flu+singapore+&+flu+babi. bag.11

Click here to load reader

Post on 10-Jul-2015

94 views

Category:

Education

0 download

Embed Size (px)

TRANSCRIPT

  • FLU SINGAPOREHAND-FOOT-MOUTH DISEASE

    NUGROHO TRISTAYANTO.S.Si, MM

  • DESKRIPSIFlu Singapore sebenarnya merupakan penyakit yang dikenal sebagai Hand, Foot, and Mouth Disease (HFMD) atau dalam bahasa Indonesia disebut Penyakit Tangan, Kaki, dan Mulut (PTKM). Penyakit ini sudah ada di tahun 1957 di Toronto, Kanada. Sejak itu terdapat banyak kejadian di seluruh dunia. Dinamakan Flu Singapore karena saat itu terjadi ledakan kasus dan kematian akibat penyakit ini di Singapura

  • Hand-Foot-Mouth disease (HFMD) adalah penyakit anak-anak yang umum terjadi. Gejalanya berupa luka pada mulut, demam, dan rash. HFMD adalah penyakit infeksi yang disebabkan oleh virus RNA yang masuk dalam famili Picornaviridae, Genus Enterovirus.Biasanya disebabkan oleh coxsackievirus A16. Sedangkan yang sering memerlukan perawatan karena keadaannya lebih berat atau ada komplikasi sampai meninggal adalah Enterovirus 71.

  • HFMD yang disebabkan oleh infeksi coxsackievirus A16 merupakan penyakit yang ringan. Umumnya pasien dapat sembuh setelah 7-10 hari tanpa penanganan medis. HFMD yang disebabkan oleh enterovirus 71 menunjukkan insiden penyakit neurologis (sistem saraf) yang lebih tinggi. Kasus encephalitis yang fatal dapat terjadi pada penyakit yang disebabkan oleh infeksi enterovirus 71.

  • EPIDEMIOLOGITerjadi pada kelompok masyarakat yang padatAnak-anak di bawah 10 tahunOrang dewasa umumnya lebih kebal terhadap enterovirus.April 2009 di China dilaporkan 115.000 kasus dan 50 meninggalDi Indonesia kasus HFMD dilaporkan terjadi di daerah Jakarta dan sekitarnya

  • Metrotvnews.comKorban virus flu Singapore di Depok, Jawa Barat, bertambah tiga menjadi 11 orang, Kamis (16/4). Semua korban adalah anak-anak.

  • Cara Penularanmelalui jalur fekal-oral (pencernaan) dan saluran pernapasan, yaitu dari droplet (butiran ludah), pilek, air liur, tinja, cairan vesikel (kelainan kulit berupa gelembung kecil berisi cairan) atau ekskreta.Penularan kontak tidak langsung melalui barang, handuk, baju, peralatan makanan, dan mainan yang terkontaminasi oleh sekresi itu.Tidak ada vektor tetapi ada pembawa (carrier) seperti lalat dan kecoa.

  • Masa Inkubasi 2 - 5 hari. Penularan dari orang ke orang terjadi setelah pasien penyakit ini beranjak sembuh. HFMD tidak ditransmisikan dari binatang ke manusia.

  • MANIFESTASI KLINIKMula-mula demam tidak tinggi 2-3 hariDiikuti faringitis, anoreksia, dan gejala seperti flu, pada umumnya yang tak mematikan. Timbul vesikel yang kemudian pecah, ada 3-10 ulkus di mulut seperti sariawan (lidah, gusi, pipi sebelah dalam) terasa nyeri sehingga sukar untuk menelan. Bersamaan dengan itu timbul rash/ruam atau vesikel (lepuh kemerahan), papulovesikel yang tidak gatal ditelapak tangan dan kaki. Kadang-kadang rash/ruam (makulopapel) pada bokong.umumnya akan membaik sendiri dalam 7-10 hari

  • Gejala yang cukup beratHiperpireksia, yaitu demam tinggi dengan suhu lebih dari 39oC. Demam tidak turun-turunTakikardia (denyut nadi menjadi cepat) Takipnea, yaitu napas jadi cepat dan sesak Anoreksia, muntah, atau diare berulang disertai dehidrasi. Letargi, lemas, dan terus mengantuk Nyeri pada leher, lengan, dan kaki. Kejang-kejang, atau terjadi kelumpuhan pada saraf cranialKeringat dingin Fotofobia (tidak tahan melihat sinar) Ketegangan pada daerah perut Halusinasi atau gangguan kesadaran

  • KomplikasiJarang terjadi, tetapi bila terdapat komplikasi harus segera ditangani. Komplikasi penyakit ini adalah : Viral atau aseptik meningitis (radang selaput otak)Viral meningitis dapat menyebabkan demam, sakit kepala, leher dan punggung. Kondisi ini biasanya ringan dan dapat sembuh tanpa penanganan.Ensefalitis (radang otak) Dapat berakibat fatal.Myocarditis (Coxsackie Virus Carditis) atau pericarditisAcute Flaccid Paralysis / Lumpuh Layuh Akut (Polio-like illness)Hilangnya kuku jari tangan dan kakiHanya bersifat sementara dan dan dapat sembuh tanpa pengobatan.

  • DIAGNOSISSampel (Spesimen) dapat diambil dari tinja, usap rektal, cairan serebrospinal dan usap/swab ulcus di mulut/tenggorokan, vesikel di kulit spesimen atau biopsi otak.Isolasi virus dengan cara biakan sel dengan suckling mouse inoculation.Setelah dilakukan Tissue Culture, kemudian dapat diidentifikasi strainnya dengan antisera tertentu.

  • Pemeriksaan Laboratorium1. Deteksi Virus : - Immuno histochemistry (in situ)- Imunofluoresensi antibodi (indirect) - Isolasi dan identifikasi virus. 2. Deteksi RNART-PCR Primer : 5CTACTTTGGGTGTCCGTGTT 3 5 GGGAACTTCGATTACCATCC 3 Partial DNA sekuensing (PCR Product)

  • 3. SerodiagnosisSerokonversi paired sera dengan uji serum netralisasi terhadap virus EV-71 (BrCr, Nagoya) pada sel Vero. Uji ELISA sedang dikembangkan.

    Sebenarnya secara klinis sudah cukup untuk mendiagnosis HFMD, Pemeriksaan lab dilakukan untuk mengetahui apakah penyebabnya Coxsackie A-16 atau Enterovirus 71.

  • PENGOBATANHFMD merupakan self limiting diseasePengobatan spesifik tidak ada, jadi hanya diberikan secara simptomatik saja berdasarkan keadaan klinis yang ada.Istirahat yang cukup, karena penurunan sistem imunDapat diberikan: Immunoglobulin IV (IGIV), pada pasien imunokompromis atau neonatus Extracorporeal membrane oxygenation. Pengobatan simptomatik: Antiseptik di daerah mulut Analgesik misal parasetamol Cairan cukup untuk dehidrasi yang disebabkan sulit minum dan karena demam Pengobatan suportif lainnya ( gizi dll )

  • Pencegahan Dan Pengendalian PenyakitPencegahan penyakit adalah dengan menghilangkan kekumuhan dan kepadatan lingkungan; kebersihan (Higiene dan Sanitasi) lingkungan maupun perorangan.Memberikan penyuluhan tentang cara-cara penularan dan pencegahan HFMD untuk memotong rantai penularan. Menyiapkan sarana kesehatan tentang tatalaksana HFMD termasuk pelaksanaan.Memberikan penyuluhan tentang tanda-tanda dan gejala HFMD.

  • NUGROHO TRISTYANTO.S.Si , M.M

    FLU BABI (SWINE FLU)

  • Pendahuluan Flu babi = flu meksiko, hog flu, pig flu, swine fluDisebabkan oleh virus influenza A subtipe H1N1 (Orthomyxoviridae)Akan tetapi ditemukan juga virus H1N2, H3N2, H1N7 pada hasil isolasi mukus babi yang menderita

  • EPIDEMIOLOGI

    Hingga 26/4, kasus flu babi dikonfirmasi terjadi di Amerika Serikat (91 kasus dengan satu kematian), Meksiko (26 kasus dengan tujuh kematian), Kanada (13 kasus), Selandia Baru (tiga kasus), Inggris (lima kasus), Israel (dua kasus), Spanyol (empat kasus), Austria (satu kasus), dan Jerman (tiga kasus). Pada Rabu (29/4), kantor berita Xinhua melaporkan jumlah kematian 25 orang di Meksiko yang diduga berhubungan dengan flu babi, sementara 89 orang dirawat di rumah sakit dengan gejala serupa flu babi.

    Hingga tanggal 30 April 2009 di Amerika terdapat 109 kasus positif flu babi,1 orang di antaranya meninggal dan masih ada kemungkinan terus bertambah

    WHO telah memperingatkan kasus-kasus di Meksiko dan Amerika Serikat berpotensi menyebabkan pandemi global dan menegaskan situasi ini serius

    2007 endemik di babi Filipina

  • Kasus yang disertai kematianKasus tanpa kematianDicurigai

  • ETIOLOGIFlu babi penyakit saluran pernafasan akut pada babi yang disebabkan oleh virus influensa tipe A subtipe H1N1 (Orthomyxoviridae)

    virus tersebut mempunyai RNA dengan sumbu protein dan permukaan virionnya diselubungi oleh semacam paku yang mengandung antigen haemagglutinin (H) dan enzim neuraminidase (N).

    Peranan haemaglutinin adalah sebagai alat melekat virion pada sel dan menyebabkan terjadinya aglutinasi sel darah merah, sedangkan enzim neurominidase bertanggung jawab terhadap elusi, terlepasnya virus dari sel darah merah dan juga mempunyai peranan dalam melepaskan virus dari sel yang terinfeksi.

    Antibodi terhadap haemaglutinin berperan dalam mencegah infeksi ulang oleh virus yang mengandung haemaglutinin yang sama. Antibodi juga terbentuk terhadap antigen neurominidase, tetapi tidak berperan dalam pencegahan infeksi.

  • Cara PenularanDapat ditularkan melalui binatang, terutama babi. Dapat juga penularan antar manusia.Seperti flu biasa : Melalui udara dan dapat juga melalui kontak langsung dengan penderita Virus flu babi umumnya menyebar lewat ludah yang terempas ke udara bebas gara-gara batuk atau bersin.Tidak menular jika kita memakan daging babi yang telah dimasak dan dibersihkan dengan baik

  • DiagnosaGejala klinis dan perubahan patologi

    Diagnosis laboratorium :1. Isolasi virus pada alantois telur ayam berembrio dan dilihat hemaglutinasi pada cairan alantois

    2. Serologi dengan memperlihatkan peningkatan antibodi pada serum ganda (paired sera) yang diambil dengan selang waktu 3-4 minggu (KRONIS)digunakan uji haemagglutination inhibition (HI), Immunodifusi single radial dan netralisasi virusKenaikan titer 4x lipatnya sudah dianggap adanya infeksidapat juga menggunakan uji fluorescent antibody technique (FAT)

  • Pengobatanoseltamivir atau zanamivir. Obat tersebut akan efektif paling lama 48 jam setelah muncul gejalaDosis pemberian oseltamivir :Untuk dewasa dan anak 13 tahun : 2 kali 75 mg per hari, selama 5 hari.Untuk anak 1 tahun : 2 mg/kg BB, 2 kali sehari selama 5 hariDosis oseltamivir dapat diberikan sesuai dengan berat badan sebagai berikut :> 40 kg : 75 mg, 2 kali sehari> 15 -23 kg : 45 mg, 2 kali sehari > 23 - 40 kg : 60 mg, 2 kali sehari 15 kg : 30 mg, 2 kali sehari

    Resisten terhadap amantadin dan rimantadin

    Perawatan simptomatik

  • Pencegahanvaksin untuk flu babi belum adaPerilaku bersih :Cuci tangan dengan bersih menggunakan sabunTidur cukup Aktif berolahraga fisik Mengendalikan pikiran agar tidak stress Minum banyak air Makan makanan yang bernutrisiMenjaga jarak dengan penderitaDaging harus dimasak matang, suhu 700C akan membunuh virus itu.