vleminckx, K., Kemler, R. and Hecht, A. (1999). The C-terminaltransactivation domain of beta-catenin is necessary and sufficient forsignaling by the LEF-1/beta-catenin complex in Xenopus laevis. Mech. Dev.81, 65-74.

Wodarz, A. and Nusse R. (1998). Mechanisms of Wnt signaling indevelopment. Annu. Rev. Cell. Dev. Biol. 14, 59-88.

Xuan, S., Baptista, C. A., Balas, G., Tao, W., Soares, V. C. and Lai, E.

(1995). Winged helix transcription factor BF-1 is essential for thedevelopment of the cerebral hemispheres. Neuron 14, 1141-1152.

Yoshida, M., Suda, Y., Matsuo, I., Miyamoto, N., Takeda, N., Kuratani, S.and Aizawa, S. (1997). Emx1 and Emx2 functions in development of dorsaltelencephalon. Development 124, 101-111.

Zhao, Y., Sheng, H. Z., Amini, R., Grinberg, A., Lee, E., Huang, S. P.,Taira, M. and Westphal, H. (1999). Control of hippocampalmorphogenesis and neuronal differentiation by the LIM homeobox geneLhx5. Science 284, 1155-1158.

Zorn, A. M., Barish, G. D., Williams, B. O., Lavender, P., Klymkowsky,M. W. and Varmus, H. E. (1999) Regulation of Wnt signaling by Soxproteins: XSox17α/β and XSox3 physically interact with β-catenin. Mol.Cell 4, 487-498.

J. Galceran and others